Family Search for PF01904 (DUF72)

April 2024: See Interactive Tools for Functional Annotation of Bacterial Genomes for advice on using these tools.

PF01904 hits 16 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.

PP_3266 conserved hypothetical protein from Pseudomonas putida KT2440
Aligns to 66:331 / 350 (76.0%), covers 99.5% of PF01904, 243.7 bits

• Global Transcriptional Responses to Osmotic, Oxidative, and Imipenem Stress Conditions in Pseudomonas putida
  Bojanovič, Applied and environmental microbiology 2017
  • “...asnB algA Cardiolipin production PP_3263 PP_3264 PP_3265 PP_3266 Biofilm PP_1281 PP_1282 PP_1283 PP_1284 PP_1285 PP_1286 PP_1287 PP_1288 Flagella PP_4358...”

PA2157 hypothetical protein from Pseudomonas aeruginosa PAO1
Aligns to 24:289 / 312 (85.3%), covers 99.5% of PF01904, 238.1 bits

• Evolved resistance to colistin and its loss due to genetic reversion in Pseudomonas aeruginosa
  Lee, Scientific reports 2016
  • “...a ferrichrome receptor and an outer membrane receptor, respectively, which are involved in iron transport. PA2157 and PA5088 were thought to encode hypothetical proteins. For P155R-rev, the five genetic mutations found in P155R were absent. Unlike the P5 isogenic mutants, the mutations found in P155R were...”
  • “...in PA4406 [ lpxC ]) among 13 genes in P5R, and two mutations (Ala76Asp in PA2157 and Leu167Pro in PA4777 [ pmrB ]) among five genes in P155R were predicted to be deleterious ( Tables 1 and 2 ). The Val260Gly substitution in PhoQ of P5R...”
• Analysis of the Pseudomonas aeruginosa regulon controlled by the sensor kinase KinB and sigma factor RpoN
  Damron, Journal of bacteriology 2012
  • “...PA2149 PA2150 PA2151 PA2152 PA2153 PA2154 PA2155 PA2156 PA2157 PA2158 PA2159 PA2160 PA2161 PA2162 PA2163 PA2164 PA2165 PA2167 PA2168 PA2169 algW algC algB lptF...”
• A eukaryotic-type signalling system of Pseudomonas aeruginosa contributes to oxidative stress resistance, intracellular survival and virulence
  Goldová, BMC genomics 2011
  • “...3.46 0.041 CHP 7.0 3.6 5.2 3.4 PA2156 2.40 0.001 CHP 3.6 2.4 2.4 2.4 PA2157 4.03 0.002 HP 6.2 3.4 4.2 3.8 PA2158 4.51 0.019 Pr. alcohol dehydrogenase (Zn-dependent) (Putative enzymes) 7.9 4.1 5.7 4.0 PA2159 a 2.89 0.062 CHP 5.9 3.2 4.4 3.7 PA2161...”
• A cystic fibrosis epidemic strain of Pseudomonas aeruginosa displays enhanced virulence and antimicrobial resistance
  Salunkhe, Journal of bacteriology 2005
  • “...California, Berkeley PA2067 PA2068 PA2069 PA2080 PA2143 PA2146 PA2157 PA2159 PA2165 PA2166 PA2171 PA2172 PA2180 PA2190 PA2193 PA2194 PA2195 PA2274 PA2300 PA2305...”
• Identification, timing, and signal specificity of Pseudomonas aeruginosa quorum-controlled genes: a transcriptome analysis
  Schuster, Journal of bacteriology 2003
  • “...PA2144 PA2146 PA2147 PA2148 PA2151 PA2152 PA2153 PA2156 PA2157 PA2158 PA2159 PA2160 PA2161 PA2163 PA2164 PA2165 PA2166 PA2167 PA2169 PA2170 PA2171 PA2172...”

MSMEG_3593 hypothetical protein from Mycobacterium smegmatis str. MC2 155
Aligns to 19:238 / 242 (90.9%), covers 100.0% of PF01904, 224.5 bits

• Characterization of Mycobacterium smegmatis sigF mutant and its regulon: overexpression of SigF antagonist (MSMEG_1803) in M. smegmatis mimics sigF mutant phenotype, loss of pigmentation, and sensitivity to oxidative stress
  Singh, MicrobiologyOpen 2015
  • “...M42 family 0.57/3.38 GCTTN 15 GGGCC 164 MSMEG_3322 Hypothetical protein 0.46/2.14 MSMEG_3358 YaeQ protein 0.61/2.01 MSMEG_3593 Protein of unknown function 0.70/4.74 GTTTN 14 GGGCA 987 MSMEG_4082 Monoxygenase 0.38/2.17 GTTGN 14 GGGCC 1024 MSMEG_4355 Peptide ABC transporter, permease protein 1.20/3.44 GGTTN 15 GGGCC 13 MSMEG_4356 Inner membrane...”

LMRG_01842 hypothetical protein from Listeria monocytogenes 10403S
lmo2406 similar to B. subtilis YunF protein from Listeria monocytogenes EGD-e
Aligns to 14:262 / 280 (88.9%), covers 96.8% of PF01904, 219.2 bits

• Listeria monocytogenes σ^A Is Sufficient to Survive Gallbladder Bile Exposure
  Boonmee, Frontiers in microbiology 2019
  • “...0.00 LMRG_01585 lmo2247 LMRG_01585-LMRG_01587 Xidoreductase of aldo/keto reductase family, subgroup 2, glyoxal reductase 2.09 0.01 LMRG_01842 lmo2406 Hypothetical protein 2.38 0.00 LMRG_02144 lmo2600 LMRG_02142-LMRG_02144 ATPase component of general energizing module of ECF transporters 2.40 0.00 LMRG_02241 lmo2694 Arginine decarboxylase/Lysine decarboxylase 2.14 0.00 LMRG_02276 lmo0853 LMRG_02275-LMRG_02277 QacE...”
• Listeria monocytogenes σ^A Is Sufficient to Survive Gallbladder Bile Exposure
  Boonmee, Frontiers in microbiology 2019
  • “...LMRG_01585 lmo2247 LMRG_01585-LMRG_01587 Xidoreductase of aldo/keto reductase family, subgroup 2, glyoxal reductase 2.09 0.01 LMRG_01842 lmo2406 Hypothetical protein 2.38 0.00 LMRG_02144 lmo2600 LMRG_02142-LMRG_02144 ATPase component of general energizing module of ECF transporters 2.40 0.00 LMRG_02241 lmo2694 Arginine decarboxylase/Lysine decarboxylase 2.14 0.00 LMRG_02276 lmo0853 LMRG_02275-LMRG_02277 QacE family...”

TM1631 conserved hypothetical protein from Thermotoga maritima MSB8
Aligns to 19:256 / 261 (91.2%), covers 100.0% of PF01904, 218.9 bits

• Role of magnesium ions in the reaction mechanism at the interface between Tm1631 protein and its DNA ligand
  Ogrizek, Chemistry Central journal 2016
  • “...10.1186/s13065-016-0188-6 Research Article Role of magnesium ions in the reaction mechanism at the interface between Tm1631 protein and its DNA ligand Ogrizek Mitja ogrizek.mitja@gmail.com Konc Janez konc@cmm.ki.si Bren Urban urban.bren@um.si http://orcid.org/0000-0001-5300-5997 Hodoek Milan milan@cmm.ki.si Janei Duanka dusanka.janezic@upr.si National Institute of Chemistry, Hajdrihova 19, 1000 Ljubljana, Slovenia...”
  • “...) applies to the data made available in this article, unless otherwise stated. A protein, Tm1631 from the hyperthermophilic organism Thermotoga maritima belongs to a domain of unknown function protein family. It was predicted that Tm1631 binds with the DNA and that the Tm1631DNA complex is...”
• Structure-based function prediction of uncharacterized protein using binding sites comparison
  Konc, PLoS computational biology 2013
  • “...function. In this paper, we propose the function of a protein of unknown activity, the Tm1631 protein from Thermotoga maritima, by comparing its predicted binding site to a library containing thousands of candidate structures. The comparison revealed numerous similarities with nucleotide binding sites including specifically, a...”
  • “...binding free energies, calculated from these models were in close agreement. We thus propose that Tm1631 is a DNA binding enzyme with endonuclease activity that recognizes DNA lesions in which at least two consecutive nucleotides are unpaired. Our approach is general, and can be applied to...”

SAV0921 hypothetical protein from Staphylococcus aureus subsp. aureus Mu50
Aligns to 16:266 / 282 (89.0%), covers 97.7% of PF01904, 210.4 bits

• Improved multiple-locus variable-number tandem-repeat assay for Staphylococcus aureus genotyping, providing a highly informative technique together with strong phylogenetic value
  Pourcel, Journal of clinical microbiology 2009
  • “...SIRU1 55 2 299 Sa2821 SAV2654e SAV2655 SAV0920e SAV0921 54 7 396 43 6 468 Sa964 Oligonucleotideg Annealing temp (C) L, AGCAGTAGTGCCGTTTGCTT R,...”

TTHA0758 hypothetical protein from Thermus thermophilus HB8
Aligns to 22:289 / 303 (88.4%), covers 99.5% of PF01904, 199.4 bits

• Identification and characterization of preferred DNA-binding sites for the Thermus thermophilus transcriptional regulator FadR
  Lee, PloS one 2017
  • “...103944 103958 6.68e-07 0.135 TTGGACCTGGTAAAA 8 Y TTHA0103 724515 724529 6.99e-07 0.135 CTGGACTTGGTCTAA +909 N TTHA0758 ( P -value) Defined as the probability of a random sequence of the same length matching that position of the sequence with as good or better score. ( Q -value)...”

bglu_1g13010 hypothetical protein from Burkholderia glumae BGR1
Aligns to 31:250 / 251 (87.6%), covers 96.3% of PF01904, 197.1 bits

• The novel kasugamycin 2'-N-acetyltransferase gene aac(2')-IIa, carried by the IncP island, confers kasugamycin resistance to rice-pathogenic bacteria
  Yoshii, Applied and environmental microbiology 2012
  • “...the sequence is a part of the hypothetical gene (bglu_1g13010), which was identified in a genome sequence of B. glumae BGR1 chromosome 1 (26). Although the...”
  • “...aac(2=)-IIa gene was inserted between the guaA and bglu_1g13010 genes. To identify the genetic element carrying aac(2=)-IIa, the region between guaA and traC...”

LSA1659 Hypothetical protein from Lactobacillus sakei subsp. sakei 23K
Aligns to 16:262 / 281 (87.9%), covers 96.8% of PF01904, 196.2 bits

• Global transcriptome response in Lactobacillus sakei during growth on ribose
  McLeod, BMC microbiology 2011
  • “...-1.0 -1.6 LSA1644 lsa1644 Hypothetical protein 1.7 D LSA1649 lsa1649 Hypothetical extracellular protein precursor -0.5 LSA1659 lsa1659 Hypothetical protein -0.5 LSA1662 lsa1662 Hypothetical protein -1.0 -0.6 -0.7 LSA1663 lsa1663 Hypothetical protein -0.8 LSA1678 lsa1678 Hypothetical protein -0.6 LSA1680 lsa1680 Hypothetical protein -0.6 LSA1716 lsa1716 Hypothetical protein...”

1vpyA / Q838R9 Crystal structure of a duf72 family protein (ef0366) from enterococcus faecalis v583 at 2.52 a resolution
Aligns to 9:247 / 251 (95.2%), covers 95.9% of PF01904, 185.3 bits

• Ligand: zinc ion (1vpyA)

VP1046 conserved hypothetical protein from Vibrio parahaemolyticus RIMD 2210633
Aligns to 24:264 / 289 (83.4%), covers 98.6% of PF01904, 184.4 bits

• QseC Inhibition as a Novel Antivirulence Strategy for the Prevention of Acute Hepatopancreatic Necrosis Disease (AHPND)-Causing Vibrio parahaemolyticus
  Yang, Frontiers in cellular and infection microbiology 2020
  • “...3.81E-10 hypothetical protein VP1044 1.889812 7.64E-08 hypothetical protein VP1045 1.791027 1.62E-11 Chromosome partition protein MukB VP1046 1.945746 3.68E-12 Chromosome partition protein MukE VP1047 2.002129 2.34E-13 Chromosome partition protein MukF VP1048 2.21627 1.06E-15 S-adenosylmethionine-dependent methyltransferase VP1049 1.637211 5.65E-10 Positive regulator of competence TfoX 4 VP0461 1.533797 5.29E-09...”

PSA3335_RS11510 DUF72 domain-containing protein from Pseudomonas savastanoi pv. savastanoi NCPPB 3335
Aligns to 23:261 / 287 (83.3%), covers 99.5% of PF01904, 182.3 bits

• HrpL Regulon of Bacterial Pathogen of Woody Host Pseudomonas savastanoi pv. savastanoi NCPPB 3335
  Moreno-Pérez, Microorganisms 2021
  • “...However, matches with other proteins were not found. Among the hypothetical proteins, those encoded by PSA3335_RS11510 and PSA3335_RS10865 showed a translocation signal, suggesting that they could be putative T3Es. Among these 26 genes, four showed identity with genes whose dependence on HrpL was previously reported in...”
  • “...PF01339 PF00072 Hypothetical proteins PSA3335_RS00675 Hypothetical protein 224 yes 2 2580 nd - Haloacid dehalogenase PSA3335_RS11510 Hypothetical protein 289 yes 2 2577 0.9994 PF01904 - PSA3335_RS23410# Hypothetical protein 48 yes 2 2567 nd PF07551 - PSA3335_RS24280# Hypothetical protein 36 no - 2542 nd - - PSA3335_RS13135...”
• Host Range Determinants of Pseudomonas savastanoi Pathovars of Woody Hosts Revealed by Comparative Genomics and Cross-Pathogenicity Tests
  Moreno-Pérez, Frontiers in plant science 2020
  • “...Pfam domain b Size (aa) hrp value c A B C Psv Psn Psf Psr PSA3335_RS11510 WP_032074452 DUF72 domain-containing protein PF01904 289 2577 + + + + + + + B7R56_RS15315 WP_057446723 Hypothetical protein Not found 304 2558 + + + a PSA3335_RS11510 and B7R56_RS15315 correspond...”

WP_032074452 DUF72 domain-containing protein from Pseudomonas savastanoi
Aligns to 25:263 / 289 (82.7%), covers 99.5% of PF01904, 182.3 bits

• Host Range Determinants of Pseudomonas savastanoi Pathovars of Woody Hosts Revealed by Comparative Genomics and Cross-Pathogenicity Tests
  Moreno-Pérez, Frontiers in plant science 2020
  • “...secretion signals found in Hop proteins ( Lindeberg etal., 2005 ). The gene coding for WP_032074452 was found in all 20 P . savastanoi genomes, whereas that for WP_057446723 was exclusively found in Psr genomes. Table 5 Novel putative type III effectors identified in Pseudomonas savastanoi...”
  • “...domain b Size (aa) hrp value c A B C Psv Psn Psf Psr PSA3335_RS11510 WP_032074452 DUF72 domain-containing protein PF01904 289 2577 + + + + + + + B7R56_RS15315 WP_057446723 Hypothetical protein Not found 304 2558 + + + a PSA3335_RS11510 and B7R56_RS15315 correspond to...”

PA14_16730 hypothetical protein from Pseudomonas aeruginosa UCBPP-PA14
Aligns to 23:262 / 288 (83.3%), covers 99.5% of PF01904, 178.5 bits

• Novel type III effectors in Pseudomonas aeruginosa
  Burstein, mBio 2015
  • “...of the newly discovered effectors suggested that pemA is part of an operon together with PA14_16730, a hypothetical protein whose gene has a start codon 18bp downstream of pemA . This operon structure is conserved across various Pseudomonas species (including P.aeruginosa , P.syringae , and P....”

PP1509 conserved hypothetical protein from Pseudomonas putida KT2440
Aligns to 25:263 / 289 (82.7%), covers 99.5% of PF01904, 177.1 bits

• UEG Week 2023 Poster Presentations
  , United European gastroenterology journal 2023

YecE / b1868 DUF72 domain-containing protein YecE from Escherichia coli K-12 substr. MG1655 (see 3 papers)
yecE / RF|NP_416382 uncharacterized protein yecE from Escherichia coli K12 (see paper)
b1868 hypothetical protein from Escherichia coli str. K-12 substr. MG1655
Aligns to 16:251 / 272 (86.8%), covers 94.5% of PF01904, 170.1 bits

• 18th Congress of the European Hematology Association, Stockholm, Sweden, June 13–16, 2013
  , Haematologica 2013

Or search for genetic data about PF01904 in the Fitness Browser