Family Search for PF01937 (ARMT1-like_dom)
April 2024: See Interactive Tools for Functional Annotation of Bacterial Genomes for advice on using these tools.
PF01937 hits 42 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.
AFUA_5G06710 DUF89 domain protein from Aspergillus fumigatus Af293
Aligns to 22:450 / 480 (89.4%), covers 99.7% of PF01937, 327.8 bits
- Conservation of nucleosome positions in duplicated and orthologous gene pairs
Nishida, TheScientificWorldJournal 2012 - “...AFUA_5G08110 0.073589072 YGL120C AFUA_5G11620 0.069009268 YIL063C AFUA_2G10810 0.06328373 YOL157C AFUA_7G06380 0.06047767 YGL043W AFUA_3G07670 0.059398891 YMR027W AFUA_5G06710 0.058232831 YHR215W AFUA_8G01910 0.05787337 YDL247W AFUA_7G05190 0.05184022 YPR048W AFUA_5G07290 0.049809159 YBL051C AFUA_5G01940 0.048514144 YHR148W AFUA_2G08320 0.047441878 YJR160C AFUA_7G05190 0.045923723 YJL039C AFUA_5G12670 0.042943521 YNL029C AFUA_5G12160 0.031203315 YGR267C AFUA_5G03140 0.029526621 YNL027W AFUA_1G06900...”
A6H630 Damage-control phosphatase ARMT1 from Mus musculus
Aligns to 20:417 / 439 (90.7%), covers 100.0% of PF01937, 320.3 bits
ARMT1_HUMAN / Q9H993 Damage-control phosphatase ARMT1; Acidic residue methyltransferase 1; Protein-glutamate O-methyltransferase; Sugar phosphate phosphatase ARMT1; EC 3.1.3.-; EC 2.1.1.- from Homo sapiens (Human) (see 2 papers)
NP_078849 damage-control phosphatase ARMT1 isoform a from Homo sapiens
Aligns to 20:419 / 441 (90.7%), covers 100.0% of PF01937, 318.9 bits
- function: Metal-dependent phosphatase that shows phosphatase activity against several substrates, including fructose-1-phosphate and fructose-6-phosphate (By similarity). Its preference for fructose-1- phosphate, a strong glycating agent that causes DNA damage rather than a canonical yeast metabolite, suggests a damage-control function in hexose phosphate metabolism (By similarity). Has also been shown to have O-methyltransferase activity that methylates glutamate residues of target proteins to form gamma-glutamyl methyl ester residues (PubMed:25732820). Possibly methylates PCNA, suggesting it is involved in the DNA damage response (PubMed:25732820).
catalytic activity: beta-D-fructose 1-phosphate + H2O = D-fructose + phosphate (RHEA:35603)
catalytic activity: beta-D-fructose 6-phosphate = D-glyceraldehyde 3-phosphate + dihydroxyacetone (RHEA:28002)
catalytic activity: L-glutamyl-[protein] + S-adenosyl-L-methionine = [protein]-L- glutamate 5-O-methyl ester + S-adenosyl-L-homocysteine (RHEA:24452)
cofactor: Mn(2+) Ni(2+) - Human ARMT1 structure and substrate specificity indicates that it is a DUF89 family damage-control phosphatase.
Dennis, Journal of structural biology 2020 (PubMed)- GeneRIF: Human ARMT1 structure and substrate specificity indicates that it is a DUF89 family damage-control phosphatase.
- Human C6orf211 encodes Armt1, a protein carboxyl methyltransferase that targets PCNA and is linked to the DNA damage response.
Perry, Cell reports 2015 - GeneRIF: Armt1 protein specifically targets proliferating cell nuclear antigen (PCNA) in breast cancer cells, predominately methylating glutamate side chains.
- Armt1: a phoenix rises from the ashes.
Hoelz, Oncotarget 2015 - GeneRIF: Studies show that acidic residue methyltransferase 1 (Armt1) has a vital role in regulation of the DNA damage response likely through its ability to O-methylate glutamyl residues of the DNA repair factor proliferating cell nuclear antigen (PCNA).
- ESR1 is co-expressed with closely adjacent uncharacterised genes spanning a breast cancer susceptibility locus at 6q25.1.
Dunbier, PLoS genetics 2011 - GeneRIF: C6ORF211 correlates with proliferation and clinical outcome in tumors.
- Candidate gene/loci studies in cleft lip/palate and dental anomalies finds novel susceptibility genes for clefts.
Vieira, Genetics in medicine : official journal of the American College of Medical Genetics 2008 - GeneRIF: Observational study of gene-disease association. (HuGE Navigator)
- Profiling hymenopteran venom toxins: Protein families, structural landscape, biological activities, and pharmacological benefits
Guido-Patiño, Toxicon: X 2022 - “...( C ) Damage-control phosphatases from wasp Pimpla hypochondriaca (Q8MMH3, AF-Q8MMH3-F1, purple) and Homo sapiens (Q9H993, 6UMQ , orange) and ( D ) Overlapping segments of M12B metalloproteases from wasp Eulophus pennicornis (B5AJT4, AF-B5AJT4-F1, purple) and snake Protobothrops mucrosquamatus (O57413, 1KUF , orange). Disulfide bridges are...”
- “...This protein shares structural homology ( Fig. 3 C) with the human metal-dependent phosphatase ARMT1 (Q9H993), also involved in metabolite damage control ( Parkinson et al., 2003 ). Ntn-hydrolase ( U ) is an enzyme from the venom of the parasitic wasp Asobara tabida , consisting...”
- Dcf1 induces glioblastoma cells apoptosis by blocking autophagy
Luo, Cancer medicine 2022 - “...FC (DCF1/EGFP) Unique peptides AA MW (kDa) 1 V9GZ17 TUBA8 1.82 1 275 31.051 2 Q9H993 ARMT1 1.292 3 441 51.14 3 Q8NHH9 QTL2 1.299 3 583 66.187 4 Q969Y2 GTPBP3 1.31 1 432 52.026 5 O00401 WASL 1.3 2 505 54.793 6 P48163 ME1 1.455...”
- Acquisition of Letrozole Resistance Through Activation of the p38/MAPK Signaling Cascade
Walker, Anticancer research 2021 - “...P08185 Corticosteroid-binding globulin OS=Homo sapiens GN=SERPINA6 PE=1 SV=1 - [CBG_HUMAN] 405 45.1119093 0.39363177 p <0.001 Q9H993 UPF0364 protein C6orf211 OS=Homo sapiens GN=C6orf211 PE=1 SV=1 - [CF211_HUMAN] 441 51.1398629 0.37407832 p <0.001 P02795 Metallothionein-2 OS=Homo sapiens GN=MT2A PE=1 SV=1 - [MT2_HUMAN] 61 6.0371964 0.33853248 p <0.001...”
- ITRAQ-based proteomic analysis reveals possible target-related proteins in human adrenocortical adenomas.
Ma, BMC genomics 2019 - “...P value Q9Y639 NPTN Neuroplastin 0.789565 0.0499304 I7GW38 ND3 NADH-ubiquinone oxidoreductase chain 3 0.789522 0.0498772 Q9H993 ARMT1 Protein-glutamate O-methyltransferase 0.789151 0.0494224 Q8TDY4 ASAP3 Arf-GAP with SH3 domain, ANK repeat and PH domain-containing protein 3 0.788918 0.049138 Q9NRG7 SDR39U1 Epimerase family protein SDR39U1 0.788899 0.0491147 Q16851 UGP2...”
- β-Catenin Knockdown Affects Mitochondrial Biogenesis and Lipid Metabolism in Breast Cancer Cells
Vergara, Frontiers in physiology 2017 - “...molecule homolog Q9BXP5 12 16.2 DCTPP1 dCTP pyrophosphatase 1 Q9H773 4 25.9 ARMT1 Protein-glutamate O-methyltransferase Q9H993 13 45.8 LUC7L Putative RNA-binding protein Luc7-like 1 Q9NQ29 8 27.7 CTPS2 CTP synthase 2 Q9NRF8 6 11.4 IMP3 U3 small nucleolar ribonucleoprotein protein IMP3 Q9NV31 3 23.4 SLTM SAFB-like...”
- Systematic Analysis of Cell-Type Differences in the Epithelial Secretome Reveals Insights into the Pathogenesis of Respiratory Syncytial Virus-Induced Lower Respiratory Tract Infections.
Zhao, Journal of immunology (Baltimore, Md. : 1950) 2017 - “...Q13642 FHL1 4 O95571 ETHE1 4 Q7L576;Q96F07 CYFIP1;CYFIP2 5 Q9BZG9 LYNX1 5 Q641Q3 METRNL 3 Q9H993 C6orf211 4 P05091 ALDH2 4 O14818 PSMA7 5 Q86YZ3 HRNR 5 P0DJI9 SAA2 3 Q13509 TUBB3 3 Q15149 PLEC 4 Q5TZA2 CROCC 4 P41227 NAA10 5 O00748 CES2 5 Q5SYB0...”
- Establishment of neutralizing rat monoclonal antibodies for fibroblast growth factor-2.
Tanaka, Monoclonal antibodies in immunodiagnosis and immunotherapy 2014
SPCC1393.13 DUF89 family protein from Schizosaccharomyces pombe
Aligns to 25:420 / 442 (89.6%), covers 99.4% of PF01937, 309.3 bits
- Fission yeast Duf89 and Duf8901 are cobalt/nickel-dependent phosphatase-pyrophosphatases that act via a covalent aspartyl-phosphate intermediate
Sanchez, The Journal of biological chemistry 2022 - “...( 1 ). The fission yeast Schizosaccharomyces pombe genome encodes two subfamily III DUF89 paralogs: SPCC1393.13 (referred to henceforth as Duf89) and SPAC806.04c (henceforth Duf8901). Alignment of the 442-amino acid Duf89 and 438-amino acid Duf8901 proteins highlights 312 positions of side-chain identity/similarity. Our interest in Duf89...”
- “...by the finding by Henry etal. ( 5 ) that deletion of the fission yeast SPCC1393.13 gene results in elevated expression of the phosphate homeostasis gene pho1 . Whereas the significance of this finding was unclear at the time, it is now known that pho1 is...”
- Systematic screen of Schizosaccharomyces pombe deletion collection uncovers parallel evolution of the phosphate signal transduction pathway in yeasts
Henry, Eukaryotic cell 2011 - “...Backcrossed, constitutive, h mating type strains (ado1, csk1, spcc1393.13, ppn1, and aps1) then were crossed on ME solid medium to the uninducible h strains...”
- “...by University of California, Berkeley Constitutive spcc338.14 spcc1393.13 spac1d4.06c spbc713.07c spac13g6.14 Product 202 HENRY ET AL. EUKARYOT. CELL 300 pho1+...”
7t7nB / O94725 Structure of spcc1393.13 protein from fission yeast (see paper)
Aligns to 23:418 / 440 (90.0%), covers 99.4% of PF01937, 309.3 bits
- Ligand: phosphate ion (7t7nB)
ART1A_SCHPO / Q9UT55 Damage-control phosphatase SPAC806.04c; Sugar phosphate phosphatase SPAC806.04c; EC 3.1.3.- from Schizosaccharomyces pombe (strain 972 / ATCC 24843) (Fission yeast) (see paper)
Aligns to 23:416 / 438 (90.0%), covers 99.4% of PF01937, 302.1 bits
- function: Metal-dependent phosphatase that shows phosphatase activity against several substrates, including fructose-1-phosphate and fructose-6-phosphate (By similarity). Its preference for fructose-1- phosphate, a strong glycating agent that causes DNA damage rather than a canonical yeast metabolite, suggests a damage-control function in hexose phosphate metabolism (By similarity).
catalytic activity: beta-D-fructose 1-phosphate + H2O = D-fructose + phosphate (RHEA:35603)
catalytic activity: beta-D-fructose 6-phosphate = D-glyceraldehyde 3-phosphate + dihydroxyacetone (RHEA:28002)
cofactor: Mn(2+) Ni(2+)
7u1xA / Q9UT55 Structure of spac806.04c protein from fission yeast covalently bound to bef3 (see paper)
Aligns to 24:417 / 439 (89.7%), covers 99.4% of PF01937, 302.1 bits
5by0A / Q04371 Crystal structure of magnesium-bound duf89 protein saccharomyces cerevisiae
Aligns to 21:435 / 465 (89.2%), covers 99.7% of PF01937, 299.1 bits
- Ligand: magnesium ion (5by0A)
ARMT1_YEAST / Q04371 Damage-control phosphatase YMR027W; Sugar phosphate phosphatase YMR027W; EC 3.1.3.- from Saccharomyces cerevisiae (strain ATCC 204508 / S288c) (Baker's yeast) (see 4 papers)
NP_013740 putative methyltransferase from Saccharomyces cerevisiae S288C
YMR027W Putative protein of unknown function; green fluorescent protein (GFP)-fusion protein localizes to the nucleus and cytoplasm; YMR027W is not an essential gene from Saccharomyces cerevisiae
Aligns to 19:438 / 470 (89.4%), covers 99.7% of PF01937, 298.6 bits
- function: Metal-dependent phosphatase that shows phosphatase activity against several substrates, including fructose-1-phosphate and fructose-6-phosphate (PubMed:27322068). Its preference for fructose-1- phosphate, a strong glycating agent that causes DNA damage rather than a canonical yeast metabolite, suggests a damage-control function in hexose phosphate metabolism (PubMed:27322068).
catalytic activity: beta-D-fructose 1-phosphate + H2O = D-fructose + phosphate (RHEA:35603)
catalytic activity: beta-D-fructose 6-phosphate = D-glyceraldehyde 3-phosphate + dihydroxyacetone (RHEA:28002)
cofactor: Mn(2+) Ni(2+) (Phosphatase activity is strongly promoted by several divalent cations but it is suggested that Mn(2+) and possibly Ni(2+) represent biologically relevant metal ion cofactors for damage-control phosphatases.)
disruption phenotype: Leads to the accumulation of fructose-1-phosphate (PubMed:27322068). Leads to increased DNA damage or decreased repair (PubMed:18085829). - PI3K drives the de novo synthesis of coenzyme A from vitamin B5
Dibble, Nature 2022 - “...(UniProt: Q949P3 ) , Pyrococcus horikoshii PH1575 (UniProt: O59272 ) and Saccharomyces cerevisiae YMR027W (UniProt: Q04371 ). The catalytic aspartates in the non-PANK4 proteins were identified previously 33 . Sequences were aligned using Clustal Omega. Statistical analyses Experiments with two treatment groups were analysed using two-tailed...”
- A family of metal-dependent phosphatases implicated in metabolite damage-control
Huang, Nature chemical biology 2016 - “...which added a C-terminal His 6 -tag. The genes encoding DUF89 proteins from yeast (YMR027W, Q04371), P. horikoshii (PH1575, O59272), A. fulgidus (AF1104, O29161), and M. thermautotrophicus (MTH1744, O27776) were cloned and mutated as described 50 . The At2g17340 expression construct was a maltose-binding protein (MBP)...”
- Virus-like particles of the Ty3 retrotransposon assemble in association with P-body components.
Beliakova-Bethell, RNA (New York, N.Y.) 2006 - GeneRIF: P-bodies may serve to segregate translation and assembly functions of the Ty3 genomic RNA to promote assembly of virus-like particles. These findings may provide insights into host factors that facilitate retrovirus assembly.
- Investigation by atomic force microscopy of the structure of Ty3 retrotransposon particles.
Kuznetsov, Journal of virology 2005 - GeneRIF: Ty3 virus like particles did not undergo major external rearrangements during proteolytic maturation.
- Fission yeast Duf89 and Duf8901 are cobalt/nickel-dependent phosphatase-pyrophosphatases that act via a covalent aspartyl-phosphate intermediate
Sanchez, The Journal of biological chemistry 2022 - “...with respect to their metal cofactor preferences and substrate repertoires. The Saccharomyces cerevisiae DUF89 protein YMR027W was especially active in hydrolyzing fructose-1-phosphate and, with lower catalytic efficiency, fructose-6-phosphate ( 1 ). A structure obtained after soaking YMR027W crystals in fructose-6-phosphate showed the sugar phosphate moiety positioned...”
- “...subsequently clarified that human C6orf211/DUF89 is a cobalt-dependent phosphomonoesterase devoid of methyltransferase activity. Budding yeast YMR027W and human C6orf211 belong to the so-called subfamily III of DUF89 proteins, which are of similar size (380480 amino acids) and have a characteristic RTxK motif situated 40 to 50...”
- Profiling Yeast Deletion Strains Using Sample Multiplexing and Network-Based Analyses
Liu, Journal of proteome research 2022 - “...multiplexed experiment, YMR090W, YDR061W, and YOR289W, had positive correlations with YBR053C. Two additional uncharacterized proteins, YMR027W and YER134C, were also in the network but were not among the deletion strains selected for our experiments. In addition, we identified four proteins (UBC5, IRC15, ECM4, and XKS1) as...”
- PI3K drives the de novo synthesis of coenzyme A from vitamin B5
Dibble, Nature 2022 - “...thaliana At2g17340 (UniProt: Q949P3 ) , Pyrococcus horikoshii PH1575 (UniProt: O59272 ) and Saccharomyces cerevisiae YMR027W (UniProt: Q04371 ). The catalytic aspartates in the non-PANK4 proteins were identified previously 33 . Sequences were aligned using Clustal Omega. Statistical analyses Experiments with two treatment groups were analysed...”
- Approaches for completing metabolic networks through metabolite damage and repair discovery
Griffith, Current opinion in systems biology 2021 - “...as metal-dependent phosphatases with potential metabolite repair roles [ 59 ]. The S.cerevisiae DUF89 protein Ymr027w showed highest activity on fructose-1-phosphate, a glycating agent and non-canonical metabolite in yeast that accumulated in YMR027W deletion strains . An invitro phosphatase screen against an array of phosphoesters with...”
- A family of metal-dependent phosphatases implicated in metabolite damage-control
Huang, Nature chemical biology 2016 - “...phosphoester metabolism. The crystal structure of the yeast ( Saccharomyces cerevisiae ) subfamily III protein YMR027W revealed a novel phosphatase active site with fructose 6-phosphate and Mg 2+ bound near conserved signature residues Asp254 and Asn255 that are critical for activity. These findings indicate that DUF89...”
- “...site as central to DUF89 function 2 . In S. cerevisiae , the DUF89 gene YMR027W is upregulated in response to treatment with the DNA-damaging agent methyl methanesulfonate 5 , and the knockout strain shows a phenotype indicative of increased DNA damage or decreased repair 6...”
- Conservation of nucleosome positions in duplicated and orthologous gene pairs
Nishida, TheScientificWorldJournal 2012 - “...263483 + chr13 YMR010W 0.985774326 0.979191015 285099 + chr13 YMR011W 0.963732981 0.981283867 288078 + chr13 YMR027W 0.961041993 0.957831173 325876 + chr13 YMR036C 0.969260192 0.963784402 343519 chr13 YMR060C 0.990018805 0.990517987 392514 chr13 YMR066W 0.98321165 0.95995151 401540 + chr13 YMR078C 0.969392941 0.976546196 424727 chr13 YMR081C 0.981254312 0.956294421 431094...”
- “...YBR060C AFUA_5G08110 0.073589072 YGL120C AFUA_5G11620 0.069009268 YIL063C AFUA_2G10810 0.06328373 YOL157C AFUA_7G06380 0.06047767 YGL043W AFUA_3G07670 0.059398891 YMR027W AFUA_5G06710 0.058232831 YHR215W AFUA_8G01910 0.05787337 YDL247W AFUA_7G05190 0.05184022 YPR048W AFUA_5G07290 0.049809159 YBL051C AFUA_5G01940 0.048514144 YHR148W AFUA_2G08320 0.047441878 YJR160C AFUA_7G05190 0.045923723 YJL039C AFUA_5G12670 0.042943521 YNL029C AFUA_5G12160 0.031203315 YGR267C AFUA_5G03140 0.029526621 YNL027W...”
- Systematic screen of Schizosaccharomyces pombe deletion collection uncovers parallel evolution of the phosphate signal transduction pathway in yeasts
Henry, Eukaryotic cell 2011 - “...Ryh1 YLR262C YIL153W YDL167C Ypt6 Rrd1 Nrp1 YJR105W YMR027W YKL139W YDR452W YOR163W Ado1 a Csk1 Aps1 Zinc finger domain transcription factora SWI/SNF complex...”
- Discrete dynamical system modelling for gene regulatory networks of 5-hydroxymethylfurfural tolerance for ethanologenic yeast
Song, IET systems biology 2009 - “...C48 IMD1 RGD1 C49 YDR210W-C YGR161C-C YFL002W-B YBL005W-A YBL101W-A YDR365W-A YOR343C-B C50 MAL33 YFR024C C51 YMR027W C52 YOL159C-A SER1 C53 MES1 MRS6 C54 UIP5 C55 YNL179C C56 YFL065C C57 TUB4 C58 MAE1 C59 YLR227W-A YAR010C YPR158W-A YOL103W-A YDR098C-A YML045W-A YLR256W-A YHR214C-C YMR051C YDR316W-A YPR158C-C YER137C-A YBR012W-A...”
- More
CG2921 uncharacterized protein from Drosophila melanogaster
Aligns to 65:451 / 478 (81.0%), covers 99.7% of PF01937, 287.7 bits
- [Mutant generation of the testis genes and phenotype analyses in Drosophila]
Tang, Yi chuan = Hereditas 2018 (PubMed)- “...their specific functions and mechanisms. In the present study, eight Drosophila genes, including CG4161, CG11475, CG2921, CG10541, CG7276, CG3800, CG8117 and CG16779, were selected for detailed studies based on their testis expression, undefined functions, and having highly homologous and conserved genes in humans (Homo sapiens) and...”
- Cytoplasmic polyadenylation is a major mRNA regulator during oogenesis and egg activation in Drosophila
Cui, Developmental biology 2013 - “...from 19 to 6551 ( Table 2 ): pimples, punt, spinster, CG8485, costa, Bj1, CG5262, CG2921, CG33298, Pp1 - 96A, ubcE2h, tango11, Dsor1, CG8180, grapes, string, CG10209, mei-p26, CG8370, and CG34398 . Two previously known WISP-regulated RNAs, bicoid and Toll ( Benoit et al., 2008 ;...”
- “...+ costa CG1708-RA 600 3.48 bj1 CG10480-RA 737 3.43 + CG5262 CG5262-RA 787 3.40 + CG2921 CG2921-RA 998 3.33 + CG33298 CG33298-RB 1087 3.30 Pp1alpha-96A CG6593-RA 1376 3.21 + ubcE2h CG2257-RA 1569 3.16 + tango11 CG30404-RB 1674 3.13 + Dsor1 CG15793-RA 2146 3.03 + CG8180 CG8180-RA...”
CNF04510 hypothetical protein from Cryptococcus neoformans var. neoformans JEC21
Aligns to 26:454 / 476 (90.1%), covers 99.7% of PF01937, 280.9 bits
- Identification of genes expressed by Cryptococcus gattii during iron deprivation
de, Brazilian journal of microbiology : [publication of the Brazilian Society for Microbiology] 2014 - “...XP_572504.1 05 0.86 minor histocompatibility antigen h13 9E-32 XP_572261.1 09 0.70 Hypothetical proteins hypothetical protein CNF04510 1E-18 XP_571639.1 01 1.35 hypothetical protein CNJ02890 8E-18 XP_567569.1 01 1.52 Control Iron genes e high-affinity iron permease AFR98470.1 15.41 Multicopper oxidase AFR98469.1 17.45 Ion regulator 1 AFR97352.1 1.19 bZIP...”
SPAC806.04c DUF89 family protein from Schizosaccharomyces pombe
Aligns to 23:418 / 440 (90.0%), covers 99.4% of PF01937, 279.8 bits
SCHCODRAFT_80832 DUF89-domain-containing protein from Schizophyllum commune H4-8
Aligns to 55:461 / 495 (82.2%), covers 99.4% of PF01937, 278.4 bits
6umqA / Q9H993 Structure of duf89 (see paper)
2 alignments in 17:393 / 415 (90.8%), covering up to 56.6% of PF01937, 278.1 bits
- Ligand: magnesium ion (6umqA)
LACBIDRAFT_243185 uncharacterized protein from Laccaria bicolor S238N-H82
Aligns to 63:469 / 503 (80.9%), covers 97.4% of PF01937, 275.5 bits
UMAG_05521 uncharacterized protein from Ustilago maydis 521
2 alignments in 22:585 / 608 (73.0%), covering up to 71.7% of PF01937, 275.0 bits
- Tetracycline-controlled (TetON) gene expression system for the smut fungus Ustilago maydis
Ingole, Frontiers in fungal biology 2022 - “...(rtTA3) operated by the promoter (433 bp upstream of the start codon) of the gene UMAG_05521 (belongs to the hypothetical sugar phosphate phosphatase family) which has constitutive expression. Nuclear localization signal (NLS) with triple MYC epitope was fused to the C-terminal region of rtTA3, followed by...”
- “...optimized for U. maydis and its expression was driven by the promoter of the gene UMAG_05521. The transcriptional repressor Ssn6 (CYC8) ortholog Mql1 from U. maydis (UMAG_05501) with six tetratricopeptide repeat (TPR) domains was translationally fused to the TetR* tailed by the Nos terminator ( Figure1B...”
ARMT1_PIMHY / Q8MMH3 Damage-control phosphatase ARMT1; Acidic residue methyltransferase 1; Protein-glutamate O-methyltransferase; Sugar phosphate phosphatase ARMT1; Venom protein 2; EC 3.1.3.-; EC 2.1.1.- from Pimpla hypochondriaca (Parasitoid wasp) (see paper)
Aligns to 59:456 / 488 (81.6%), covers 97.1% of PF01937, 267.8 bits
- function: Metal-dependent phosphatase that shows phosphatase activity against several substrates, including fructose-1-phosphate and fructose-6-phosphate (By similarity). Its preference for fructose-1- phosphate, a strong glycating agent that causes DNA damage rather than a canonical yeast metabolite, suggests a damage-control function in hexose phosphate metabolism (By similarity). Has also been shown to have O-methyltransferase activity that methylates glutamate residues of target proteins to form gamma-glutamyl methyl ester residues (By similarity). Possibly methylates PCNA, suggesting it is involved in the DNA damage response (By similarity).
catalytic activity: beta-D-fructose 1-phosphate + H2O = D-fructose + phosphate (RHEA:35603)
catalytic activity: beta-D-fructose 6-phosphate = D-glyceraldehyde 3-phosphate + dihydroxyacetone (RHEA:28002)
catalytic activity: L-glutamyl-[protein] + S-adenosyl-L-methionine = [protein]-L- glutamate 5-O-methyl ester + S-adenosyl-L-homocysteine (RHEA:24452)
cofactor: Mn(2+) Ni(2+) - Profiling hymenopteran venom toxins: Protein families, structural landscape, biological activities, and pharmacological benefits
Guido-Patiño, Toxicon: X 2022 - “...Solenopsis invicta (P35778, 2VZN , blue), ( C ) Damage-control phosphatases from wasp Pimpla hypochondriaca (Q8MMH3, AF-Q8MMH3-F1, purple) and Homo sapiens (Q9H993, 6UMQ , orange) and ( D ) Overlapping segments of M12B metalloproteases from wasp Eulophus pennicornis (B5AJT4, AF-B5AJT4-F1, purple) and snake Protobothrops mucrosquamatus (O57413,...”
- “...that these short linear amphipathic peptides generally fold into -helical structures. The damage-control phosphatase ARMT1 (Q8MMH3) is the unique representative of the R protein family. It was initially found from the cDNA (gene vpr 2 ) of the venomous gland of the parasitic wasp Pimpla hypochondriaca...”
- Gene duplications are extensive and contribute significantly to the toxic proteome of nematocysts isolated from Acropora digitifera (Cnidaria: Anthozoa: Scleractinia)
Gacesa, BMC genomics 2015 - “...1.0E-47 J3S9D9 Phospholipase A2 activation (Reticulocalbin-2) Crotalus adamanteus (Eastern diamondback rattlesnake) adi_v1.10508 Venom maturation 5.0E-53 Q8MMH3 Protein-glutamate O-methyltransferase Pimpla hypochondriaca (Parasitoid wasp) Identification of potential gene duplicates Evaluation of the role that gene duplication plays in the evolution of toxin diversity requires phylogenetic analysis of sequence...”
CG11475 uncharacterized protein from Drosophila melanogaster
Aligns to 58:434 / 464 (81.2%), covers 99.7% of PF01937, 265.6 bits
- Genomic changes associated with adaptation to arid environments in cactophilic Drosophila species
Rane, BMC genomics 2019 - “...Protein uncouples respiration and energy dissipation DBUZO2011185 CG17387 Involved in cilium dependent cell motility DBUZO2010006 CG11475 ( DUF89 ) May be involved in protein methylation in response to DNA damage DBUZO2009533 Ppm1 Involved in protein serine/threonine phosphatase activity DBUZO2005585 CG9702 Transmembrane transporter involved in sulfate transport...”
- [Mutant generation of the testis genes and phenotype analyses in Drosophila]
Tang, Yi chuan = Hereditas 2018 (PubMed)- “...about their specific functions and mechanisms. In the present study, eight Drosophila genes, including CG4161, CG11475, CG2921, CG10541, CG7276, CG3800, CG8117 and CG16779, were selected for detailed studies based on their testis expression, undefined functions, and having highly homologous and conserved genes in humans (Homo sapiens)...”
- Myopathic lamin mutations cause reductive stress and activate the nrf2/keap-1 pathway
Dialynas, PLoS genetics 2015 - “...Gkt; plexB; Sclp; Sh 10 Other function Ilp5; l(2)efl; Prp31; RpS11 31 Unknown function CG9836; CG11475; CG14673; CG34115 22 Mutant lamins cause reductive stress Cellular anti-oxidant genes are typically activated in response to a redox imbalance. Measurements of the levels of oxidized (GSSG) and reduced (GSH)...”
- Widespread adaptive evolution of Drosophila genes with sex-biased expression
Pröschel, Genetics 2006 - “...McDonald-Kreitman tests Gene CG3085 CG5565 CG6255 CG8564 CG10750 CG11475 CG18418 CG3509 CG3975 CG4973 CG6874 CG9273 CG12276 CG3476 Bias Ds Ps Dn Pn P-valuea...”
- Correction
, Proceedings of the National Academy of Sciences of the United States of America 2002 - Identification of G protein-coupled receptors for Drosophila PRXamide peptides, CCAP, corazonin, and AKH supports a theory of ligand-receptor coevolution
Park, Proceedings of the National Academy of Sciences of the United States of America 2002 - “...in line 14 of the Abstract, the term CG11475 should read CG14575. www.pnas.orgcgidoi10.1073pnas.222515499 www.pnas.org PNAS October 15, 2002 vol. 99 no. 21...”
- “...Four Drosophila GPCRs in the NMU group (CG11475, CG8795, CG9918, CG8784) are activated by insect PRXa pyrokinins, (FXPRXamide), Cap2b-like peptides (FPRXamide),...”
CC1G_07544 DUF89 domain-containing protein from Coprinopsis cinerea okayama7#130
Aligns to 73:479 / 523 (77.8%), covers 99.0% of PF01937, 260.1 bits
AF1104 conserved hypothetical protein from Archaeoglobus fulgidus DSM 4304
O29161 Damage-control phosphatase AF_1104 from Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Aligns to 3:283 / 288 (97.6%), covers 99.4% of PF01937, 256.1 bits
- A family of metal-dependent phosphatases implicated in metabolite damage-control
Huang, Nature chemical biology 2016 - “...crystal structures of the subfamily I proteins PH1575 from Pyrococcus horikoshii (PDB code 2G8L) and AF1104 from Archaeoglobus fulgidus (PDB code 2FFJ), the side chains of the cysteines in the CxxC and KC motifs face each other across the rim of the putative substrate-binding cleft, and...”
- “...nm ( Supplementary Fig. 6 ). Three other purified subfamily I proteins ( A. fulgidus AF1104, Methanothermobacter thermautotrophicus MTH1744, and Desulfatibacillum alkenivorans Dalk1756; Supplementary Fig. 1 ) were found to have similar spectra ( Supplementary Fig. 6 ). Such spectra are typical for proteins with a...”
- A family of metal-dependent phosphatases implicated in metabolite damage-control
Huang, Nature chemical biology 2016 - “...genes encoding DUF89 proteins from yeast (YMR027W, Q04371), P. horikoshii (PH1575, O59272), A. fulgidus (AF1104, O29161), and M. thermautotrophicus (MTH1744, O27776) were cloned and mutated as described 50 . The At2g17340 expression construct was a maltose-binding protein (MBP) fusion in the pVP13-GW vector 2 . Production...”
PF1587 hypothetical protein from Pyrococcus furiosus DSM 3638
Aligns to 9:285 / 290 (95.5%), covers 99.4% of PF01937, 250.4 bits
- A family of metal-dependent phosphatases implicated in metabolite damage-control
Huang, Nature chemical biology 2016 - “...not fit with a molybdopterin chromophore, such as has been proposed for subfamily I protein PF1587 from P. furiosus (based on a preparation of uncertain purity whose Mo content was <<1 g-atom/mol) 41 . Because the chromophore was not needed for catalysis ( Supplementary Fig. 10...”
- A computational framework for proteome-wide pursuit and prediction of metalloproteins using ICP-MS and MS/MS data
Lancaster, BMC bioinformatics 2011 - “...Calculation . A, B and C illustrate the calculation with data for p i = PF1587 and m j = Mo, arrows represent generic steps in the calculation. A) Peptide counts for each protein (per fraction) are reduced to Boolean values (present/not present-shown as blue/white cells...”
- “...proteins were found in total (Table 3 , Additional File 9 ). A novel Mo-protein (PF1587) was purified by the metal-based chromatography method from which the data set was derived [ 6 ] and this is identified by the GMPA analysis as a likely Mo-protein. This...”
D89S1_PYRHO / O59272 Damage-control phosphatase PH1575; Nucleotides phosphatase PH1575; EC 3.1.3.- from Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3) (see paper)
PH1575 hypothetical protein from Pyrococcus horikoshii OT3
Aligns to 3:279 / 287 (96.5%), covers 99.4% of PF01937, 249.5 bits
- function: Metal-dependent phosphatase with probable damage-control functions (PubMed:27322068). Shows phosphatase activity against p- nitrophenyl phosphate (pNPP), but natural substrates have not been identified yet (PubMed:27322068). Low phosphatase activity against 8- oxo nucleotides suggests that it could hydrolyze oxidatively damaged purine nucleotides or their biosynthetic intermediates (PubMed:27322068).
cofactor: Mn(2+) Ni(2+) (Phosphatase activity is strongly promoted by several divalent cation ions but it is suggested that Mn(2+) and possibly Ni(2+) represent biologically relevant metal ion cofactors for damage-control phosphatase activity (PubMed:27322068).)
cofactor: [2Fe-2S] cluster (The [2Fe-2S] cluster does not seem to be directly involved in catalysis (PubMed:27322068).) - PI3K drives the de novo synthesis of coenzyme A from vitamin B5
Dibble, Nature 2022 - “...(UniProt: Q9NVE7 ) , Arabidopsis thaliana At2g17340 (UniProt: Q949P3 ) , Pyrococcus horikoshii PH1575 (UniProt: O59272 ) and Saccharomyces cerevisiae YMR027W (UniProt: Q04371 ). The catalytic aspartates in the non-PANK4 proteins were identified previously 33 . Sequences were aligned using Clustal Omega. Statistical analyses Experiments with...”
- A family of metal-dependent phosphatases implicated in metabolite damage-control
Huang, Nature chemical biology 2016 - “...His 6 -tag. The genes encoding DUF89 proteins from yeast (YMR027W, Q04371), P. horikoshii (PH1575, O59272), A. fulgidus (AF1104, O29161), and M. thermautotrophicus (MTH1744, O27776) were cloned and mutated as described 50 . The At2g17340 expression construct was a maltose-binding protein (MBP) fusion in the pVP13-GW...”
- PI3K drives the de novo synthesis of coenzyme A from vitamin B5
Dibble, Nature 2022 - “...sapiens PANK4 (UniProt: Q9NVE7 ) , Arabidopsis thaliana At2g17340 (UniProt: Q949P3 ) , Pyrococcus horikoshii PH1575 (UniProt: O59272 ) and Saccharomyces cerevisiae YMR027W (UniProt: Q04371 ). The catalytic aspartates in the non-PANK4 proteins were identified previously 33 . Sequences were aligned using Clustal Omega. Statistical analyses...”
- A family of metal-dependent phosphatases implicated in metabolite damage-control
Huang, Nature chemical biology 2016 - “...~25 residues from the C terminus. In the crystal structures of the subfamily I proteins PH1575 from Pyrococcus horikoshii (PDB code 2G8L) and AF1104 from Archaeoglobus fulgidus (PDB code 2FFJ), the side chains of the cysteines in the CxxC and KC motifs face each other across...”
- “...certain bacteria. Representatives of each subfamily were selected for biochemical and structural characterization: P. horikoshii PH1575 from subfamily I; Arabidopsis At2g17340 and the DUF89 domains of Arabidopsis pantothenate kinase 2 (PanK2) and human pantothenate kinase 4 (PanK4) from subfamily II; and yeast YMR027W from subfamily III....”
MTH1744 conserved protein from Methanothermobacter thermautotrophicus str. Delta H
O27776 Conserved protein from Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Aligns to 3:282 / 286 (97.9%), covers 99.7% of PF01937, 249.1 bits
- A family of metal-dependent phosphatases implicated in metabolite damage-control
Huang, Nature chemical biology 2016 - “...Fig. 6 ). Three other purified subfamily I proteins ( A. fulgidus AF1104, Methanothermobacter thermautotrophicus MTH1744, and Desulfatibacillum alkenivorans Dalk1756; Supplementary Fig. 1 ) were found to have similar spectra ( Supplementary Fig. 6 ). Such spectra are typical for proteins with a [2Fe-2S] cluster. Inductively...”
- “...from yeast (YMR027W, Q04371), P. horikoshii (PH1575, O59272), A. fulgidus (AF1104, O29161), and M. thermautotrophicus (MTH1744, O27776) were cloned and mutated as described 50 . The At2g17340 expression construct was a maltose-binding protein (MBP) fusion in the pVP13-GW vector 2 . Production and purification of proteins....”
- A family of metal-dependent phosphatases implicated in metabolite damage-control
Huang, Nature chemical biology 2016 - “...yeast (YMR027W, Q04371), P. horikoshii (PH1575, O59272), A. fulgidus (AF1104, O29161), and M. thermautotrophicus (MTH1744, O27776) were cloned and mutated as described 50 . The At2g17340 expression construct was a maltose-binding protein (MBP) fusion in the pVP13-GW vector 2 . Production and purification of proteins. Plasmids...”
Csac_2091 protein of unknown function DUF89 from Caldicellulosiruptor saccharolyticus DSM 8903
Aligns to 3:281 / 292 (95.5%), covers 98.7% of PF01937, 233.6 bits
- Genome Wide Re-Annotation of Caldicellulosiruptor saccharolyticus with New Insights into Genes Involved in Biomass Degradation and Hydrogen Production
Chowdhary, PloS one 2015 - “...the list of essential genes, 7 of them Csac_2571, Csac_1262, Csac_0970, Csac_1701, Csac_2220, Csac_1839 and Csac_2091, were found to be hypothetical and the re-annotation study predicted their function as O-antigen polymerase, histone family DNA-binding protein, uracil-DNA glycosylase, glycyl-tRNA synthase subunit, dCTP deaminase, metalloprotease ybeY and aminopeptidase...”
AT4G35360 pantothenate kinase family protein from Arabidopsis thaliana
Aligns to 48:359 / 367 (85.0%), covers 99.4% of PF01937, 224.3 bits
Dde_3221 Protein of unknown function superfamily from Desulfovibrio desulfuricans G20
Aligns to 3:279 / 285 (97.2%), covers 99.4% of PF01937, 224.2 bits
D89S2_ARATH / Q949P3 Damage-control phosphatase At2g17340; Sugar phosphates phosphatase At2g17340; EC 3.1.3.- from Arabidopsis thaliana (Mouse-ear cress) (see paper)
NP_565412 pantothenate kinase from Arabidopsis thaliana
AT2G17340 pantothenate kinase-related from Arabidopsis thaliana
Aligns to 48:359 / 367 (85.0%), covers 99.7% of PF01937, 221.2 bits
- function: Metal-dependent phosphatase with probable damage-control functions (PubMed:27322068). Shows phosphatase activity against several substrates, including sugar phosphates and p-nitrophenyl phosphate(pNPP) (PubMed:27322068). Prefers sugar phosphate substrates, including the extremely potent glycating agents ribose-5-phosphate and erythrose-4-phosphate (PubMed:27322068).
cofactor: Mn(2+) Ni(2+) (Phosphatase activity is strongly promoted by several divalent cations but it is suggested that Mn(2+) and possibly Ni(2+) represent biologically relevant metal ion cofactors for damage-control phosphatases.)
subunit: Multimer. - The structure at 1.7 A resolution of the protein product of the At2g17340 gene from Arabidopsis thaliana.
Bitto, Acta crystallographica. Section F, Structural biology and crystallization communications 2005 - GeneRIF: X-ray crystallographic structure of teh At2g17340 gene from Arabidopsis thaliana
- PI3K drives the de novo synthesis of coenzyme A from vitamin B5
Dibble, Nature 2022 - “...identifiers are as follows: Homo sapiens PANK4 (UniProt: Q9NVE7 ) , Arabidopsis thaliana At2g17340 (UniProt: Q949P3 ) , Pyrococcus horikoshii PH1575 (UniProt: O59272 ) and Saccharomyces cerevisiae YMR027W (UniProt: Q04371 ). The catalytic aspartates in the non-PANK4 proteins were identified previously 33 . Sequences were aligned...”
- PANTOTHENATE KINASE4, LOSS OF GDU2, and TRANSPOSON PROTEIN1 affect the canalization of tomato fruit metabolism
Wijesingha, Plant physiology 2023 - “...stress ( Zhang et al. 2019 ). Orthologs to Solyc10g074590 include the pantothenate kinases AT2G17320, AT2G17340, and AT4G35360. In a study that characterized the 3D structure of the protein product of AT2G17340, the proteins carboxy terminus was found to have sequence homology to PANK2 (AT4G32180) (...”
- “...kinase, phosphorylating pantothenate to 4-phosphopantothenate ( Tilton et al. 2006 ) it seems plausible that AT2G17340 and its orthologs are also pantothenate kinases. The candidate gene Solyc10g074630, annotated as ARF-like protein ( Hosmani et al. 2019 ), has a homolog in A. thaliana , namely the...”
- PI3K drives the de novo synthesis of coenzyme A from vitamin B5
Dibble, Nature 2022 - “...corresponding sequence identifiers are as follows: Homo sapiens PANK4 (UniProt: Q9NVE7 ) , Arabidopsis thaliana At2g17340 (UniProt: Q949P3 ) , Pyrococcus horikoshii PH1575 (UniProt: O59272 ) and Saccharomyces cerevisiae YMR027W (UniProt: Q04371 ). The catalytic aspartates in the non-PANK4 proteins were identified previously 33 . Sequences...”
- A family of metal-dependent phosphatases implicated in metabolite damage-control
Huang, Nature chemical biology 2016 - “...plants and animals 3 , 4 . The crystal structure of the stand-alone DUF89 protein At2g17340 from Arabidopsis thaliana (PDB codes 1XFI and 2Q40) reveals a new protein fold and several conserved residues, including Asp220, Asn221, and Asp256 coordinating a metal ion (probably Mg 2+ ),...”
- “...subfamily were selected for biochemical and structural characterization: P. horikoshii PH1575 from subfamily I; Arabidopsis At2g17340 and the DUF89 domains of Arabidopsis pantothenate kinase 2 (PanK2) and human pantothenate kinase 4 (PanK4) from subfamily II; and yeast YMR027W from subfamily III. These proteins were expressed in...”
- Recruitment of the NineTeen Complex to the activated spliceosome requires AtPRMT5
Deng, Proceedings of the National Academy of Sciences of the United States of America 2016 - “...1961 B atprmt5-1 atprmt5-2 prp8-9 atprmt5-2 prp8-8 353 At2g17340 1079 1504 500 bp At1g22250 810 1440 500 bp Col atprmt5 atprmt5-2 prp8-8 atprmt5-1 prp8-9...”
- Mining the soluble chloroplast proteome by affinity chromatography
Bayer, Proteomics 2011 - “...+ WP, LFA AT1G79870 a) Oxidoreductase family protein O + AT2G17240 Unknown protein C + AT2G17340 Pantothenate kinase-related O + AT2G21350 RNA binding C + AT2G23390 Acyl-CoA N-acyltransferase M + AT2G25870 Haloacid dehalogenase-like family protein M + AT2G31890 b) ATRAP; putative RNA binding domain C +...”
- The structure at 1.7 A resolution of the protein product of the At2g17340 gene from Arabidopsis thaliana
Bitto, Acta crystallographica. Section F, Structural biology and crystallization communications 2005 - “...1.7 A resolution of the protein product of the At2g17340 gene from Arabidopsis thaliana ISSN 1744-3091 Eduard Bitto, Craig A. Bingman, Simon T. M. Allard, Gary...”
- “...3 June 2005 Online 23 June 2005 PDB Reference: At2g17340, 1xfi, r1xfisf. The crystal structure of the At2g17340 protein from A. thaliana was determined by the...”
AT2G17320 pantothenate kinase-related from Arabidopsis thaliana
Aligns to 42:353 / 361 (86.4%), covers 99.4% of PF01937, 211.5 bits
- PANTOTHENATE KINASE4, LOSS OF GDU2, and TRANSPOSON PROTEIN1 affect the canalization of tomato fruit metabolism
Wijesingha, Plant physiology 2023 - “...cinerea stress ( Zhang et al. 2019 ). Orthologs to Solyc10g074590 include the pantothenate kinases AT2G17320, AT2G17340, and AT4G35360. In a study that characterized the 3D structure of the protein product of AT2G17340, the proteins carboxy terminus was found to have sequence homology to PANK2 (AT4G32180)...”
- Imputation of 3 million SNPs in the Arabidopsis regional mapping population
Arouisse, The Plant journal : for cell and molecular biology 2020 - “...role in signalling during pathogen recognition and the subsequent activation of plant defence mechanisms (e.g. AT2G17320). Figure 5 Manhattan plots illustrating the genomewide association analysis of growth reduction in plants exposed to heat using 3M imputed single nucleotide polymorphisms (SNPs) (upper plot), filtered 1M SNPs (middle...”
- The structure at 1.7 A resolution of the protein product of the At2g17340 gene from Arabidopsis thaliana
Bitto, Acta crystallographica. Section F, Structural biology and crystallization communications 2005 - “...FFAS03 (Jaroszewski et al., 2000). The A. thaliana proteins At2g17320 and At4g35360 (cyan and yellow) confirmed by a comparison of the available show a close...”
- “...Two of them are highly homologous to At2g17340: At2g17320 is 87% identical and At4g35360 is 86% identical to At2g17340. At2g17340 also shows sequence homology...”
SCO6072 hypothetical protein from Streptomyces coelicolor A3(2)
Aligns to 285:645 / 666 (54.2%), covers 98.4% of PF01937, 211.0 bits
2q40A / Q949P3 Ensemble refinement of the protein crystal structure of gene product from arabidopsis thaliana at2g17340 (see paper)
Aligns to 43:337 / 343 (86.0%), covers 99.7% of PF01937, 195.2 bits
- Ligand: magnesium ion (2q40A)
DVU2984 conserved hypothetical protein from Desulfovibrio vulgaris Hildenborough
Aligns to 3:331 / 335 (98.2%), covers 99.0% of PF01937, 193.0 bits
NP_001392985 4'-phosphopantetheine phosphatase isoform 8 from Mus musculus
Aligns to 62:375 / 384 (81.8%), covers 98.1% of PF01937, 187.7 bits
PANK4_RAT / Q923S8 4'-phosphopantetheine phosphatase; Inactive pantothenic acid kinase 4; rPanK4; EC 3.1.3.- from Rattus norvegicus (Rat) (see paper)
Q923S8 pantothenate kinase (EC 2.7.1.33) from Rattus norvegicus (see paper)
NP_598215 4'-phosphopantetheine phosphatase from Rattus norvegicus
Aligns to 451:764 / 773 (40.6%), covers 98.1% of PF01937, 178.9 bits
PANK4 / Q9NVE7 Pantothenate kinase 4 (EC 2.7.1.33) from Homo sapiens (see 11 papers)
PANK4_HUMAN / Q9NVE7 4'-phosphopantetheine phosphatase; Inactive pantothenic acid kinase 4; hPanK4; EC 3.1.3.- from Homo sapiens (Human) (see 4 papers)
NP_060686 4'-phosphopantetheine phosphatase from Homo sapiens
Aligns to 450:764 / 773 (40.8%), covers 97.4% of PF01937, 177.5 bits
- function: Phosphatase which shows a preference for 4'- phosphopantetheine and its oxidatively damaged forms (sulfonate or S- sulfonate), providing strong indirect evidence that the phosphatase activity pre-empts damage in the coenzyme A (CoA) pathway (PubMed:27322068). Hydrolyzing excess 4'-phosphopantetheine could constitute a directed overflow mechanism to prevent its oxidation to the S-sulfonate, sulfonate, or other forms (PubMed:27322068). Hydrolyzing 4'-phosphopantetheine sulfonate or S-sulfonate would forestall their conversion to inactive forms of CoA and acyl carrier protein (PubMed:27322068). May play a role in the physiological regulation of CoA intracellular levels (Probable).
catalytic activity: (R)-4'-phosphopantetheine + H2O = (R)-pantetheine + phosphate (RHEA:68328)
catalytic activity: (R)-4'-phosphopantetheine sulfonate + H2O = (R)-pantetheine sulfonate + phosphate (RHEA:68336)
catalytic activity: (R)-4'-phospho-S-sulfopantetheine + H2O = (R)-S- sulfopantetheine + phosphate (RHEA:68340)
cofactor: Mn(2+) Ni(2+) (Phosphatase activity is strongly promoted by several divalent cation ions but it is suggested s that Mn(2+) and possibly Ni(2+) represent biologically relevant metal ion cofactors for damage-control phosphatases.)
subunit: Homodimer. Interacts with PKM. - A novel mutation of PANK4 causes autosomal dominant congenital posterior cataract.
Sun, Human mutation 2019 (PubMed)- GeneRIF: the association of a new entity of an autosomal dominant cataract with mutations in PANK4, which influences cell proliferation, apoptosis of lens epithelial cells, crystallin abnormalities, and fiber cell derangement, subsequently induces cataract.
- Human pantothenate kinase 4 is a pseudo-pantothenate kinase.
Yao, Protein science : a publication of the Protein Society 2019 - GeneRIF: The human PANK4 is a pseudo-pantothenate kinase-a catalytically deficient variant of the catalytically active PANK4 found in plants and fungi.
- Characterization and validation of Entamoeba histolytica pantothenate kinase as a novel anti-amebic drug target
Nurkanto, International journal for parasitology. Drugs and drug resistance 2018 - “...follows: E. histolytica ( XP_001913460 ); Entamoeba nuttali ( XP_008855986 ); Homo sapiens PanK4 ( NP_060686 ); Homo sapiens PanK3 ( NP_078870 ); Arabidopsis thaliana ( NP_001031768 ). Identical residues are denoted by asterisks (*). The glycine residue in the ATP binding sites are shown in...”
- [Screening susceptibility genes of type 2 diabetes in Chinese population by single nucleotide polymorphism analysis].
Li, Zhongguo yi xue ke xue yuan xue bao. Acta Academiae Medicinae Sinicae 2005 (PubMed)- GeneRIF: Observational study of gene-disease association. (HuGE Navigator)
- High glucose upregulates pantothenate kinase 4 (PanK4) and thus affects M2-type pyruvate kinase (Pkm2).
Li, Molecular and cellular biochemistry 2005 (PubMed)- GeneRIF: PanK4 interacts with Pkm2 and thereby may modulate the glucose metabolism through regulating the activity of Pkm2.
- PI3K drives the de novo synthesis of coenzyme A from vitamin B5
Dibble, Nature 2022 - “...proteins, the species, proteins and corresponding sequence identifiers are as follows: Homo sapiens PANK4 (UniProt: Q9NVE7 ) , Arabidopsis thaliana At2g17340 (UniProt: Q949P3 ) , Pyrococcus horikoshii PH1575 (UniProt: O59272 ) and Saccharomyces cerevisiae YMR027W (UniProt: Q04371 ). The catalytic aspartates in the non-PANK4 proteins were...”
- A novel heteromeric pantothenate kinase complex in apicomplexan parasites
Tjhin, PLoS pathogens 2021 - “...cerevisiae (Q04430); Aspergillus nidulans (O93921); Homo sapiens PanK1 (Q8TE04), PanK2 (Q9BZ23), PanK3 (Q9H999) and PanK4 (Q9NVE7); Arabidopsis thaliana PanK1 (O80765) and PanK2 (Q8L5Y9); Plasmodium falciparum PanK1 (Q8ILP4) and PanK2 (Q8IL92) and Toxoplasma gondii PanK1 (A0A125YTW9) and PanK2 (V5B595). Statistical analysis Statistical analysis between the means of...”
- Proteogenomics analysis unveils a TFG-RET gene fusion and druggable targets in papillary thyroid carcinomas
Krishnan, Nature communications 2020 - “...GN=PTPN11 PE=1 SV=2 5 P32456 GBP2_HUMAN Guanylate-binding protein 2 OS=Homo sapiens GN=GBP2 PE=1 SV=3 6 Q9NVE7 PANK4_HUMAN Pantothenate kinase 4 OS=Homo sapiens GN=PANK4 PE=1 SV=1 7 Q53RD9 FBLN7_HUMAN Fibulin-7 OS=Homo sapiens GN=FBLN7 PE=2 SV=1 8 Q9UDY2 ZO2_HUMAN Tight junction protein ZO-2 OS=Homo sapiens GN=TJP2 PE=1 SV=2...”
- Molecular mechanisms of OLIG2 transcription factor in brain cancer.
Tsigelny, Oncotarget 2016 - “...(UniProtKB Q8TDB4); pantothenate kinase 4 ( PANK4 )a key regulator of coenzyme A biosynthesis (UniProtKB Q9NVE7); sphingosine-1-phosphate lyase 1 ( SGPL1 ), which elevates stress-induced ceramide production and apoptosis [ 206 ], protein phosphatase 6, regulatory subunit 1 ( PPP6R1 )a regulatory subunit of protein phosphatase...”
- RNA Interference Screen to Identify Kinases That Suppress Rescue of ΔF508-CFTR.
Trzcińska-Daneluti, Molecular & cellular proteomics : MCP 2015
W5Q9Q5 4'-phosphopantetheine phosphatase from Ovis aries
Aligns to 450:764 / 773 (40.8%), covers 97.4% of PF01937, 176.0 bits
Q4R4U1 4'-phosphopantetheine phosphatase from Macaca fascicularis
Aligns to 450:764 / 773 (40.8%), covers 97.4% of PF01937, 173.8 bits
PANK4_MOUSE / Q80YV4 4'-phosphopantetheine phosphatase; Inactive pantothenic acid kinase 4; mPanK4; EC 3.1.3.- from Mus musculus (Mouse) (see paper)
Aligns to 451:811 / 820 (44.0%), covers 98.1% of PF01937, 171.4 bits
- function: Phosphatase which shows a preference for 4'- phosphopantetheine and its oxidatively damaged forms (sulfonate or S- sulfonate), providing strong indirect evidence that the phosphatase activity pre-empts damage in the coenzyme A (CoA) pathway. Hydrolyzing excess 4'-phosphopantetheine could constitute a directed overflow mechanism to prevent its oxidation to the S-sulfonate, sulfonate, or other forms. Hydrolyzing 4'-phosphopantetheine sulfonate or S-sulfonate would forestall their conversion to inactive forms of CoA and acyl carrier protein. May play a role in the physiological regulation of CoA intracellular levels.
catalytic activity: (R)-4'-phosphopantetheine + H2O = (R)-pantetheine + phosphate (RHEA:68328)
catalytic activity: (R)-4'-phosphopantetheine sulfonate + H2O = (R)-pantetheine sulfonate + phosphate (RHEA:68336)
catalytic activity: (R)-4'-phospho-S-sulfopantetheine + H2O = (R)-S- sulfopantetheine + phosphate (RHEA:68340)
cofactor: Mn(2+) Ni(2+)
subunit: Homodimer. Interacts with PKM.
disruption phenotype: Knockout mice have a body weight and a lifespan similar to wild-type animals. About 10% of the animals start developing cataract at 2 months. At 15 months, 50% homozygous animals are affected. Heterozygous animals develop cataract later, with 10% animals affected at 9 months and 25% at 15.
AtPANK2 / Q8L5Y9 pantothenate kinase (EC 2.7.1.33) from Arabidopsis thaliana (see 9 papers)
PANK2_ARATH / Q8L5Y9 Pantothenate kinase 2; AtPANK2; Pantothenic acid kinase 2; EC 2.7.1.33; EC 3.1.3.- from Arabidopsis thaliana (Mouse-ear cress) (see 2 papers)
AT4G32180 ATPANK2 (PANTOTHENATE KINASE 2); pantothenate kinase from Arabidopsis thaliana
Aligns to 553:892 / 901 (37.7%), covers 90.0% of PF01937, 154.1 bits
- function: Catalyzes the phosphorylation of pantothenate the first step in CoA biosynthesis. May play a role in the physiological regulation of the intracellular CoA concentration. Functionally redudant with PANK1 (PubMed:16897480). The phosphatase activity shows preference for normal or oxidatively damaged intermediates of 4'-phosphopantetheine, which provides strong indirect evidence that the phosphatase activity pre- empts damage in the CoA pathway (PubMed:27322068). Hydrolyzing excess 4'-phosphopantetheine could constitute a directed overflow mechanism to prevent its oxidation to the S-sulfonate, sulfonate, or other forms (PubMed:27322068). Hydrolyzing 4'-phosphopantetheine sulfonate or S- sulfonate would forestall their conversion to inactive forms of CoA and acyl carrier protein (PubMed:27322068).
catalytic activity: (R)-pantothenate + ATP = (R)-4'-phosphopantothenate + ADP + H(+) (RHEA:16373)
catalytic activity: (R)-4'-phosphopantothenate + H2O = (R)-pantothenate + phosphate (RHEA:68332)
catalytic activity: (R)-4'-phosphopantetheine + H2O = (R)-pantetheine + phosphate (RHEA:68328)
catalytic activity: (R)-4'-phosphopantetheine sulfonate + H2O = (R)-pantetheine sulfonate + phosphate (RHEA:68336)
cofactor: Mn(2+) Ni(2+) (Phosphatase activity is strongly promoted by several divalent cation ions but it is suggested s that Mn(2+) and possibly Ni(2+) represent biologically relevant metal ion cofactors for damage-control phosphatases.)
disruption phenotype: No visible phenotype under normal growth conditions, but homozygous double mutants pank1-1 and pank2-1 are embryonic lethal. - PANTOTHENATE KINASE4, LOSS OF GDU2, and TRANSPOSON PROTEIN1 affect the canalization of tomato fruit metabolism
Wijesingha, Plant physiology 2023 - “...product of AT2G17340, the proteins carboxy terminus was found to have sequence homology to PANK2 (AT4G32180) ( Bitto et al. 2005 ). Since PANK2 was previously characterized to act as a pantothenate kinase, phosphorylating pantothenate to 4-phosphopantothenate ( Tilton et al. 2006 ) it seems plausible...”
- A family of metal-dependent phosphatases implicated in metabolite damage-control
Huang, Nature chemical biology 2016 - “...given in Supplementary Table 6 . All constructs were sequence-verified. Full-length cDNAs for Arabidopsis PanK2 (At4g32180) and human PanK4 were obtained from the Riken BioResource Center (clone RAFL0998-B15) and Thermo Scientific (clone 5244472), respectively. The Arabidopsis PanK2 and human PanK4 DUF89 domains were expressed by changing...”
- Identification of two novel type 1 peroxisomal targeting signals in Arabidopsis thaliana
Ramirez, Acta histochemica 2014 - “...2C family Group E AT3G24550 PERK1: proline-rich extensin-like receptor kinase 1 AT3G20110 CYP705A20: cytochrome P450 AT4G32180 PANK2: pantothenate kinase 2 AT1G61000 Nuf2 domain-containing protein AT2G26920 Ubiquitin-associated/translation elongation factor AT5G12120 Ubiquitin-associated/translation elongation factor AT4G35270 NLP2: NIN-like protein 2 AT1G47640 unknown...”
- Exon-primed intron-crossing (EPIC) markers for evolutionary studies of Ficus and other taxa in the fig family (Moraceae)
Yao, Applications in plant sciences 2013 - “...0.02760 JQ341941 AT2G26990 FUS12 R: CATCAGAGCCATCTTCCTTTTG JQ341942 FA32180 F: TGCTCGAACTAAGGGAAGAATG 741/628 (+13) 38 0.05163 JQ341943 AT4G32180 ATPANK2 R: GCTGCAAGAACACCTTCAATAA JQ341944 FA32910 F: GGTTGGAATTCTTGGAGAAAATAC 455/284 (+2) 12 0.02655 JQ341945 AT4G32910 F26P21_30 R: GTGAAGCCAAAACTTGAGCATA JQ341946 FA36880b F: GCTGTTGGGACATTGTTGAC 1044/896 (+6) 41 0.03958 JQ341947 AT5G36880 F5H8_15 R: ATAACCGCTACACTCCCCTTC JQ341948...”
- Transcriptional profiles underlying parent-of-origin effects in seeds of Arabidopsis thaliana
Tiwari, BMC plant biology 2010 - “...lipase class 3 family protein lipid metabolic process At4g21590 ENDO3 putative endonuclease DNA catabolism/stamen development At4g32180 ATPANK2 pantothenate kinase coenzyme A biosynthesic process At5g03200 zinc finger (C3HC4-type RING finger) family protein N-terminal protein myristoylation At5g20580 unknown protein unknown At5g23660 MTN3 homolog of the Medicago nodulin MTN3...”
- Proteomic profiling of tandem affinity purified 14-3-3 protein complexes in Arabidopsis thaliana
Chang, Proteomics 2009 - “...(2) At3g50000 99.8 26 Protein kinase AFC1 (1) At3g53570 99.9 31 Pantothenate kinase 2 (1) At4g32180 100 42 PHOPHOTASE S/T-protein phosphatase BSU1 (2) At1g03445 100 36 S/T-protein phosphatase BSL1 (2) At4g03080 99.9 31 Kinase associated protein phosphatase (3) At5g19280 100 34 RECEPTORS Glutamate receptor 1.2 (3)...”
- The structure at 1.7 A resolution of the protein product of the At2g17340 gene from Arabidopsis thaliana
Bitto, Acta crystallographica. Section F, Structural biology and crystallization communications 2005 - “...available show a close homology to At2g17340. Furthermore, At4g32180 (blue) and At2g17340 share 32% identity. At4g32180 is currently annotated as a pantothenate...”
- “...kinase 4 (hPanK4, pink). Also, in its amino-terminal part At4g32180 shows a high level of homology to the A. kinase (PDB codes 1esm and 1sq5; Yun et...”
- A novel heteromeric pantothenate kinase complex in apicomplexan parasites
Tjhin, PLoS pathogens 2021 - “...PanK1 (Q8TE04), PanK2 (Q9BZ23), PanK3 (Q9H999) and PanK4 (Q9NVE7); Arabidopsis thaliana PanK1 (O80765) and PanK2 (Q8L5Y9); Plasmodium falciparum PanK1 (Q8ILP4) and PanK2 (Q8IL92) and Toxoplasma gondii PanK1 (A0A125YTW9) and PanK2 (V5B595). Statistical analysis Statistical analysis between the means of the pantothenate phosphorylation rate by the Parent...”
F6GSM7 Pantothenate kinase 2 from Vitis vinifera
Aligns to 574:913 / 921 (36.9%), covers 94.5% of PF01937, 153.9 bits
B8BDU9 Pantothenate kinase 2 from Oryza sativa subsp. indica
Aligns to 558:893 / 903 (37.2%), covers 91.0% of PF01937, 151.9 bits
NP_001031768 pantothenate kinase 2 from Arabidopsis thaliana
Aligns to 553:782 / 783 (29.4%), covers 61.4% of PF01937, 112.4 bits
DVU1887 hypothetical protein from Desulfovibrio vulgaris Hildenborough
Aligns to 62:384 / 580 (55.7%), covers 72.7% of PF01937, 37.1 bits
Or search for genetic data about PF01937 in the Fitness Browser
by Morgan Price,
Arkin group
Lawrence Berkeley National Laboratory