Family Search for PF01973 (MptE-like)
PaperBLAST, GapMind, SitesBLAST, and Sites on a Tree will be down for server maintenance on Friday March 29.
Running HMMer for PF01973
PF01973 hits 56 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.
CAC2168 Uncharacterized conserved protein from Clostridium acetobutylicum ATCC 824
Aligns to 189:359 / 578 (29.6%), covers 99.4% of PF01973, 187.0 bits
CA_C2196 motility associated factor glycosyltransferase family protein from Clostridium acetobutylicum ATCC 824
CAC2196 Uncharacterized conserved protein from Clostridium acetobutylicum ATCC 824
Aligns to 193:360 / 544 (30.9%), covers 99.4% of PF01973, 183.4 bits
- Structure and computational analysis of a novel protein with metallopeptidase-like and circularly permuted winged-helix-turn-helix domains reveals a possible role in modified polysaccharide biosynthesis
Das, BMC bioinformatics 2014 - “.... CA_C2194 NP_348811.1 nucleoside-diphosphate sugar epimerase 15895463 . CA_C2195 NP_348812.1 Peptidase-like (peptidase_MH superfamily) 15895464 . CA_C2196 NP_348813.1 Methyltransferase+Glycosyltransferase (currently annotated as: MAF_flag10, DUF115) 15895465 . CA_C2197 NP_348814.1 aminosugar N -acetyltransferase 15895466 acpA CA_C2198 NP_348815.1 acyl carrier protein 15895467 . CA_C2199 NP_348816.1 aminosugsar N -acetyltransferase+HAD Phosphatase This...”
- Genome sequence of a proteolytic (Group I) Clostridium botulinum strain Hall A and comparative analysis of the clostridial genomes
Sebaihia, Genome research 2007 - “...loci of C. botulinum (CBO2728), C. acetobutylicum (CAC2168, CAC2196, and CAC2202), and C. tetani (CTC1697 and CTC1714). In addition to Campylobacter, members of...”
- Analysis of the lateral flagellar gene system of Aeromonas hydrophila AH-3
Canals, Journal of bacteriology 2006 - “...proteins of Shewanella oneidensis (SO3259), Clostridium acetobutylicum (CAC2196), and Campylobacter jejuni (Cj1337) (36, 27, and 26% identity, respectively). A...”
- Polar flagellum biogenesis in Aeromonas hydrophila
Canals, Journal of bacteriology 2006 - “...Shewanella oneidensis (GenBank no. SO3259), Clostridium acetobutylicum (CAC2196), and Campylobacter jejuni (Cj1337), a group of proteins thought to be involved...”
CAC2202 Uncharacterized conserved protein from Clostridium acetobutylicum ATCC 824
Aligns to 191:362 / 592 (29.1%), covers 100.0% of PF01973, 167.4 bits
A911_06490 motility associated factor glycosyltransferase family protein from Campylobacter jejuni subsp. jejuni PT14
Aligns to 216:390 / 648 (27.0%), covers 98.8% of PF01973, 164.7 bits
Cj1335 motility accessory factor (function unknown) from Campylobacter jejuni subsp. jejuni NCTC 11168
Cj1318 hypothetical protein Cj1318 (1318 family) from Campylobacter jejuni subsp. jejuni NCTC 11168
Aligns to 217:391 / 649 (27.0%), covers 98.8% of PF01973, 163.2 bits
- Persistent contamination of raw milk by Campylobacter jejuni ST-883
Jaakkonen, PloS one 2020 - “...Cj1330 KBNHAAAG_01283 8 151640 snp 3 C T - 0 0 69 64 protein PseD Cj1335 KBNHAAAG_01288 8 157973 ins TGGGGGGGGGTAT TGGGGGGGGGGTAT reference 0 8 15 9 hypothetical protein Cj1342c KBNHAAAG_01293 9 5364 del ACCCCCCCCCATA ACCCCCCCCATA alternate 0 8 23 45 capsule methyltransferase Cj1420c KBNHAAAG_01367 9...”
- High Throughput Method for Analysis of Repeat Number for 28 Phase Variable Loci of Campylobacter jejuni Strain NCTC11168
Lango-Scholey, PloS one 2016 - “...540 -37 (10G) cj1321-fwd-VIC cj1321-rev AAAAAGGAATGATGCGTTGC CCCGCTCCTATGATGATGAC cj1326 672 +252 9G cj1326-fwd-FAM cj1326-rev CTTTTGGAATAGATATAGTTCC TTAGAGGTATGTAGTAAAGAC cj1335 1,944 +168 11G cj1335-fwd-NED cj1318-35-rev CACAATTGGTTTATCCAAGG GTTTGCAACTCTTTAATGGG cj1342c 1,239 +560 9G cj1342-fwd-FAM cj1342-rev TTGGCAATCGTCCTCAAACC GCCAAATGCGCTAAATATCC cj1420c 771 +393 9G cj1420-fwd-FAM cj1420-rev GCTAGTTCTTTCCATTGGAC CTACAATGTGGCGAGGATTC cj1421c 1,836 +87 9G cj1421-22-fwd cj1421-rev-VIC TTGGGTATTTAAGTTGGGGAAA...”
- “...89 275 C1 cj0275 cj1296 cj1306 Yellow Yellow Yellow 215 104 304 C2 cj0171 cj1144 cj1335 Yellow Yellow Yellow 282 173 337 D cj0565 cj0617 cj1139 cj1305 cj1321 cj1421 Green Green Green Green Green Green 357 167 200 220 149 287 E cj0046 cj0676 cj1295 cj1310...”
- Standing genetic variation in contingency loci drives the rapid adaptation of Campylobacter jejuni to a novel host
Jerome, PloS one 2011 - “...C. jejuni genome. Because sequences surrounding six tracts ( Cj1305c , Cj1310c , Cj1318 , Cj1335 , Cj1421c , and Cj1422c ) match multiple sites in the genome, short sequence reads could not be unambiguously mapped to these loci. These tracts were defined by colony PCR...”
- Identification of motility and autoagglutination Campylobacter jejuni mutants by random transposon mutagenesis
Golden, Infection and immunity 2002 - “...subunit, FlaA. Furthermore, five novel genes (those in Cj1334, Cj1335, Cj1336, Cj1337, and Cj1341c) were also found in this region of DNA and had strong...”
- Persistent contamination of raw milk by Campylobacter jejuni ST-883
Jaakkonen, PloS one 2020 - “...protein Cj1306c KBNHAAAG_01256 8 130522 ins ACCCCCCCCATA ACCCCCCCCCATA reference 0 33 85 36 hypothetical protein Cj1318 KBNHAAAG_01269 8 141128 ins TGGGGGGGGTAT TGGGGGGGGGGTAT reference 33 33 31 36 pseudaminic acid biosynthesis protein PseA Cj1324 KBNHAAAG_01277 8 146844 ins TTTAG TATTAG alternate 0 33 0 0 isomerase Cj1330...”
- Nonselective Bottlenecks Control the Divergence and Diversification of Phase-Variable Bacterial Populations
Aidley, mBio 2017 - “...a random pattern for each lineage. For example, lineage NE2C had an on-to-off switch in cj1318 and cj1426c while NE5F has an off-to-on switch in cj1310 and an on-to-off switch in cj1421 . Switches in larger bottlenecks tended to be partial changes in proportions with more...”
- “...cj1306c (9), cj1342c (9), cj1429c (10) D cj0031 (9), cj0275 (8), cj0628 (11), cj1295 (9), cj1318 (11), cj1420c (9) To visualize the effects of the experimental bottlenecks, we plotted the diversity and divergence values against each other ( Fig.2C ). The expected constraint of small bottlenecks...”
- High Throughput Method for Analysis of Repeat Number for 28 Phase Variable Loci of Campylobacter jejuni Strain NCTC11168
Lango-Scholey, PloS one 2016 - “...1,224 +579 9G cj1306-fwd-NED cj1306-rev TTTATTCCTTCGCGTGGAGA AAAAATGATCGCCCTGCAT cj1310c 1,212 +579 9G cj1310-fwd-FAM cj1310-rev GAACAAATTATTCCTCTTATAG TCGAAATAAAATTCCCCTTGA cj1318 1,947 +167 11G cj1318-fwd-FAM cj1318-35-rev TCCGTGCGTCCTTCTTTTGGAC GTTTGCAACTCTTTAATGGG cj1321 540 -37 (10G) cj1321-fwd-VIC cj1321-rev AAAAAGGAATGATGCGTTGC CCCGCTCCTATGATGATGAC cj1326 672 +252 9G cj1326-fwd-FAM cj1326-rev CTTTTGGAATAGATATAGTTCC TTAGAGGTATGTAGTAAAGAC cj1335 1,944 +168 11G cj1335-fwd-NED cj1318-35-rev CACAATTGGTTTATCCAAGG...”
- “...cj1326 cj1342 Blue Blue Blue Blue Blue Blue 457 221 280 128 165 392 B cj1318 cj1420 cj1426 cj1429 cj1437 Blue Blue Blue Blue Green 332 109 209 89 275 C1 cj0275 cj1296 cj1306 Yellow Yellow Yellow 215 104 304 C2 cj0171 cj1144 cj1335 Yellow Yellow...”
- The CJIE1 prophage of Campylobacter jejuni affects protein expression in growth media with and without bile salts
Clark, BMC microbiology 2014 - “...Cj1310c gi|218562921 Cj1310c Part of O-linked glycosylation locus 0.230.25 1.331.02 0.870.81 Motility accessory factor gi|407942710 Cj1318 Part of O-linked glycosylation locus 0.030.32 0.930.98 1.000.17 Maf7; hypothetical protein C8J_1258 gi|157415578 Cj1342c Motility accessory factor 0.200.10 1.570.31 1.870.31 Sugar transferase gi|218563025 Cj1421c Part of capsule locus 0.500.17 0.800.66...”
- Effects of the Campylobacter jejuni CJIE1 prophage homologs on adherence and invasion in culture, patient symptoms, and source of infection
Clark, BMC microbiology 2012 - “...Amplification products were visualized by agarose gel electrophoresis and ethidium bromide staining. One gene pair, cj1318 and cj1336, had extensive overlapping regions of DNA sequence identity. The primers obtained could not differentiate the two genes; for the purposes of our discussion, positive results were taken to...”
- Passage of Campylobacter jejuni through the chicken reservoir or mice promotes phase variation in contingency genes Cj0045 and Cj0170 that strongly associates with colonization and disease in a mouse model
Kim, Microbiology (Reading, England) 2012 - “...Cj0685c, cipA Cj1139c, wlaN Cj1144-45c* Cj1305c/06c/10cD Cj1318, maf1/35-36*, maf4D Cj1321 Cj1325-26* Cj1342c, maf7 Cj1420c Cj1421c/22cD Cj1426c Cj1429c 9G...”
- The main Aeromonas pathogenic factors
Tomás, ISRN microbiology 2012 - “...multiple copies of hypothetical genes encoding proteins which belong to the motility accessory factor (MAF, Cj1318 family) of proteins. Insertional inactivation of individual copies of these genes has provided evidence for a role in motility or glycosylation although the precise function of each MAF gene remains...”
- Standing genetic variation in contingency loci drives the rapid adaptation of Campylobacter jejuni to a novel host
Jerome, PloS one 2011 - “...the AT-rich C. jejuni genome. Because sequences surrounding six tracts ( Cj1305c , Cj1310c , Cj1318 , Cj1335 , Cj1421c , and Cj1422c ) match multiple sites in the genome, short sequence reads could not be unambiguously mapped to these loci. These tracts were defined by...”
- More
Sputcn32_2630 protein of unknown function DUF115 from Shewanella putrefaciens CN-32
Aligns to 173:339 / 821 (20.3%), covers 98.8% of PF01973, 162.8 bits
Cj1337 hypothetical protein Cj1337 from Campylobacter jejuni subsp. jejuni NCTC 11168
Aligns to 206:382 / 628 (28.2%), covers 98.8% of PF01973, 162.7 bits
- Transcriptome and proteome dynamics in chemostat culture reveal how Campylobacter jejuni modulates metabolism, stress responses and virulence factors upon changes in oxygen availability
Guccione, Environmental microbiology 2017 - “...PglA (Cj1125) 1.130 0.247 4.6 0.00038 PglF (Cj 1120) 1.571 0.488 3.2 < 0.0001 PseE (Cj1337) 0.468 0.130 3.6 0.0140 Outer membrane CjkT (Cj1170) 5.883 0.878 6.7 < 0.0001 BamA (Cj0129) 2.735 0.631 4.3 < 0.0001 CadF (Cj1478) 15.989 6.592 2.4 < 0.0001 FlpA (Cj1279) 10.570...”
- Comparison of epidemiologically linked Campylobacter jejuni isolated from human and poultry sources
Lajhar, Epidemiology and infection 2015 - “...252 bp; CJE1500, 545 bp; Cj1321, 249 bp; maf5/pseE (Cj1337) 146 bp; gmhA2 (Cj1424) 450 bp; flgE2 (Cj1729c), 555 bp; CJE1733, 447 bp. For further data analysis...”
- Campylobacter jejuni survival within human epithelial cells is enhanced by the secreted protein CiaI
Buelow, Molecular microbiology 2011 - “...F38011 chromosomal DNA using the primers FlaInsert-Up-SacI-F and FlaInsert-Up-XhoI-SacII-R for an upstream homologous region containing Cj1337 , and FlaInsert-XhoI-NotI-BamHI-Dn-F and FlaInsert-Dn-KpnI-R for a downstream homologous region containing Cj1338 . They were subsequently cloned into pBSK-Kan2 using SacI and XhoI for the upstream region and XhoI and...”
- Biofilm formation by Campylobacter jejuni is increased under aerobic conditions
Reuter, Applied and environmental microbiology 2010 - “...biofilm formation (34); mutants defective in flagellar modification (cj1337) and assembly (fliS) are defective in adhering to glass surfaces (21); and a...”
- Comparison of PCR binary typing (P-BIT), a new approach to epidemiological subtyping of Campylobacter jejuni, with serotyping, pulsed-field gel electrophoresis, and multilocus sequence typing methods
Cornelius, Applied and environmental microbiology 2010 - “...20, 22, 37, 53, 64, 65 maf5/pseE (Cj1337) For: TTGGGGCTAGACGATTATGG Rev: TGAGAATGTGTTTGCCCATC 146 22, 26 pldA (Cj1351) For: GCTTTGGCTAATTATCTTGGTGA Rev:...”
- Characterization of two Campylobacter jejuni strains for use in volunteer experimental-infection studies
Poly, Infection and immunity 2008 - “...(pseD) Cj1333 (pseD) Cj1334 (maf-3) Cj1336 (maf-4) Cj1337 (pseE) Cj1338c (flaB) Cj1339c (flaA) Cj1340c Cj1341 (maf-6) Cj1342c (maf-7) Cj1343c % Identity/%...”
- Changes in flagellin glycosylation affect Campylobacter autoagglutination and virulence
Guerry, Molecular microbiology 2006 - “...Twenty-four of the 45 genes found between Cj1293 and Cj1337 in NCTC 11168 are missing in 81-176. Mutation of six new genes, in addition to three previously...”
- “...of one of these maf genes in NCTC 11168 (maf5 or Cj1337) resulted in a non-motile phenotype, and more recently this same group has 300 P. Guerry et al. have two...”
- A sigma28-regulated nonflagella gene contributes to virulence of Campylobacter jejuni 81-176
Goon, Infection and immunity 2006 - “...within the 3 end of flaB and the adjacent Cj1337 gene that introduced XhoI and BamHI sites, respectively, and the amplicon was cloned into pCE101. After DNA...”
- More
CBO2728 hypothetical protein from Clostridium botulinum A str. ATCC 3502
Aligns to 183:354 / 571 (30.1%), covers 98.8% of PF01973, 162.7 bits
A911_06495 motility associated factor glycosyltransferase family protein from Campylobacter jejuni subsp. jejuni PT14
Aligns to 206:382 / 628 (28.2%), covers 98.8% of PF01973, 162.4 bits
YP_001397580 motility accessory factor from Campylobacter jejuni subsp. doylei 269.97
Aligns to 207:383 / 629 (28.1%), covers 98.8% of PF01973, 161.7 bits
CMTB2_07872 hypothetical protein from Caminibacter mediatlanticus TB-2
Aligns to 206:377 / 631 (27.3%), covers 98.8% of PF01973, 160.5 bits
- The Helicobacter pylori J99 jhp0106 Gene, under the Control of the CsrA/RpoN Regulatory System, Modulates Flagella Formation and Motility
Kao, Frontiers in microbiology 2017 - “...al., 2006 Campylobacter jejuni PseE Flagellin glycosylation 628 34 McNally et al., 2006 Caminibacter mediatlanticus CMTB2_07872 Unclear 631 41 Denitrovibrio acetiphilus Dacet_0453 Unclear 633 29 Helicobacter mustelae HMU07160 Unclear 629 62 Helicobacter pylori Jhp0106 Motility accessory factor 627 100 Schirm et al., 2003 Nautilia profundicola NAMH_1610...”
- “...showed the highest identity to Jhp0106, followed by WS2199 (55%), NAMH_1610 (44%), Sdel_2228 (42%), and CMTB2_07872 (41%) (Table 3 ). The phylogenic tree based on the homologous full-length sequence of 16 proteins was also displayed in Figure S5 . Previous studies reported that Maf4, PseD and...”
Cj1340c hypothetical protein Cj1340c (1318 family) from Campylobacter jejuni subsp. jejuni NCTC 11168
Aligns to 203:375 / 605 (28.6%), covers 98.8% of PF01973, 158.0 bits
- Survival of Campylobacter jejuni 11168H in Acanthamoebae castellanii Provides Mechanistic Insight into Host Pathogen Interactions
Nasher, Microorganisms 2022 - “...cgb Single domain hemoglobin 4.663339 1.88 10 26 Cj0974 Uncharacterized protein 4.417067 6.57 10 5 Cj1340c Maf1 Motility accessory protein 4.349186 6.28 10 34 Cj0380c Uncharacterized protein 4.241269 1.77 10 4 Cj0972 Uncharacterized protein 4.14400 1.08 10 5 Cj0758 grpE Response to hyperosmotic and heat shock...”
- Survival of Campylobacter jejuni in Acanthamoebae castellanii provides mechanistic insight into host pathogen interactions
Nasher, 2022 - Binding of Phage-Encoded FlaGrab to Motile Campylobacter jejuni Flagella Inhibits Growth, Downregulates Energy Metabolism, and Requires Specific Flagellar Glycans
Sacher, Frontiers in microbiology 2020 - “...we found that 12664 encodes another DUF2920-containing gene, CJ12664_1277 , just upstream of maf4 ( cj1340c ) ( Figure 4 , Region I), and we found that 12661 also encoded this second DUF2920-containing gene ( CJ12661_1263) . However, strain 12661 is also missing the DUF2920-containing gene...”
- The Helicobacter pylori J99 jhp0106 Gene, under the Control of the CsrA/RpoN Regulatory System, Modulates Flagella Formation and Motility
Kao, Frontiers in microbiology 2017 - “...a.a (no.) Identities to Jhp0106 (%) References Calditerrivibrio nitroreducens Calni_0724 Unclear 633 30 Campylobacter jejuni Cj1340c Motility accessory factor 605 30 Golden and Acheson, 2002 Campylobacter jejuni Maf1 Motility accessory factor 649 35 Karlyshev et al., 2002 Campylobacter jejuni Maf3 Motility accessory factor 619 34 McNally...”
- Refined analysis of the Campylobacter jejuni iron-dependent/independent Fur- and PerR-transcriptomes
Butcher, BMC genomics 2015 - “...primarily down-regulated in the perR strain (~2 fold) and includes several motility associated genes ( cj1340c - cj1345c , maf6 , maf7 ). Interestingly, no genes were found to be down-regulated in all three strains and only cj1340c ( fur , perR ), flaA ( fur...”
- Phenotypic screening of a targeted mutant library reveals Campylobacter jejuni defenses against oxidative stress
Flint, Infection and immunity 2014 - “...cj0672 cj0947c cj0949c cj1036c cj1167 cj1209 cj1241 cj1255 cj1340c cj1388 cj1406c cj1623 dprA folP pstC spoT Surface structures flaG flgD flgE 2268 iai.asm.org...”
- Characterization of two Campylobacter jejuni strains for use in volunteer experimental-infection studies
Poly, Infection and immunity 2008 - “...Cj1336 (maf-4) Cj1337 (pseE) Cj1338c (flaB) Cj1339c (flaA) Cj1340c Cj1341 (maf-6) Cj1342c (maf-7) Cj1343c % Identity/% similaritya Not Not Not Not Not Not 99/99...”
- The protein network of bacterial motility
Rajagopala, Molecular systems biology 2007 - “...et al (2004) COG2604 CJ1318 CJ1318 (CJE) FliN, FliQ Golden et al (2000) None HP0488 CJ1340c (CJE) FlgE, FlgB FlhA+FlhF c Rain et al (2001) ; Niehus et al (2004) COG1923 B4172 hfq (ECO) FliS, FliL /+ a Arifuzzaman et al (2006) COG0455 TP0712 (CJ0063c) HP1034...”
- More
SO_3273 conserved hypothetical protein from Shewanella oneidensis MR-1
Aligns to 173:339 / 822 (20.3%), covers 98.8% of PF01973, 157.1 bits
- Analyzing the modification of the Shewanella oneidensis MR-1 flagellar filament
Bubendorfer, PloS one 2013 - “...part of the operon. Similar homologies of SO_3259 occur to PseD (25%/40%). A second protein, SO_3273, also annotated as MAF, exhibits a similar degree of homology to PseE (22%/41%) and PseD (22%/35%). Thus, these two proteins might be another part of the S. oneidensis MR-1 flagellin...”
- “...Further analyses are also directed towards the question of whether the MAF proteins SO_3259 and SO_3273 are also part of the S. oneidensis glycosylation pathway. Our analysis also demonstrated that several lysine residues are methylated. So far, we have not determined whether or not function or...”
- Evidence-based annotation of gene function in Shewanella oneidensis MR-1 using genome-wide fitness profiling across 121 conditions
Deutschbauer, PLoS genetics 2011 - “...a plasmid carrying an intact copy of the mutated gene. SO_2650 has no known domains. SO_3273 (protein of unknown function DUF115) contains a tetratricopeptide-like helical domain (IPR011990), a common structural motif. SO_3257 is discussed in the main text. (B) SO_1071 is a predicted membrane protein from...”
B2K12_RS06385, B5D75_RS06380 motility associated factor glycosyltransferase family protein from Campylobacter jejuni subsp. jejuni
Aligns to 216:392 / 654 (27.1%), covers 98.8% of PF01973, 156.7 bits
CjjRM3420_1272 motility associated factor glycosyltransferase family protein from Campylobacter jejuni subsp. jejuni str. RM3420
Aligns to 202:378 / 617 (28.7%), covers 99.4% of PF01973, 155.4 bits
CJJ81176_1337 PseE from Campylobacter jejuni subsp. jejuni 81-176
Aligns to 208:384 / 632 (28.0%), covers 98.2% of PF01973, 155.1 bits
CjjRM3420_1274 motility associated factor glycosyltransferase family protein from Campylobacter jejuni subsp. jejuni str. RM3420
Aligns to 206:384 / 632 (28.3%), covers 98.8% of PF01973, 154.6 bits
- Biomolecule sulphation and novel methylations related to Guillain-Barré syndrome-associated Campylobacter jejuni serotype HS:19
Heikema, Microbial genomics 2021 - “...94 18 ST-61/HS:4, ST?/mix, ST677/HS:4 CjjRM3420_1273 cluster III motility associated factor, glycosyltransferase family 100 5 CjjRM3420_1274 motility associated factor glycosyltransferase family 100 7 CjjRM3420_1292 a cluster IV toxin-antitoxin complex, mRNA interferase, E 1.2e-6 toxin-antitoxin / translation control 100 20 ST-42/HS:23, ST-362/HS:41, ST-179/HS:4, ST-508/HS:4, ST677/HS:4, ST-61/HS:4, ST-45/mix...”
Cj1333 hypothetical protein Cj1333 (1318 family) from Campylobacter jejuni subsp. jejuni NCTC 11168
Aligns to 212:388 / 653 (27.1%), covers 98.8% of PF01973, 154.0 bits
- Domestication of Campylobacter jejuni NCTC 11168
Pascoe, Microbial genomics 2019 - “...[ 32, 77, 78 ]. A knockout mutant of the final gene in this block, Cj1333 , demonstrated compromised agglutination and reduced invasion (in INT-407 cells) [ 78 ]. This region of the C. jejuni genome is prone to recombination and has shown a high level...”
- A network-based approach to identify substrate classes of bacterial glycosyltransferases
Sánchez-Rodríguez, BMC genomics 2014 - “...for N- ( CJ1121c CJ1129c ) [ 33 ] and O- glycoprotein biosynthesis ( CJ1311 CJ1333 ) [ 34 ] and the CPS biosynthesis cluster ( CJ1416c CJ1442c ) [ 39 , 40 ]. In addition, we made a total of 17 new predictions for yet...”
- The sweet tooth of bacteria: common themes in bacterial glycoconjugates
Tytgat, Microbiology and molecular biology reviews : MMBR 2014 - “...8, 2017 by University of California, Berkeley and Cj1333. Further experimental validation of these targets is needed to confirm that they are truly flagellar...”
- Effects of the Campylobacter jejuni CJIE1 prophage homologs on adherence and invasion in culture, patient symptoms, and source of infection
Clark, BMC microbiology 2012 - “...cj1218 F AATTCTTTCGACTTCTTCC 317 46.6 R ATTTTATCGGCACACTTGA cj1318/ cj1336 F GGAGGAAATGGAAAAGTTGAA 477 48.2 R AAATTGAGTACGCAGAGGTTGT cj1333 F TTTTGGGGAATTTGATAAGGA 460 44.6 R ACAGTTGTAGGTGGTAATA cj1463 F AAAGCCTTAAAAGAACAAACCAA 174 48.8 R TGAAAAACCCATACCTCCACTTA cj1622 F ACGCCTTACATGAGTTTAT 438 48.4 R TAGGGCAATCTTTTCTTATG cj1729 F CCATCTGCCGTTACTACTACTTTT 441 52.2 R ACAGGCTGGAACACCGACTATTA The cj locus...”
- Characterization of two Campylobacter jejuni strains for use in volunteer experimental-infection studies
Poly, Infection and immunity 2008 - “...Cj1329 (ptmE) Cj1330 (ptmF) Cj1331 (ptmB) Cj1332 (ptmA) Cj1333 (pseD) Cj1333 (pseD) Cj1334 (maf-3) Cj1336 (maf-4) Cj1337 (pseE) Cj1338c (flaB) Cj1339c (flaA)...”
- “...repetitive nature of the gene. c Cj1306c and Cj1333 homologs in the CG8421 genome are represented by incomplete ORFs (Cj8421_1347, Cj8421_1348, and...”
- Changes in flagellin glycosylation affect Campylobacter autoagglutination and virulence
Guerry, Molecular microbiology 2006 - “...the 81-176 gene that shows the highest homology to Cj1333 maps between Cj1334 and Cj1337. Of the seven maf gene homologues described by Karlyshev et al. (2002)...”
- “...Cj1311 Cj1312 Cj1313 Cj1314c Cj1315c Cj1316c Cj1317 Cj1334 Cj1333 dcd; dCTP deaminase pseB pseC Amidopeptidase Unknown Unknown accP NA Unknown fabH2 accP...”
- Identification of motility and autoagglutination Campylobacter jejuni mutants by random transposon mutagenesis
Golden, Infection and immunity 2002 - “...blot analysis, yet were unable to autoagglutinate (Cj1318, Cj1333, Cj1340c, and Cj1062). These results suggest that FlaA is necessary but not sufficient to...”
- “...phenotype. Furthermore, two of the four AAG mutants (Cj1333 and Cj1062) were unable to invade INT-407 intestinal epithelial cells, as determined by a gentamicin...”
B2K12_RS06335, B5D75_RS06330 motility associated factor glycosyltransferase family protein from Campylobacter jejuni subsp. jejuni
Aligns to 216:392 / 650 (27.2%), covers 98.8% of PF01973, 153.8 bits
CJJ81176_1335 motility accessory factor from Campylobacter jejuni subsp. jejuni 81-176
Aligns to 190:366 / 604 (29.3%), covers 99.4% of PF01973, 153.2 bits
Cj1334 hypothetical prootein Cj1334 (1318 family) from Campylobacter jejuni subsp. jejuni NCTC 11168
Aligns to 202:378 / 619 (28.6%), covers 99.4% of PF01973, 152.4 bits
- Campylobacter jejuni genotypes are associated with post-infection irritable bowel syndrome in humans
Peters, Communications biology 2021 - “...Eleven genes ( Cj0208_fokIM , Cj0261c_ubiG , Cj0533_sucC , Cj0720c_flaC , Cj1293_pseB , Cj1300_ubiG , Cj1334 , Cj1351_pldA , Cj1414c_kpsC , Cj1729c_flgE , g00183 ) had the greatest number of variants associated with PI-IBS. Three of these are involved in energy metabolism; Cj0208 , a DNA...”
- “...mediates flagellin glycosylation 60 . This has been shown to facilitate bacterial motility 61 . Cj1334 is an uncharacterized gene but shares 90% homology with bacterial motility associated factor glycosyltransferase family protein. Cj1351 ( pldA ) cleaves phospholipids resulting in lysophospholipids that contain only acyl chain...”
- The acid adaptive tolerance response in Campylobacter jejuni induces a global response, as suggested by proteomics and microarrays
Varsaki, Microbial biotechnology 2015 - “...motility that were differentially expressed (upregulated) were cj0319 ( fliG ), cj0320 ( fliH) and cj1334 ( maf3 ). For the rest of the genes composing the flagella machinery, the results given by the microarrays are of no statistical value ( P -value>0.05). Two-component regulators are...”
- Development and validation of a comparative genomic fingerprinting method for high-resolution genotyping of Campylobacter jejuni
Taboada, Journal of clinical microbiology 2012 - “...630 Cj1550c Cj1329 Cj0177 Cj1334 Cj0566 AGGCACTGCGTTTGAAAAGT GGCTTAGGCTCTCGCTTAAAA TTTATGTTGAGCGCTTGTGC TGCTTGTACATCGCCCTTTA GTTTCCACAAGCCTTAGAAAAA...”
- Comparison of molecular typing methods useful for detecting clusters of Campylobacter jejuni and C. coli isolates through routine surveillance
Clark, Journal of clinical microbiology 2012 - “...CGF_MP4 Cj1550c Cj1329 Cj0177 Cj1334 Cj0566 AGGCACTGCGTTTGAAAAGT GGCTTAGGCTCTCGCTTAAAA TTTATGTTGAGCGCTTGTGC TGCTTGTACATCGCCCTTTA GTTTCCACAAGCCTTAGAAAAA...”
- Modification of the Campylobacter jejuni flagellin glycan by the product of the Cj1295 homopolymeric-tract-containing gene
Hitchen, Microbiology (Reading, England) 2010 - “...(+) Upstream of Cj1321 Transferase 10 10 Cj1317/8 Unknown (Cj1318 family) 9 () 9 () Cj1334 Unknown (Cj1318 family) 9 () 9 () Cj0170/1 Unknown 10 () 9 () *+, In-frame; , out-of-frame. Table 2. LC-ES-MS/MS analysis of flagellin-derived tryptic glycopeptides from the NCTC 11168 Cj1295::aphA...”
- Identification of Campylobacter jejuni genes involved in the response to acidic pH and stomach transit
Reid, Applied and environmental microbiology 2008 - “...(flgDEI and fliD) and glycosylation (Cj1316c, Cj1321, Cj1325, Cj1334, and neuA2), oxidative stress defense (ahpC, tpx, Cj1064, katA, perR, and cft), iron uptake...”
- “...up-regulation of five genes involved in flagellar glycosylation (Cj1334, pseA [Cj1316c], Cj1321, Cj1325, and neuA2). It is possible that the up-regulation of...”
- Characterization of two Campylobacter jejuni strains for use in volunteer experimental-infection studies
Poly, Infection and immunity 2008 - “...Cj1331 (ptmB) Cj1332 (ptmA) Cj1333 (pseD) Cj1333 (pseD) Cj1334 (maf-3) Cj1336 (maf-4) Cj1337 (pseE) Cj1338c (flaB) Cj1339c (flaA) Cj1340c Cj1341 (maf-6) Cj1342c...”
- Functional characterization of the flagellar glycosylation locus in Campylobacter jejuni 81-176 using a focused metabolomics approach
McNally, The Journal of biological chemistry 2006 (PubMed)- “...was shown that pseD, pseE, Cj1314c, Cj1315c, Cjb1301, Cj1334, Cj1341c, and Cj1342c have no role in the CMP-Pse5NAc7NAc or CMP-Pse5NAc7Am pathways. These results...”
- “...none Cj1311 Cj1312 Cj1313 Cj1314c Cj1315c Cj1316c Cj1317 Cj1334 Cj1333 Cj1337 Cj1341c Cj1342c a c pseB pseC unknown/CjB1301 pseF pseG pseH probable cyclase...”
- More
NAMH_1610 motility associated factor glycosyltransferase family protein from Nautilia profundicola AmH
Aligns to 208:379 / 643 (26.7%), covers 98.8% of PF01973, 152.3 bits
- The Helicobacter pylori J99 jhp0106 Gene, under the Control of the CsrA/RpoN Regulatory System, Modulates Flagella Formation and Motility
Kao, Frontiers in microbiology 2017 - “...62 Helicobacter pylori Jhp0106 Motility accessory factor 627 100 Schirm et al., 2003 Nautilia profundicola NAMH_1610 Motility accessory factor 643 44 Sulfurospirillum deleyianum Sdel_2228 Unclear 627 42 Syntrophomonas wolfei Swol_0199 Unclear 671 28 The genes close to jhp0106 in H. pylori J99 are shown in Figure...”
- “.... Among them, HMU07160 (62%) showed the highest identity to Jhp0106, followed by WS2199 (55%), NAMH_1610 (44%), Sdel_2228 (42%), and CMTB2_07872 (41%) (Table 3 ). The phylogenic tree based on the homologous full-length sequence of 16 proteins was also displayed in Figure S5 . Previous studies...”
Cj1341c hypothetical protein Cj1341c (1318 family) from Campylobacter jejuni subsp. jejuni NCTC 11168
Aligns to 203:372 / 607 (28.0%), covers 99.4% of PF01973, 150.0 bits
- Agricultural intensification and the evolution of host specialism in the enteric pathogen Campylobacter jejuni
Mourkas, Proceedings of the National Academy of Sciences of the United States of America 2020 - “...related to motility-associated factors ( maf family genes), involved in flagellar biosynthesis ( cj1340 and cj1341c ) ( 32 , 33 ) and capsule biosynthesis ( id86_0802 and id86_0803 ) ( Table 1 and Dataset S2 ). Flagellar motility and surface structures are known to impact...”
- Binding of Phage-Encoded FlaGrab to Motile Campylobacter jejuni Flagella Inhibits Growth, Downregulates Energy Metabolism, and Requires Specific Flagellar Glycans
Sacher, Frontiers in microbiology 2020 - “...flagellin in Campylobacter . For instance, strain 12664 lacks the motility associated factor maf5 ( cj1341c ), while maf6 ( cj1342c ) is missing from both 12664 and 12661 ( Figure 4 , Region I). As well, the poly-G tract in maf2 is uniquely absent in...”
- Genomic insights from whole genome sequencing of four clonal outbreak Campylobacter jejuni assessed within the global C. jejuni population
Clark, BMC genomics 2016 - “...two genes encoding motility functions; flagellin A and the motility accessory factor protein homologous to Cj1341c. We hypothesize that these are allelic differences arising from homologous recombination. These data provide further evidence that isolate 002544 is not as closely related as the other three outbreak isolates....”
- Identification of Campylobacter jejuni genes involved in its interaction with epithelial cells
Novik, Infection and immunity 2010 - “...cells. Two insertions were mapped to cj1340 and cj1341c, which belong to the maf (motility-associated factors) gene family. This gene family is prone to...”
- Functional characterization of the flagellar glycosylation locus in Campylobacter jejuni 81-176 using a focused metabolomics approach
McNally, The Journal of biological chemistry 2006 (PubMed)- “...shown that pseD, pseE, Cj1314c, Cj1315c, Cjb1301, Cj1334, Cj1341c, and Cj1342c have no role in the CMP-Pse5NAc7NAc or CMP-Pse5NAc7Am pathways. These results...”
- “...Cj1313 Cj1314c Cj1315c Cj1316c Cj1317 Cj1334 Cj1333 Cj1337 Cj1341c Cj1342c a c pseB pseC unknown/CjB1301 pseF pseG pseH probable cyclase Amidotransferase pseA...”
- Changes in flagellin glycosylation affect Campylobacter autoagglutination and virulence
Guerry, Molecular microbiology 2006 - “...11168, only five, Cj1333 (maf2), Cj1334 (maf3), Cj1337 (maf5), Cj1341c (maf6) and Cj1342c (maf7), were found in 81-176. There was one gene unique to 81-176 that...”
- “...134 205 NA NA 817 1407 Cj1337 Cj1338c Cj1339c Cj1341c Cj1342c pseE flaB flaA Unknown (maf6) Unknown (maf7) 61/76 75/81 75/81 58/72 71/80 (653) (576) (576) (605)...”
- Identification of motility and autoagglutination Campylobacter jejuni mutants by random transposon mutagenesis
Golden, Infection and immunity 2002 - “...five novel genes (those in Cj1334, Cj1335, Cj1336, Cj1337, and Cj1341c) were also found in this region of DNA and had strong homology to the genes in three of...”
CjjRM3420_1273 motility associated factor glycosyltransferase family protein from Campylobacter jejuni subsp. jejuni str. RM3420
Aligns to 208:384 / 654 (27.1%), covers 98.8% of PF01973, 149.8 bits
mptE / Q59028 6-hydroxymethyl-7,8-dihydropterin pyrophosphokinase (EC 2.7.6.3) from Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440) (see 2 papers)
MPTE_METJA / Q59028 6-hydroxymethyl-7,8-dihydropterin pyrophosphokinase; HPPK; 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine pyrophosphokinase; 6-hydroxymethyl-7,8-dihydropterin diphosphokinase; 6-HMPDK; 7,8-dihydro-6-hydroxymethylpterin diphosphokinase; 7,8-dihydro-6-hydroxymethylpterin pyrophosphokinase; PPPK; EC 2.7.6.3 from Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440) (Methanococcus jannaschii) (see paper)
MJ1634 conserved hypothetical protein from Methanocaldococcus jannaschii DSM 2661
Aligns to 30:199 / 241 (70.5%), covers 98.2% of PF01973, 146.5 bits
- function: Catalyzes the transfer of diphosphate from ATP to 6- hydroxymethyl-7,8-dihydropterin (6-HMD), leading to 6-hydroxymethyl- 7,8-dihydropterin diphosphate (6-HMDP).
catalytic activity: 6-hydroxymethyl-7,8-dihydropterin + ATP = (7,8-dihydropterin- 6-yl)methyl diphosphate + AMP + H(+) (RHEA:11412)
cofactor: Mg(2+) - Comparative genomics guided discovery of two missing archaeal enzyme families involved in the biosynthesis of the pterin moiety of tetrahydromethanopterin and tetrahydrofolate
de, ACS chemical biology 2012 - “...PF0930 derived protein likewise did not show any activity. Similar results were obtained with the MJ1634 protein. A biochemical validation strategy was then used to confirm the genetic results. mj 0408, mj 1634, and its homologue from P. furiosis ( pf 0930) were all expressed in...”
- “...to 0.2%) were used as needed. Cloning and expression of the M. jannaschii mj0408 and mj1634 and expression of their gene products The M. jannaschii genes mj 0408 and mj 1634 was amplified from M. jannaschii genomic DNA by PCR. The primers used for mj 0408...”
HPYLSS1_00109 motility associated factor glycosyltransferase family protein from Helicobacter pylori SS1
Aligns to 205:378 / 627 (27.8%), covers 99.4% of PF01973, 145.8 bits
Dacet_0453 hypothetical protein from Denitrovibrio acetiphilus DSM 12809
Aligns to 212:382 / 633 (27.0%), covers 98.8% of PF01973, 145.7 bits
CJJ81176_1336 PseD from Campylobacter jejuni subsp. jejuni 81-176
Aligns to 210:387 / 654 (27.2%), covers 99.4% of PF01973, 145.6 bits
B2K12_RS06420 motility associated factor glycosyltransferase family protein from Campylobacter jejuni
Aligns to 203:372 / 607 (28.0%), covers 99.4% of PF01973, 145.4 bits
HPG27_RS00595 motility associated factor glycosyltransferase family protein from Helicobacter pylori G27
Aligns to 205:378 / 627 (27.8%), covers 99.4% of PF01973, 142.7 bits
- Helicobacter pylori Stress-Response: Definition of the HrcA Regulon
Roncarati, Microorganisms 2019 - “...up- and down-regulated genes. Gene Names Log2 FC Common Names Description HPG27_RS00240 2.4 tnpB transposase HPG27_RS00595 2.2 HPG27_RS00595 motility accessory factor HPG27_RS00600 2.1 flaB flagellin B HPG27_RS01480 2.1 flgL flagellar hook-associated protein FlgL HPG27_RS01595 1.2 babA, omp28 membrane protein (adhesin) HPG27_RS01870 1.9 HPG27_RS01870 hypothetical protein HPG27_RS00070...”
Calni_0724 No description from Calditerrivibrio nitroreducens Yu37-1, DSM 19672
Aligns to 207:377 / 625 (27.4%), covers 98.8% of PF01973, 141.9 bits
HP0114 hypothetical protein from Helicobacter pylori 26695
Aligns to 206:379 / 628 (27.7%), covers 99.4% of PF01973, 140.8 bits
- The Role of a Dipeptide Transporter in the Virulence of Human Pathogen, Helicobacter pylori
Xu, Frontiers in microbiology 2021 - “...Gene no. Gene name or function log 2 (fold change) Upregulated HP0059 Predicted gene 2.4264 HP0114 Predicted gene 1.3287 HP0115 flaB 1.7312 HP0116 topA 1.378 HP0117 Predicted gene 1.3026 HP0119 Predicted gene 2.2661 HP0131 Predicted gene 1.7324 HP0132 sdaA 1.2527 HP0140 lctP 1.1428 HP0142 mutY 1.0653...”
- Structural and functional characterization of the Helicobacter pylori cytidine 5'-monophosphate-pseudaminic acid synthase PseF: molecular insight into substrate recognition and catalysis mechanism
Wahid, Advances and applications in bioinformatics and chemistry : AABC 2017 - “...acid capsule expression protein (KpsF), 50S ribosomal protein L34 (RpmH) and three hypothetical proteins (HP0465; HP0114, HP1570). Conclusion The present study presents physicochemical properties, structural and functional analysis and crucial residues of substrate recognition and the catalytic mechanism of HpPseF derived by using a broad range...”
- The Helicobacter pylori J99 jhp0106 Gene, under the Control of the CsrA/RpoN Regulatory System, Modulates Flagella Formation and Motility
Kao, Frontiers in microbiology 2017 - “...*** /2.95 jhp1296 b Type II restriction endonuclease 2.56 ** /1.27 CHEMOTAXIS AND MOTILITY jhp0106 HP0114 Unclear 3.70 ** /4.37 jhp0107 ( flaB ) HP0115 Flagellin B 3.99 *** /3.04 jhp0280 ( flgL ) HP0295 Flagellar hook-associated protein 3 (HAP3) 3.66 ** /4.20 jhp0349 HP1076 Cochaperone...”
- The HP0256 gene product is involved in motility and cell envelope architecture of Helicobacter pylori
Douillard, BMC microbiology 2010 - “...) 1.445 0.239 HP1585 flagellar basal-body rod protein ( flgG ) 0.590 0.019 Class II HP0114 hypothetical protein 1.230 0.357 HP0115 flagellin B ( flaB ) 1.906 0.032 HP0295 flagellin B homolog ( fla ) 1.734 0.179 HP0869 hydrogenase expression/formation protein ( hypA ) 1.307 0.109...”
- Effect of FliK mutation on the transcriptional activity of the {sigma}54 sigma factor RpoN in Helicobacter pylori
Douillard, Microbiology (Reading, England) 2009 - “...described in the manufacturers manual. Primer pairs were designed to amplify the intergenic region between hp0114 and hp0115 and an internal region of the hp0115 gene ( Supplementary Table S1 ). Next, the two regions were amplified by PCR using cDNA preparations. Bioinformatics analysis Predictions of...”
- “...class II genes in the flagellar regulon ( Table 3 ), with only three exceptions. HP0114, part of the RpoN regulon and located downstream of flaB /HP0115, was not upregulated compared with other RpoN-dependent genes in the fliK mutant ( Fig. 3 , Table 3 )....”
- The 3'-to-5' exoribonuclease (encoded by HP1248) of Helicobacter pylori regulates motility and apoptosis-inducing genes
Tsao, Journal of bacteriology 2009 - “...TABLE 1. HP1248-repressed genesa Genome organizationb HP0031 HP0114 HP0115 HP0130 HP0175 HP0176 HP0194 HP0231 HP0390 HP0486 HP0547 HP0631 HP0653 HP0671 HP0682...”
- The pH-responsive regulon of HP0244 (FlgS), the cytoplasmic histidine kinase of Helicobacter pylori
Wen, Journal of bacteriology 2009 - “...HP0295 [fla], HP0870 [flgE], HP0869 [hypA], HP1120, HP1233, HP0114, and HP0906 genes) that are class 2 flagellar genes (middle flagellar structural genes) and...”
- “...region HP1233 H. pylori predicted coding region HP0114 H. pylori predicted coding region HP0906 Hydantoin utilization protein A (hyuA) N-Methylhydantoinase H....”
- An Aeromonas caviae genomic island is required for both O-antigen lipopolysaccharide biosynthesis and flagellin glycosylation
Tabei, Journal of bacteriology 2009 - “...loci of a number of bacteria, including H. pylori (HP0114), C. jejuni (Cj1318), A. hydrophila AH-3, and A. hydrophila ATCC 7966T (4, 18, 37, 42). Mutation of...”
- More
WP_001028953 motility associated factor glycosyltransferase family protein from Helicobacter pylori
jhp0106 putative from Helicobacter pylori J99
Aligns to 205:378 / 627 (27.8%), covers 99.4% of PF01973, 140.6 bits
- The Helicobacter pylori J99 jhp0106 Gene, under the Control of the CsrA/RpoN Regulatory System, Modulates Flagella Formation and Motility
Kao, Frontiers in microbiology 2017 - “...model of Jhp0106 protein Complete amino acid sequence of H. pylori J99 Jhp0106 (Accession number: WP_001028953 ) was downloaded from NCBI database ( http://www.ncbi.nlm.nih.gov/protein/ ). A three-dimensional structural modeling was carried out on the SWISS-MODEL Workspace server ( http://swissmodel.expasy.org/ ) (Arnold et al., 2006 ). The...”
- Untargeted Microbial Exometabolomics and Metabolomics Analysis of Helicobacter pylori J99 and jhp0106 Mutant
Kao, Metabolites 2021 - “...34940566 10.3390/metabo11120808 metabolites-11-00808 Article Untargeted Microbial Exometabolomics and Metabolomics Analysis of Helicobacter pylori J99 and jhp0106 Mutant https://orcid.org/0000-0001-8782-3912 Kao Cheng-Yen 1 Kuo Pei-Yun 1 https://orcid.org/0000-0003-1760-9536 Liao Hsiao-Wei 2 * Jang Cholsoon Academic Editor 1 Institute of Microbiology and Immunology, School of Life Science, National Yang Ming...”
- “...opportunity to comprehensively explore metabolites of interest. Herein, we investigated the metabolic pathways associated with Jhp0106, a glycosyltransferase enzyme in Helicobacter pylori . Through untargeted exometabolomic and metabolomic profiling, we identified 9 and 10 features with significant differences in the culture media and pellets of the...”
- Glycosyltransferase Jhp0106 (PseE) contributes to flagellin maturation in Helicobacter pylori
Yang, Helicobacter 2021 - “...John Wiley and Sons Inc. Hoboken 7988653 33586844 10.1111/hel.12787 HEL12787 Original Article Original Articles Glycosyltransferase Jhp0106 (PseE) contributes to flagellin maturation in Helicobacter pylori YANG et al. Yang KaiYuan 1 Kao ChengYen 1 2 Su Marcia ShuWei 2 Wang Shuying 3 Chen YuehLin 2 Hu ShiauTing...”
- “...remains poorly understood. Therefore, the aim of this study is to characterize a putative glycosyltransferase jhp0106 in flagellar formation. Materials and Methods Western blotting and chemical deglycosylation were performed to examine FlaA glycosylation. Protein structural analyses were executed to identify the active site residues of Jhp0106,...”
- The Helicobacter pylori J99 jhp0106 Gene, under the Control of the CsrA/RpoN Regulatory System, Modulates Flagella Formation and Motility
Kao, Frontiers in microbiology 2017 - “...in Microbiology 1664-302X Frontiers Media S.A. 5368276 10.3389/fmicb.2017.00483 Microbiology Original Research The Helicobacter pylori J99 jhp0106 Gene, under the Control of the CsrA/RpoN Regulatory System, Modulates Flagella Formation and Motility Kao Cheng-Yen 1 Chen Jenn-Wei 2 3 Wang Shuying 2 3 Sheu Bor-Shyang 4 5 Wu...”
- “...csrA mutant were found to be differentially expressed compared with the wild-type. Among CsrA-regulated genes, jhp0106 , with unclear function, was found located downstream of flaB in the J99 genome. We hypothesized that flaB - jhp0106 is in an operon under the control of RpoN binding...”
Swol_0199 hypothetical protein from Syntrophomonas wolfei subsp. wolfei str. Goettingen
Aligns to 244:414 / 671 (25.5%), covers 98.8% of PF01973, 140.4 bits
HMU07160 hypothetical protein from Helicobacter mustelae 12198
Aligns to 206:379 / 629 (27.7%), covers 98.2% of PF01973, 137.6 bits
- The Helicobacter pylori J99 jhp0106 Gene, under the Control of the CsrA/RpoN Regulatory System, Modulates Flagella Formation and Motility
Kao, Frontiers in microbiology 2017 - “...2006 Caminibacter mediatlanticus CMTB2_07872 Unclear 631 41 Denitrovibrio acetiphilus Dacet_0453 Unclear 633 29 Helicobacter mustelae HMU07160 Unclear 629 62 Helicobacter pylori Jhp0106 Motility accessory factor 627 100 Schirm et al., 2003 Nautilia profundicola NAMH_1610 Motility accessory factor 643 44 Sulfurospirillum deleyianum Sdel_2228 Unclear 627 42 Syntrophomonas...”
- “...high similarity to Jhp0106, and the results are shown in Table 3 . Among them, HMU07160 (62%) showed the highest identity to Jhp0106, followed by WS2199 (55%), NAMH_1610 (44%), Sdel_2228 (42%), and CMTB2_07872 (41%) (Table 3 ). The phylogenic tree based on the homologous full-length sequence...”
SO3259, SO_3259 Flagellar glycosylation protein from Shewanella oneidensis MR-1
Aligns to 182:353 / 441 (39.0%), covers 99.4% of PF01973, 137.6 bits
- Analyzing the modification of the Shewanella oneidensis MR-1 flagellar filament
Bubendorfer, PloS one 2013 - “...be located 57 bp upstream of SO_3261 [34] . Accordingly, RT-PCR indicates that the gene SO_3259 (encoding a putative motility accessory factor, MAF) which located upstream is not co-transcribed with SO_3261-3265 ( Fig. S1 ). Similarly, also the small open reading frame SO_3260 (encoding a hypothetical...”
- “...[48] . Notably, the central region of PseE shares 29% identity and 44% similarity to SO_3259, annotated as motility accessory factor (MAF) and encoded by a gene which is located directly upstream of the smf operon, but likely not part of the operon. Similar homologies of...”
- Evidence-based annotation of gene function in Shewanella oneidensis MR-1 using genome-wide fitness profiling across 121 conditions
Deutschbauer, PLoS genetics 2011 - “...function for SO_3259-SO_3260, we analyzed homologs with experimental evidence in other species. We find that SO_3259 is similar to the flagellar modification genes pseD and pseE from Campylobacter jejuni , that are involved in decorating the flagellum with sugars and are required for full motility [40]...”
- Analysis of the lateral flagellar gene system of Aeromonas hydrophila AH-3
Canals, Journal of bacteriology 2006 - “...lfgKL of Vibrio parahaemolyticus flgL of Vibrio parahaemolyticus SO3259 of Shewanella oneidensis 44/65 65/77 63/78 65/78 51/69 41/60 57/73 50/68 50/71 42/61...”
- “...exhibited homology with proteins of Shewanella oneidensis (SO3259), Clostridium acetobutylicum (CAC2196), and Campylobacter jejuni (Cj1337) (36, 27, and 26%...”
- Polar flagellum biogenesis in Aeromonas hydrophila
Canals, Journal of bacteriology 2006 - “...protein of Shewanella oneidensis (GenBank no. SO3259), Clostridium acetobutylicum (CAC2196), and Campylobacter jejuni (Cj1337), a group of proteins...”
DPCES_3251 6-hydroxymethylpterin diphosphokinase MptE-like protein from Desulfitobacterium hafniense
Aligns to 197:372 / 606 (29.0%), covers 98.8% of PF01973, 136.7 bits
- Draft genome sequence and characterization of Desulfitobacterium hafniense PCE-S
Goris, Standards in genomic sciences 2015 - “...(DPCES_0024-6), and a protein annotated as cellulose synthase (DPCES_2599). A cluster encoding polysaccharide synthesis enzymes (DPCES_3251 to 3245) might be responsible for the biosynthesis of the slime sacculus of PCE-S. Five CRISPR regions with a length from 958 to 3415bp and 14 to 51 spacers were...”
LIC_12413 6-hydroxymethylpterin diphosphokinase MptE-like protein from Leptospira interrogans serovar Copenhageni str. Fiocruz L1-130
Aligns to 206:391 / 609 (30.5%), covers 94.7% of PF01973, 136.3 bits
TDE1457 conserved hypothetical protein from Treponema denticola ATCC 35405
Aligns to 194:369 / 507 (34.7%), covers 97.1% of PF01973, 125.1 bits
Shew185_2971 protein of unknown function DUF115 from Shewanella baltica OS185
Aligns to 181:353 / 435 (39.8%), covers 91.2% of PF01973, 123.1 bits
- Genomic Variations Underlying Speciation and Niche Specialization of Shewanella baltica
Deng, mSystems 2019 - “...9 Shew185_2889 Shew185_2902 Polysaccharide biosynthesis, aerobically upregulated by OS185 0.36 0.041 1/0, 7 14 10 Shew185_2971 Shew185_2982 Membrane biosynthesis- related genes 0.413 0.017 4/0, 33 12 11 Shew185_3236 Shew185_3273 CRISPR-associated proteins and phage components 0.426 0.071 13/2, 58 26 12 Shew185_3331 Shew185_3384 Iron complex transportation, galactose...”
- “...and GI-13, with the former containing genes involved in amino sugar and nucleotide sugar metabolism (Shew185_2971 to -2982) and the latter containing a number of sulfite reductases ( sir , Sbal195_3991 to -4002 in OS195 and Shew185_3866 to -3877 in OS185), all of which were upregulated...”
Sdel_2228 protein of unknown function DUF115 from Sulfurospirillum deleyianum DSM 6946
Aligns to 205:378 / 627 (27.8%), covers 98.8% of PF01973, 115.9 bits
- The Helicobacter pylori J99 jhp0106 Gene, under the Control of the CsrA/RpoN Regulatory System, Modulates Flagella Formation and Motility
Kao, Frontiers in microbiology 2017 - “...100 Schirm et al., 2003 Nautilia profundicola NAMH_1610 Motility accessory factor 643 44 Sulfurospirillum deleyianum Sdel_2228 Unclear 627 42 Syntrophomonas wolfei Swol_0199 Unclear 671 28 The genes close to jhp0106 in H. pylori J99 are shown in Figure 1A . jhp0106 was located immediately downstream of...”
- “...them, HMU07160 (62%) showed the highest identity to Jhp0106, followed by WS2199 (55%), NAMH_1610 (44%), Sdel_2228 (42%), and CMTB2_07872 (41%) (Table 3 ). The phylogenic tree based on the homologous full-length sequence of 16 proteins was also displayed in Figure S5 . Previous studies reported that...”
ASA_0374 hypothetical protein from Aeromonas salmonicida subsp. salmonicida A449
Aligns to 532:703 / 779 (22.1%), covers 98.2% of PF01973, 113.5 bits
ASA_2656 6-hydroxymethylpterin diphosphokinase MptE-like protein from Aeromonas salmonicida subsp. salmonicida A449
Aligns to 276:457 / 550 (33.1%), covers 88.3% of PF01973, 111.4 bits
- The genome of Aeromonas salmonicida subsp. salmonicida A449: insights into the evolution of a fish pathogen
Reith, BMC genomics 2008 - “...flagella are dispersed around the genome in multiple operons (ASA_1336 ASA_1360, ASA_1484 ASA_1499, ASA_1505 ASA_1507, ASA_2656 ASA_2662), but also include interrupted genes: flgL (ASA_1499), encoding a flagellar hook-associated protein, has a 5 bp duplication; flrA (ASA_1505), encoding a transcriptional activator, contains a 13 bp deletion; and,...”
AHA_1703 hypothetical protein from Aeromonas hydrophila subsp. hydrophila ATCC 7966
A0KIY8 Motility associated factor glycosyltransferase family protein from Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Aligns to 250:431 / 669 (27.2%), covers 84.8% of PF01973, 108.8 bits
amb0685 Uncharacterized protein from Magnetospirillum magneticum AMB-1
Aligns to 247:421 / 666 (26.3%), covers 91.8% of PF01973, 103.4 bits
PAB1706 hypothetical protein from Pyrococcus abyssi GE5
Aligns to 33:186 / 233 (66.1%), covers 95.3% of PF01973, 102.7 bits
TPESAMD_0174 6-hydroxymethylpterin diphosphokinase MptE-like protein from Treponema pallidum subsp. pertenue str. SamoaD
Aligns to 198:369 / 506 (34.0%), covers 95.3% of PF01973, 102.4 bits
- Whole genome sequences of three Treponema pallidum ssp. pertenue strains: yaws and syphilis treponemes differ in less than 0.2% of the genome sequence
Cejková, PLoS neglected tropical diseases 2012 - “...TP0127 TP0127 TPESAMD_0127a, TPESAMD_0127b 0 c TP0172, TP0173 TP0172_173 TPESAMD_0172 2 TP0174, TP0175, TP0176 TP0174_175_176 TPESAMD_0174 3 TP0284, TP0285 TP0284_285 TPESAMD_0284 2 TP0286, TP0287 TP0286_287 TPESAMD_0286 2 TP0288, TP0289 TP0288_289 TPESAMD_0288 2 TP0299, TP0300 TP0299_300 TPESAMD_0300 2 TP0314, TP0315 TP0314, TP0315 TPESAMD_0314 2 TP0324, TP0325 TP0324_325...”
jhp0417 putative from Helicobacter pylori J99
Aligns to 256:420 / 631 (26.1%), covers 95.9% of PF01973, 101.2 bits
- Sequential isolation of metabolites and lipids from a single sample to achieve multiomics by using TRIzol reagent
Kao, Talanta 2023 (PubMed)- “...examine metabolite and lipid alterations associated with the jhp0417 mutation in Helicobacter pylori by using the TRIzol sequential isolation protocol and MeOH...”
- “...layer and MeOH extraction methods with significant differences between the jhp0417 mutant and WT H. pylori . Fig. 4 Fig. 5 Comparison of (a) score plots and VIP...”
- The Helicobacter pylori J99 jhp0106 Gene, under the Control of the CsrA/RpoN Regulatory System, Modulates Flagella Formation and Motility
Kao, Frontiers in microbiology 2017 - “...with flagella structure proteins (FlaA, FlaB, FlaG, FlaL, FliD), pseudaminic acid synthase (NeuB), CagDelta protein (Jhp0417), hypothetical proteins (PdP, Jhp0578), and a septum formation inhibitor (MinC) (Figure S6 ). These results suggested that Jhp0106 functions as a glycosyltransferase and is involved in the transfer of pseudaminic...”
HP0465 conserved hypothetical protein from Helicobacter pylori 26695
Aligns to 256:420 / 631 (26.1%), covers 98.8% of PF01973, 100.3 bits
- Study of Helicobacter pylori Isolated from a High-Gastric-Cancer-Risk Population: Unveiling the Comprehensive Analysis of Virulence-Associated Genes including Secretion Systems, and Genome-Wide Association Study
Saruuljavkhlan, Cancers 2023 - “...of the total of nine synonymous SNPs were ascertained within genes encoding hypothetical proteins (HP0463, HP0465, and HP0502). A point of particular interest arises from the observation that certain SNPs manifest a presence in two established virulence factors: specifically, vapD , responsible for encoding a virulence-associated...”
- Proteome Data Improves Protein Function Prediction in the Interactome of Helicobacter pylori
Wuchty, Molecular & cellular proteomics : MCP 2018 - “...FlgB and homology comparisons of the operon member HP0465 with motility accessory factors of C. jejuni (56). Moreover, transposon insertion into the HP0466...”
- Structural and functional characterization of the Helicobacter pylori cytidine 5'-monophosphate-pseudaminic acid synthase PseF: molecular insight into substrate recognition and catalysis mechanism
Wahid, Advances and applications in bioinformatics and chemistry : AABC 2017 - “...polysialic acid capsule expression protein (KpsF), 50S ribosomal protein L34 (RpmH) and three hypothetical proteins (HP0465; HP0114, HP1570). Conclusion The present study presents physicochemical properties, structural and functional analysis and crucial residues of substrate recognition and the catalytic mechanism of HpPseF derived by using a broad...”
- Evolution in an oncogenic bacterial species with extreme genome plasticity: Helicobacter pylori East Asian genomes
Kawai, BMC microbiology 2011 - “...0.0118 2 [ 99 ] maf Maf family (motility accessory family of flagellin-associated proteins) homolog HP0465 0.0259 0.0214 2 [ 86 ] Hypothetical protein HP0097 0.0257 0.0207 2 Hypothetical protein HP1143 0.0254 0.0146 2 cvpA Membrane protein required for colicin V production and secretion mHP0181 0.0252...”
PH1244 hypothetical protein from Pyrococcus horikoshii OT3
Aligns to 66:220 / 266 (58.3%), covers 95.9% of PF01973, 96.0 bits
MPTE_PYRFU / Q8U2A9 6-hydroxymethyl-7,8-dihydropterin pyrophosphokinase; HPPK; 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine pyrophosphokinase; 6-hydroxymethyl-7,8-dihydropterin diphosphokinase; 6-HMPDK; 7,8-dihydro-6-hydroxymethylpterin diphosphokinase; 7,8-dihydro-6-hydroxymethylpterin pyrophosphokinase; PPPK; EC 2.7.6.3 from Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1) (see paper)
PF0930 hypothetical protein from Pyrococcus furiosus DSM 3638
Aligns to 33:186 / 231 (66.7%), covers 95.9% of PF01973, 95.4 bits
- function: Catalyzes the transfer of diphosphate from ATP to 6- hydroxymethyl-7,8-dihydropterin (6-HMD), leading to 6-hydroxymethyl- 7,8-dihydropterin diphosphate (6-HMDP). To a lesser extent, can also use CTP, UTP, and GTP as the nucleotide triphosphate substrate.
catalytic activity: 6-hydroxymethyl-7,8-dihydropterin + ATP = (7,8-dihydropterin- 6-yl)methyl diphosphate + AMP + H(+) (RHEA:11412)
cofactor: Mg(2+) - Comparative genomics guided discovery of two missing archaeal enzyme families involved in the biosynthesis of the pterin moiety of tetrahydromethanopterin and tetrahydrofolate
de, ACS chemical biology 2012 - “...extract not expressing the MJ0408 derived protein likewise did not show any activity. (D) Purified PF0930 derived protein was incubated with 6-HMD and ATP as described in the methods section. After incubation, the sample was oxidized with iodine to convert the dihydropterins to the fluorescent pterins...”
- “...MonoQ fraction of the purified enzyme produced from an E. coli extract not expressing the PF0930 derived protein likewise did not show any activity. Similar results were obtained with the MJ1634 protein. A biochemical validation strategy was then used to confirm the genetic results. mj 0408,...”
- Robust, high-throughput solution structural analyses by small angle X-ray scattering (SAXS)
Hura, Nature methods 2009 - “...or a homolog. Here, multimers in crystal lattices (PF0094 homolog PDB 1J08, PF0380 PDB 1VK1, PF0930 homolog PDB 1V7L, and PF1090 PDB 1SJ1) are used to identify a best fit to the SAXS data. Figure 3 SAXS provides accurate shape and assembly in solution for most...”
TP0175 T. pallidum predicted coding region TP0175 from Treponema pallidum subsp. pallidum str. Nichols
Aligns to 99:191 / 210 (44.3%), covers 46.2% of PF01973, 69.7 bits
- Whole genome sequences of three Treponema pallidum ssp. pertenue strains: yaws and syphilis treponemes differ in less than 0.2% of the genome sequence
Cejková, PLoS neglected tropical diseases 2012 - “...TPESAMD_0126 b 2 TP0127 TP0127 TPESAMD_0127a, TPESAMD_0127b 0 c TP0172, TP0173 TP0172_173 TPESAMD_0172 2 TP0174, TP0175, TP0176 TP0174_175_176 TPESAMD_0174 3 TP0284, TP0285 TP0284_285 TPESAMD_0284 2 TP0286, TP0287 TP0286_287 TPESAMD_0286 2 TP0288, TP0289 TP0288_289 TPESAMD_0288 2 TP0299, TP0300 TP0299_300 TPESAMD_0300 2 TP0314, TP0315 TP0314, TP0315 TPESAMD_0314 2...”
- Complete genome sequence of Treponema paraluiscuniculi, strain Cuniculi A: the loss of infectivity to humans is associated with genome decay
Šmajs, PloS one 2011 - “...were fused to one gene in the Cuniculi A genome (TP0006, TP0007, TP0008 and TP0174, TP0175, TP0176). Similar situation was also found in the genome of T. pallidum subspecies pertenue Samoa D where sequencing revealed fusion of 48 Nichols orthologs into 23 genes (data not shown)....”
TDE1458 conserved hypothetical protein from Treponema denticola ATCC 35405
Aligns to 140:320 / 509 (35.6%), covers 87.7% of PF01973, 53.4 bits
AF0878 conserved hypothetical protein from Archaeoglobus fulgidus DSM 4304
Aligns to 56:172 / 197 (59.4%), covers 68.4% of PF01973, 52.6 bits
slr2125 unknown protein from Synechocystis sp. PCC 6803
Aligns to 33:187 / 264 (58.7%), covers 91.8% of PF01973, 50.3 bits
- Ethylene causes transcriptomic changes in Synechocystis during phototaxis
Lacey, Plant direct 2018 - “...ssl0452 nblA1, nblA Phycobilisome degradation 2.55 4.8010 4 Chromosome sll1693 Methyltransferase 2.53 3.4710 6 Chromosome slr2125 Hypothetical protein 2.48 6.2810 6 Chromosome ssr2016 Required for ferredoxin:plastoquinone reductase 2.45 6.5810 3 Chromosome sll0218 Hypothetical protein 2.42 1.8810 3 Chromosome ssl3044 Ferredoxin 2.41 1.8910 6 Chromosome sll5042 Sulfotransferase...”
- “...gspG Type 4 pilinlike protein 2.09 1.0310 02 slr1457 chrA Chromate transporter 2.77 1.1710 03 slr2125 Methyltransferase 2.48 6.2810 06 slr2126 Hypothetical protein 3.20 4.9810 10 slr5053 Unknown protein 2.85 1.7510 04 slr5054 Glycosyltransferase 4.28 3.2210 12 slr5055 Mannosaminuronic acid transferase 2.30 2.2410 03 slr5056 Glycosyltransferase...”
TP0177 T. pallidum predicted coding region TP0177 from Treponema pallidum subsp. pallidum str. Nichols
Aligns to 132:265 / 436 (30.7%), covers 67.8% of PF01973, 38.4 bits
Or search for genetic data about PF01973 in the Fitness Browser
by Morgan Price,
Arkin group
Lawrence Berkeley National Laboratory