Family Search for PF02965 (Met_synt_B12)
April 2024: See Interactive Tools for Functional Annotation of Bacterial Genomes for advice on using these tools.
PF02965 hits 106 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.
R1CGJ7 Methionine synthase from Emiliania huxleyi
2 alignments in 336:1118 / 1138 (43.3%), covering up to 95.2% of PF02965, 646.7 bits
- How haptophytes microalgae mitigate vitamin B12 limitation.
Nef, Scientific reports 2019 - “...with following entries (Uniprot): Chlamydomonas reinhardtii METH (A8HYR2) and METE (A8JH37), E . huxleyi METH (R1CGJ7), MAT from Escherichia coli (P0A817) and Arabidopsis thaliana (Q9SJL8), Homo sapiens and A . thaliana SAHH (P23526; O23255), Rattus norvegicus CBLA (D3ZNY3), Homo sapiens CBLB (Q96EY8) and MMCM (P22033), Propionibacterium...”
3bulA / P13009 E. Coli i690c/g743c meth c-terminal fragment (649-1227) (see paper)
Aligns to 287:558 / 577 (47.1%), covers 99.6% of PF02965, 437.4 bits
- Ligand: cobalamin (3bulA)
c4976 5-methyltetrahydrofolate--homocysteine methyltransferase from Escherichia coli CFT073
Aligns to 937:1208 / 1227 (22.2%), covers 99.6% of PF02965, 435.9 bits
MetH / b4019 cobalamin-dependent methionine synthase (EC 2.1.1.13) from Escherichia coli K-12 substr. MG1655 (see 60 papers)
metH / P13009 cobalamin-dependent methionine synthase (EC 2.1.1.13) from Escherichia coli (strain K12) (see 58 papers)
METH_ECOLI / P13009 Methionine synthase; 5-methyltetrahydrofolate--homocysteine methyltransferase; Methionine synthase, vitamin-B12-dependent; MS; EC 2.1.1.13 from Escherichia coli (strain K12) (see 4 papers)
metH methionine synthase; EC 2.1.1.13 from Escherichia coli K12 (see 15 papers)
b4019 B12-dependent methionine synthase from Escherichia coli str. K-12 substr. MG1655
NP_418443 cobalamin-dependent methionine synthase from Escherichia coli str. K-12 substr. MG1655
Aligns to 937:1208 / 1227 (22.2%), covers 99.6% of PF02965, 435.3 bits
- function: Catalyzes the transfer of a methyl group from methyl- cobalamin to homocysteine, yielding enzyme-bound cob(I)alamin and methionine. Subsequently, remethylates the cofactor using methyltetrahydrofolate.
catalytic activity: (6S)-5-methyl-5,6,7,8-tetrahydrofolate + L-homocysteine = (6S)-5,6,7,8-tetrahydrofolate + L-methionine (RHEA:11172)
cofactor: methylcob(III)alamin
cofactor: Zn(2+) (Binds 1 zinc ion per subunit.) - Methylfolate Trap Promotes Bacterial Thymineless Death by Sulfa Drugs
Guzzo, PLoS pathogens 2016 - “..., b1710 , and b1709 , respectively) triple mutant remained SULFA resistant, whereas metH ( b4019 ), btuB ( b3966 ), and a btuB CED quadruple mutant all became hypersusceptible ( Fig 4A , Table 1 ). In serial dilution-spot tests using 125 g/ml SMZ, these...”
- Gap-filling analysis of the iJO1366 Escherichia coli metabolic network reconstruction for discovery of metabolic functions
Orth, BMC systems biology 2012 - “...(b3708) or malY (b1622) aroE (b3281) ydiB (b1692) ilvA (b3772) tdcB (b3117) metE (b3829) metH (b4019) ubiB (b3835) alternate reaction: OPHHX3 glnA (b3870) ycjK (b1297) metL (b3940) thrL (b0002) or malY (b1622) ppa (b4226) ppx (b2502) or surE (b2744) serB (b4388) alternate reaction: GHMT2r Table 4...”
- Genome-scale gene/reaction essentiality and synthetic lethality analysis
Suthers, Molecular systems biology 2009 - “...YadF (b0126) Disjoint pair Hashimoto and Kato (2003) High CO 2 concentration metE (b3829), metH (b4019) Disjoint pair Ahmed (1973) and Urbanowski et al (1987) Methionine cysK (b2414), cysM (b2421) Disjoint pair Saito et al (1993) Cysteine argF (b0273), argI (b4254) Disjoint pair Lee and Cho...”
- “...Cannot complement folA (b0048); Hypothesis Suppress cynT (b0339) Cannot complement yadF (b0126); Hypothesis Suppress metH (b4019) Cannot complement metE (b3829); Hypothesis Change HSDy GPR a relationship from OR to AND thrA (b0002) and metL (b3940) cannot complement each other; both essential; Hypothesis Suppress puuA (b1297) cannot...”
- A disulfide-stabilized conformer of methionine synthase reveals an unexpected role for the histidine ligand of the cobalamin cofactor.
Datta, Proceedings of the National Academy of Sciences of the United States of America 2008 - GeneRIF: describe an x-ray structure of the mutant fragment in the reactivation conformation
- Cloning and sequence analysis of the Escherichia coli metH gene encoding cobalamin-dependent methionine synthase and isolation of a tryptic fragment containing the cobalamin-binding domain.
Banerjee, The Journal of biological chemistry 1989 (PubMed)- GeneRIF: N-terminus verified by Edman degradation on mature peptide
- Antimalarial target vulnerability of the putative Plasmodium falciparum methionine synthase
Leela, PeerJ 2024 - “...the cobalamin-dependent methionine synthase (MS) enzymes from human (MTR, Q99707-1) and Escherichia coli K12 (metH, P13009), together with Plasmodium spp. candidate MS from orthologous group 1324at5820 encoded by P.falciparum PF3D7_1233700 (Pf, Q8I585), P.knowlesi PKH_145080 (Pk, A0A384KWI2), P.malariae PmUG01_14067900 (Pm, A0A1A8X239), P. ovale wallikeri PowCR01_140053700 (Pow, A0A1C3L5P3),...”
- “...the cobalamin-dependent methionine synthase (MS) enzymes from human (MTR, Q99707-1) and Escherichia coli K12 (metH, P13009), together with Plasmodium candidate MS from orthologous group 1324at5820 encoded by P. falciparum PF3D7_1233700 (Pf, Q8I585), P. knowlesi PKH_145080 (Pk, A0A384KWI2), P. malariae PmUG01_14067900 (Pm, A0A1A8X239), P. ovale wallikeri PowCR01_140053700...”
- Proteomic analyses revealed the antibacterial mechanism of Aronia melanocarpa isolated anthocyanins against Escherichia coli O157: H7
Deng, Current research in food science 2022 - “...related to energy metabolism (P00363), two proteins related to amino acid biosynthesis and metabolism (P00370, P13009), and one protein related to lipid metabolism and transport (P76506). In the MRM experiments, the protein was quantified using peptide segments to draw a box-plot. Fig. 9 shows the box-plot...”
- “...Down P00370 gdhA NADP-specific glutamate dehydrogenase Up Q9S5G5 hisB Histidine biosynthesis bifunctional protein HisB Down P13009 metH Methionine synthase Up P06988 hisD Histidinol dehydrogenase Up B1LRA3 msrA Peptide methionine sulfoxide reductase MsrA Up P0AD97 livJ Leu/Ile/Val-binding protein Up Lipid metabolism and transport P0AEK5 fabI Enoyl-[acyl-carrier-protein] reductase...”
- Study on the Mechanism of the Danggui-Chuanxiong Herb Pair on Treating Thrombus through Network Pharmacology and Zebrafish Models.
Zhang, ACS omega 2021 - “...T54 72kDa type IV collagenase P08253 MMP2 T55 matrix metalloproteinase-9 P14780 MMP9 T56 methionine synthase P13009 MTR T57 NADH dehydrogenase [ubiquinone] 1 subcomplex subunit 4-like2 Q9NRX3 NDUFA4L2 T58 acyl carrier protein, mitochondrial O14561 NDUFAB1 T59 nuclear factor erythroid 2-related factor2 Q14494 NFE2L2 T60 nuclear factor NF-kappa-B...”
- Genome-wide identification and transcriptional analysis of folate metabolism-related genes in maize kernels.
Lian, BMC plant biology 2015 - “...(Q2QLY5), METE2 ORYSJ (Q2QLY4), MS1 ARATH (O50008), MS2 ARATH (Q9SRV5), MS3 ARATH (Q0WNZ5), METH ECOLI (P13009), METE YEAST (P05694), METH HUMAN (Q99707), METH RAT (Q9Z2Q4), METH MOUSE (A6H5Y3); FPGS-1 SORBI (C5WWE5), FPGS-2 SORBI (C5WMM8), FPGS-1 SETIT (K4A7H2), FPGS-2 SEITI (K4A839), FPGS-1 ORYSJ (Q337F3), FPGS-2 ORYSJ (Q10SU1),...”
- Uncovering the human methyltransferasome
Petrossian, Molecular & cellular proteomics : MCP 2011 - “...the N-terminal sequence of MetH (UniProtKB accession number P13009 (residues 2-325)) using the PSI-BLAST parameter. These proteins were confirmed by the HHpred...”
- “...of the C terminus of MetH (UniProtKB accession number P13009 (residues 897-1227)) was used to build its superfamily profile through PSI-BLAST and scan the human...”
- The Escherichia coli proteome: past, present, and future prospects
Han, Microbiology and molecular biology reviews : MMBR 2006 - “...P00959 Methionyl-tRNA synthetase 5.56/76,123.54 MetH P13009 Methionine synthase 4.97/135,865.85 4.96/134,153 MetK P0A817 S-Adenosylmethionine synthetase...”
- Synthesis of autoinducer 2 by the lyme disease spirochete, Borrelia burgdorferi
Babb, Journal of bacteriology 2005 - “...accession numbers M87625, AAK45422, X92082, AF082893, P13009, AAN51667, CAE07753, AAC73364, and U50929, respectively). Each BORRELIA BURGDORFERI AI-2 3082...”
- Cobalamin-independent methionine synthase (MetE): a face-to-face double barrel that evolved by gene duplication
Pejchal, PLoS biology 2005 - “...(SwissProt P25665), S. cerevisiae MetE (SwissProt P05694), T. maritima MetE/TM1286 (SwissProt Q9X112), and MetH (SwissProt P13009). This research was supported by grants from the National Institutes of Health (NIH) GM16429 (to MLL) and the Michigan NIH Molecular Biophysics Training Grant GM08270 (to RP). The authors would...”
- More
ECs4937 B12-dependent homocysteine-N5-methyltetrahydrofolate transmethylase from Escherichia coli O157:H7 str. Sakai
Aligns to 937:1208 / 1227 (22.2%), covers 99.6% of PF02965, 435.3 bits
MPHLCCUG_RS15920 methionine synthase from Mycolicibacterium phlei
Aligns to 966:1238 / 1258 (21.7%), covers 100.0% of PF02965, 431.9 bits
- Cobalamin is present in cells of non-tuberculous mycobacteria, but not in Mycobacterium tuberculosis
Minias, Scientific reports 2021 - “...hemY ChlI component of cobalt chelatase SAMEA4434518_01694 Vitamin B12 dependent enzymes metH 5-Methyltetrahydrofolatehomocysteine methyltransferase CDN37_RS02225 MPHLCCUG_RS15920 A5717_31970 SAMEA4434518_01721 MXEN_01507 AWC27_RS09650 MSMEG_0093 mutB Methylmalonyl-CoA mutase SAMEA4434518_02142 MSMEG_3159 nrdZ Ribonucleotide reductase of class II MKAN_19005 MXEN_17528 We used RNA-Seq data available at ENA Database to estimate gene expression...”
S3645 B12-dependent homocysteine-N5-methyltetrahydrofolate transmethylase from Shigella flexneri 2a str. 2457T
Aligns to 937:1208 / 1227 (22.2%), covers 99.6% of PF02965, 431.2 bits
STM14_5035 methionine synthase from Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S
Aligns to 937:1208 / 1227 (22.2%), covers 99.6% of PF02965, 430.4 bits
JHW33_RS14885 methionine synthase from Rahnella aceris
Aligns to 943:1214 / 1233 (22.1%), covers 99.6% of PF02965, 430.4 bits
STY4405 B12-dependent homocysteine-N5-methyltetrahydrofolate transmethylase from Salmonella enterica subsp. enterica serovar Typhi str. CT18
Aligns to 937:1208 / 1227 (22.2%), covers 99.6% of PF02965, 430.3 bits
LIC20085 methionine synthase from Leptospira interrogans serovar Copenhageni str. Fiocruz L1-130
LB108 B12-dependent methionine synthase from Leptospira interrogans serovar lai str. 56601
LB_108 methionine synthase from Leptospira interrogans serovar Lai str. 56601
Aligns to 949:1222 / 1247 (22.0%), covers 99.6% of PF02965, 429.7 bits
- Response of Leptospira interrogans to physiologic osmolarity: relevance in signaling the environment-to-host transition
Matsunaga, Infection and immunity 2007 - “...LIC13430 LIC20149 LIC20079 LIC12233 LIC12331 LIC13353 LIC20085 LIC13321 LIC13194 LIC13202 LIC20132 LIC20171 LIC13208 LIC20041 LIC11143 LIC12322 LIC12323...”
- Response of Leptospira interrogans to physiologic osmolarity: relevance in signaling the environment-to-host transition
Matsunaga, Infection and immunity 2007 - “...LA4275 LA1101 LA4286 LB187 LB102 LA1532 LA1416 LA4200 LB108 LA4164 LA3998 LA4009 LB162 LB215 LA4019 LB055 LA2915 LA1424 LA1423 LB274 LA1430 LA4139 LA0932 LA1161...”
- Synthesis of autoinducer 2 by the lyme disease spirochete, Borrelia burgdorferi
Babb, Journal of bacteriology 2005 - “...salvage enzyme, the ortholog of MetH encoded by ORF LB108. Next, plasmid libraries of B. burgdorferi DNA were used in attempts to complement an E. coli metE...”
- The sigma factor σ54 is required for the long-term survival of Leptospira biflexa in water
Zhang, Molecular microbiology 2018 - “...LEPBI_I2431 2.54 - Hypothetical protein No hit No hit LEPBI_II0183 2.54 COG1410E B12-dependent methionine synthase LB_108 LBL_4107 LEPBI_I3034 2.45 COG3329R Putative permease; putative membrane protein LA_4270 LBL_0122 LEPBI_I2424 2.42 COG1136V ABC-type transport system, ATP binding protein LA_0274, LA_2982, LA_3713 LBL_0572, LBL_0299, LBL_2006, LBL_2140 LEPBI_I3255 2.32 COG0300R...”
M0M57_09420 methionine synthase from Flavobacterium azooxidireducens
Aligns to 607:879 / 895 (30.5%), covers 99.6% of PF02965, 429.5 bits
MSMEG_4185 methionine synthase from Mycolicibacterium smegmatis MC2 155
MSMEG_4185 methionine synthase from Mycobacterium smegmatis str. MC2 155
Aligns to 954:1226 / 1246 (21.9%), covers 100.0% of PF02965, 429.3 bits
- The Benefits of Toxicity: M. smegmatis VapBC TA Module Is Induced by Tetracycline Exposure and Promotes Survival
Zamakhaev, Microorganisms 2023 - “...the decrease amidst synthase enzymes, such as tryptophan synthase MSMEG_3220, asparagine synthase MSMEG_2594, methionine synthase MSMEG_4185, carbamoyl phosphate synthase MSMEG_3047, etc. (nine enzymes overall). However, the abundance ratio of glutamine synthetase MSMEG_4290 was 94-fold higher when compared to the control. Moreover, three enzymes of amino acid...”
- De Novo Cobalamin Biosynthesis, Transport, and Assimilation and Cobalamin-Mediated Regulation of Methionine Biosynthesis in Mycobacterium smegmatis
Kipkorir, Journal of bacteriology 2021 - “...Ethanolamine ammonia-lyase, large subunit AdoCbl Isomerization MSMEG_1554 ( eutC ) Ethanolamine ammonia-lyase, light chain AdoCbl MSMEG_4185 ( metH ) Methionine synthase MeCbl Methyl transfer a Annotation is from reference 63 . We postulated that metE would similarly be subject to riboswitch-mediated repression in M. smegmatis ,...”
- “...deleted 120-bp cobK allele. To generate an in-frame, unmarked deletion in M. smegmatis metH ( MSMEG_4185 ), a 1,524-bp amplicon (FR1) of the 5 coding sequence of metH and another 1,480-bp amplicon (FR2) containing 354bp of the 3 end of metH were joined in a three-way...”
- Methylfolate Trap Promotes Bacterial Thymineless Death by Sulfa Drugs
Guzzo, PLoS pathogens 2016 - “...in this subgroup had Himar1 insertions at three different TA dinucleotides within the same gene, msmeg_4185 (2xTA 499-500 , 1xTA 2881-2882 , and 1xTA 3091-3092 , S1 Fig ), which encodes a homolog of B 12 -dependent methionine synthase. Two other mutants had insertions at TA...”
- “...the intrinsic SULFA resistance, and 5-CH 3 -H 4 PteGlu n metabolism, the encoding genes, msmeg_4185 and msmeg_3873 , respectively, were individually deleted by homologous recombination [ 34 ]. Similar to the transposon mutants, the targeted null mutants, Ms metH and Ms cobIJ , displayed increased...”
AWC27_RS09650 methionine synthase from Mycobacterium szulgai
Aligns to 952:1224 / 1244 (21.9%), covers 100.0% of PF02965, 428.6 bits
- Cobalamin is present in cells of non-tuberculous mycobacteria, but not in Mycobacterium tuberculosis
Minias, Scientific reports 2021 - “...cobalt chelatase SAMEA4434518_01694 Vitamin B12 dependent enzymes metH 5-Methyltetrahydrofolatehomocysteine methyltransferase CDN37_RS02225 MPHLCCUG_RS15920 A5717_31970 SAMEA4434518_01721 MXEN_01507 AWC27_RS09650 MSMEG_0093 mutB Methylmalonyl-CoA mutase SAMEA4434518_02142 MSMEG_3159 nrdZ Ribonucleotide reductase of class II MKAN_19005 MXEN_17528 We used RNA-Seq data available at ENA Database to estimate gene expression through transcripts per million...”
A5717_31970 methionine synthase from Mycolicibacterium porcinum
Aligns to 953:1225 / 1245 (21.9%), covers 100.0% of PF02965, 428.4 bits
- Cobalamin is present in cells of non-tuberculous mycobacteria, but not in Mycobacterium tuberculosis
Minias, Scientific reports 2021 - “...ChlI component of cobalt chelatase SAMEA4434518_01694 Vitamin B12 dependent enzymes metH 5-Methyltetrahydrofolatehomocysteine methyltransferase CDN37_RS02225 MPHLCCUG_RS15920 A5717_31970 SAMEA4434518_01721 MXEN_01507 AWC27_RS09650 MSMEG_0093 mutB Methylmalonyl-CoA mutase SAMEA4434518_02142 MSMEG_3159 nrdZ Ribonucleotide reductase of class II MKAN_19005 MXEN_17528 We used RNA-Seq data available at ENA Database to estimate gene expression through...”
MCNS_30990 methionine synthase from Mycobacterium conspicuum
Aligns to 962:1234 / 1254 (21.8%), covers 100.0% of PF02965, 428.0 bits
- Cobalamin is present in cells of non-tuberculous mycobacteria, but not in Mycobacterium tuberculosis
Minias, Scientific reports 2021 - “...of cobalt chelatase Rv2850c MAB_2985c MCNS_17540 Vitamin B12 dependent enzymes metH 5-Methyltetrahydrofolatehomocysteine methyltransferase Rv2124c MAB_2129 MCNS_30990 AWC07_11205 H0P51_RS04340 EET03_RS15385 mutB Methylmalonyl-CoA mutase Rv1493 MAB_2711c MCNS_22010 nrdZ Ribonucleotide reductase of class II Rv0570 AWC07_08365 Species M. kansasii M. persicum M. phlei M. porcinum M. terrae M. xenopi...”
SO1030 5-methyltetrahydrofolate--homocysteine methyltransferase from Shewanella oneidensis MR-1
Aligns to 953:1225 / 1244 (21.9%), covers 99.6% of PF02965, 427.8 bits
LBL_4107 Methionine synthase from Leptospira borgpetersenii serovar Hardjo-bovis L550
Aligns to 949:1222 / 1247 (22.0%), covers 99.3% of PF02965, 426.9 bits
- The sigma factor σ54 is required for the long-term survival of Leptospira biflexa in water
Zhang, Molecular microbiology 2018 - “...2.54 - Hypothetical protein No hit No hit LEPBI_II0183 2.54 COG1410E B12-dependent methionine synthase LB_108 LBL_4107 LEPBI_I3034 2.45 COG3329R Putative permease; putative membrane protein LA_4270 LBL_0122 LEPBI_I2424 2.42 COG1136V ABC-type transport system, ATP binding protein LA_0274, LA_2982, LA_3713 LBL_0572, LBL_0299, LBL_2006, LBL_2140 LEPBI_I3255 2.32 COG0300R SDR...”
MDG893_RS02235 methionine synthase from Marinobacter algicola DG893
Aligns to 943:1215 / 1235 (22.1%), covers 100.0% of PF02965, 426.2 bits
MMAR_4825 5-methyltetrahydrofolate--homocysteine methyltransferase, MetH from Mycobacterium marinum M
Aligns to 952:1224 / 1244 (21.9%), covers 100.0% of PF02965, 424.5 bits
GQR50_20625 methionine synthase from Aeromonas hydrophila
Aligns to 941:1212 / 1227 (22.2%), covers 99.6% of PF02965, 423.6 bits
BAB1_0188 Dihydropteroate synthase, DHPS:Homocysteine S-methyltransferase:Cobalamin-dependent methionine synthase, B12-binding:Vitamin ... from Brucella melitensis biovar Abortus 2308
Aligns to 963:1235 / 1261 (21.6%), covers 99.6% of PF02965, 422.8 bits
- Brucella Periplasmic Protein EipB Is a Molecular Determinant of Cell Envelope Integrity and Virulence
Herrou, Journal of bacteriology 2019 - “...and the metabolic genes encoding methionine synthase (bab1_0188) and homoserine dehydrogenase (bab1_1293). (B) Growth on SBA plates containing 2 g/ml of...”
- “...lovHK (bab2_0652) (30), bab1_1293 (homoserine dehydrogenase), and bab1_0188 (methionine synthase) had fewer Tn insertions in the eipB background relative to the...”
- The RNA chaperone Hfq independently coordinates expression of the VirB type IV secretion system and the LuxR-type regulator BabR in Brucella abortus 2308
Caswell, Journal of bacteriology 2012 - “...include metH (B12-dependent methionine synthase; BAB1_0188), hyp (hypothetical protein; BAB1_0189), babR (LuxR-type transcriptional regulator; BAB1_0190), and...”
- “...region are metH (B12dependent methionine synthase; BAB1_0188), hyp (hypothetical protein; BAB1_0189), babR (LuxR-type transcriptional regulator; BAB1_0190), and...”
- Genome sequence of Brucella abortus vaccine strain S19 compared to virulent strains yields candidate virulence genes
Crasta, PloS one 2008 - “...cysK 42 10 BAB1_1968 7 7 1 Cysteine synthase 97 9 BR0188 metH 42 10 BAB1_0188 1 1 methionine synthase 110 6 BRA1146 fliF 30 3 BAB2_1105 1 1 flagellar M-ring protein FliF 120 8 BR0181 cysI 42 8 BAB1_0181 1 2 1 Hypothetical protein 128...”
BMEI1759 5-METHYLTETRAHYDROFOLATE--HOMOCYSTEINE METHYLTRANSFERASE from Brucella melitensis 16M
Aligns to 963:1235 / 1261 (21.6%), covers 99.6% of PF02965, 422.7 bits
- Transcriptomic Analysis of the Brucella melitensis Rev.1 Vaccine Strain in an Acidic Environment: Insights Into Virulence Attenuation
Salmon-Divon, Frontiers in microbiology 2019 - “...Downregulation BMEI0624 Ketol-acid reductoisomerase Downregulation BMEI0626 PLP-dependent aminotransferase family protein Upregulation BMEI0796 Hypothetical protein Downregulation BMEI1759 Methionine synthase Downregulation BMEI1837 DUF3131 domain-containing protein Downregulation BMEII0056 Magnesium-translocating P-type ATPase Upregulation BMEII0077 Isochorismate synthase Upregulation BMEII0361 Sugar ABC transporter ATP-binding protein Upregulation BMEII0591 Sugar ABC transporter permease Upregulation...”
- “...and degradation ( Eschenbrenner et al., 2002 ). Second, Rev.1 showed a downregulated expression of BMEI1759 ( Table 3 ), which encodes for the vitamin B12-dependent methyltransferase, MetH ( Lestrate et al., 2000 ). As MetH is involved in methionine biosynthesis, its downregulation in Rev.1 may...”
- Genomic analysis of the original Elberg Brucella melitensis Rev.1 vaccine strain reveals insights into virulence attenuation
Salmon-Divon, Virulence 2018 - “...genes involved in amino acid metabolism (Supplementary Table S5). Notably, we found that the ORF BMEI1759 possesses a missense mutation (c.523G>C) in the Rev.1 genome. This ORF encodes the vitamin B12-dependent methyltransferase MetH, which is involved in methionine biosynthesis and was previously screened in a murine...”
- Main functions and taxonomic distribution of virulence genes in Brucella melitensis 16 M
Brambila-Tapia, PloS one 2014 - “...dipeptide transport protein, partial E 171 [7] BMEI0933 cysK Cysteine synthase A E 212 [17] BMEI1759 metH B12-dependent methionine synthase E 510 [17] BMEII0040 gltB Glutamate synthase [NADPH] large chain E 566 [8] BMEII0136 pheB Homoprotocatechuate 2,3-dioxygenase E 81 [7] BMEII0626 BMEII0626 Membrane dipeptidase E 269...”
- Differential expression of iron acquisition genes by Brucella melitensis and Brucella canis during macrophage infection
Eskra, PloS one 2012 - “...BMEI1757 BCAN_A0196 aminotransferase - NC 2.96 BMEI1758 BCAN_A0195 ttranscriptional activator, LuxR family - 2.36 NC BMEI1759 BCAN_A0193 B12-dependent methionine synthase metH NC 2.17 BMEI1760 BCAN_A0192 hypothetical protein BMEI1760 - NC 2.17 BMEI1764 BCAN_A0188 oxidoreductase - NC 56.25 BMEI1765 BCAN_A0187 phosphoadenosine phosphosulfate reductase cysH NC 45.65 BMEI1766...”
- Analyses of Brucella pathogenesis, host immunity, and vaccine targets using systems biology and bioinformatics
He, Frontiers in cellular and infection microbiology 2012 - “...BMEI0451 Macrophages 12438693 20 leuC BMEI0157 Macrophages 12438693 21 lysA BMEI0084 Macrophages 12438693 22 metH BMEI1759 Mice, macrophages, HeLa 14979322 23 nifS BMEI1043 Macrophages 14979322 24 pheB BMEII0136 Mice 14979322 25 serB BMEI0615 Macrophages 12438693 26 thrA BMEI0725 Macrophages 14979322 27 thrC BMEI1450 Macrophages 14979322 F:...”
Achr_18530 methionine synthase from Azotobacter chroococcum NCIMB 8003
Aligns to 941:1212 / 1230 (22.1%), covers 100.0% of PF02965, 422.5 bits
- Azotobacter Genomes: The Genome of Azotobacter chroococcum NCIMB 8003 (ATCC 4412)
Robson, PloS one 2015 - “...2 -independent ribonucleoside reductase (discussed earlier: Achr_570; Avin_00800); met H for the B12-dependent methionine synthase (Achr_18530; Avin_29240); and eut BC for ethanolamine ammonia lyase (Achr_32230, 32220; Avin_09920, 09930). However, neither obviously requires B12 for growth because they also carry genes for B12-independent counterparts/pathways: an O 2...”
BR0188 5-methyltetrahydrofolate--homocysteine methyltransferase from Brucella suis 1330
Aligns to 963:1235 / 1261 (21.6%), covers 99.6% of PF02965, 422.4 bits
YPO3722 5-Methyltetrahydrofolate--homocysteine methyltransferase from Yersinia pestis CO92
y0020 B12-dependent homocysteine-N5-methyltetrahydrofolate transmethylase, repressor of metE and metF from Yersinia pestis KIM
Aligns to 941:1212 / 1231 (22.1%), covers 99.6% of PF02965, 422.4 bits
- Dynamics of CRISPR loci in microevolutionary process of Yersinia pestis strains
Barros, PloS one 2014 - “...Transcriptional Regulator 2516 AGGTGCAACAGGGACTTTAGGATAGAAAAGTCC fosfolipaseD pMT1 Plasmid Region 2517 ACTTAGGGACATTAGCTTGGGATGTGAAACAG YPO3682 Transcriptional Regulator 2518 GTGTGGGTTTCGACATCCAACAACTGCCAAAT YPO3722 Methyltransferase 2519 AAGCTAAAGGCCCGCCGTTTGTGGTGGTACCA pMT1 pMT1 Plasmid Region 2520 ATGTAGTTCCCGCTGGAACTTGTCCATCCATA YPO2108 Hypothetical Phage Protein 2521 CCTTTCCCAGTAGAGCTGAACCATCTTTATCA YPO2109 Hypothetical Phage Protein 2522 GTTTGCTACCATCACCGCCAGTAGTGTATCCC YPO1270 Protein ABC transporter 2523 CTTGACCCTCAAATTGAGTGTAAAGGGGTTTGG YPO2093 Phage Protein...”
- Characterization of phagosome trafficking and identification of PhoP-regulated genes important for survival of Yersinia pestis in macrophages
Grabenstein, Infection and immunity 2006 - “...in macrophagesc Annotatione Not applicable YPO3722, methionine synthase Hypothetical protein YPO0256, two-component sensor, spiR/ssrA Defectived Defective...”
- Characterization of phagosome trafficking and identification of PhoP-regulated genes important for survival of Yersinia pestis in macrophages
Grabenstein, Infection and immunity 2006 - “...95-70 21-29 98-31 100-53 61-22 31-05 75-11 41-48 Unknown 5 to y0020 y0020 y0455b y0513 y0513 y0513 3 to y0564 y0943b 3 to y1820 y1921 y1921 y1921 y2124 3 to...”
- “...in this screen encode hypothetical proteins (e.g., y0020, y2124, Downloaded from http://iai.asm.org/ on February 13, 2017 by University of California, Berkeley...”
BCAN_A0193 methionine synthase from Brucella canis ATCC 23365
Aligns to 963:1235 / 1261 (21.6%), covers 99.6% of PF02965, 422.4 bits
MAV_2379 methionine synthase from Mycobacterium avium 104
Aligns to 962:1237 / 1257 (22.0%), covers 100.0% of PF02965, 421.6 bits
- Adaptive Changes in Mycobacterium avium Gene Expression Profile Following Infection of Genetically Susceptible and Resistant Mice
Ignatov, Acta naturae 2010 - “...the I/St mice MAV_2015 MbtG; mycobactin lysine-N-oxygenase MAV_1696 Glutamate dehydrogenase MAV_1304 NarH; nitrate reductase, ?-subunit MAV_2379 MetH; vitamin B12-dependent methionine synthase MAV_2385 Mce protein MAV_2063 Mce protein MAV_2386 Mce protein MAV_0118 PPE protein MAV_3109 RifB; polyketide synthase 7 MAV_0880 3-Ketosteroid-?-1-dehydrogenase MAV_3000 Acyl-CoA dehydrogenase MAV_4019 Assumed acyl-CoA...”
- “...important, for example, when the pathogen is in a latent state [ 27 ]. The MAV_2379 gene coding for 12 -dependent methionine synthase MetH is expressed at a high level in M. vium from the I/St mice. This protein is involved in the final stage of...”
BMEA_RS00885 methionine synthase from Brucella melitensis ATCC 23457
Aligns to 963:1235 / 1261 (21.6%), covers 99.6% of PF02965, 420.7 bits
- Genetic Characterization and Comparative Genome Analysis of Brucella melitensis Isolates from India
Azam, International journal of genomics 2016 - “...23457 in the coding region. S. no Gene ID ATCC_23457 Bm IND1 Gene name 1 BMEA_RS00885 GTTTCGCGGAAGCTTTCGCGGAA GTTTCGCGGAA Methionine synthase 2 BMEA_RS00935 CGGG CGGGG Glycerol-3-phosphate dehydrogenase 3 BMEA_RS00980 GCC GCCC ABC transporter permease 4 BMEA_RS01770 ATTTTTT ATTTTT FAD-binding molybdopterin dehydrogenase 5 BMEA_RS02325 ATAT ATATTAT 4-Hydroxy-3-methylbut-2-enyl diphosphate...”
W5S_RS19920 methionine synthase from Pectobacterium parmentieri
Aligns to 921:1192 / 1211 (22.5%), covers 99.6% of PF02965, 420.1 bits
VC0390 5-methyltetrahydrofolate--homocysteine methyltransferase from Vibrio cholerae O1 biovar eltor str. N16961
Aligns to 939:1210 / 1226 (22.2%), covers 99.6% of PF02965, 419.9 bits
Avin_29240 5-methyltetrahydrofolate--homocysteine methyltransferase, MetH from Azotobacter vinelandii AvOP
Aligns to 986:1257 / 1278 (21.3%), covers 99.6% of PF02965, 419.9 bits
- Azotobacter Genomes: The Genome of Azotobacter chroococcum NCIMB 8003 (ATCC 4412)
Robson, PloS one 2015 - “...-independent ribonucleoside reductase (discussed earlier: Achr_570; Avin_00800); met H for the B12-dependent methionine synthase (Achr_18530; Avin_29240); and eut BC for ethanolamine ammonia lyase (Achr_32230, 32220; Avin_09920, 09930). However, neither obviously requires B12 for growth because they also carry genes for B12-independent counterparts/pathways: an O 2 -dependent...”
NP_250534 B12-dependent methionine synthase from Pseudomonas aeruginosa PAO1
PA1843 methionine synthase from Pseudomonas aeruginosa PAO1
Aligns to 945:1216 / 1234 (22.0%), covers 100.0% of PF02965, 419.0 bits
- Swarming of Pseudomonas aeruginosa is controlled by a broad spectrum of transcriptional regulators, including MetR.
Yeung, Journal of bacteriology 2009 - GeneRIF: Downregulation of the putative methionine synthase gene metH (PA1843) and the putative ABC transporter gene PA4223 might explain the swarming defect of the metR mutant.
- Methylfolate Trap Promotes Bacterial Thymineless Death by Sulfa Drugs
Guzzo, PLoS pathogens 2016 - “...also importing B 12 from the environment. Transposon mutants with insertions in genes encoding metH (PA1843), cobI (PA2904), cobJ (PA2903), cobH (PA2905) and btuB (PA1271) were obtained from the Pseudomonas Transposon Mutant Collection (Manoil Laboratory, University of Washington Genome Sciences) [ 46 ] ( S2 Table...”
- Protein-to-mRNA ratios are conserved between Pseudomonas aeruginosa strains
Kwon, Journal of proteome research 2014 - “...and PA4557), nucleotide excision repair (PA1529 and PA4234), and one carbon (folate) metabolism (PA0944 and PA1843) showed low protein-to-mRNA ratios. Genes involved in oxidative phosphorylation (PA1582| sdhD , PA2643| nuoH , PA2645| nuoJ , PA2646| nuoK , PA2648| nuiM , and PA4430) had reasonably high mRNA...”
- Swarming of Pseudomonas aeruginosa is controlled by a broad spectrum of transcriptional regulators, including MetR
Yeung, Journal of bacteriology 2009 - “...Downregulation of the putative methionine synthase gene metH (PA1843) and the putative ABC transporter gene PA4223 might explain the swarming defect of the metR...”
- “...with the genes required for swarming motility revealed PA1843 (metH), PA2399 (pvdD), PA2413 (pvdH), PA2891, PA4144, and PA4223. Conversely, PA0633, PA0848, and...”
VIBHAR_03712 cobalamin-dependent methionine synthase from Vibrio harveyi ATCC BAA-1116
Aligns to 939:1210 / 1226 (22.2%), covers 99.6% of PF02965, 417.6 bits
MAB_2129 5-methyltetrahydrofolate--homocysteine methyltransferase MetH from Mycobacterium abscessus ATCC 19977
Aligns to 958:1233 / 1253 (22.0%), covers 100.0% of PF02965, 414.4 bits
- Cobalamin is present in cells of non-tuberculous mycobacteria, but not in Mycobacterium tuberculosis
Minias, Scientific reports 2021 - “...component of cobalt chelatase Rv2850c MAB_2985c MCNS_17540 Vitamin B12 dependent enzymes metH 5-Methyltetrahydrofolatehomocysteine methyltransferase Rv2124c MAB_2129 MCNS_30990 AWC07_11205 H0P51_RS04340 EET03_RS15385 mutB Methylmalonyl-CoA mutase Rv1493 MAB_2711c MCNS_22010 nrdZ Ribonucleotide reductase of class II Rv0570 AWC07_08365 Species M. kansasii M. persicum M. phlei M. porcinum M. terrae M....”
- “...ChlI component of cobalt chelatase MAB_2985c 196.3366667 1.652099674 Vitamin B12 dependent enzymes metH 5-Methyltetrahydrofolatehomocysteine methyltransferase MAB_2129 605.9966667 39.45958101 MSMEG_0093 94.66 39.15167557 mutB Methylmalonyl-CoA mutase MAB_2711c 180.9466667 2.206928484 nrdZ Ribonucleotide reductase of class II Gene name Description M. tuberculosis Locus Rich 7H9 broth Cholesterol Macrophages Average SD...”
MAB_2129 methionine synthase from Mycobacteroides abscessus ATCC 19977
Aligns to 960:1235 / 1255 (22.0%), covers 100.0% of PF02965, 414.4 bits
- Cobalamin is present in cells of non-tuberculous mycobacteria, but not in Mycobacterium tuberculosis
Minias, Scientific reports 2021 - “...component of cobalt chelatase Rv2850c MAB_2985c MCNS_17540 Vitamin B12 dependent enzymes metH 5-Methyltetrahydrofolatehomocysteine methyltransferase Rv2124c MAB_2129 MCNS_30990 AWC07_11205 H0P51_RS04340 EET03_RS15385 mutB Methylmalonyl-CoA mutase Rv1493 MAB_2711c MCNS_22010 nrdZ Ribonucleotide reductase of class II Rv0570 AWC07_08365 Species M. kansasii M. persicum M. phlei M. porcinum M. terrae M....”
- “...ChlI component of cobalt chelatase MAB_2985c 196.3366667 1.652099674 Vitamin B12 dependent enzymes metH 5-Methyltetrahydrofolatehomocysteine methyltransferase MAB_2129 605.9966667 39.45958101 MSMEG_0093 94.66 39.15167557 mutB Methylmalonyl-CoA mutase MAB_2711c 180.9466667 2.206928484 nrdZ Ribonucleotide reductase of class II Gene name Description M. tuberculosis Locus Rich 7H9 broth Cholesterol Macrophages Average SD...”
SMc03112 PROBABLE 5-METHYLTETRAHYDROFOLATE--HOMOCYSTEINE METHYLTRANSFERASE (METHIONINE SYNTHASE, VITAMIN-B12 DEPENDENT ISOZYME) PROTEIN from Sinorhizobium meliloti 1021
Aligns to 959:1231 / 1257 (21.7%), covers 99.6% of PF02965, 412.1 bits
SAMCFNEI73_Ch3399 methionine synthase from Sinorhizobium americanum
Aligns to 958:1230 / 1256 (21.7%), covers 99.6% of PF02965, 411.9 bits
Alvin_1622 methionine synthase from Allochromatium vinosum DSM 180
Aligns to 959:1235 / 1253 (22.1%), covers 99.6% of PF02965, 410.8 bits
- Metabolomic profiling of the purple sulfur bacterium Allochromatium vinosum during growth on different reduced sulfur compounds and malate
Weissgerber, Metabolomics : Official journal of the Metabolomic Society 2014 - “...O -succinyl- l -homoserine sulfhydrylase (Alvin_1027), MetE cobalamin-independent methionine synthase (Alvin_2262), MetH cobalamin-dependent methionine synthase (Alvin_1622), AhcY adenosylhomocysteinase (Alvin_0320), BchM magnesium protoporphyrin O -methyltransferase (Alvin_2638), MetK S -adenosylmethionine synthetase (Alvin_0318); 0319, methyltransferase type 11 (Alvin_0319). The transcriptomic ( boxes ) (Weissgerber et al. 2013 ), proteomic...”
- “...precursor for methionine by accepting a methyl group from N5-methyl-5,6,7,8-tetrahydrofolate catalyzed by either cobalamin-dependent (MetH: Alvin_1622) or cobalamin-independent (MetE: Alvin_2262) methionine synthase (Pejchal and Ludwig 2005 ). Homocysteine is the most abundant amino acid in A. vinosum (up to five times more abundant than the proteinogenic...”
PSHAa2222 putative B12-dependent homocysteine-N5-methyltetrahydrofolate transmethylase (C terminal) from Pseudoalteromonas haloplanktis TAC125
Aligns to 588:857 / 876 (30.8%), covers 99.3% of PF02965, 410.4 bits
- Diauxie and co-utilization of carbon sources can coexist during bacterial growth in nutritionally complex environments
Perrin, Nature communications 2020 - “...Aromatic amino acids metabolism 0.11 Concerning MetJ regulon, we noticed a group of genes (including PSHAa2222, PSHAa2223, PSHAa0287 and PSHAa2292) whose expression values are negatively correlated with those of genes PSHAa2274-76 and PSHAa1226 (Fig. 3d ). This group of co-regulated genes include those involved in the...”
- “...(upstream the main product methionine), whereas members the other one are in its close proximity (PSHAa2222) or involved in the methionine salvage pathway (PSHAa2292), the set of reactions responsible for the recycle of the thiomethyl group of S-adenosylmethionine from methylthioadenosine (Fig. 3j ). In a previous...”
XC_RS13715 methionine synthase from Xanthomonas campestris pv. campestris str. 8004
Aligns to 608:899 / 918 (31.8%), covers 99.6% of PF02965, 407.8 bits
PP_2375 5-methyltetrahydrofolate--homocysteine methyltransferase from Pseudomonas putida KT2440
Aligns to 941:1217 / 1235 (22.4%), covers 100.0% of PF02965, 405.7 bits
RSP_3346 5-methyltetrahydrofolate--homocysteine methyltransferase from Rhodobacter sphaeroides 2.4.1
Aligns to 611:882 / 908 (30.0%), covers 100.0% of PF02965, 403.2 bits
LEPBI_II0183 Methionine synthase from Leptospira biflexa serovar Patoc strain 'Patoc 1 (Paris)'
Aligns to 955:1226 / 1250 (21.8%), covers 99.3% of PF02965, 403.1 bits
- The sigma factor σ54 is required for the long-term survival of Leptospira biflexa in water
Zhang, Molecular microbiology 2018 - “...signal peptide No hit No hit LEPBI_I2431 2.54 - Hypothetical protein No hit No hit LEPBI_II0183 2.54 COG1410E B12-dependent methionine synthase LB_108 LBL_4107 LEPBI_I3034 2.45 COG3329R Putative permease; putative membrane protein LA_4270 LBL_0122 LEPBI_I2424 2.42 COG1136V ABC-type transport system, ATP binding protein LA_0274, LA_2982, LA_3713 LBL_0572,...”
BPHYT_RS02305 methionine synthase from Paraburkholderia phytofirmans PsJN
Aligns to 615:891 / 905 (30.6%), covers 99.3% of PF02965, 401.4 bits
- GapMind: Automated Annotation of Amino Acid Biosynthesis
Price, mSystems 2020 - “...-dependent methionine synthase MetH is a single protein with five domains. In Burkholderia phytofirmans PsJN, BPHYT_RS02305 contains the pterin-binding domain, the two domains involved in binding vitamin B12, and the domain for the reactivation of vitamin B12, while BPHYT_RS02310 contains the S -methyltransferase domain ( Fig.2B...”
V22_33860 methionine synthase from Calycomorphotria hydatis
Aligns to 940:1211 / 1229 (22.1%), covers 99.6% of PF02965, 401.2 bits
CC2137, CC_2137 5-methyltetrahydrofolate--homocysteine methyltransferase from Caulobacter crescentus CB15
CCNA_02221 methionine synthase I metH from Caulobacter crescentus NA1000
Aligns to 596:872 / 899 (30.8%), covers 99.6% of PF02965, 400.9 bits
- Global transcriptional response of Caulobacter crescentus to iron availability
da, BMC genomics 2013 - “...by iron limitation there are many involved in methionine biosynthesis, such as methionine synthases (CC0482, CC2137, CC2138), adenosylmethionine synthtase (CC0050), S-adenosyl-L-homocysteine hydrolase (CC0257) and methylenetetrahydrofolate reductase (CC2140), which is required to produce 5-methyltetrahydrofolate as methyl-group donor for methionine synthesis. Pathways of protein catabolism were also repressed...”
- “...CCNA_00515 Cobalamin-independent methionine synthase (Zinc) 2.49 CC_0984 CCNA_01035 Gamma-glutamyltranspeptidase 2.68 CC_1048 CCNA_01100 Acylamino-acid-releasing enzyme 2.73 CC_2137 CCNA_02221 Methionine synthase I metH (Zinc) 2.52 CC_2138 CCNA_02222 5-methyltetrahydrofolate 2.72 CC_2139 CCNA_02223 Beta-lactamase, type II (Zinc) 2.83 CC_2140 CCNA_02224 Methylenetetrahydrofolate reductase 2.39 CC_2840 CCNA_02933 Aminopeptidase 2.14 CC_3044 CCNA_03139 Dihydroxy-acid...”
- Use of the Caulobacter crescentus genome sequence to develop a method for systematic genetic mapping
West, Journal of bacteriology 2002 - “...domain of 5-methyltetrahydrofolate-homocysteine methyltransferase, while CC2137 encodes a 900-amino-acid polypeptide homologous to the C-terminal domain of...”
- CAU-1, a subclass B3 metallo-beta-lactamase of low substrate affinity encoded by an ortholog present in the Caulobacter crescentus chromosome
Docquier, Antimicrobial agents and chemotherapy 2002 - “...imperfect palindrome, after which there is another ORF (CC2137) that encodes a homolog to the carboxy-terminal cobalamin-binding domain of the MetH family (27)....”
- Absolute Measurements of mRNA Translation in Caulobacter crescentus Reveal Important Fitness Costs of Vitamin B12 Scavenging
Aretakis, mSystems 2019 - “...colored. (B) Pathway of methionine biosynthesis, MetX1 (CCNA_03309), MetX2 (CCNA_00559), MetZ (CCNA_02321), MetE (CCNA_00515), MetH (CCNA_02221), and CCNA_02222. Pathway for B 12 utilization, BtuB (CCNA_01826) and BtuR (CCNA_02321). Pathway for tRNA modification, MtaB (CCNA_03798). Pathway for nucleotide reduction, NrdJ (CCNA_01966), NrdE (CCNA_03607), and NrdB (CCNA_00261). Pathway...”
- Global transcriptional response of Caulobacter crescentus to iron availability
da, BMC genomics 2013 - “...Cobalamin-independent methionine synthase (Zinc) 2.49 CC_0984 CCNA_01035 Gamma-glutamyltranspeptidase 2.68 CC_1048 CCNA_01100 Acylamino-acid-releasing enzyme 2.73 CC_2137 CCNA_02221 Methionine synthase I metH (Zinc) 2.52 CC_2138 CCNA_02222 5-methyltetrahydrofolate 2.72 CC_2139 CCNA_02223 Beta-lactamase, type II (Zinc) 2.83 CC_2140 CCNA_02224 Methylenetetrahydrofolate reductase 2.39 CC_2840 CCNA_02933 Aminopeptidase 2.14 CC_3044 CCNA_03139 Dihydroxy-acid dehydratase...”
BP3594 5-methyltetrahydrofolate--homocysteine methyltransferase from Bordetella pertussis Tohama I
Aligns to 970:1242 / 1257 (21.7%), covers 100.0% of PF02965, 400.1 bits
PSPPH_2620 5-methyltetrahydrofolate--homocysteine methyltransferase from Pseudomonas syringae pv. phaseolicola 1448A
Aligns to 941:1221 / 1239 (22.7%), covers 100.0% of PF02965, 398.5 bits
BP1026B_I3121 methionine synthase from Burkholderia pseudomallei 1026b
Aligns to 615:891 / 905 (30.6%), covers 99.6% of PF02965, 397.8 bits
BTH_I0357 5-methyltetrahydrofolate--homocysteine methyltransferase from Burkholderia thailandensis E264
Aligns to 615:891 / 905 (30.6%), covers 99.3% of PF02965, 396.7 bits
RSc0294 PROBABLE 5-METHYLTETRAHYDROFOLATE--HOMOCYSTEINE METHYLTRANSFERASE (METHIONINE SYNTHASE, VITAMIN-B12 DEPENDENT ISOZYME) PROTEIN from Ralstonia solanacearum GMI1000
Aligns to 615:891 / 905 (30.6%), covers 100.0% of PF02965, 395.9 bits
Cenrod_2368 methionine synthase from Candidatus Symbiobacter mobilis CR
Aligns to 631:906 / 918 (30.1%), covers 99.6% of PF02965, 394.2 bits
bglu_1g32290 Methionine synthase from Burkholderia glumae BGR1
Aligns to 615:891 / 905 (30.6%), covers 99.3% of PF02965, 392.5 bits
- Unraveling the role of quorum sensing-dependent metabolic homeostasis of the activated methyl cycle in a cooperative population of Burkholderia glumae
Kang, Scientific reports 2019 - “...in B . glumae : metE1 (bglu_1g08430) and metE2 (bglu_2g04930), and metH1 (bglu_1g32280) and metH2 (bglu_1g32290). MetE1 and MetE2 share 53% identity (Supplementary Fig. 1 ). The proteins produced by the two respective MetH genes (MetH1; 38.2 KDa and MetH2; 99.6 KDa) aligned to the N-terminus...”
- “...BGR1 a bglu_1g01990 bglu_1g02010 - metE1 (bglu_1g08430) - metE2 (bglu_2g04930) - metH1 (bglu_1g32280) - metH2 (bglu_1g32290) bglu_1g33680 - bglu_2g06400 - bglu_1g23220 - bglu_2g17510 Burkholderia thailandensis E264 b BTH_I3165 BTH_I3163 BTH_I1606 - metH1 (BTH_I0358) - metH2 (BTH_I0357) BTH_I0174 - BTH_II1307 - BTH_II1338 - BTH_I2673 Burkholderia pseudomallei 1026b...”
Swit_2399 methionine synthase (B12-dependent) from Sphingomonas wittichii RW1
Aligns to 624:887 / 902 (29.3%), covers 99.3% of PF02965, 390.2 bits
Q54P92 Methionine synthase from Dictyostelium discoideum
Aligns to 957:1237 / 1260 (22.3%), covers 99.6% of PF02965, 389.7 bits
- AlphaKnot: server to analyze entanglement in structures predicted by AlphaFold methods.
Niemyska, Nucleic acids research 2022 - “...not all homological structures deposited in the AlpahFold possess it. Figure 4. Protein (UniProtKB ID: Q54P92) with very high pLDDT value, but whose topology (knot with 10 crossings K10 146 , shown with schematic) suggests that the prediction is not reliable. Other potential applications include in...”
- “...can provide critical insights in such cases. Figure 4 shows a protein structure (UniProtKB ID: Q54P92) with a high pLDDT reliability which is certainly not a realistic model from the topological perspective. The knot formed is 10 146 , which is much more complicated than any...”
XP_010818713 methionine synthase isoform X1 from Bos taurus
Aligns to 964:1245 / 1264 (22.3%), covers 100.0% of PF02965, 388.7 bits
XP_011960415 methionine synthase isoform X3 from Ovis aries
Aligns to 952:1233 / 1252 (22.5%), covers 100.0% of PF02965, 387.7 bits
A1S_0971 B12-dependent methionine synthase from Acinetobacter baumannii ATCC 17978
Aligns to 918:1188 / 1207 (22.5%), covers 99.6% of PF02965, 383.7 bits
ABAYE2822 methionine synthase (B12-dependent homocysteine-N5-methyltetrahydrofolate transmethylase, repressor of metE and metF) from Acinetobacter baumannii AYE
Aligns to 939:1209 / 1228 (22.1%), covers 99.6% of PF02965, 383.7 bits
B4DST3 Methionine synthase from Homo sapiens
Aligns to 819:1100 / 1118 (25.2%), covers 100.0% of PF02965, 382.2 bits
MTR / Q99707 cobalamin-dependent methionine synthase (EC 2.1.1.13) from Homo sapiens (see 5 papers)
METH_HUMAN / Q99707 Methionine synthase; MS; 5-methyltetrahydrofolate--homocysteine methyltransferase; Cobalamin-dependent methionine synthase; Vitamin-B12 dependent methionine synthase; EC 2.1.1.13 from Homo sapiens (Human) (see 7 papers)
Q99707 methionine synthase (EC 2.1.1.13) from Homo sapiens (see paper)
Aligns to 965:1246 / 1265 (22.3%), covers 100.0% of PF02965, 381.9 bits
- function: Catalyzes the transfer of a methyl group from methylcob(III)alamin (MeCbl) to homocysteine, yielding enzyme-bound cob(I)alamin and methionine in the cytosol (PubMed:16769880, PubMed:27771510, PubMed:17288554). MeCbl is an active form of cobalamin (vitamin B12) used as a cofactor for methionine biosynthesis. Cob(I)alamin form is regenerated to MeCbl by a transfer of a methyl group from 5-methyltetrahydrofolate (PubMed:16769880, PubMed:27771510, PubMed:17288554). The processing of cobalamin in the cytosol occurs in a multiprotein complex composed of at least MMACHC, MMADHC, MTRR (methionine synthase reductase) and MTR which may contribute to shuttle safely and efficiently cobalamin towards MTR in order to produce methionine (PubMed:16769880, PubMed:27771510).
catalytic activity: (6S)-5-methyl-5,6,7,8-tetrahydrofolate + L-homocysteine = (6S)-5,6,7,8-tetrahydrofolate + L-methionine (RHEA:11172)
cofactor: methylcob(III)alamin
cofactor: Zn(2+) (Binds 1 zinc ion per subunit.)
subunit: Monomer (PubMed:17288554). Dimer (PubMed:17288554). Forms a multiprotein complex with MMACHC, MMADHC and MTRR (PubMed:17288554, PubMed:16769880, PubMed:27771510). - A novel nanobody as therapeutics target for EGFR-positive colorectal cancer therapy: exploring the effects of the nanobody on SW480 cells using proteomics approach
Lamtha, Proteome science 2022 - “...5.28E 01 0.01 1.51E 16 Q9HD67 Unconventional myosin-X 0 1.321 2.79E 01 0.01 1.51E 16 Q99707 Methionine synthase 0.002 1.307 4.10E 01 0.01 1.51E 16 Q9NX05 Constitutive coactivator of PPAR-gamma-like protein 2 0 1.305 7.79E 01 0.01 1.51E 16 Q969X5 Endoplasmic reticulum-Golgi intermediate compartment protein 1...”
- “...Comparison between R9VH36 and control dominant proteins, there were 8 proteins (P02042, Q13315, P54802, Q9HD67, Q99707, Q9NX05, Q969X5, and A6NED2) in R9VH36 exhibited opposite expression direction when comparing to gefitinib. These proteins are involved in DNA-damage checkpoint processes. This information could lead us to a broader...”
- Brain Proteomic Profiling in Intractable Epilepsy Caused by TSC1 Truncating Mutations: A Small Sample Study.
Liu, Frontiers in neurology 2020 - “...(KCNA2) 0.045913807 1.71 Cell membrane/Cell projection/Cell junction Q96D05 Uncharacterized protein FAM241B (FAM241B) 0.027804687 1.7 Membrane Q99707 Methionine synthase (MTR) 0.01578569 1.7 Cytoplasm O94817 Ubiquitin-like protein ATG12 (ATG12) 0.012333544 1.66 Cytoplasm/Preautophagosomal structure membrane Q9Y6D5 Brefeldin A-inhibited guanine nucleotide-exchange protein 2 (ARFGEF2) 0.030295761 1.65 Cytoplasm/Membrane/Golgi apparatus Q9BZL4 Protein...”
- Peptidome analysis of umbilical cord mesenchymal stem cell (hUC-MSC) conditioned medium from preterm and term infants.
Wang, Stem cell research & therapy 2020 - “...PLPVKSPA 1.01 2.97 22.11 Q9Y6R1 SLC4A4 Electrogenic sodium bicarbonate cotransporter 1 HHTIYIGVHVPKSYR 0.78 2.99 8.24 Q99707 MTR Methionine synthase KSARVMKKAVG 1.66 3.12 21.33 Q8WXG9 ADGRV1 Adhesion G-protein coupled receptor V1 RFLQSIYLVPEEDHILIIPVVRGKDN 1.97 3.13 8.73 P43243-2 MATR3 Matrin-3 HLILN 0.67 3.21 8.71 O75970-3 MPDZ Multiple PDZ domain...”
- Traditional Human Populations and Nonhuman Primates Show Parallel Gut Microbiome Adaptations to Analogous Ecological Conditions.
Sharma, mSystems 2020 - “...significantly higher in gorillas during the wet season. In contrast, abundance of methionine synthase ( Q99707 ) was higher in the BaAka and tended to be higher when gorillas consumed more leaves ( Fig.3d ). Abundance of aconitate hydratase ( Q99798 ) was also higher in...”
- “...of Bacteroides ovatus and an unknown Prevotella were also associated with both XDEs Q99798 and Q99707 (methionine synthase) ( Fig.4d and Data Set S1 , tab 13). Carbohydrate utilization capabilities of shared taxonomic traits between humans and gorillas. Given the associations detected between specific marker taxa...”
- Genome-wide identification and transcriptional analysis of folate metabolism-related genes in maize kernels.
Lian, BMC plant biology 2015 - “...(O50008), MS2 ARATH (Q9SRV5), MS3 ARATH (Q0WNZ5), METH ECOLI (P13009), METE YEAST (P05694), METH HUMAN (Q99707), METH RAT (Q9Z2Q4), METH MOUSE (A6H5Y3); FPGS-1 SORBI (C5WWE5), FPGS-2 SORBI (C5WMM8), FPGS-1 SETIT (K4A7H2), FPGS-2 SEITI (K4A839), FPGS-1 ORYSJ (Q337F3), FPGS-2 ORYSJ (Q10SU1), FPGS-3 ORYSJ (B9G6I2), FPGS1 ARATH (F4K2A1),...”
- A curated C. difficile strain 630 metabolic network: prediction of essential targets and inhibitors.
Larocque, BMC systems biology 2014 - “...(folD | fhs | fchA) d P24182 [53%] Q96RQ3 [48%] CNC , THL , I2A (Q99707 [31%]) scoB (folD | fhs | fchA) d E9YQ86 [56%] B7Z609 [51%] SIN , EMT (P55809 [52%]) scoA (folD | fhs | fchA) d G1YD51 [53%] Q6IAV5 [42%] SIN ,...”
- Differentiation of mesenchymal stem cells derived from pancreatic islets and bone marrow into islet-like cell phenotype
Zanini, PloS one 2011 - “...Q9UPN3 MACF1 Microtubule-actin cross-linking factor 1, isoforms 1/2/3/5 623626 5,27 16 3 56 _ _ Q99707 METH Methionine synthase 141749 5,39 9 9 56 _ _ Q9Y623 MYH4 Myosin-4 223902 5,65 11 7 56 _ _ Q99497 PARK7 Protein DJ-1 20050 6,33 7 28 70 _...”
- Epigenetic virtues of chromodomains
Blus, Critical reviews in biochemistry and molecular biology 2011 - “...NRK (Q7Z2Y5) PPIP5K2 (O43314) GCC1 (Q96CN9) MAC2BP (Q08380) GABRG3 (Q99928) DP-150 (Q14203) LNP (Q9C0E8) MTR (Q99707) C9orf144B (Q6ZU69) PC-LKC (Q9BYE9) Ru2 (Q9UPZ3) DNM1 (Q05193) CASP-14 (P31944) XDH (P47989) 5-HT-7 (P34969) N-RAP (Q86VF7) LYST (Q99698) RYR-3 (Q15413) EDF (P08476) AP-A (Q07075) CIP150 (Q4ADV7) CK-73 (Q86Y46) CrAT (P43155)...”
- More
XP_011542496 methionine synthase isoform X1 from Homo sapiens
Aligns to 1021:1302 / 1321 (21.3%), covers 100.0% of PF02965, 381.8 bits
- Association of MTR gene polymorphisms with the occurrence of non-syndromic congenital heart disease: a case-control study.
Liu, Scientific reports 2023 - GeneRIF: Association of MTR gene polymorphisms with the occurrence of non-syndromic congenital heart disease: a case-control study.
- Association of MTR and MTRR genes and oral health-related quality of life in children with dental caries.
Antunes, Brazilian oral research 2023 (PubMed)- GeneRIF: Association of MTR and MTRR genes and oral health-related quality of life in children with dental caries.
- Common Variants in One-Carbon Metabolism Genes (MTHFR, MTR, MTHFD1) and Depression in Gynecologic Cancers.
Pawlik, International journal of molecular sciences 2023 - GeneRIF: Common Variants in One-Carbon Metabolism Genes (MTHFR, MTR, MTHFD1) and Depression in Gynecologic Cancers.
- MTR-G is a high-risk allele for lower-extremity arteriosclerotic occlusion.
Wen, The International journal of neuroscience 2022 (PubMed)- GeneRIF: MTR-G is a high-risk allele for lower-extremity arteriosclerotic occlusion.
- Folate metabolism abnormalities in infertile patients with endometriosis.
Guedes, Biomarkers in medicine 2022 (PubMed)- GeneRIF: Folate metabolism abnormalities in infertile patients with endometriosis.
- "Association of MTHFR and MS/MTR gene polymorphisms with congenital heart defects in North Indian population (Jammu and Kashmir): a case-control study encompassing meta-analysis and trial sequential analysis".
Raina, BMC pediatrics 2022 - GeneRIF: ""Association of MTHFR and MS/MTR gene polymorphisms with congenital heart defects in North Indian population (Jammu and Kashmir): a case-control study encompassing meta-analysis and trial sequential analysis"".
- Investigation of the relationship between MTRR A66G, MTR A2756G gene variations and cell anomalies in early diagnosis and progression of bladder cancer.
Alkanli, Molecular biology reports 2022 (PubMed)- GeneRIF: Investigation of the relationship between MTRR A66G, MTR A2756G gene variations and cell anomalies in early diagnosis and progression of bladder cancer.
- Association between MTR A2756G polymorphism and susceptibility to congenital heart disease: A meta-analysis.
Liu, PloS one 2022 - GeneRIF: Association between MTR A2756G polymorphism and susceptibility to congenital heart disease: A meta-analysis.
- More
NP_110491 methionine synthase from Rattus norvegicus
G3V8A4 Methionine synthase from Rattus norvegicus
Aligns to 953:1234 / 1253 (22.5%), covers 99.6% of PF02965, 379.8 bits
- Effects of zinc deficiency and zinc supplementation on homocysteine levels and related enzyme expression in rats.
Jing, Journal of trace elements in medicine and biology : organ of the Society for Minerals and Trace Elements (GMS) 2015 (PubMed)- GeneRIF: The objective of this study was to investigate the effects of dietary Zn supply on homocysteine levels and expression of Methionine synthase and betaine-homocysteine methyltransferase in growing rats.
- Bioactive constituents of Salvia przewalskii and the molecular mechanism of its antihypoxia effects determined using quantitative proteomics.
Wang, Pharmaceutical biology 2020 - “...D4AAP6 Mn1 Transcriptional regulator 1.40 .028 Q5RJS2 Rhoj Ras homologue family member J 1.28 .005 G3V8A4 Mtr Methyltransferase 1.27 .026 P35444 Comp Cartilage oligomeric matrix protein 1.27 .038 G3V7D0 Mmp8 Matrix metalloproteinase 1.26 .027 P10959 Ces1c Carboxylesterase 1C 1.23 .023 F1LVC4 Tigd2 Tigger transposable element-derived 2...”
- Peptidomic Analysis of Rat Plasma: Proteolysis in Hemorrhagic Shock.
Aletti, Shock (Augusta, Ga.) 2016 - “...P05545 Serpina3k chymotrypsin-like DIISNILHNF D3ZY96 Ngp chymotrypsin-like DIVLTQSPVL F1LYU4 chymotrypsin-like EAHKSEIAHRFKDLGEQHFKGL P02770 Alb chymotrypsin-like ELVEAYQEQAKGLLDGGVDILL G3V8A4 Mtr chymotrypsin-like EMLKGMIMSGMNVAHL D3ZH80 LOC689343 chymotrypsin-like EMQQQELAQMRQRDANL M0R4D8 Taf4a chymotrypsin-like ETLKDDTEKLKQLNTEQNIL Q5FVG2 Epb41l5 chymotrypsin-like FAQVPQAPPVLVFKL P13221 Got1 chymotrypsin-like FGSPLGKDLLFKDSAFGL Q7TMC7 Tf chymotrypsin-like FIGGDAGDAFDGYDFGDDPSDKF P02680 Fgg chymotrypsin-like FILKHTGPGILSMANAGPNTNGSQF M0RCZ9 Ppia chymotrypsin-like...”
- “...Maml2 F1M3B2 Maml2 x Mannan-binding lectin serine protease 1 Q8CHN8-2 Masp1 x x Methionine synthase G3V8A4 Mtr x x Murinoglobulin-1 Q03626 Mug1 x Murinoglobulin-2 Q6IE52 Mug2 x Nicotinamide phosphoribosyltransferase Q80Z29 Nampt x x Nucleosome assembly protein 1-like 4 Q5U2Z3 Nap1l4 x x Neutrophilic granule protein (P...”
METH_RAT / Q9Z2Q4 Methionine synthase; MS; 5-methyltetrahydrofolate--homocysteine methyltransferase; Cobalamin-dependent methionine synthase; Vitamin-B12 dependent methionine synthase; EC 2.1.1.13 from Rattus norvegicus (Rat) (see 2 papers)
Q9Z2Q4 methionine synthase (EC 2.1.1.13) from Rattus norvegicus (see paper)
Aligns to 953:1234 / 1253 (22.5%), covers 99.6% of PF02965, 379.4 bits
- function: Catalyzes the transfer of a methyl group from methylcob(III)alamin (MeCbl) to homocysteine, yielding enzyme-bound cob(I)alamin and methionine in the cytosol (PubMed:9219091, PubMed:9972236). MeCbl is an active form of cobalamin (vitamin B12) used as a cofactor for methionine biosynthesis (PubMed:9219091, PubMed:9972236). Cob(I)alamin form is regenerated to MeCbl by a transfer of a methyl group from 5-methyltetrahydrofolate (By similarity). The processing of cobalamin in the cytosol occurs in a multiprotein complex composed of at least MMACHC, MMADHC, MTRR (methionine synthase reductase) and MTR which may contribute to shuttle safely and efficiently cobalamin towards MTR in order to produce methionine (By similarity).
catalytic activity: (6S)-5-methyl-5,6,7,8-tetrahydrofolate + L-homocysteine = (6S)-5,6,7,8-tetrahydrofolate + L-methionine (RHEA:11172)
cofactor: methylcob(III)alamin
cofactor: Zn(2+) (Binds 1 zinc ion per subunit.)
subunit: Monomer (PubMed:9219091). Dimer. Forms a multiprotein complex with MMACHC, MMADHC and MTRR. - TMT-based quantitative proteomics analysis of the effects of Jiawei Danshen decoction myocardial ischemia-reperfusion injury.
Zhu, Proteome science 2022 - “...3.60 1 0.03 0.73 1.23 A0A0H2UI07 Pklr Pyruvate kinase L/R 3.58 2 0.01 0.67 1.73 Q9Z2Q4 Mtr Methionine synthase 0.72 1 0.02 1.36 0.79 Bioinformatics analysis of DEPs and JWDSD To investigate the biological role of DEPs screened to prevent and treat MIRI in JWDSD. GO...”
- Genome-wide identification and transcriptional analysis of folate metabolism-related genes in maize kernels.
Lian, BMC plant biology 2015 - “...(Q9SRV5), MS3 ARATH (Q0WNZ5), METH ECOLI (P13009), METE YEAST (P05694), METH HUMAN (Q99707), METH RAT (Q9Z2Q4), METH MOUSE (A6H5Y3); FPGS-1 SORBI (C5WWE5), FPGS-2 SORBI (C5WMM8), FPGS-1 SETIT (K4A7H2), FPGS-2 SEITI (K4A839), FPGS-1 ORYSJ (Q337F3), FPGS-2 ORYSJ (Q10SU1), FPGS-3 ORYSJ (B9G6I2), FPGS1 ARATH (F4K2A1), FPGS2 ARATH (F4J2K2),...”
XP_006516724 methionine synthase isoform X1 from Mus musculus
Aligns to 699:980 / 999 (28.2%), covers 99.6% of PF02965, 377.9 bits
A6H5Y3 Methionine synthase from Mus musculus
Aligns to 953:1234 / 1253 (22.5%), covers 99.6% of PF02965, 377.4 bits
- Genome-wide identification and transcriptional analysis of folate metabolism-related genes in maize kernels.
Lian, BMC plant biology 2015 - “...(Q0WNZ5), METH ECOLI (P13009), METE YEAST (P05694), METH HUMAN (Q99707), METH RAT (Q9Z2Q4), METH MOUSE (A6H5Y3); FPGS-1 SORBI (C5WWE5), FPGS-2 SORBI (C5WMM8), FPGS-1 SETIT (K4A7H2), FPGS-2 SEITI (K4A839), FPGS-1 ORYSJ (Q337F3), FPGS-2 ORYSJ (Q10SU1), FPGS-3 ORYSJ (B9G6I2), FPGS1 ARATH (F4K2A1), FPGS2 ARATH (F4J2K2), FPGS3 ARATH (Q8W035),...”
- In vivo substrates of the lens molecular chaperones αA-crystallin and αB-crystallin.
Andley, PloS one 2014 - “...8 A-crystallin Q569M7 20 5 Serrate RNA effector molecule homolog Q99MR6 100 2 Methionine synthase A6H5Y3 139 2 2296 Filensin A2AMT1 74 43 1.07 5.61 5.19 Gelsolin P13020 86 5 Calpain 3 A2AVV5 85 4 3001 60 kDa Heat shock protein, mitochondrial P63038 61 16 1.11...”
SPRG_02541 methionine synthase from Saprolegnia parasitica CBS 223.65
Aligns to 985:1260 / 1279 (21.6%), covers 100.0% of PF02965, 375.8 bits
- Analysis of Saprolegnia parasitica Transcriptome following Treatment with Copper Sulfate
Hu, PloS one 2016 - “...and SPRG_01617) were upregulated, while SPRG_11730, SPRG_04491, SPRG_10490, SPRG_12259, SPRG_04186, SPRG_18377, SPRG_18063, SPRG_06771, SPRG_16261, and SPRG_02541 genes were downregulated after copper sulfate treatment. These findings were consistent with the GO enrichment analysis, which indicated that copper sulfate mostly prevented the growth of S. parasitica by affecting...”
PITG_01804 methionine synthase from Phytophthora infestans T30-4
Aligns to 898:1173 / 1203 (22.9%), covers 100.0% of PF02965, 375.1 bits
CAC0578 Cobalamine-dependent methionine synthase I (methyltransferase and cobalamine-binding domain) from Clostridium acetobutylicum ATCC 824
Aligns to 931:1198 / 1212 (22.1%), covers 99.3% of PF02965, 373.3 bits
- Complex and extensive post-transcriptional regulation revealed by integrative proteomic and transcriptomic analysis of metabolite stress response in Clostridium acetobutylicum
Venkataramanan, Biotechnology for biofuels 2015 - “...stress. Similarly, among the 12 proteins identified under butanol stress, three (CAC2229 - pyruvate:ferredoxin oxidoreductase, CAC0578 - MetH, CAC3392 - Bdh) and five (CAC2709 - EtfA, CAC0022 - aspartate semialdehyde dehydrogenase, CAP0165 - Adc, CAC2333 - SpsI, CAC3146 - RplJ) were identified under medium and high...”
- Genome sequence and comparative analysis of the solvent-producing bacterium Clostridium acetobutylicum
Nölling, Journal of bacteriology 2001 - “...2017 by University of California, Berkeley CAC0039, CAC0408 CAC0578 a Commentb B.s. gene product 4834 NOLLING ET AL. J. BACTERIOL. TABLE 4. Specific expansion...”
Clocel_2896 methionine synthase from Clostridium cellulovorans 743B
Aligns to 931:1202 / 1220 (22.3%), covers 99.6% of PF02965, 373.0 bits
- Clostridium cellulovorans Proteomic Responses to Butanol Stress
Costa, Frontiers in microbiology 2021 - “...of amino acids including proline and arginine (Clocel_2734, Clocel_3150, Clocel_1668), lysine (Clocel_1978, Clocel_3115), methionine (Clocel_1764, Clocel_2896, Clocel_3040), and branched chain amino acids (BCAA) (Clocel_1324, Clocel_1325, Clocel_0493) ( Table 1 and Supplementary Table 2 ). In addition, up-regulated proteins include four aminotransferases (Clocel_1948, Clocel_2059, Clocel_2390, Clocel_3812). The...”
ACIAD1045 methionine synthase (B12-dependent homocysteine-N5-methyltetrahydrofolate transmethylase, repressor of metE and metF) from Acinetobacter sp. ADP1
Aligns to 940:1209 / 1228 (22.0%), covers 100.0% of PF02965, 370.1 bits
Cbs_3100 methionine synthase from Clostridium beijerinckii ATCC 35702
Aligns to 931:1198 / 1213 (22.1%), covers 99.6% of PF02965, 364.7 bits
BT0249 5-methyltetrahydrofolate--homocysteine methyltransferase or methionine synthase from Bacteroides thetaiotaomicron VPI-5482
Aligns to 6:285 / 300 (93.3%), covers 99.6% of PF02965, 331.8 bits
- GapMind: Automated Annotation of Amino Acid Biosynthesis
Price, mSystems 2020 - “...methionine synthase is split in a different way, with the reactivation domain in one protein (BT0249) and the other four domains in another protein (BT0180) ( Fig.2B ). GapMind automatically joins these proteins together based on the nonoverlapping alignments of two pieces to the same characterized...”
Odosp_3416 methionine synthase from Odoribacter splanchnicus DSM 20712
Aligns to 933:1166 / 1178 (19.9%), covers 99.6% of PF02965, 218.7 bits
- Breed differences in the expression levels of gga-miR-222a in laying hens influenced H2S production by regulating methionine synthase genes in gut bacteria
Xing, Microbiome 2021 - “...differentially expressed microbial genes related to H 2 S production identified two methionine synthase genes, Odosp_3416 and BF9343_2953 , that are targeted by gga-miR-222a. Interestingly, in vitro fermentation results showed that gga-miR-222a upregulates the expression of these genes, which increased methionine concentrations but decreased H 2...”
- “...Desulfovibrio desulfuricans CK3_01000 (5.31) Unclassified Clostridiales SELR_06150 (4.94) Selenomonas ruminantium Bache_0784 (2.36) Bacteroides helcogenes MetH Odosp_3416 (8.48) Odoribacter splanchnicus Bacsa_0021 (5.67) Bacteroides salanitronis BF9343_2953 (5.31) Bacteroides fragilis NCTC9343 AspB BVU_0144 ( 5.37) Bacteroides vulgatus Bache_2087 ( 4.20) Bacteroides helcogenes PRU_1300 ( 3.66) Prevotella ruminicola OBV_25710 (...”
MLD56_13735 methionine synthase from Paenibacillus peoriae
Aligns to 895:1146 / 1146 (22.0%), covers 94.9% of PF02965, 202.2 bits
PPE_RS12455 methionine synthase from Paenibacillus polymyxa E681
Aligns to 895:1146 / 1146 (22.0%), covers 94.9% of PF02965, 200.2 bits
PPSC2_RS42420 methionine synthase from Paenibacillus polymyxa M1
Aligns to 895:1146 / 1146 (22.0%), covers 94.9% of PF02965, 198.6 bits
C1A50_RS13320 methionine synthase from Paenibacillus polymyxa
Aligns to 895:1146 / 1146 (22.0%), covers 94.9% of PF02965, 196.9 bits
GBAA4478 5-methyltetrahydrofolate--homocysteine methyltransferase from Bacillus anthracis str. 'Ames Ancestor'
Aligns to 889:1132 / 1132 (21.6%), covers 87.2% of PF02965, 172.5 bits
- Comparative Analysis of the Global Transcriptomic Response to Oxidative Stress of Bacillus anthracis htrA-Disrupted and Parental Wild Type Strains
Zaide, Microorganisms 2020 - “...failure of the htrA strain to respond to oxidative stress. Interestingly, the two genesGBAA2633 and GBAA4478 (belonging to the metal ion binding GO category)downregulated in the WT strain, encode a cysteine dioxygenase and a 5-methyltetrahydrofolate-homocysteine methyltransferase, respectively ( Figure 4 A). Cysteine dioxygenase (GBAA2633), which is...”
- “...cysteine, is downregulated 26-fold upon induction of oxidative stress. The second gene, homocysteine methyl transferase (GBAA4478), downregulated more than 3-fold, participates in the process of converting homocysteine to methionine. The downregulation of these two genes that are part of the biosynthesis of cysteine and methionine may...”
WP_108075232 methionine synthase from Vitiosangium sp. GDMCC 1.1324
Aligns to 940:1170 / 1170 (19.7%), covers 78.0% of PF02965, 164.5 bits
- 2-Hydroxysorangiadenosine: Structure and Biosynthesis of a Myxobacterial Sesquiterpene-Nucleoside
Okoth, Molecules (Basel, Switzerland) 2020 - “...Sensory transducer WP_146210122 92/74.69 sora12 509 Eudesmadiene transferase WP_108075230 100/73.80 sora13 1171 Methionine synthase (MetH) WP_108075232 100/97.61 sora14 299 SAM-dependent methyltransferase WP_108075233 100/97.32 sora15 292 Patatin lipid acyl hydrolases WP_108075234 100/98.97 sora16 375 Dehydrogenase WP_052519033 91/82.11 sora17 205 Tet R transcriptional regulator WP_073564266 100/79.62 sora18 147...”
SCO1657 methionine synthase from Streptomyces coelicolor A3(2)
Aligns to 955:1170 / 1170 (18.5%), covers 76.9% of PF02965, 143.3 bits
- Identification of metE as a second target of the sRNA scr5239 in Streptomyces coelicolor
Vockenhuber, PloS one 2015 - “...coelicolor two independent non-homologous enzymes can carry out this reaction: The cobalamin-dependent methionine synthase MetH (SCO1657) and the cobalamin-independent MetE (SCO0985). In the MetH catalysed reaction cobalamin serves as a methyl acceptor and donor giving MetH a roughly 50-fold higher turnover rate then its functional sibling...”
- Genome-scale analysis reveals a role for NdgR in the thiol oxidative stress response in Streptomyces coelicolor
Kim, BMC genomics 2015 - “...conditions. In addition, we observed low levels of NdgR binding at the promoters of metH (SCO1657) and leuA (SCO5559) relative to the other binding peaks. Taken together, these results show that binding locations of NdgR were successfully detected in vivo . Sequence analysis of NdgR-binding regions...”
- ArgR of Streptomyces coelicolor is a versatile regulator
Pérez-Redondo, PloS one 2012 - “...and the B 12 -dependent and the B 12 -independent methionine synthases MetH and MetE (SCO1657 and SCO0985, respectively). Two genes involved in sporulation regulation, and five genes for aerial mycelium formation are also included in this group ( Table S1 ). Type II genes For...”
- LAL regulators SCO0877 and SCO7173 as pleiotropic modulators of phosphate starvation response and actinorhodin biosynthesis in Streptomyces coelicolor
Guerra, PloS one 2012 - “...Only three SS genes are common to both mutants, namely aminotransferase SCO1054 , methionine synthase SCO1657 , and the lysyl-tRNA synthetase ( SCO3397 ), and all of them showed increased transcript levels in the mutants ( Table S2 ), which indicates a down-regulation of these genes...”
- Novel genes that influence development in Streptomyces coelicolor
Gehring, Journal of bacteriology 2004 - “...region of metH (Table 1) (36). The metH gene (SCO1657 or SCI46.02c) is inferred to encode the vitamin B12-dependent methionine synthase that catalyzes the final...”
WP_159536573 methionine synthase from Streptomyces sp. Tu 3180
Aligns to 941:1156 / 1158 (18.7%), covers 77.7% of PF02965, 142.8 bits
SYNPCC7002_A2466 5-methyltetrahydrofolate--homocysteine methyltransferase (methionine synthase) from Synechococcus sp. PCC 7002
Aligns to 923:1180 / 1180 (21.9%), covers 93.8% of PF02965, 131.7 bits
- Metagenomic analysis reveals potential interactions in an artificial coculture
Ren, AMB Express 2017 - “...corrinoids transport ( btuBFCD ) SYNPCC7002_A0634/0635/0637 MSTH_03067-03070 Cobalamin-associated enzymes Cobalamin-dependent methionine synthase ( metH ) SYNPCC7002_A2466 MSTH_00354/00815 PSTH_03850 Cobalamin-independent methionine synthase ( metE ) MSTH_01286 PSTH_01866 Methylmalonyl-CoA mutase MSTH_01813/02120 Cobalamin-dependent ribonucleotide reductase (class II) MSTH_00664 PSTH_00904 PSTH_00905 Cobalamin-independent ribonucleotide reductase (class I) SYNPCC7002_A1350 SYNPCC7002_A0382 PSTH_02138 PSTH_02139...”
- Complementation of Cobalamin Auxotrophy in Synechococcus sp. Strain PCC 7002 and Validation of a Putative Cobalamin Riboswitch In Vivo
Pérez, Journal of bacteriology 2016 - “...fragments of the metH gene (GenBank locus tag SYNPCC7002_A2466) were obtained by PCR with Synechococcus sp. strain PCC 7002 genomic DNA as the template...”
- “...a cobalamin-dependent methionine synthase gene (CyanoBase ID SYNPCC7002_A2466 [metH]), and bioinformatic analyses have suggested that this is probably the only...”
8sseA / Q5SKM5 Methionine synthase, c-terminal fragment, cobalamin and reactivation domains from thermus thermophilus hb8
Aligns to 243:507 / 507 (52.3%), covers 81.3% of PF02965, 127.0 bits
- Ligand: cobalamin (8sseA)
TTH_RS03220 methionine synthase from Thermus thermophilus HB8
Aligns to 921:1185 / 1185 (22.4%), covers 81.3% of PF02965, 124.7 bits
SY28_RS08890 methionine synthase from Meiothermus taiwanensis
Aligns to 947:1213 / 1213 (22.0%), covers 79.5% of PF02965, 124.6 bits
- Species-specific transcriptomic network inference of interspecies interactions
McClure, The ISME journal 2018 - “...each species. Specifically, the M. ruber metH gene (SY28_RS08890) which encodes methionine synthase, a B12-dependent enzyme, also had a large number of edges...”
- Indirect Interspecies Regulation: Transcriptional and Physiological Responses of a Cyanobacterium to Heterotrophic Partnership
Bernstein, mSystems 2017 - “...i and pO 2 treatments into opposing clusters D ( tll1027 ) and C ( SY28_RS08890 ), indicating that methionine may be directly exchanged from T. elongatus as growth requirements increase with the specific growth rate. Both strains also expressed vitamin B 12 -independent homocysteine methyltransferase...”
- “...decreased with I i , and they were grouped into cluster C, including metHX ( SY28_RS08890 and SY28_RS05725 ). Genes involved in cysteine biosynthesis shared common transcriptional patterning between species, indicating that while M. ruber may have salvaged cyanobacterium-derived methionine, it likely synthesized its own cysteine...”
ETSB_0394 methionine synthase from cyanobacterium endosymbiont of Epithemia turgida isolate EtSB Lake
Aligns to 933:1192 / 1192 (21.8%), covers 92.7% of PF02965, 120.0 bits
tll1027 5-methyltetrahydrofolate--homocysteine methyltransferase from Thermosynechococcus elongatus BP-1
Aligns to 922:1176 / 1176 (21.7%), covers 93.4% of PF02965, 115.0 bits
AWC07_11205 methionine synthase from Mycobacterium gastri
Aligns to 976:1195 / 1195 (18.4%), covers 76.9% of PF02965, 114.0 bits
- Cobalamin is present in cells of non-tuberculous mycobacteria, but not in Mycobacterium tuberculosis
Minias, Scientific reports 2021 - “...cobalt chelatase Rv2850c MAB_2985c MCNS_17540 Vitamin B12 dependent enzymes metH 5-Methyltetrahydrofolatehomocysteine methyltransferase Rv2124c MAB_2129 MCNS_30990 AWC07_11205 H0P51_RS04340 EET03_RS15385 mutB Methylmalonyl-CoA mutase Rv1493 MAB_2711c MCNS_22010 nrdZ Ribonucleotide reductase of class II Rv0570 AWC07_08365 Species M. kansasii M. persicum M. phlei M. porcinum M. terrae M. xenopi M.szulgai...”
SYNW1238 putative methionine synthase from Synechococcus sp. WH 8102
Aligns to 959:1209 / 1209 (20.8%), covers 93.4% of PF02965, 111.7 bits
CDN37_RS02225 methionine synthase from Mycobacterium persicum
Aligns to 976:1195 / 1195 (18.4%), covers 76.9% of PF02965, 111.6 bits
- Cobalamin is present in cells of non-tuberculous mycobacteria, but not in Mycobacterium tuberculosis
Minias, Scientific reports 2021 - “...MSMEG_0969 hemY ChlI component of cobalt chelatase SAMEA4434518_01694 Vitamin B12 dependent enzymes metH 5-Methyltetrahydrofolatehomocysteine methyltransferase CDN37_RS02225 MPHLCCUG_RS15920 A5717_31970 SAMEA4434518_01721 MXEN_01507 AWC27_RS09650 MSMEG_0093 mutB Methylmalonyl-CoA mutase SAMEA4434518_02142 MSMEG_3159 nrdZ Ribonucleotide reductase of class II MKAN_19005 MXEN_17528 We used RNA-Seq data available at ENA Database to estimate gene...”
EET03_RS15385 methionine synthase from Mycobacterium innocens
Aligns to 974:1192 / 1192 (18.4%), covers 76.9% of PF02965, 111.6 bits
- Cobalamin is present in cells of non-tuberculous mycobacteria, but not in Mycobacterium tuberculosis
Minias, Scientific reports 2021 - “...Rv2850c MAB_2985c MCNS_17540 Vitamin B12 dependent enzymes metH 5-Methyltetrahydrofolatehomocysteine methyltransferase Rv2124c MAB_2129 MCNS_30990 AWC07_11205 H0P51_RS04340 EET03_RS15385 mutB Methylmalonyl-CoA mutase Rv1493 MAB_2711c MCNS_22010 nrdZ Ribonucleotide reductase of class II Rv0570 AWC07_08365 Species M. kansasii M. persicum M. phlei M. porcinum M. terrae M. xenopi M.szulgai M. smegmatis...”
PMM0877 putative methionine synthase from Prochlorococcus marinus sp. MED4
Aligns to 937:1186 / 1186 (21.1%), covers 93.0% of PF02965, 111.1 bits
Rv2124c Probable 5-methyltetrahydrofolate--homocystein methyltransferase MetH (Methionine synthase, vitamin-B12 dependent isozyme) (MS) from Mycobacterium tuberculosis H37Rv
O33259 Methionine synthase from Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Aligns to 974:1192 / 1192 (18.4%), covers 76.9% of PF02965, 110.8 bits
- Dependency on host vitamin B12 has shaped Mycobacterium tuberculosis Complex evolution
Campos-Pardos, Nature communications 2024 - Cobalamin is present in cells of non-tuberculous mycobacteria, but not in Mycobacterium tuberculosis
Minias, Scientific reports 2021 - “...ChlI component of cobalt chelatase Rv2850c MAB_2985c MCNS_17540 Vitamin B12 dependent enzymes metH 5-Methyltetrahydrofolatehomocysteine methyltransferase Rv2124c MAB_2129 MCNS_30990 AWC07_11205 H0P51_RS04340 EET03_RS15385 mutB Methylmalonyl-CoA mutase Rv1493 MAB_2711c MCNS_22010 nrdZ Ribonucleotide reductase of class II Rv0570 AWC07_08365 Species M. kansasii M. persicum M. phlei M. porcinum M. terrae...”
- “...chelatase Rv2850c 135.66 6.78823001 38.01666667 3.454488224 81.53333333 115.3055458 Vitamin B12 dependent enzymes metH 5-Methyltetrahydrofolatehomocysteine methyltransferase Rv2124c 155.78 9.823003614 311.4966667 16.31473431 128.15 45.50090622 mutB Methylmalonyl-CoA mutase Rv1493 48.83 1.851323851 139.7433333 70.5155852 38.08333333 53.8579665 nrdZ Ribonucleotide reductase of class II Rv0570 60.79333333 1.360890232 366.2433333 120.7928051 119.6 101.265619 Studies...”
- The unfoldase ClpC1 of Mycobacterium tuberculosis regulates the expression of a distinct subset of proteins having intrinsically disordered termini
Lunge, The Journal of biological chemistry 2020 (secret) - Purifying Selective Pressure Suggests the Functionality of a Vitamin B12 Biosynthesis Pathway in a Global Population of Mycobacterium tuberculosis
Minias, Genome biology and evolution 2018 - “...metZ Rv0391 1,221 2.54 0.90 8 8 cobL Rv2072c 1,173 4.18 0.87 5 5 metH Rv2124c 3,579 2.93 0.84 14 13 hemD Rv0511 1,698 3.47 0.84 5 4 nrdZ Rv0570 2,054 3.65 0.76 11 10 cobK Rv2070c 735 5.85 0.72 5 3 cobB Rv2848c 1,374 1.97...”
- Identification of Mycobacterial Antigens in Human Urine by Use of Immunoglobulin G Isolated from Sera of Patients with Active Pulmonary Tuberculosis
Kim, Journal of clinical microbiology 2016 - “...Membrane transport protein mmpL8 Rv3823c 2 Methionine synthase Rv2124c 2 Molybdenum import ATP-binding protein Rv1859 1 Urine donors Serum donors Identified by...”
- Methylfolate Trap Promotes Bacterial Thymineless Death by Sulfa Drugs
Guzzo, PLoS pathogens 2016 - “...metH exhibited significantly increased sensitivity to SULFA treatment. In trans expression of H37Rv metH ( rv2124c ) restored SULFA resistance to both Rv metH and CDC1551 ( Fig 3E and 3F ). As previously suggested [ 39 ], the proliferation of CDC1551 in macrophages in the...”
- Phylogenetic analysis of vitamin B12-related metabolism in Mycobacterium tuberculosis
Young, Frontiers in molecular biosciences 2015 - “...B12-independent mechanism. Biosynthesis of methionine B12-dependent methionine synthesis M. tuberculosis has a B12-dependent methionine synthase (Rv2124c) with sequence characteristics matching the predominant form of MetH found in most actinomycetes (MetH a ). MetH catalyzes the B12-dependent synthesis of L-methionine (EC 2.1.1.13), utilizing L-homocysteine and 5-methyltetrahydrofolate (N...”
- Whole-genome-based Mycobacterium tuberculosis surveillance: a standardized, portable, and expandable approach
Kohl, Journal of clinical microbiology 2014 - “...definer into the core genome consisting of 3,257 genes (Rv2124c and Rv2407), and three SNPs are located in core genome genes for which the sequencing data did...”
- More
- Diverse protein regulations on PHA formation in Ralstonia eutropha on short chain organic acids
Lee, International journal of biological sciences 2009 - “...tetrahydropteroyltriglutamate--homocysteine methyltransferase 4 28 (25) Q8FQB2 Streptomyces coelicolor Methionine biosynthesis Methionine synthase 6 27 (22) O33259 Mycobacterium tuberclosis Methionine biosynthesis Glutamate 5-kinase 3 35 (34) Q7N7B2 Photorhabdus luminescens subsp. laumondii Proline biosynthesis Putative cystathionine gamma-lyase 2 29 (21) Q59829 Streptomyces coelicolor Cysteine biosynthesis Acetylornitine aminotransferase 2...”
PMT0729 putative methionine synthase from Prochlorococcus marinus str. MIT 9313
Aligns to 965:1214 / 1214 (20.6%), covers 93.4% of PF02965, 108.0 bits
RGRSB_0352 methionine synthase from cyanobacterium endosymbiont of Rhopalodia gibberula
Aligns to 933:1192 / 1192 (21.8%), covers 93.0% of PF02965, 107.7 bits
NIS_RS03035 methionine synthase from Nitratiruptor sp. SB155-2
Aligns to 895:1148 / 1148 (22.1%), covers 74.4% of PF02965, 106.6 bits
cg1701 homocysteine methyltransferase from Corynebacterium glutamicum ATCC 13032
Aligns to 978:1196 / 1196 (18.3%), covers 76.9% of PF02965, 105.8 bits
metH / Q8NQD1 cobalamin-dependent methionine synthase (EC 2.1.1.13) from Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / BCRC 11384 / JCM 1318 / LMG 3730 / NCIMB 10025) (see paper)
Aligns to 1003:1221 / 1221 (17.9%), covers 76.9% of PF02965, 105.8 bits
MXEN_01507 methionine synthase from Mycobacterium xenopi RIVM700367
Aligns to 974:1192 / 1192 (18.4%), covers 76.9% of PF02965, 104.3 bits
- Cobalamin is present in cells of non-tuberculous mycobacteria, but not in Mycobacterium tuberculosis
Minias, Scientific reports 2021 - “...of cobalt chelatase SAMEA4434518_01694 Vitamin B12 dependent enzymes metH 5-Methyltetrahydrofolatehomocysteine methyltransferase CDN37_RS02225 MPHLCCUG_RS15920 A5717_31970 SAMEA4434518_01721 MXEN_01507 AWC27_RS09650 MSMEG_0093 mutB Methylmalonyl-CoA mutase SAMEA4434518_02142 MSMEG_3159 nrdZ Ribonucleotide reductase of class II MKAN_19005 MXEN_17528 We used RNA-Seq data available at ENA Database to estimate gene expression through transcripts per...”
SSPN_RS0127935 methionine synthase from Saccharopolyspora spinosa NRRL 18395
Aligns to 932:1188 / 1188 (21.6%), covers 76.9% of PF02965, 104.1 bits
ML1307 5-methyltetrahydrofolate-homocysteine methyltransferase from Mycobacterium leprae TN
Aligns to 989:1206 / 1206 (18.1%), covers 73.3% of PF02965, 99.9 bits
- Mycobacterium leprae Transcriptome During In Vivo Growth and Ex Vivo Stationary Phases
Ojo, Frontiers in cellular and infection microbiology 2021 - “...(ML2323c), asd (ML2322c), thrA (ML1129), metB (ML2394c), metA/X (ML0682c), metZ (ML0275c), metE (ML0961c) and metH (ML1307) were transcriptionally active in M. leprae under all conditions tested ( Figure4B ). All the genes of this probable alternate pathway were upregulated under axenic conditions with the exception of...”
PFREUD_11340 methionine synthase from Propionibacterium freudenreichii subsp. shermanii CIRM-BIA1
Aligns to 911:1163 / 1163 (21.8%), covers 76.9% of PF02965, 99.0 bits
Nmar_1267 Methionine synthase from Nitrosopumilus maritimus SCM1
Aligns to 612:832 / 832 (26.6%), covers 93.0% of PF02965, 85.0 bits
- Aquatic metagenomes implicate Thaumarchaeota in global cobalamin production
Doxey, The ISME journal 2015 - “...maritimus and other Thaumarchaeota were also found to encode cobalamin-dependent enzymes such as methionine synthase (Nmar_1267), ribonucleotide reductase (Nmar_1627), and methylmalonyl CoA mutase (B 12 binding domain, Nmar_0958), as well as probable cobalt transporters (Nmar_0878). As further support for cobalamin biosynthetic potential, we identified dual cob/cbi...”
BT_0342 conserved hypothetical protein from Bacteroides thetaiotaomicron VPI-5482
Aligns to 30:256 / 257 (88.3%), covers 63.0% of PF02965, 63.5 bits
- Gut Commensal Bacteroidetes Encode a Novel Class of Vitamin B12-Binding Proteins
Putnam, mBio 2022 - “...complexes, including MetH (B 12 -dependent methionine synthase; BT_0180), Mta (methylamine/trimethylamine methyltransferase corrinoid proteins; BT_0340, BT_0342, BT_0343), HpnR / Hyp (B 12 -binding domain/radical SAM domain protein; BT_0640), MutAB (methylmalonyl-CoA mutase; BT_2090 and BT_2091), and NrdJ (B 12 -dependent ribonucleotide reductase; BT_2145) ( 12 , 16...”
Or search for genetic data about PF02965 in the Fitness Browser
by Morgan Price,
Arkin group
Lawrence Berkeley National Laboratory