Family Search for PF03458 (Gly_transporter)

April 2024: See Interactive Tools for Functional Annotation of Bacterial Genomes for advice on using these tools.

Running HMMer for PF03458

PF03458 hits 37 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.

TC 1.A.62.2.1 / A0M015 Bacterial TRIC family homologue from Gramella forsetii (strain KT0803) (see paper)
2 alignments in 10:171 / 215 (71.2%), covering up to 97.4% of PF03458, 171.9 bits

• substrates: Metabolites, cations, ions
• Bioinformatic characterization of the trimeric intracellular cation-specific channel protein family.
  Silverio, The Journal of membrane biology 2011
  • “...e 70 with BLAST. The latter protein is closely related to a Bacteroides protein (Acc A0M015) with a BLAST e value of e 26 . Comparison of the frog protein with the Bacteroides protein using the IC program, confirmed with the GAP program, yielded a comparison...”
  • “...Acc Q6GN30); the prokaryotic group is represented by a Gramella forsetii protein (gi 117577491, Acc A0M015). The IC program was used to identify the most similar pair of proteins. The GAP program was used to produce the alignment and confirm homology with default settings and 500...”

TC 1.A.62.2.4 / A4WTL9 TRIC family homologue of 213 aas and 7 TMSs; it's high resolution 3-d structure is known (PDB# 5H36). TRIC channels are implicated in Ca2+ signaling and homeostasis from Rhodobacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
2 alignments in 7:168 / 213 (71.8%), covering up to 97.4% of PF03458, 162.2 bits

• substrates: Ca2+
  tcdb comment: Kasuya et al. 2016 presented crystal structures of two prokaryotic TRIC channels in the closed state and conducted structure-based functional analyses of these channels. Each trimer subunit consists of seven TMSs with two inverted 3 TMS repeats (Silverio and Saier 2011). The electrophysiological, biochemical and biophysical analyses revealed that TRIC channels possess an ion-conducting pore within each subunit, and that trimer formation contributes to the stability of the protein. The symmetrically related TMS2 and TMS5 helices are kinked at conserved glycine clusters, and these kinks are important for channel activity. The kinks in TMS2 and TMS5 generate lateral fenestrations at each subunit interface that are occupied by lipid molecules (Kasuya et al. 2016)

SO1319 putative transporter, required for glycine utilization from Shewanella oneidensis MR-1
2 alignments in 6:168 / 208 (73.6%), covering up to 96.2% of PF03458, 162.0 bits

• mutant phenotype: PFam PF03458.9 (UPF0126). conserved specific phenotype of UPF0126

SO3342 putative transporter, required for L-alanine utilization from Shewanella oneidensis MR-1
2 alignments in 9:169 / 213 (71.4%), covering up to 96.2% of PF03458, 157.5 bits

• mutant phenotype: PFam PF03458.9 (UPF0126). conserved specific phenotype of UPF0126

Shewana3_1204 putative transporter, required for glycine and L-alanine utilization from Shewanella sp. ANA-3
2 alignments in 9:169 / 213 (71.4%), covering up to 96.2% of PF03458, 157.4 bits

• mutant phenotype: PFam PF03458.9 (UPF0126). Substrates are from the conserved specific phenotypes of UPF0126

PG0587 yadS protein from Porphyromonas gingivalis W83
PGN_0633 hypothetical protein from Porphyromonas gingivalis ATCC 33277
EG14_09225, PGTDC60_1713 trimeric intracellular cation channel family protein from Porphyromonas gingivalis TDC60
2 alignments in 13:173 / 210 (72.4%), covering up to 97.4% of PF03458, 155.6 bits

• Identification and characterization of a minisatellite contained within a novel miniature inverted-repeat transposable element (MITE) of Porphyromonas gingivalis
  Klein, Mobile DNA 2015
  • “...protease (Peptidase C10) prtT - BrickBuilt_10 PGN_0632 PG0585 PGTDC60_1709 EG14_09225 Aspartyl-tRNA amidotransferase B + PGN_0633 PG0587 PGTDC60_1713 EG14_09235 Membrane protein putative ion channel btuF - BrickBuilt_11 PGN_0667 PG0625 PGTDC60_1753 EG14_09060 GTP cyclohydrolase I/PorSS CTD folE + PGN_0668 PG0627 PGTDC60_1756 EG14_09045 RNA-binding protein/PorSS CTD - BrickBuilt_12 PGN_0819...”
• Identification and characterization of a minisatellite contained within a novel miniature inverted-repeat transposable element (MITE) of Porphyromonas gingivalis
  Klein, Mobile DNA 2015
  • “...Serine protease (Peptidase C10) prtT - BrickBuilt_10 PGN_0632 PG0585 PGTDC60_1709 EG14_09225 Aspartyl-tRNA amidotransferase B + PGN_0633 PG0587 PGTDC60_1713 EG14_09235 Membrane protein putative ion channel btuF - BrickBuilt_11 PGN_0667 PG0625 PGTDC60_1753 EG14_09060 GTP cyclohydrolase I/PorSS CTD folE + PGN_0668 PG0627 PGTDC60_1756 EG14_09045 RNA-binding protein/PorSS CTD - BrickBuilt_12...”
• Identification and characterization of a minisatellite contained within a novel miniature inverted-repeat transposable element (MITE) of Porphyromonas gingivalis
  Klein, Mobile DNA 2015
  • “...- PGN_0559 PG1550 PGTDC60_0751 EG14_03655 Serine protease (Peptidase C10) prtT - BrickBuilt_10 PGN_0632 PG0585 PGTDC60_1709 EG14_09225 Aspartyl-tRNA amidotransferase B + PGN_0633 PG0587 PGTDC60_1713 EG14_09235 Membrane protein putative ion channel btuF - BrickBuilt_11 PGN_0667 PG0625 PGTDC60_1753 EG14_09060 GTP cyclohydrolase I/PorSS CTD folE + PGN_0668 PG0627 PGTDC60_1756 EG14_09045...”
  • “...(Peptidase C10) prtT - BrickBuilt_10 PGN_0632 PG0585 PGTDC60_1709 EG14_09225 Aspartyl-tRNA amidotransferase B + PGN_0633 PG0587 PGTDC60_1713 EG14_09235 Membrane protein putative ion channel btuF - BrickBuilt_11 PGN_0667 PG0625 PGTDC60_1753 EG14_09060 GTP cyclohydrolase I/PorSS CTD folE + PGN_0668 PG0627 PGTDC60_1756 EG14_09045 RNA-binding protein/PorSS CTD - BrickBuilt_12 PGN_0819 PG0796...”

YadS / b0157 PF03458 family protein YadS from Escherichia coli K-12 substr. MG1655 (see 2 papers)
b0157 conserved inner membrane protein from Escherichia coli str. K-12 substr. MG1655
2 alignments in 4:166 / 207 (73.9%), covering up to 98.7% of PF03458, 153.5 bits

• Human body temperature (37degrees C) increases the expression of iron, carbohydrate, and amino acid utilization genes in Escherichia coli K-12
  White-Ziegler, Journal of bacteriology 2007
  • “...General function prediction or function unknown yadS b0157 Putative membrane protein 2.2 Continued on following page Downloaded from http://jb.asm.org/ on April...”
• YdgG (TqsA) controls biofilm formation in Escherichia coli K-12 through autoinducer 2 transport
  Herzberg, Journal of bacteriology 2006
  • “...b2236 4 4 4 4 4 yfaA yadS b0370 b2230 b0157 b0370 4 4 4 ORF, hypothetical protein ORF, hypothetical protein ORF, hypothetical protein; related to phage ORF,...”
• Global impact of sdiA amplification revealed by comprehensive gene expression profiling of Escherichia coli
  Wei, Journal of bacteriology 2001
  • “...same method. Discrepancies in the measurements of the b0157 (1.5-fold increase in reverse transcriptase PCR (RT-PCR) versus an 11-fold increase in the...”

PA1037 hypothetical protein from Pseudomonas aeruginosa PAO1
2 alignments in 4:165 / 206 (74.3%), covering up to 97.4% of PF03458, 153.1 bits

• A shotgun antisense approach to the identification of novel essential genes in Pseudomonas aeruginosa
  Rusmini, BMC microbiology 2014
  • “...name and product annotation c Function class c Species containing orthologs in DEG d E6 PA1037 yicG - conserved hypothetical protein (4) Hypothetical, unclassified, unknown PA1038 hypothetical protein (4) PA1039 ychJ - hypotetical protein (4) PA1040 hypothetical protein (4) S9B6a PA1089 conserved hypothetical protein (4) Hypothetical,...”

PFL_0559 membrane protein, putative from Pseudomonas fluorescens Pf-5
2 alignments in 3:164 / 203 (75.4%), covering up to 97.4% of PF03458, 152.9 bits

• Carbazole-degradative IncP-7 plasmid pCAR1.2 is structurally unstable in Pseudomonas fluorescens Pf0-1, which accumulates catechol, the intermediate of the carbazole degradation pathway
  Takahashi, Applied and environmental microbiology 2009
  • “...of the Km resistance gene was located in Pfl_0559 (encoding N-acylglucosamine 2-epimerase) by direct sequencing as described previously (34) using the primer...”
  • “...specific for repA and carAc of pCAR1.2 and Pfl_0559 of the Pf0-1Km chromosome. Determination of the growth profiles of the plasmid-harboring strains. A 40%...”

PS417_02455 putative transporter, required for glycine utilization from Pseudomonas simiae WCS417
2 alignments in 3:164 / 204 (75.0%), covering up to 97.4% of PF03458, 152.5 bits

• mutant phenotype: PFam PF03458.9 (UPF0126). Substrate is a conserved specific phenotype of UPF0126

AO353_13110 putative transporter, required for glycine utilization from Pseudomonas fluorescens FW300-N2E3
2 alignments in 3:164 / 203 (75.4%), covering up to 97.4% of PF03458, 152.1 bits

• mutant phenotype: PFam PF03458.9 (UPF0126). conserved specific phenotype of UPF0126

Pf6N2E2_3621 putative transporter, required for glycine utilization from Pseudomonas fluorescens FW300-N2E2
2 alignments in 3:163 / 203 (74.9%), covering up to 97.4% of PF03458, 152.1 bits

• mutant phenotype: PFam PF03458.9 (UPF0126). conserved specific phenotype of UPF0126

PP4901 conserved hypothetical protein from Pseudomonas putida KT2440
2 alignments in 3:164 / 203 (75.4%), covering up to 97.4% of PF03458, 150.6 bits

• Simultaneous catabolite repression between glucose and toluene metabolism in Pseudomonas putida is channeled through different signaling pathways
  del, Journal of bacteriology 2007
  • “...PP1982 (ibpA) PP3735 PP3961 PP1687 PP2644 PP3353 PP4561 PP4901 PP4981 PP4982 a Family Probable toluene porin Probable toluene porin Toluene monooxygenase Benzyl...”

NT01EI_3103 hypothetical protein from Edwardsiella ictaluri 93-146
2 alignments in 4:166 / 203 (75.4%), covering up to 97.4% of PF03458, 150.5 bits

• Transposon mutagenesis and identification of mutated genes in growth-delayed Edwardsiella ictaluri
  Kalindamar, BMC microbiology 2019
  • “...protein 3.00E-25 7 Eis175 NT01EI_3774 IS1 transposase 7.00E-93 19 Eis176 NT01EI_0962 esaT 5.00E-129 27 Eis180 NT01EI_3103 UPF0126 domain protein 7.00E-12 16 Eis183 NT01EI_3105 Chloride transporter, chloride channel (ClC) family 6.00E-166 53 Eis184 NT01EI_0419 RNA methyltransferase, TrmH family, group 3 9.00E-27 21 Eis185 NT01EI_3386 TRAP transporter, DctM...”

PfGW456L13_161 putative transporter, required for glycine utilization from Pseudomonas fluorescens GW456-L13
2 alignments in 3:164 / 203 (75.4%), covering up to 97.4% of PF03458, 149.8 bits

• mutant phenotype: PFam PF03458.9 (UPF0126). conserved specific phenotype of UPF0126

VC2115 conserved hypothetical protein from Vibrio cholerae O1 biovar eltor str. N16961
2 alignments in 4:165 / 207 (73.9%), covering up to 96.2% of PF03458, 148.5 bits

• Expansion of the SOS regulon of Vibrio cholerae through extensive transcriptome analysis and experimental validation
  Krin, BMC genomics 2018
  • “...398 and 547) and seven genes ( rtxH, smpA , VC0025, VC0424, VC0484, VC1272 and VC2115) highly expressed and/or induced by MMC treatment were not found to be involved in UV and MMC resistance. Among the 17 genes shown to play a role in UV resistance,...”

DVU2672 membrane protein, putative from Desulfovibrio vulgaris Hildenborough
2 alignments in 6:167 / 207 (73.9%), covering up to 97.4% of PF03458, 146.9 bits

• Prediction and Characterization of Missing Proteomic Data in Desulfovibrio vulgaris
  Li, Comparative and functional genomics 2011
  • “...x Outer membrane protein, OMP85 family DVU2356 20.54 6021.30 x 36.26 7883.90 x Membrane protein DVU2672 3.30 3253.30 x 4.47 5875.90 x Membrane protein DVU2725 5.20 4925.80 x 13.97 8894.70 x Membrane protein Cellular processes DVU0302 28.35 22358.00 x 37.21 21180.00 x Chemotaxis protein CheX DVU2069...”

CJJ81176_RS02890 trimeric intracellular cation channel family protein from Campylobacter jejuni subsp. jejuni 81-176
CJJ81176_0621 hypothetical protein from Campylobacter jejuni subsp. jejuni 81-176
Cj0593c putative integral membrane protein from Campylobacter jejuni subsp. jejuni NCTC 11168
2 alignments in 9:170 / 210 (72.4%), covering up to 94.9% of PF03458, 146.0 bits

• Horizontal genetic exchange of chromosomally encoded markers between Campylobacter jejuni cells
  Samarth, PloS one 2020
  • “...genome (the genomic regions from ciaB , motAB , docB , kpsE , cstII and CJJ81176_RS02890 ). We used 5 l of PCR reaction to run agarose gel electrophoresis and found that all six genomic regions were effortlessly amplified from the cell-free culture supernatant, producing the...”
  • “...represent the PCR products from ciaB , motAB , docB , kpsE , cstII and CJJ81176_RS02890 regions, respectively. Recombination in presence of chicken cecal supernatant In this experiment, we aimed to study HGT in the presence of a chicken cecal extract. Since the chicken intestinal tract...”
• Horizontal genetic exchange of chromosomally encoded markers between Campylobacter jejuni cells
  Samarth, PloS one 2020
  • “.... Primer3-r TCAACCCAAACCATGAAAGA Primer4-f TGTTTTGCTATCGCAAGCTG Primers used to amplify genomic region (Locus tag CJJ81176_0620 and CJJ81176_0621 ) of C . jejuni . Primer4-r TATCATAGCCGTTGCTGCTG Primer5-f TCAATCAAACGCCTAAGTATGG Primers used to amplify the ciaB genomic region of C . jejuni . Primer5-r ACAACGCGTTCAGGAGAAAG Primer6-f TCGCTCTTCGCATAAAACAA Primers used to...”
• Metabolic and fitness determinants for in vitro growth and intestinal colonization of the bacterial pathogen Campylobacter jejuni
  Gao, PLoS biology 2017
  • “...hypothetical protein CJJ81176_0367 7.85 0.00 6.40 hypothetical protein CJJ81176_0427 * 7.14 0.00 1.79 hypothetical protein CJJ81176_0621 * 7.70 0.00 0.40 integral membrane protein CJJ81176_0840 * 6.24 0.04 1.43 membrane protein CJJ81176_0901 * 6.84 0.01 0.59 putative periplasmic protein CJJ81176_1031 * 6.27 0.04 0.71 membrane protein CJJ81176_1118...”
• Transcriptional regulation of the CmeABC multidrug efflux pump and the KatA catalase by CosR in Campylobacter jejuni
  Hwang, Journal of bacteriology 2012
  • “...-2.990 0.00711 0.00907 0.00898 Function unknown Cj0573 Cj0593c Cj0776c Cj0880c Cj1725 ctsR glpT Cj0573 Cj0593c Cj0776c Cj0880c Cj1725 Cj1475c Cj0292c Putative...”
• Identification of Campylobacter jejuni genes contributing to acid adaptation by transcriptional profiling and genome-wide mutagenesis
  Reid, Applied and environmental microbiology 2008
  • “...as a number of genes of unknown function (Cj0417, Cj0593c, Cj0660c, Cj0990c, Cj1056c, and Cj1089c). Notably, within cluster C are two genes (Cj0414 and Cj0415)...”

YicG / b3646 PF03458 family inner membrane protein YicG from Escherichia coli K-12 substr. MG1655 (see 2 papers)
b3646 orf, hypothetical protein from Escherichia coli str. K-12 substr. MG1655
2 alignments in 4:165 / 205 (74.6%), covering up to 97.4% of PF03458, 145.8 bits

• Separation of the bacterial species, Escherichia coli, from mixed-species microbial communities for transcriptome analysis
  Dai, BMC microbiology 2011
  • “...DNA-binding transcriptional regulator flhE b1878 -2.7 1.2 -3.2 1.2 -1.8 (-1.7, -2.0) Conserved protein yicG b3646 -3.0 1.2 -4.6 1.3 -3.7 (-3.3, -4.1) Conserved inner membrane protein # Fold-changes of gene expression were significantly different from 2, with one-tail t-tests performed (p < 0.05). * Sorted...”

Z5071 orf, hypothetical protein from Escherichia coli O157:H7 EDL933
2 alignments in 22:183 / 223 (68.6%), covering up to 97.4% of PF03458, 145.2 bits

• Comparison of strand-specific transcriptomes of enterohemorrhagic Escherichia coli O157:H7 EDL933 (EHEC) under eleven different environmental conditions including radish sprouts and cattle feces
  Landstorfer, BMC genomics 2014
  • “...(1) 1.5 (3) 5.1 (11) 2.1 (0) 2.4 (4) 2.1 (3) 2.1 (0) 2.1 (0) Z5071 inner membrane protein LB-antibiotics 1 (4) 0.7 (1) 1.9 (2) 0.5 (5) 0.7 (2) 5.7 (51) 2.4 (7) 4.4 (0) 1.2 (5) 0.5 (3) 4.4 (0) Z5212 hypothetical protein LB-antibiotics...”

YPK_4174 hypothetical protein from Yersinia pseudotuberculosis YPIII
2 alignments in 4:165 / 205 (74.6%), covering up to 97.4% of PF03458, 145.1 bits

• Genome-Scale Mapping Reveals Complex Regulatory Activities of RpoN in Yersinia pseudotuberculosis
  Mahmud, mSystems 2020
  • “...10.1 54,70,24 YPK_4151 NA 133, 191 IrGS48 4602274 5.6 4.2 4.0 TTGGCGCACAAATTGCTC + 10.1 NA YPK_4174 NA NA IrGS49 4612122 5.6 4.2 4.0 ATGGCACGCTAGTTGCGG 10.6 54,70,24 YPK_4181 V NA 173, 123 Intragenic antisense (D sites) IrGAs1 128696 3.0 NA NA CTGGCCCAATACATGCAT 10.1 54,28,24,32 YPK_0107 YPK_105, YPK_106...”

STM3738 putative inner membrane protein from Salmonella typhimurium LT2
2 alignments in 4:165 / 205 (74.6%), covering up to 97.4% of PF03458, 145.0 bits

• Inorganic Polyphosphate Is Essential for Salmonella Typhimurium Virulence and Survival in Dictyostelium discoideum
  Varas, Frontiers in cellular and infection microbiology 2018
  • “...protein STM14_4698 STM3901 ilvG Acetolactate synthase 2 catalytic subunit STM14_4760 STM3957 pldA Phospholipase A STM14_4785 STM3738 yigC 3-octaprenyl-4-hydroxybenzoate decarboxylase STM14_4789 STM3983 fadB Multifunctional fatty acid oxidation complex subunit alpha STM14_5386 STM4489 Putative DNA helicase STM14_5404 STM4503 Putative inner membrane protein STM14_5437 STM4525 hsdM DNA methylase M...”

lpg2725 inner membrane protein from Legionella pneumophila subsp. pneumophila str. Philadelphia 1
2 alignments in 4:165 / 209 (73.2%), covering up to 96.2% of PF03458, 144.8 bits

• Genomic Analysis Reveals Novel Diversity among the 1976 Philadelphia Legionnaires' Disease Outbreak Isolates and Additional ST36 Strains
  Mercante, PloS one 2016
  • “...(lpg1912) Framshift causes premature stop at codon 38 Del T 1 3,088,004 3,077,599 Hypothetical protein (lpg2725) Frameshift creates premature stop at codon 204 G T 1 3,151,187 3,140,784 nuoB2 (lpg2788) Synonymous Deletion 181 3,258,530 3,248,127 ptsP (lpg2871) Frameshift creates premature stop at codon 631 Philadelphia-4 G...”
  • “...1 2,539,995 2,491,740 Downstream of hypothetical protein (lpg2207) Unknown Insertion 2 3,125,898 3,077,599 Hypothetical protein (lpg2725) Frameshift creates premature stop at codon 194 A G 1 3,197,722 3,149,427 ftsH (lpg2796) I478T T C 1 3,296,986 3,248,468 ptsP (lpg2871) Q495R ATCC Philadelphia-1 Insertion 37,890 173,321 173,321 Downstream...”

PMI2861 hypothetical protein from Proteus mirabilis HI4320
2 alignments in 4:164 / 205 (74.1%), covering up to 96.2% of PF03458, 142.0 bits

• Pathogenesis of Proteus mirabilis Infection
  Armbruster, EcoSal Plus 2018
  • “...PMI1608 Unknown; biofilm-deficient in crystal violet assay but blocks catheters more rapidly ( 177 ) PMI2861 Putative membrane protein ( 177 ) PMI3402 MuA-like DNA binding protein; mutant has increased biofilm in crystal violet assay and blocks catheters more rapidly ( 177 ) Table 8 Iron-related...”
• Elucidating the genetic basis of crystalline biofilm formation in Proteus mirabilis
  Holling, Infection and immunity 2014
  • “...NHSH1 PMI1608 ABBF1.1C8 NHSE5 PMI2867 PMI1551 DLD1A6 PMI2861 DLD1D11 STS8.1D7 PMI0696d PMI1479e glnE gltS lrp nirB Urease production (mean SD)c Swimming...”

TC 1.A.62.3.1 / Q981D4 Archaeal TRIC family homologue of 205 aas and 7 TMSs from Sulfolobus solfataricus (see paper)
SSO0012 Conserved hypothetical protein from Sulfolobus solfataricus P2
2 alignments in 6:169 / 205 (74.6%), covering up to 97.4% of PF03458, 141.6 bits

• substrates: potassium ions, sodium ions
  tcdb comment: In animals, Ca2+ release from the sarcoplasmic reticulum (SR) or endoplasmic reticulum (ER) is crucial for muscle contraction, cell growth, apoptosis, learning and memory. The eukaryotic TRIC channels are cation channels balancing the SR and ER membrane potentials, and are implicated in Ca2+ signaling and homeostasis.Kasuya et al. 2016 presented crystal structures of two prokaryotic TRIC channels in the closed state and conducted structure-based functional analyses of these channels. Each trimer subunit consists of seven TMSs with two inverted 3 TMS repeats (Silverio and Saier 2011). The electrophysiological, biochemical and biophysical analyses revealed that TRIC channels possess an ion-conducting pore within each subunit, and that trimer formation contributes to the stability of the protein. The symmetrically related TMS2 and TMS5 helices are kinked at conserved glycine clusters, and these kinks are important for channel activity. The kinks in TMS2 and TMS5 generate lateral fenestrations at each subunit interface that are occupied by lipid molecules (Kasuya et al. 2016). TRIC channels are involved in K+ uptake in prokaryotes, and have ion-conducting pores contained within each monomer. In a 2.2-Å resolution K+-bound structure, ion/water densities have been resolved inside the pore (PDB# 5H35) (Su et al. 2017). At the central region, a filter-like structure is shaped by the kinks on the second and fifth transmembrane helices and two nearby phenylalanine residues. Below the filter, the cytoplasmic vestibule is occluded by a plug-like motif attached to an array of pore-lining charged residues (Kasuya et al. 2016). The asymmetric filter-like structure at the pore center of SsTRIC may serve as a basis for the channel to bind and select monovalent cations, K+ and Na+ (Ou et al. 2017)
• Bioinformatic characterization of the trimeric intracellular cation-specific channel protein family
  Silverio, The Journal of membrane biology 2011
  • “...protein (GenBank index (gi) 121957073) and an archaeal protein, the Sulfolobus solfataricus P2 hypothetical protein SSO0012 (gi 15896983). Further statistical analyses allowed us to establish that TRIC homologs occur throughout the three domains of life (see Matias et al. 2010 and Wang et al. 2009 for...”
• Bioinformatic characterization of the trimeric intracellular cation-specific channel protein family.
  Silverio, The Journal of membrane biology 2011
  • “...protein (TC 1.A.62.1.1, Acc Q3TMP8) and the prokaryotic (archaeal) S. solfataricus protein (TC 1.A.62.3.1, Acc Q981D4). The former protein is closely related to a frog homolog (Acc Q6GN30) where the two proteins gave an e value of e 70 with BLAST. The latter protein is closely...”

TC 1.A.62.3.2 / Q9RKM3 UPF0126 of 7 TMSs. Adjacent to genes encoding a putative oligopeptide ABC uptake permease that controls sporulation and actinorhodin production (TC#3.A.1.5.34) from Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
SCO4104 integral membrane protein from Streptomyces coelicolor A3(2)
2 alignments in 9:171 / 218 (70.6%), covering up to 97.4% of PF03458, 139.7 bits

• substrates: Oligopeptides
• An unusual response regulator influences sporulation at early and late stages in Streptomyces coelicolor
  Tian, Journal of bacteriology 2007
  • “...reduced in both whiI null and D27A mutantsd SCO4104 SCO4393 SCO4761 SCO5315* SCO6197 SCO0681 rdlA groES whiE SCO0682 SCO1366* SCO1367 SCO2008* SCO2009 SCO2162...”

Psest_1636 putative transporter, required for glycine utilization from Pseudomonas stutzeri RCH2
2 alignments in 5:166 / 208 (73.6%), covering up to 96.2% of PF03458, 139.4 bits

• mutant phenotype: PFam PF03458.9 (UPF0126). conserved specific phenotype of UPF0126

BCAM2631 hypothetical protein from Burkholderia cenocepacia J2315
2 alignments in 2:163 / 203 (75.4%), covering up to 97.4% of PF03458, 137.6 bits

• Identification of potential CepR regulated genes using a cep box motif-based search of the Burkholderia cenocepacia genome
  Chambers, BMC microbiology 2006
  • “...2:1060868 scpB : serine-carboxyl proteinase precursor + K56-I2-P5, K56-I2-P10 BCAS0293 3:328037 3:328810 aidA + K56-I2-P9 BCAM2631 2:2981279 2:2980753 COG2860: predicted membrane protein - K56-I2-P12 BCAM2630 2:2979794 2:2980345 phuV : hemin specific ATP-binding protein + K56-I2-2PB2 no gene 2:2980336 - K56-I2-NB12 BCAM1187 2:1298085 2:1297891 COG4774, Outer membrane...”

I35_6528 trimeric intracellular cation channel family protein from Burkholderia cenocepacia H111
2 alignments in 2:163 / 203 (75.4%), covering up to 97.4% of PF03458, 137.0 bits

• Biosynthesis of fragin is controlled by a novel quorum sensing signal
  Jenul, Nature communications 2018
  • “...(I35_2670 I35_2671). In addition, a hemin transport system (I35_6523I35_6526) and two neighbor genes (I35_6527 and I35_6528) are also upregulated in the H111 hamD mutant and therefore downregulated by valdiazen. Comparison of the transcriptome of the wild type with the one of the hamD mutant in the...”

BPSS0239 putative membrane protein from Burkholderia pseudomallei K96243
2 alignments in 2:163 / 202 (75.7%), covering up to 96.2% of PF03458, 136.6 bits

• A genomic survey of positive selection in Burkholderia pseudomallei provides insights into the evolution of accidental virulence
  Nandi, PLoS pathogens 2010
  • “...BPSL3288- BPSL3330 ) [56] , siderophore biosynthesis and iron metabolism genes ( BPSL1771- BPSL1787 , BPSS0239- BPSS0244 , BPSS0581- BPSS0588 ) [57] , and fimbrae/pili ( BPSL2026- BPSL2031 , BPSS1593- BPSS1605 ) [45] ( Figure 5F , Table S9A and S9B ). Taken collectively, these findings...”

SMc00330 PUTATIVE TRANSMEMBRANE PROTEIN from Sinorhizobium meliloti 1021
2 alignments in 5:166 / 211 (72.5%), covering up to 97.4% of PF03458, 133.2 bits

• Transcriptomic Insight in the Control of Legume Root Secondary Infection by the Sinorhizobium meliloti Transcriptional Regulator Clr
  Zou, Frontiers in microbiology 2017
  • “...-1,149 smc02588 Putative permease ABC transport protein -1,0468 -1,1399 smc01957 Conserved hypothetical protein -1,0356 -1,0588 smc00330 Putative transmembrane protein -1,312 -1,0338 smc01949 LivG branched aminoacid transport protein -1,0369 -1,0298 smc01931 Conserved hypothetical transmembrane protein -1,0284 -1,0104 Genes showing up- or down-regulation in both aerobic or microoxic...”

Spy49_1321c hypothetical protein from Streptococcus pyogenes NZ131
2 alignments in 7:168 / 205 (74.1%), covering up to 96.2% of PF03458, 132.7 bits

• Effects of the ERES pathogenicity region regulator Ralp3 on Streptococcus pyogenes serotype M49 virulence factor expression
  Siemens, Journal of bacteriology 2012
  • “...spy49_0673 spy49_0674 spy49_0830 spy49_1024 spy49_1321c spy49_1322c spy49_1323c spy49_1324c spy49_1325c spy49_1326c spy49_1577c spy49_1578c spy49_1579c...”

HVO_0780 UPF0126 domain protein from Haloferax volcanii DS2
2 alignments in 22:185 / 218 (69.7%), covering up to 96.2% of PF03458, 132.1 bits

• Deciphering a pathway of Halobacterium salinarum N-glycosylation
  Kandiba, MicrobiologyOpen 2015
  • “...volcanii aglD and Hbt. salinarum VNG0318G revealed a stretch of Hfx. volcanii genes spanning from HVO_0780 - HVO_0812 that was essentially mirrored by Hbt. salinarum genes spanning from VNG0298H-VNG0330G ( Fig S2 ). Indeed, of the 22 homologous gene pairs in these stretches, the predicted protein...”
  • “...Halobacterium salinarum VNG0318G are found in almost identical gene clusters. Gene clusters spanning Hfx. volcanii HVO_0780 - HVO_0812 and Hbt. salinarum VNG0298H - VNG330G were compared. Homologous sequences are connected by vertical lines, with the numbers indicating the percentage in identity at the amino acid level....”

SPy1701 conserved hypothetical protein from Streptococcus pyogenes M1 GAS
2 alignments in 3:164 / 201 (75.6%), covering up to 96.2% of PF03458, 131.3 bits

• New Pathogenesis Mechanisms and Translational Leads Identified by Multidimensional Analysis of Necrotizing Myositis in Primates
  Kachroo, mBio 2020
  • “...Spy0963 14.0 12.7 Spy1318 rocA TCS accessory protein Spy1324 2.3 2.3 Spy1720 mga Standalone regulator Spy1701 1.5 2.3 Spy1724 ihk TCS histidine kinase Spy1704 10.5 6.5 Spy1725 irr TCS response regulator Spy1705 16.1 10.2 Other Spy0281 dahA Putative role in defense against stress Spy0340 NS 5.0...”

PGA1_c00920 putative transporter, required for glycine utilization from Phaeobacter inhibens BS107
2 alignments in 5:167 / 207 (74.4%), covering up to 97.4% of PF03458, 126.2 bits

• mutant phenotype: PFam PF03458.9 (UPF0126). conserved specific phenotype of UPF0126

VDA_001326 trimeric intracellular cation channel family protein from Photobacterium damselae subsp. damselae CIP 102761
2 alignments in 4:167 / 204 (75.0%), covering up to 97.4% of PF03458, 121.9 bits

• Transcriptome changes in response to temperature in the fish pathogen Photobacterium damselae subsp. damselae: Clues to understand the emergence of disease outbreaks at increased seawater temperatures
  Matanza, PloS one 2018
  • “...PlpV -1.8 2.02363E-17 ChrI Hypothetical proteins of unknown function VDA_000632 Hypothetical protein -6.2 8.1218E-133 ChrII VDA_001326 Hypothetical protein -3.4 2.00678E-63 ChrI VDA_000814 Hypothetical protein -3.8 7.28892E-46 ChrII VDA_000647 Hypothetical protein -3.6 2.93637E-36 ChrII VDA_001949 Hypothetical protein -3.5 1.82412E-53 ChrI VDA_001746 Hypothetical protein -3.4 1.43464E-49 ChrI VDA_002346...”

FTL_1485 hypothetical protein from Francisella tularensis subsp. holarctica
2 alignments in 13:184 / 216 (75.5%), covering up to 97.4% of PF03458, 109.8 bits

• Global transcriptional response to mammalian temperature provides new insight into Francisella tularensis pathogenesis
  Horzempa, BMC microbiology 2008
  • “...racemase, alr 2.1 [ 67 ] FTL_1474 transcriptional elongation factor, qreA 1.8 [ 13 ] FTL_1485 Conserved hypothetical membrane protein 2.2 [ 46 , 69 ] FTL_1545 SNO glutamine amidotransferase family protein 2.6 [ 46 , 69 ] FTL_1546 Pyridoxine/pyridoxal 5-phosphate biosynthesis protein 2.2 [ 46...”

Or search for genetic data about PF03458 in the Fitness Browser