Family Search for PF03478 (DUF295)
April 2024: See Interactive Tools for Functional Annotation of Bacterial Genomes for advice on using these tools.
PF03478 hits 132 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.
Q2QXK7 F-box domain containing protein from Oryza sativa subsp. japonica
Aligns to 57:383 / 419 (78.0%), covers 99.6% of PF03478, 210.9 bits
- Genomic approach to study floral development genes in Rosa sp.
Dubois, PloS one 2011 - “...0,00 1,27 0,03 0,71 0,44 BI978115 (Q84W81) Hypothetical protein At5g49800 1,27 0,34 1,85 0,57 EC586690 Q2QXK7) F-box domain, putative 1,31 0,91 1,36 0,02 EC588294 (Q1S0D0) Glyoxalase/bleomycin resistance protein 1,32 0,46 0,77 1,19 EC588783 (Q9LUC1) Putative protein At3g14740 1,34 0,27 1,19 0,31 RoAP1a (Q283Q1) APETALA1 protein 1,38...”
AT4G22165 F-box family protein from Arabidopsis thaliana
Aligns to 53:331 / 363 (76.9%), covers 94.6% of PF03478, 175.8 bits
AT4G22060 F-box family protein from Arabidopsis thaliana
Aligns to 56:367 / 399 (78.2%), covers 100.0% of PF03478, 175.5 bits
KIB4_ARATH / Q9SRV0 F-box protein KIB4; Protein KINK SUPPRESSED IN BZR1-1D 4 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
AT3G03730 F-box family protein from Arabidopsis thaliana
Aligns to 59:359 / 393 (76.6%), covers 99.2% of PF03478, 172.0 bits
- function: Component of SCF(ASK-cullin-F-box) E3 ubiquitin ligase complexes, which may mediate the ubiquitination and subsequent proteasomal degradation of target proteins. Required for brassinosteroid (BR) signal transduction. Mediates ASK7/BIN2/SK21 inactivation both by competing with substrate binding (e.g. BZR1) and by promoting its ubiquitination and subsequent proteasomal degradation.
disruption phenotype: Abolished brassinosteroid (BR)-induced ASK7/BIN2/SK21 degradation, and BR-insensitivity. Suppression of the constitutive BR-response phenotype in the dominant mutant bzr1-1D, and accumulation of phosphorylated BZR1. - Neofunctionalization of Mitochondrial Proteins and Incorporation into Signaling Networks in Plants
Lama, Molecular biology and evolution 2019 - “...AtFDB17 + + + cyt Ang Eud AT3G03726 AtFDB18 + + + cyt Ang Eud AT3G03730 AtFDB19 + + + cyt Ang Eud AT3G22333 AtFDB20 + + + Ang Eud AT3G22345 AtFDB21 + + + cyt Ang Eud AT4G10820 AtFDB22 + + + cyt Ang Eud...”
SKI23_ARATH / Q3EBZ2 F-box protein SKIP23; SKP1-interacting partner 23 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
AT2G17030 F-box family protein from Arabidopsis thaliana
Aligns to 46:364 / 407 (78.4%), covers 98.5% of PF03478, 169.0 bits
- function: Component of SCF(ASK-cullin-F-box) E3 ubiquitin ligase complexes, which may mediate the ubiquitination and subsequent proteasomal degradation of target proteins.
subunit: Part of a SCF (ASK-cullin-F-box) protein ligase complex (By similarity). Interacts with SKP1A/ASK1. - iRefIndex: a consolidated protein interaction database with provenance.
Razick, BMC bioinformatics 2008 - “...For example, Q7XJL8 was found to be a secondary accession in three separate UniProt records (Q3EBZ2, Q6DR20, and Q8GWA9). 2) The secondary references supplied by the interaction record point to more than one unique protein sequence. 3) An EntrezGene identifier is provided in the interaction record...”
- Neofunctionalization of Mitochondrial Proteins and Incorporation into Signaling Networks in Plants
Lama, Molecular biology and evolution 2019 - “...AtFDA9 + + (+) pm Ang Eud Brass AT2G16365 AtFDA10 + + (+) nu Vir AT2G17030 AtFDA11/SKIP23 + + + golgi + Vir AT2G17036 AtFDA12 + + + cyt AT2G17690 AtFDA13 + + + cyt cyto + Ang Eud Brass AT2G24250 AtFDA14 + + + cyt...”
- “...2008 ). The Arabidopsis genome contains 20 ancestral-type F-box/DUF295 proteins. The SKP1-interacting Protein SKIP23 ( At2g17030 ) is part of this group and was previously found to interact with ASK1 ( Risseeuw etal. 2003 ), a component of, for example, the strigolactone SCF MAX2 receptor complex...”
AT4G22180 F-box family protein from Arabidopsis thaliana
Aligns to 63:369 / 402 (76.4%), covers 96.1% of PF03478, 166.9 bits
AT4G22660 F-box family protein from Arabidopsis thaliana
Aligns to 53:363 / 396 (78.5%), covers 100.0% of PF03478, 165.5 bits
KIB1_ARATH / Q9SU05 F-box/kelch-repeat protein KIB1; Protein KINK SUPPRESSED IN BZR1-1D 1 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
AT4G12810 F-box family protein from Arabidopsis thaliana
NP_193017 F-box family protein from Arabidopsis thaliana
Aligns to 69:342 / 382 (71.7%), covers 99.6% of PF03478, 164.0 bits
- function: Component of SCF(ASK-cullin-F-box) E3 ubiquitin ligase complexes, which may mediate the ubiquitination and subsequent proteasomal degradation of target proteins. Required for brassinosteroid (BR) signal transduction. Mediates ASK7/BIN2/SK21 inactivation both by competing with substrate binding (e.g. BZR1) and by promoting its ubiquitination and subsequent proteasomal degradation.
subunit: Part of a SCF (SKP1-cullin-F-box) protein ligase complex. Binds directly to several GSK3 family proteins such as SKP1A/ASK1, ASK1/SK11, ASK3/SK12, ASK5/SK13, ASK7/BIN2/SK21, ASK9/SK22 and ASK6/SK23. Interacts with ASK7/BIN2/SK21 in a brassinosteroid (BR)- dependent manner.
disruption phenotype: Abolished brassinosteroid (BR)-induced ASK7/BIN2/SK21 degradation, and severe BR-insensitivity. Suppression of the constitutive BR-response phenotype in the dominant mutant bzr1-1D, and accumulation of phosphorylated BZR1. - Neofunctionalization of Mitochondrial Proteins and Incorporation into Signaling Networks in Plants
Lama, Molecular biology and evolution 2019 - “...AtFDB21 + + + cyt Ang Eud AT4G10820 AtFDB22 + + + cyt Ang Eud AT4G12810 AtFDB23 + + + cyt Ang Eud AT4G12820 AtFDB24 + + + cyt Ang Eud AT4G14165 AtFDB25 + + + cyt Ang Eud AT4G17565 AtFDB26 + + + cyt Ang...”
- The F-box Protein KIB1 Mediates Brassinosteroid-Induced Inactivation and Degradation of GSK3-like Kinases in Arabidopsis
Zhu, Molecular cell 2017 - “...Liu et al., 1995 ), we identified a T-DNA flanking sequence in the promoter of AT4G12810 in the kib1-1;bzr1-1D mutant ( Figure 1D ). Quantitative RT-PCR analysis showed that the expression level of AT4G12810 was greatly reduced in kib1-1;bzr1-1D , whereas the expression levels of its...”
- “...AT4G12800 and AT4G12820 were not affected ( Figure 1E ). To confirm that loss of AT4G12810 expression is responsible for the kib1-1 phenotype, we obtained another T-DNA insertion mutant kib12 (SAIL_1230_F06), in which a T-DNA was inserted in an exon of AT4G12810 ( Figure 1D )....”
- The F-box Protein KIB1 Mediates Brassinosteroid-Induced Inactivation and Degradation of GSK3-like Kinases in Arabidopsis.
Zhu, Molecular cell 2017 - GeneRIF: KIB1 plays an essential role in brassinosteroid signaling by inhibiting BIN2 through dual mechanisms of blocking substrate access and promoting degradation. [KIB1]
AT2G24080 F-box family protein-related from Arabidopsis thaliana
Aligns to 40:348 / 374 (82.6%), covers 99.6% of PF03478, 159.4 bits
AT5G66830 F-box family protein from Arabidopsis thaliana
Aligns to 63:357 / 394 (74.9%), covers 100.0% of PF03478, 158.0 bits
KIB3_ARATH / Q9ZW91 F-box protein KIB3; Protein KINK SUPPRESSED IN BZR1-1D 3 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
AT1G67160 F-box family protein from Arabidopsis thaliana
Aligns to 59:356 / 450 (66.2%), covers 99.2% of PF03478, 157.3 bits
- function: Component of SCF(ASK-cullin-F-box) E3 ubiquitin ligase complexes, which may mediate the ubiquitination and subsequent proteasomal degradation of target proteins. Required for brassinosteroid (BR) signal transduction. Mediates ASK7/BIN2/SK21 inactivation both by competing with substrate binding (e.g. BZR1) and by promoting its ubiquitination and subsequent proteasomal degradation.
disruption phenotype: Abolished brassinosteroid (BR)-induced ASK7/BIN2/SK21 degradation, and BR-insensitivity. Suppression of the constitutive BR-response phenotype in the dominant mutant bzr1-1D, and accumulation of phosphorylated BZR1. - The U-box ubiquitin ligase TUD1 promotes brassinosteroid-induced GSK2 degradation in rice
Liu, Plant communications 2023 - “...LOC_Os04g08510 or at the Arabidopsis Information Resource website ( https://www.arabidopsis.org/ ) under the accession numbers AT1G67160 (KIB1), AT3G49810 (PUB30), and AT5G65920 (PUB31). The RNA sequencing data in this study have been deposited at the National Genomics Data Center ( http://ngdc.cncb.ac.cn/gsa/ ) under the accession number CRA008101...”
- Neofunctionalization of Mitochondrial Proteins and Incorporation into Signaling Networks in Plants
Lama, Molecular biology and evolution 2019 - “...AT1G27550 AtFDB3 + + + mito Brass AT1G27580 AtFDB4 + + + mito Ang Eud AT1G67160 AtFDB5 + + + cyt Ang Eud AT1G69090 AtFDB6 + + + plastid Brass AT2G03560 AtFDB7 + + + cyt Ang Eud Brass AT2G03610 AtFDB8 + + + cyt Ang...”
AT5G38270 F-box family protein from Arabidopsis thaliana
Aligns to 64:377 / 406 (77.3%), covers 99.6% of PF03478, 154.8 bits
AT2G05970 F-box family protein from Arabidopsis thaliana
Aligns to 54:343 / 377 (76.9%), covers 100.0% of PF03478, 154.6 bits
AT4G17565 F-box family protein from Arabidopsis thaliana
Aligns to 62:348 / 378 (75.9%), covers 95.8% of PF03478, 154.6 bits
KIB2_ARATH / Q9SU04 F-box protein KIB2; Protein KINK SUPPRESSED IN BZR1-1D 2 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
AT4G12820 F-box family protein from Arabidopsis thaliana
Aligns to 109:405 / 442 (67.2%), covers 99.2% of PF03478, 152.8 bits
- function: Component of SCF(ASK-cullin-F-box) E3 ubiquitin ligase complexes, which may mediate the ubiquitination and subsequent proteasomal degradation of target proteins. Required for brassinosteroid (BR) signal transduction. Mediates ASK7/BIN2/SK21 inactivation both by competing with substrate binding (e.g. BZR1) and by promoting its ubiquitination and subsequent proteasomal degradation.
subunit: Interacts with ASK7/BIN2/SK21.
disruption phenotype: Abolished brassinosteroid (BR)-induced ASK7/BIN2/SK21 degradation, and BR-insensitivity. Suppression of the constitutive BR-response phenotype in the dominant mutant bzr1-1D, and accumulation of phosphorylated BZR1. - Neofunctionalization of Mitochondrial Proteins and Incorporation into Signaling Networks in Plants
Lama, Molecular biology and evolution 2019 - “...AtFDB22 + + + cyt Ang Eud AT4G12810 AtFDB23 + + + cyt Ang Eud AT4G12820 AtFDB24 + + + cyt Ang Eud AT4G14165 AtFDB25 + + + cyt Ang Eud AT4G17565 AtFDB26 + + + cyt Ang Eud AT4G22035 AtFDB27 + + + Eud Brass...”
- The F-box Protein KIB1 Mediates Brassinosteroid-Induced Inactivation and Degradation of GSK3-like Kinases in Arabidopsis
Zhu, Molecular cell 2017 - “...greatly reduced in kib1-1;bzr1-1D , whereas the expression levels of its neighboring genes AT4G12800 and AT4G12820 were not affected ( Figure 1E ). To confirm that loss of AT4G12810 expression is responsible for the kib1-1 phenotype, we obtained another T-DNA insertion mutant kib12 (SAIL_1230_F06), in which...”
AT3G22345 hypothetical protein from Arabidopsis thaliana
Aligns to 62:334 / 334 (81.7%), covers 90.0% of PF03478, 150.5 bits
NP_565302 F-box only protein (DUF295) from Arabidopsis thaliana
Aligns to 65:377 / 395 (79.2%), covers 99.2% of PF03478, 148.0 bits
AT2G03560 ubiquitin-protein ligase from Arabidopsis thaliana
Aligns to 65:378 / 453 (69.3%), covers 99.2% of PF03478, 147.4 bits
AT1G27540 F-box family protein from Arabidopsis thaliana
Aligns to 28:357 / 383 (86.2%), covers 99.6% of PF03478, 146.4 bits
AT4G22170 F-box family protein from Arabidopsis thaliana
Aligns to 53:331 / 363 (76.9%), covers 99.6% of PF03478, 146.3 bits
AT2G26160 hypothetical protein from Arabidopsis thaliana
Aligns to 36:329 / 331 (88.8%), covers 88.8% of PF03478, 146.0 bits
AT1G44080 F-box protein-related / C-type lectin-related from Arabidopsis thaliana
Aligns to 38:323 / 347 (82.4%), covers 93.8% of PF03478, 144.1 bits
AT2G33200 F-box family protein from Arabidopsis thaliana
Aligns to 49:349 / 376 (80.1%), covers 99.6% of PF03478, 143.3 bits
AT2G04810 F-box family protein from Arabidopsis thaliana
Aligns to 67:369 / 397 (76.3%), covers 86.5% of PF03478, 140.3 bits
- Regulatory dynamics of gene expression in the developing male gametophyte of Arabidopsis
Klodová, Plant reproduction 2023 - “...to 35 differentially expressed F-box proteins. Notably, five F-box genes were exclusively expressed in Col-0 (At2g04810, At3g47130, At5g38391, At5g42460, At5g56380), while two were only expressed in Ler-0 (At5g56440, At3g21170). Although some F-box transcripts differ in expression between accessions, their developmental expression profiles were similar for most...”
- Neofunctionalization of Mitochondrial Proteins and Incorporation into Signaling Networks in Plants
Lama, Molecular biology and evolution 2019 - “...+ + + cyt Ang Eud Brass AT2G03610 AtFDB8 + + + cyt Ang Eud AT2G04810 AtFDB9 + + + cyt Ang Eud AT2G04830 AtFDB10 + + + cyt Ang Brass AT2G04840 AtFDB11 + + + cyt Ang Eud AT2G05970 AtFDB12 + + + cyt Ang...”
AT5G25290 F-box family protein from Arabidopsis thaliana
Aligns to 58:373 / 397 (79.6%), covers 99.6% of PF03478, 138.7 bits
AT2G04840 F-box family protein from Arabidopsis thaliana
Aligns to 45:361 / 389 (81.5%), covers 86.9% of PF03478, 137.9 bits
AT1G10110 F-box family protein from Arabidopsis thaliana
Aligns to 1:302 / 332 (91.0%), covers 93.1% of PF03478, 136.6 bits
- Neofunctionalization of Mitochondrial Proteins and Incorporation into Signaling Networks in Plants
Lama, Molecular biology and evolution 2019 - “...Ang Eud AT5G24040 AtFDA19 + + + cyt Land AT5G60060 AtFDA20 + + + cyt AT1G10110 AtFDB1 + + + cyt Ang Eud AT1G27540 AtFDB2 + + + plastid Vir AT1G27550 AtFDB3 + + + mito Brass AT1G27580 AtFDB4 + + + mito Ang Eud AT1G67160...”
- Contribution of transcriptional regulation to natural variations in Arabidopsis
Chen, Genome biology 2005 - “...KD subunit (TFIIIB) 16263_at At2g02320 3.12005E-06 0.0234253 gb|AAC78515.1| F-box protein (SKP1 interacting partner 3-related) 17145_at At1g10110 6.9462E-08 0.0005215 gb|AAC34337.1| Contains Pfam PF00646: F-box domain; similar to F-box protein family, AtFBX7 13863_at At2g21470 9.36899E-07 0.0070342 gb|AAD23691.1| Nearly identical to SUMO activating enzyme 2 (SAE2) 12599_at At2g29910 2.33543E-10...”
- “...(NADPH oxidase) (RbohB) 16263_at At2g02320 3.12005E-06 0.0234253 gb|AAC78515.1| F-box protein (SKP1 interacting partner 3-related) 17145_at At1g10110 6.9462E-08 0.0005215 gb|AAC34337.1| Contains Pfam PF00646: F-box domain; similar to F-box protein family, AtFBX7 12599_at At2g29910 2.33543E-10 0.0000018 gb|AAD23631.1| F-box protein family contains F-box domain Pfam:PF00646 34 INTERACTION WITH THE...”
AT5G55150 F-box family protein from Arabidopsis thaliana
Aligns to 36:331 / 360 (82.2%), covers 89.2% of PF03478, 134.9 bits
- Physiological and Transcriptomic Analysis of Arabidopsis thaliana Responses to Ailanthone, a Potential Bio-Herbicide
Hopson, International journal of molecular sciences 2022 - “...AT2G42065 DnaJ domain protein 6.94 3.95 5.42 UP AT3G54530 hypothetical protein 6.85 4.55 5.52 UP AT5G55150 F-box SKIP23-like protein (DUF295) 6.65 3.82 3.02 UP AT5G54560 hypothetical protein (DUF295) 6.60 6.05 6.05 UP AT2G20800 NAD(P)H dehydrogenase B4 ( NDB4 ) 6.34 3.76 4.46 UP AT5G54450 hypothetical protein...”
- Transcriptome analysis reveals major transcriptional changes during regrowth after mowing of red clover (Trifolium pratense)
Herbert, BMC plant biology 2021 - “...tdn_154158 8,9 General cell functions ( T. pratense, M. truncatula ) Tp57577_TGAC_v2_mRNA39482.v2 Medtr3g114970.2 M. truncatula AT5G55150 13 TPM1 tdn_65187 9,1 Transposon ( T. pratense, Prunus persica A. thaliana ) Tp57577_TGAC_v2_mRNA30115.v2 Prupe.4G011200.1 Prunus persica AT4G29090 14 TPM1 tdn_100956 9,2 Metabolism ( T. pratense, Capsella rubella, A. thaliana...”
- Neofunctionalization of Mitochondrial Proteins and Incorporation into Signaling Networks in Plants
Lama, Molecular biology and evolution 2019 - “...AT5G66830 AtFDB38 + + + cyt AT1G57790 AtFDR1 + + + Not clear cyt + AT5G55150 AtFDR2 + + + Not clear pm Land AT1G05540 AtDOA1 + + mito Land AT1G05550 AtDOA2 + + pm Land Ang AT1G30160 AtDOA3 + + cyt + Eud AT1G30170 AtDOA4...”
- “...Supplementary Material online). A fourth group (indicated in orange in fig.1 ), including At1g57790 and At5g55150 , contains the F-box domain, but the DUF295 domain mentioned in the TAIR annotation was not identified using the PFAM profile, indicating it has diverged substantially. A yeast two-hybrid interaction...”
- How exposure to ALS-inhibiting gametocide tribenuron-methyl induces male sterility in rapeseed
Lian, BMC plant biology 2019 - “...endoplasmic reticulum-type TC169680 48.78 OPA3-like protein EV166804 48.59 Protein SRG1 TC171321 47.96 Putative F-box protein At5g55150 TC163384 47.93 ABC transporter B family member 4 TC174670 45.16 External alternative NAD(P)H-ubiquinone oxidoreductase B4, mitochondrial TC187508 42.47 Ethylene-responsive transcription factor CRF6 TC165449 41.90 Ubiquinol oxidase 3, mitochondrial TC166236 41.39...”
- “...ABC transporter C family member 3 TC180553 39.97 AAA-ATPase At1g43910 FG565272 39.51 Putative F-box protein At5g55150 TC173139 37.31 Ubiquinol oxidase 1a, mitochondrial EL625815 36.34 UDP-glycosyltransferase 74E2 TC161751 32.55 Cytosolic sulfotransferase 12 FG566389 31.71 UDP-glycosyltransferase 73C4 FG566278 31.50 Probable inactive poly [ADP-ribose] polymerase SRO3 TC163015 30.51 Indole...”
- The IDA-LIKE peptides IDL6 and IDL7 are negative modulators of stress responses in Arabidopsis thaliana
Vie, Journal of experimental botany 2017 - “...a At3g09450 2.136 0.099 0.008 UGT74E2 (UDP-GLUCOSYL TRANSFERASE 74E2) At1g05680 2.151 1.090 0.048 DUF295-domain protein At5g55150 2.202 1.096 0.043 ZAT10/STZ (SALT-TOLERANCE ZINC FINGER) a At1g27730 2.215 0.137 0.008 ZAT12 /RHL41 (RESPONSIVE TO HIGH LIGHT 41) At5g59820 2.359 0.619 0.013 CML38 (CALMODULIN-LIKE PROTEIN 38) a At1g76650 2.456...”
AT3G25750 F-box family protein from Arabidopsis thaliana
Aligns to 44:320 / 348 (79.6%), covers 89.6% of PF03478, 134.3 bits
AT4G35733 hypothetical protein from Arabidopsis thaliana
Aligns to 43:339 / 358 (83.0%), covers 95.4% of PF03478, 133.9 bits
- Comparative Application of Terminal Restriction Fragment Analysis Tools to Large-Scale Genomic Assays
Abdulkina, International journal of molecular sciences 2023 - “...of At4g04870 gene, which encodes Cardiolipin synthase) and position 16,935,117 (missense nucleotide change aTg/aAg in At4g35733 gene, leading to M231K substitution in F-box SKIP23-like protein), and on chromosome 3, position 7,407,370 (missense nucleotide change Gga/Aga in At3g21120 gene, leading to G349R substitution in a little-characterized F-box...”
- “...8.78 C T 0.028 Intergenic 4:16935117 4 16935117 8.7 T A 0.04 MISSENSE aTg/aAg M231K At4g35733 1:21870431 1 21870431 8.32 T G 0.038 Intergenic 2:356311 2 356311 8.30 T A 0.036 Intergenic 3:7407370 3 7407370 8.06 G A 0.104 MISSENSE Gga/Aga, G349R At3g21120 WALTER (LM) 5:5538242...”
- Parallel adaptation to lower altitudes is associated with enhanced plasticity in Heliosperma pusillum (Caryophyllaceae)
Szukala, 2022 - Neofunctionalization of Mitochondrial Proteins and Incorporation into Signaling Networks in Plants
Lama, Molecular biology and evolution 2019 - “...AtFDA16 + + + cyt Ang Eud AT3G25750 AtFDA17 + + + nu Ang Eud AT4G35733 AtFDA18 + + + cyt Ang Eud AT5G24040 AtFDA19 + + + cyt Land AT5G60060 AtFDA20 + + + cyt AT1G10110 AtFDB1 + + + cyt Ang Eud AT1G27540 AtFDB2...”
AT2G33190 F-box family protein from Arabidopsis thaliana
Aligns to 48:352 / 379 (80.5%), covers 99.6% of PF03478, 133.2 bits
Q6DR20 F-box protein At2g17036 from Arabidopsis thaliana
Aligns to 47:358 / 404 (77.2%), covers 91.5% of PF03478, 130.4 bits
- iRefIndex: a consolidated protein interaction database with provenance.
Razick, BMC bioinformatics 2008 - “...example, Q7XJL8 was found to be a secondary accession in three separate UniProt records (Q3EBZ2, Q6DR20, and Q8GWA9). 2) The secondary references supplied by the interaction record point to more than one unique protein sequence. 3) An EntrezGene identifier is provided in the interaction record as...”
AT2G17036 F-box family protein from Arabidopsis thaliana
Aligns to 46:357 / 428 (72.9%), covers 91.5% of PF03478, 130.1 bits
AT5G60060 F-box family protein from Arabidopsis thaliana
Aligns to 61:356 / 374 (79.1%), covers 94.2% of PF03478, 129.7 bits
AT1G69090 F-box family protein from Arabidopsis thaliana
Aligns to 72:369 / 401 (74.3%), covers 100.0% of PF03478, 129.6 bits
GRMZM2G062031, LOC100276496 uncharacterized protein LOC100276496 from Zea mays
Aligns to 52:351 / 382 (78.5%), covers 96.5% of PF03478, 122.7 bits
- Identification and Validation of Candidate Genes Conferring Resistance to Downy Mildew in Maize (Zea mays L.)
Kim, Genes 2020 - “...15 ( GRMZM2G128315, AC210003.2_FG004, GRMZM2G045049, GRMZM2G178880, GRMZM2G363066, GRMZM2G028643, GRMZM2G330907, GRMZM2G047677, AC191071.3_FG001, GRMZM2G133707, GRMZM2G020043, GRMZM2G039345, GRMZM2G314171, GRMZM2G062031, and GRMZM2G005984 ) were upregulated by DM in the DM-resistant genotypes ( Figure 4 and Figure S4 ). These 15 upregulated genes were classified as peroxidase (POX), chloroplastic/mitochondrial phosphoribosylformylglycinamidine (PITG)...”
- “...photosystem II repair protein PSB27-H1 chloroplastic, photosystem II protein, and uncharacterized. The uncharacterized genes ( GRMZM2G062031, GRMZM2G133707, GRMZM2G20043, and GRMZM2G314171 ) were highly expressed in DM-infected plants. Of the 45 genes, 30 were partially upregulated and were classified into 20 functional annotations. 4. Discussion DM, caused...”
- “...acid receptor PYL5; abscisic acid receptor PYL3; pyrabactin resistance-like protein GRMZM2G062031 T01 1809 382 Uncharacterized LOC100276496 Uncharacterized LOC100276496 GRMZM2G128315 T01 3343 964 Probable LRR receptor-like serine/threonine-protein kinase IRK Putative leucine-rich repeat receptor-like protein kinase family protein GRMZM2G005984 9 9.05 T01 951 222 Photosystem II 11 kd...”
AT5G52940 hypothetical protein from Arabidopsis thaliana
Aligns to 50:348 / 362 (82.6%), covers 84.6% of PF03478, 118.1 bits
- Neofunctionalization of Mitochondrial Proteins and Incorporation into Signaling Networks in Plants
Lama, Molecular biology and evolution 2019 - “...Ang Eud AT4G13680 AtDOB3 + + mito Brass Eud AT5G52930 AtDOB4 + + mito + AT5G52940 AtDOB5 + + mito + Vir AT5G53230 AtDOB6 + + mito + Ang Eud AT5G53240 AtDOB7 + + mito Brass AT5G54320 AtDOB8 + + mito Ang Eud AT5G54330 AtDOB9 +...”
- “...of the predicted mitochondrial isoforms, we cloned three representatives AtDOA10 ( At4g25930 ), AtDOB5 ( At5g52940 ), and AtDOB12 ( At5g54550 ) into C-terminal GFP-fusion vectors (see below for more information on why these were selected). The localization of the fusion proteins was analyzed by transient...”
GRMZM2G067198 uncharacterized protein LOC100274863 from Zea mays
Aligns to 55:354 / 385 (77.9%), covers 96.9% of PF03478, 116.6 bits
AT5G03390 hypothetical protein from Arabidopsis thaliana
Aligns to 33:360 / 373 (87.9%), covers 95.4% of PF03478, 116.2 bits
- Neofunctionalization of Mitochondrial Proteins and Incorporation into Signaling Networks in Plants
Lama, Molecular biology and evolution 2019 - “...mito AT4G25920 AtDOA9 + + mito Eud AT4G25930 AtDOA10 + + mito + Ang Eud AT5G03390 AtDOA11 + + mito plastid Land AT5G46130 AtDOA12 + + mito AT5G46140 AtDOA13 + + cyt AT5G53780 AtDOA14 + + cyt Eud Brass AT5G53790 AtDOA15 + + pm Brass AT5G55440...”
- “...in purified mitochondria by mass spectrometry (MS) ( Senkler etal. 2017 ), whereas AtDOA11 ( AT5G03390 ) was identified by MS in purified chloroplasts ( Zybailov etal. 2008 ). As no green fluorescent protein (GFP) localization data were published for any of the predicted mitochondrial isoforms,...”
AT5G54320 hypothetical protein from Arabidopsis thaliana
Aligns to 41:351 / 369 (84.3%), covers 83.8% of PF03478, 116.1 bits
- Neofunctionalization of Mitochondrial Proteins and Incorporation into Signaling Networks in Plants
Lama, Molecular biology and evolution 2019 - “...Vir AT5G53230 AtDOB6 + + mito + Ang Eud AT5G53240 AtDOB7 + + mito Brass AT5G54320 AtDOB8 + + mito Ang Eud AT5G54330 AtDOB9 + + mito Ang Eud AT5G54420 AtDOB10 + + pm Land Brass AT5G54450 AtDOB11 + + mito + Ang Eud AT5G54550 AtDOB12...”
- “...of 34 genes (80%) spread over 13 tandems. One tandem even contained six genes spanning At5g54320 to At5g54560 . The F-box/DUF295 FDB group contained 26 of 38 (68%) tandem duplicated genes spread over 10 tandems. Also here tandems of up to six genes were found (At4g22030...”
AT1G68960 hypothetical protein from Arabidopsis thaliana
Aligns to 36:354 / 376 (84.8%), covers 83.0% of PF03478, 115.8 bits
AT2G14290 F-box family protein from Arabidopsis thaliana
Aligns to 53:326 / 353 (77.6%), covers 99.6% of PF03478, 115.7 bits
- Functional Insight of Nitric-Oxide Induced DUF Genes in Arabidopsis thaliana
Nabi, Frontiers in plant science 2020 - “...IPR007612); BEST Arabidopsis thaliana protein match is: Protein of unknown function (DUF567) (TAIR : AT2G38640.1) AT2G14290 0.28000 23.59000 84.25000 0.00000 6.37693 CONTAINS InterPro DOMAIN/s: F-box domain, cyclin-like (InterPro : IPR001810), F-box domain, Skp2-like (InterPro : IPR022364), Protein of unknown function DUF295 (InterPro : IPR005174); BEST Arabidopsis...”
- Genes Modulating the Increase in Sexuality in the Facultative Diplosporous Grass Eragrostis curvula under Water Stress Conditions
Selva, Genes 2020 - “...downregulated under stress conditions are the SNF1-related protein kinase regulatory subunit -1 and F-box proteins (At2g14290, At3g07870, and At5g07610). Regarding genes previously related to apomixis and upregulated under stress, the transcription factor NAC10 should be mentioned. 3.9. Validation by qRT-PCR qRT-PCR assays were used to corroborate...”
- Neofunctionalization of Mitochondrial Proteins and Incorporation into Signaling Networks in Plants
Lama, Molecular biology and evolution 2019 - “...+ + + cyt Ang Eud AT2G05970 AtFDB12 + + + cyt Ang Eud Brass AT2G14290 AtFDB13 + + + cyt Land AT2G14500 AtFDB14 + + + cyt Ang Eud AT2G24080 AtFDB15 + + + cyt Eud AT2G33190 AtFDB16 + + + cyt AT2G33200 AtFDB17 +...”
AT1G27580 F-box family protein from Arabidopsis thaliana
Aligns to 27:338 / 364 (85.7%), covers 77.2% of PF03478, 114.1 bits
AT5G53230 hypothetical protein from Arabidopsis thaliana
Aligns to 43:346 / 358 (84.9%), covers 84.9% of PF03478, 113.9 bits
NP_176753 ascorbic acid mannose pathway regulator 1 from Arabidopsis thaliana
AT1G65770 F-box family protein from Arabidopsis thaliana
Aligns to 51:345 / 360 (81.9%), covers 82.2% of PF03478, 113.7 bits
- AMR1, an Arabidopsis gene that coordinately and negatively regulates the mannose/l-galactose ascorbic acid biosynthetic pathway.
Zhang, Plant physiology 2009 - GeneRIF: AMR1 appears to play an important role in modulating ascorbic acid levels in Arabidopsis by regulating the expression of major pathway genes in response to developmental and environmental cues. [AMR1]
- Antioxidants of Non-Enzymatic Nature: Their Function in Higher Plant Cells and the Ways of Boosting Their Biosynthesis
Rudenko, Antioxidants (Basel, Switzerland) 2023 - “...] At1g14520 At4g26260 Myo-Inositol Oxygenase, MIOX1 Convertion of Myo-inositol into L-Gulono-1,4-lactone Myo-inositol [ 257 ] At1g65770 Ascorbic Acid Mannose Pathway Regulator 1, AMR1, ATFDA7, F-BOX/DUF295 ANCESTRAL 7 Regulation of the mannose/L-galactose ascorbic acid biosynthetic pathway in response to developmental and environmental factors [ 276 ] At3g23230...”
- Genetic and biochemical strategies for regulation of L-ascorbic acid biosynthesis in plants through the L-galactose pathway
Castro, Frontiers in plant science 2023 - “...( Zhang etal., 2009 ). These researchers observed that when the transcripts of the gene At1g65770 , named AMR1 (ascorbic acid mannose pathway regulator 1), accumulate, the AsA content decreases in cells of thale cress, which is associated with the reduced expression level of the genes...”
- Neofunctionalization of Mitochondrial Proteins and Incorporation into Signaling Networks in Plants
Lama, Molecular biology and evolution 2019 - “...AT1G65740 AtFDA5/UCL1 + + + cyt + Eud Brass AT1G65760 AtFDA6 + + + pm AT1G65770 AtFDA7 + + + mito + Eud Brass AT2G16290 AtFDA8 + + + pm Ang Eud Brass AT2G16300 AtFDA9 + + (+) pm Ang Eud Brass AT2G16365 AtFDA10 + +...”
- Key changes in gene expression identified for different stages of C4 evolution in Alloteropsis semialata
Dunning, Journal of experimental botany 2019 - “...complex AT3G52200 0 13 20 ASEM_AUS1_38810 UDP-glycosyltransferase AT1G05680 0 35 17 ASEM_AUS1_24427 Putative F-box protein AT1G65770 0 19 16 ASEM_AUS1_43609 a Flavin-containing monooxygenase FMO GS-OX-like 9 AT5G07800 0 7 13 ASEM_AUS1_40960 Cysteine-rich receptor-like protein kinase 26 AT4G23240 1 18 13 ASEM_AUS1_16960 a Valine-tRNA ligase AT1G14610 0...”
- An E3 ligase complex regulates SET-domain polycomb group protein activity in Arabidopsis thaliana
Jeong, Proceedings of the National Academy of Sciences of the United States of America 2011 - “...(qRT-PCR) showed that expression of At1g65740, At1g65760, and At1g65770 was elevated in ucl1-D homozygous plants (Fig. S1B). Among these three genes, we...”
- “...UCL1 overexpression (Fig. 2A). Likewise, overexpression of the At1g65770 gene, which is adjacent to UCL1, did not activate CLF-target genes (Fig. S4A). These...”
AT5G53790 hypothetical protein from Arabidopsis thaliana
Aligns to 37:347 / 380 (81.8%), covers 93.8% of PF03478, 112.6 bits
AT5G55440 hypothetical protein from Arabidopsis thaliana
Aligns to 27:343 / 365 (86.8%), covers 95.8% of PF03478, 112.5 bits
- Marker and readout genes for defense priming in Pseudomonas cannabina pv. alisalensis interaction aid understanding systemic immunity in Arabidopsis
Sistenich, Scientific reports 2024 - “...after rechallenge in primed leaves (immunological condition 2 compared to condition 4; Fig. 1 ) AT5G55440 ATDOA16 DUF295 ORGANELLAR A 16, Fbox protein 7.08 1.85 5.16 2.98 AT5G22380 NAC090 NAC domain containing protein 90 6.01 1.19 1.54 3.47 AT3G25010 RLP41 Receptorlike protein 41 5.93 0.15 4.53...”
- “...protein 7.26 2.21 2.50 3.03 AT5G62480 GSTU9 Glutathione Stransferase tau 9 7.12 4.63 3.13 2.32 AT5G55440 ATDOA16 DUF295 ORGANELLAR A 16, Fbox protein 7.08 1.85 5.16 2.98 Top genes expressed because of priming in systemic rechallenge condition (condition 3 compared to condition 4) AT5G24540 BGLU31 Beta...”
- Neofunctionalization of Mitochondrial Proteins and Incorporation into Signaling Networks in Plants
Lama, Molecular biology and evolution 2019 - “...+ cyt AT5G53780 AtDOA14 + + cyt Eud Brass AT5G53790 AtDOA15 + + pm Brass AT5G55440 AtDOA16 + + mito Eud Brass AT5G67040 AtDOA17 + + cyt Brass AT3G25200 AtDOB1 + + cyt Ang Eud AT3G43170 AtDOB2 + + perox Ang Eud AT4G13680 AtDOB3 + +...”
- A Lipid Transfer Protein Increases the Glutathione Content and Enhances Arabidopsis Resistance to a Trichothecene Mycotoxin
McLaughlin, PloS one 2015 - “...Sequence analysis indicated that the T-DNA tag was inserted into the last exon of the At5G55440 gene ( Fig 1B ), which encodes a protein of unknown function. To determine the effect of the insertion on transcription in this region, expression of At5G55440, two upstream genes...”
- “...was little difference in expression of At5G55420 and no expression was detected from At5G55430 or At5G55440 in either trr1 or in wild type. However in trr1 , expression of At5G55450, which is ~220 bp downstream of the T-DNA insert was induced 12-fold and expression of At5G55460,...”
AT5G54450 hypothetical protein from Arabidopsis thaliana
Aligns to 39:351 / 368 (85.1%), covers 84.2% of PF03478, 109.6 bits
- Physiological and Transcriptomic Analysis of Arabidopsis thaliana Responses to Ailanthone, a Potential Bio-Herbicide
Hopson, International journal of molecular sciences 2022 - “...6.60 6.05 6.05 UP AT2G20800 NAD(P)H dehydrogenase B4 ( NDB4 ) 6.34 3.76 4.46 UP AT5G54450 hypothetical protein (DUF295) 6.24 2.60 3.30 UP AT5G36130 Cytochrome P450 superfamily protein 2.08 2.99 2.05 DOWN AT4G40020 Myosin heavy chain-related protein 2.24 1.23 1.26 DOWN AT4G31940 cytochrome P450, family 82,...”
- Neofunctionalization of Mitochondrial Proteins and Incorporation into Signaling Networks in Plants
Lama, Molecular biology and evolution 2019 - “...Eud AT5G54330 AtDOB9 + + mito Ang Eud AT5G54420 AtDOB10 + + pm Land Brass AT5G54450 AtDOB11 + + mito + Ang Eud AT5G54550 AtDOB12 + + mito + Ang Eud AT5G54560 AtDOB13 + + mito + Land AT5G55270 AtDOB14 + + plastid Eud AT5G55870 AtDOB15...”
- “...Organellar genes that are apparently regulated by ANAC017, five are present in tandem gene duplications. At5g54450 , At5g54550 , and At5g54560 form a consecutive group of three (from a total of six in close proximity) (see table1 ), whereas At5g52930 and At5g52940 form a consecutive group...”
- The modulation of acetic acid pathway genes in Arabidopsis improves survival under drought stress
Rasheed, Scientific reports 2018 - “...to WT plants. Gene Name Fold change WT_D/WT_C P5_C/WT_C P5_D/WT_D AT4G33070 PDC1 0.90 17.36 31.35 AT5G54450 Hypothetical protein (DUF295) 1.21 31.75 25.97 AT2G03130 Ribosomal protein 0.74 9.13 14.01 AT2G47520 Ethylene Response Factor 71 (ERF71) 0.86 14.32 13.45 AT3G42658 SADHU3-2 1.16 14.53 8.13 AT5G09570 Cox19-like CHCH family...”
- Genome-wide transcriptome analysis of two contrasting Brassica rapa doubled haploid lines under cold-stresses using Br135K oligomeric chip
Jung, PloS one 2014 - “...Bra034094 AT3G10120 Unknown protein 4.9 4.0 3.4 1.1 1.2 1.6 0.8 1.0 2.2 1.6 Bra039899 AT5G54450 Protein of unknown function (DUF295) 4.2 3.9 3.1 0.9 1.2 1.5 1.1 1.3 1.1 0.9 Bra024091 AT4G30230 Unknown protein 4.2 4.2 2.0 1.1 1.0 1.6 1.3 1.9 1.0 0.9 Bra009220...”
AT1G57790 F-box family protein from Arabidopsis thaliana
Aligns to 56:322 / 352 (75.9%), covers 99.2% of PF03478, 108.8 bits
- Neofunctionalization of Mitochondrial Proteins and Incorporation into Signaling Networks in Plants
Lama, Molecular biology and evolution 2019 - “...Eud AT5G38270 AtFDB37 + + + cyt Ang Eud AT5G66830 AtFDB38 + + + cyt AT1G57790 AtFDR1 + + + Not clear cyt + AT5G55150 AtFDR2 + + + Not clear pm Land AT1G05540 AtDOA1 + + mito Land AT1G05550 AtDOA2 + + pm Land Ang...”
- “...1 , Supplementary Material online). A fourth group (indicated in orange in fig.1 ), including At1g57790 and At5g55150 , contains the F-box domain, but the DUF295 domain mentioned in the TAIR annotation was not identified using the PFAM profile, indicating it has diverged substantially. A yeast...”
- Genome-wide identification of genes regulated in trans by transposable element small interfering RNAs
McCue, RNA biology 2013 - “...transgenes. We have confirmed the targeting of the genic mRNAs At2g16910/ AMS , At4g30850/HHP2, and At1g57790 by the TE siRNAs we predicted using STTM transgenes ( Fig. 4A , Table 1 ). In each of these cases, the decreased expression detected on the ddm1 F6 microarray...”
AT5G53780 hypothetical protein from Arabidopsis thaliana
Aligns to 48:359 / 376 (83.0%), covers 89.6% of PF03478, 108.7 bits
AT2G45940 hypothetical protein from Arabidopsis thaliana
Aligns to 4:311 / 352 (87.5%), covers 93.8% of PF03478, 108.5 bits
FB111_ARATH / Q3EBY8 F-box protein At2g17690; Protein SUPPRESSOR OF DRM1 DRM2 CMT3 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
NP_179360 ascorbic acid mannose pathway regulator, putative (DUF295) from Arabidopsis thaliana
AT2G17690 SDC (SUPPRESSOR OF DRM1 DRM2 CMT3) from Arabidopsis thaliana
Aligns to 57:401 / 421 (81.9%), covers 86.5% of PF03478, 107.6 bits
- function: Involved in heat stress response. Contributes to recovery from heat stress.
- SDC mediates DNA methylation-controlled clock pace by interacting with ZTL in Arabidopsis.
Tian, Nucleic acids research 2021 - GeneRIF: SDC mediates DNA methylation-controlled clock pace by interacting with ZTL in Arabidopsis.
- Heat-induced release of epigenetic silencing reveals the concealed role of an imprinted plant gene.
Sanchez, PLoS genetics 2014 - GeneRIF: We propose that transcriptional gene silencing, known to be involved in gene imprinting, is also co-opted in the specific tuning of SDC expression upon heat stress and subsequent recovery
- Tandem repeats upstream of the Arabidopsis endogene SDC recruit non-CG DNA methylation and initiate siRNA spreading.
Henderson, Genes & development 2008 - GeneRIF: SDC has important implications for how plant genomes utilize gene silencing to repress endogenous genes. [Suppressor of drm1 drm2 cmt3] [SDC]
- DDT-RELATED PROTEIN4-IMITATION SWITCH alters nucleosome distribution to relieve transcriptional silencing in Arabidopsis
Zhang, The Plant cell 2023 - “...(DDR5), AT5G38690 (DDR1), AT1G67780 (DDR3), AT5G08630 (DDW1), AT3G06400 (CHR11), AT5G18620 (CHR17), AT5G64360 (DNAJ1), AT2G01710 (DNAJ2), AT2G17690 (SDC), AT4G25530 (FWA), AT5G49160 (MET1), AT5G14620 (DRM2), and AT1G69770 (CMT3). Supplementary Material koad143_Supplementary_Data Click here for additional data file. Acknowledgments We thank the flow cytometry Core at National Center for...”
- SDC mediates DNA methylation-controlled clock pace by interacting with ZTL in Arabidopsis
Tian, Nucleic acids research 2021 - “...ddc3 mutant and found that the transcript levels of AT3G30720 ( Qua-Quine Starch, QQS ), AT2G17690 ( SDC ) and AT2G34655 were elevated in both met1 and ddc3 mutants ( Supplementary Figure S6B ). Among these, AT2G34655 encodes a hypothetical protein composed of only 22 amino...”
- Epigenetic regulation of spurious transcription initiation in Arabidopsis
Le, Nature communications 2020 - “...showing the ectopic activation of the TSSs at FWA ( AT4G25530 ) and SDC ( AT2G17690 ) gene loci in the met1 and ddm1 backgrounds (indicated by orange windows). Their dominant CTSSs (red arrows) were aligned to the upstream sequences, indicating the presence of TATA-box motifs...”
- The Pol IV largest subunit CTD quantitatively affects siRNA levels guiding RNA-directed DNA methylation
Wendte, Nucleic acids research 2019 - “...and siRNA levels. ( A ) AtSN1 ( AT3TE63860 ); ( B ) SDC ( AT2G17690 ); ( C ) AT3TE63155 ; ( D ) AT5TE47755 ; ( E ) AT3TE47840 ; ( F ) ERT14 (AT2G01422) ; ( G ) soloLTR (AT5TE35950) ; ( H...”
- Neofunctionalization of Mitochondrial Proteins and Incorporation into Signaling Networks in Plants
Lama, Molecular biology and evolution 2019 - “...Vir AT2G17030 AtFDA11/SKIP23 + + + golgi + Vir AT2G17036 AtFDA12 + + + cyt AT2G17690 AtFDA13 + + + cyt cyto + Ang Eud Brass AT2G24250 AtFDA14 + + + cyt + Land AT2G24255 AtFDA15 + + + pm Ang Eud AT2G26160 AtFDA16 + +...”
- DNA sequence properties that predict susceptibility to epiallelic switching
Catoni, The EMBO journal 2017 - “...represent unmethylated cytosine and closed circles methylated. DNA methylation analyses at two RTELs (AT3TE46565Copia28 and AT2G17690 SDC promoter). General marking as in (A). Transcript levels in met11 and in reciprocal F1 hybrids of met11 and wild type (colour code above the graphs) of transposons assigned to...”
- A two-step process for epigenetic inheritance in Arabidopsis
Blevins, Molecular cell 2014 - “...or the indicated mutants (see also Figure S2 ). (C) Diagram of the SDC locus (At2g17690), showing upstream tandem repeats (purple arrows), the Pol II transcription start site (+1), and PolyA+ RNA-seq data plotted on a log 2 scale (black). PCR amplicons for chromatin immunoprecipitation (ChIP)...”
- Heat-induced release of epigenetic silencing reveals the concealed role of an imprinted plant gene
Sanchez, PLoS genetics 2014 - “...[16] , [18] [20] . We tested the heat stress entrainment of the genes SDC (AT2G17690), SQN (AT2G15790), and APUM9 (AT1G35730). Of these three candidates, only SDC showed a response pattern similar to L5-GUS ( Figure 1B and S 1). We hypothesized that for both L5-GUS...”
- More
AT2G14500 F-box family protein from Arabidopsis thaliana
Aligns to 48:345 / 347 (85.9%), covers 95.4% of PF03478, 107.1 bits
AT2G16290 hypothetical protein from Arabidopsis thaliana
Aligns to 82:391 / 415 (74.7%), covers 64.5% of PF03478, 106.6 bits
- Neofunctionalization of Mitochondrial Proteins and Incorporation into Signaling Networks in Plants
Lama, Molecular biology and evolution 2019 - “...AT1G65760 AtFDA6 + + + pm AT1G65770 AtFDA7 + + + mito + Eud Brass AT2G16290 AtFDA8 + + + pm Ang Eud Brass AT2G16300 AtFDA9 + + (+) pm Ang Eud Brass AT2G16365 AtFDA10 + + (+) nu Vir AT2G17030 AtFDA11/SKIP23 + + + golgi...”
- “...). Interestingly, AtFDA9 ( At2g16300 ) is nearly identical to the adjacent gene AtFDA8 ( At2g16290 ), however a frameshift has occurred due to a single base deletion just before the start of the DUF295 domain. This leads to a premature stop codon and truncated AtFDA9...”
- Restriction site extension PCR: a novel method for high-throughput characterization of tagged DNA fragments and genome walking
Ji, PloS one 2010 - “...KINASE 1) 87 2982bp of 5end of AT5G67390 87 562 bp downstream of CD of At2g16290 (F-box family protein) 88 633 bp of 3 end of AT4G36030 (armadillo/beta-catenin repeat family protein) 89 4835bp of upstream of CD of AT5G50910 (located in endomembrane sysytem) 91 7221 bp...”
- “...insertions: one is 2982bp of 5end of AT5G67390, and the other 562 bp downstream of At2g16290 (F-box family protein). 4. Isolating unknown sequence from a particular known gene sequence in different plant species The above work suggests that as long as the sequence of a DNA...”
AT5G55270 hypothetical protein from Arabidopsis thaliana
Aligns to 52:346 / 361 (81.7%), covers 84.9% of PF03478, 105.3 bits
AT5G53240 hypothetical protein from Arabidopsis thaliana
Aligns to 37:348 / 361 (86.4%), covers 81.9% of PF03478, 104.7 bits
- Experimentally heat-induced transposition increases drought tolerance in Arabidopsis thaliana
Thieme, The New phytologist 2022 - “...class) family (/) 5 2105023943 Intron AT5G51800 Protein kinase superfamily protein (/) 5 2160203034 Exon AT5G53240 Hypothetical protein (DUF295) (+/) 5 2284643236 Intron AT5G56400 FBD, Fbox, Skp2like and Leucine Rich Repeat domainscontaining protein (+/) Location, description (Araport11) and zygosity (/ homozygous ONSEN , +/ heterozygous) of...”
- Neofunctionalization of Mitochondrial Proteins and Incorporation into Signaling Networks in Plants
Lama, Molecular biology and evolution 2019 - “...AT5G52940 AtDOB5 + + mito + Vir AT5G53230 AtDOB6 + + mito + Ang Eud AT5G53240 AtDOB7 + + mito Brass AT5G54320 AtDOB8 + + mito Ang Eud AT5G54330 AtDOB9 + + mito Ang Eud AT5G54420 AtDOB10 + + pm Land Brass AT5G54450 AtDOB11 + +...”
- BLISTER Regulates Polycomb-Target Genes, Represses Stress-Regulated Genes and Promotes Stress Responses in Arabidopsis thaliana
Kleinmanns, Frontiers in plant science 2017 - “...gene 13 (SAG13) 10.90 Yes 9 AT5G53230 Protein of unknown function (DUF295) 10.73 Yes 10 AT5G53240 Protein of unknown function (DUF295) 9.96 Yes 11 AT1G09180 Secretion-associated RAS super family 1 (SARA1) 8.44 No 12 AT3G57260 beta-1,3-glucanase 2, PATHOGENESIS-RELATED PROTEIN 2, (PR2) 8.00 Yes 13 AT2G38240 2-oxoglutarate...”
- Differential proteomic analysis of Arabidopsis thaliana genotypes exhibiting resistance or susceptibility to the insect herbivore, Plutella xylostella
Collins, PloS one 2010 - “...individual Ril; isocitrate dehydrogenase (pooled Rils=At5g14590; individual Ril=At1g65930), malate dehydrogenase (pooled Rils=At5g58330; individual Ril=At5g53240 and At5g53240 or At3g15020), and glyceraldehyde-3-phosphate dehydrogenase (pooled Rils=At1g42970 and At3g04120; individual Ril=At1g13440). The relevance of these has been discussed above. A number of other protein differences between Rils 57 and 23...”
AT5G52930 hypothetical protein from Arabidopsis thaliana
Aligns to 40:341 / 359 (84.1%), covers 82.6% of PF03478, 103.7 bits
- Neofunctionalization of Mitochondrial Proteins and Incorporation into Signaling Networks in Plants
Lama, Molecular biology and evolution 2019 - “...Eud AT3G43170 AtDOB2 + + perox Ang Eud AT4G13680 AtDOB3 + + mito Brass Eud AT5G52930 AtDOB4 + + mito + AT5G52940 AtDOB5 + + mito + Vir AT5G53230 AtDOB6 + + mito + Ang Eud AT5G53240 AtDOB7 + + mito Brass AT5G54320 AtDOB8 + +...”
- “...group of three (from a total of six in close proximity) (see table1 ), whereas At5g52930 and At5g52940 form a consecutive group (two out of two at this locus). This suggests their coregulation is possibly caused by coduplication of regulatory information. This coexpression of neighboring genes...”
AT4G25920 hypothetical protein from Arabidopsis thaliana
Aligns to 123:362 / 390 (61.5%), covers 74.9% of PF03478, 102.7 bits
- Neofunctionalization of Mitochondrial Proteins and Incorporation into Signaling Networks in Plants
Lama, Molecular biology and evolution 2019 - “...Land Vir AT4G14260 AtDOA7 + + nu Brass Eud AT4G16080 AtDOA8 + + mito mito AT4G25920 AtDOA9 + + mito Eud AT4G25930 AtDOA10 + + mito + Ang Eud AT5G03390 AtDOA11 + + mito plastid Land AT5G46130 AtDOA12 + + mito AT5G46140 AtDOA13 + + cyt...”
- “...as an annotated domain ( fig.1 ). Yeast two-hybrid interactions have been reported only for At4g25920 ( Arabidopsis Interactome Mapping Consortium 2011 ) ( supplementary table 1 , Supplementary Material online). A fourth group (indicated in orange in fig.1 ), including At1g57790 and At5g55150 , contains...”
- Comparative analysis of plant immune receptor architectures uncovers host proteins likely targeted by pathogens
Sarris, BMC biology 2016 - “...DNA-binding domain HARXL16 AT4G32570 tify tify domain HARXL21 AT1G15750 WD40 WD domain, G-beta repeat HARXL44 AT4G25920 DUF295 Protein of unknown function (DUF295) HARXL44 AT4G16380 HMA Heavy metal-associated domain HARXL45_group AT4G02550 Myb_DNA-bind_3 Myb/SANT-like DNA-binding domain HARXL68 AT1G45145 Thioredoxin Thioredoxin HARXL68 AT5G42980 Thioredoxin Thioredoxin HARXL73 AT4G39050 Kinesin Kinesin...”
- Conserved versatile master regulators in signalling pathways in response to stress in plants
Balderas-Hernández, AoB PLANTS 2013 - “...Sip1p/Sip2p/Gal83p family member); activates glucose-repressed genes, represses glucose-induced genes; role in sporulation and peroxisome biogenesis AT4G25920 828698 Hypothetical protein AT1G07310 837242 Calcium-dependent lipid-binding domain GDU4 817013 Glutamine dumper 4 ATERDJ2A 844334 Translocation protein SEC63 AT1G19450 8838529 Sugar transporter ERD6-like 4 CNGC18 831339 Cyclic nucleotide-gated channel 18...”
- Regulation of ABCB1/PGP1-catalysed auxin transport by linker phosphorylation
Henrichs, The EMBO journal 2012 - “...protein (At3G48830) and an unknown protein (At4G25920). In addition, two protein kinases, the histidinelike kinase AHK5/CYTOKININ INDEPENDENT2 (At5G10720)...”
- “...AT3G48830 61 3.2 Similar to unknown protein 1.1 AT4G25920 38 AHK5 (CYTOKININ INDEPENDENT 2) AT5G10720 34 1.2 PID (PINOID) AT2G34650 32 3.0 Protein phosphatase...”
AT5G54330 hypothetical protein from Arabidopsis thaliana
Aligns to 41:341 / 356 (84.6%), covers 84.2% of PF03478, 102.1 bits
- FIERY1 promotes microRNA accumulation by suppressing rRNA-derived small interfering RNAs in Arabidopsis
You, Nature communications 2019 - “...the location of the mutation to a region consisting of 10 candidate genes (AT5G49770, AT5G52170, AT5G54330, AT5G55330, AT5G57060, AT5G62770, AT5G63450, AT5G63980, AT5G64390, and AT5G64430) that contained SNPs with discordant chastity scores over 0.95. We designed dCAPS primers for all of the candidate genes and analyzed another...”
- Neofunctionalization of Mitochondrial Proteins and Incorporation into Signaling Networks in Plants
Lama, Molecular biology and evolution 2019 - “...Ang Eud AT5G53240 AtDOB7 + + mito Brass AT5G54320 AtDOB8 + + mito Ang Eud AT5G54330 AtDOB9 + + mito Ang Eud AT5G54420 AtDOB10 + + pm Land Brass AT5G54450 AtDOB11 + + mito + Ang Eud AT5G54550 AtDOB12 + + mito + Ang Eud AT5G54560...”
AT5G54560 hypothetical protein from Arabidopsis thaliana
Aligns to 54:335 / 360 (78.3%), covers 78.0% of PF03478, 101.4 bits
- Physiological and Transcriptomic Analysis of Arabidopsis thaliana Responses to Ailanthone, a Potential Bio-Herbicide
Hopson, International journal of molecular sciences 2022 - “...hypothetical protein 6.85 4.55 5.52 UP AT5G55150 F-box SKIP23-like protein (DUF295) 6.65 3.82 3.02 UP AT5G54560 hypothetical protein (DUF295) 6.60 6.05 6.05 UP AT2G20800 NAD(P)H dehydrogenase B4 ( NDB4 ) 6.34 3.76 4.46 UP AT5G54450 hypothetical protein (DUF295) 6.24 2.60 3.30 UP AT5G36130 Cytochrome P450 superfamily...”
- Neofunctionalization of Mitochondrial Proteins and Incorporation into Signaling Networks in Plants
Lama, Molecular biology and evolution 2019 - “...AtDOB11 + + mito + Ang Eud AT5G54550 AtDOB12 + + mito + Ang Eud AT5G54560 AtDOB13 + + mito + Land AT5G55270 AtDOB14 + + plastid Eud AT5G55870 AtDOB15 + + mito Ang Eud AT5G55880 AtDOB16 + + mito Ang Eud AT5G55890 AtDOB17 + +...”
- “...genes (80%) spread over 13 tandems. One tandem even contained six genes spanning At5g54320 to At5g54560 . The F-box/DUF295 FDB group contained 26 of 38 (68%) tandem duplicated genes spread over 10 tandems. Also here tandems of up to six genes were found (At4g22030 to At4g22180)....”
AT1G65740 F-box family protein from Arabidopsis thaliana
NP_176751 ascorbic acid mannose pathway regulator (DUF295) from Arabidopsis thaliana
Aligns to 60:354 / 371 (79.5%), covers 81.9% of PF03478, 101.0 bits
- Neofunctionalization of Mitochondrial Proteins and Incorporation into Signaling Networks in Plants
Lama, Molecular biology and evolution 2019 - “...cyt AT1G64840 AtFDA3 + + + cyt, pm + Vir At1g65375 AtFDA4 + + + AT1G65740 AtFDA5/UCL1 + + + cyt + Eud Brass AT1G65760 AtFDA6 + + + pm AT1G65770 AtFDA7 + + + mito + Eud Brass AT2G16290 AtFDA8 + + + pm Ang...”
- “...interact with Arabidopsis 14-3-3 proteins ( Hong etal. 2017 ). Upward Curly Leaf 1 (UCL1, At1g65740 ) was found to be a nuclear protein interacting with Curly Leaf Polycomb proteins and ASK1 ( Jeong etal. 2011 ). This indicates that ASK1 binding is a common feature...”
- Control of Paternally Expressed Imprinted UPWARD CURLY LEAF1, a Gene Encoding an F-Box Protein That Regulates CURLY LEAF Polycomb Protein, in the Arabidopsis Endosperm
Jeong, PloS one 2015 - “...According to the TAIR annotation, At1g65750 , which is located upstream of the UCL1 ( At1g65740 ) locus, encodes a non-LTR retrotransposon (LINE). Using the RepeatMasker program ( http://www.repeatmasker.org/cgi-bin/WEBRepeatMasker ), we identified two ATLINE1_1 transposable elements (TEs) in the Col-0 ecotype, namely 1) a long one...”
- “...that At1g65750 has a single non-LTR retrotransposon (LINE), which is located upstream of UCL1 ( At1g65740 ), At1g65750 is likely composed of two ATLINE1_1 transposable elements (TEs), according to the RepeatMasker program. Interestingly, the number of ATLINE1_1 TEs is not identical in different ecotypes. While both...”
- An E3 ligase complex regulates SET-domain polycomb group protein activity in Arabidopsis thaliana
Jeong, Proceedings of the National Academy of Sciences of the United States of America 2011 - “...had inserted in the intergenic region between At1g65740 and At1g65750 (Fig. 1B). Real-time quantitative RT-PCR (qRT-PCR) showed that expression of At1g65740,...”
- “...observed the curly leaf phenotype only when overexpressing At1g65740 in transgenic plants using the Cauliflower Mosaic Virus (CaMV) promoter (Figs. S1 C and D...”
- Control of Paternally Expressed Imprinted UPWARD CURLY LEAF1, a Gene Encoding an F-Box Protein That Regulates CURLY LEAF Polycomb Protein, in the Arabidopsis Endosperm.
Jeong, PloS one 2015 - GeneRIF: UPWARD CURLY LEAF1 (UCL1), a gene encoding an E3 ligase that degrades the CURLY LEAF (CLF) polycomb protein, is a paternally expressed imprinted gene(PEG). [UCL1]
AT1G05540 hypothetical protein from Arabidopsis thaliana
Aligns to 30:346 / 367 (86.4%), covers 90.0% of PF03478, 100.8 bits
AT1G30170 hypothetical protein from Arabidopsis thaliana
Aligns to 29:346 / 366 (86.9%), covers 92.3% of PF03478, 100.1 bits
- A novel seed plants gene regulates oxidative stress tolerance in Arabidopsis thaliana
Sujeeth, Cellular and molecular life sciences : CMLS 2020 - “...HSFA2, ZAT10 ), chromatin remodelers ( CHR34 ), and unknown or uncharacterized proteins ( AT5G59390, AT1G30170, AT1G21520 ) are elevated in atr7 . This indicates that atr7 is primed for an upcoming oxidative stress via pathways involving genes of unknown functions. Collectively, the data reveal ATR7...”
- “...remodelers ( CHR34 ), and many genes encoding uncharacterized proteins ( ANAC085 , AT5G59390 , AT1G30170 , AT1G21520 ), were constantly upregulated in atr7 in the absence of stress (Table 1 , Supplementary Table3). Among the proteins encoded by the 100 most upregulated genes, 32% are...”
- Neofunctionalization of Mitochondrial Proteins and Incorporation into Signaling Networks in Plants
Lama, Molecular biology and evolution 2019 - “...Land AT1G05550 AtDOA2 + + pm Land Ang AT1G30160 AtDOA3 + + cyt + Eud AT1G30170 AtDOA4 + + mito Ang AT1G68960 AtDOA5 + + mito Ang Eud AT2G45940 AtDOA6 + + cyt Land Vir AT4G14260 AtDOA7 + + nu Brass Eud AT4G16080 AtDOA8 + +...”
AT5G54550 hypothetical protein from Arabidopsis thaliana
Aligns to 50:341 / 359 (81.3%), covers 79.2% of PF03478, 100.0 bits
AT5G55890 hypothetical protein from Arabidopsis thaliana
AT5G55880 hypothetical protein from Arabidopsis thaliana
Aligns to 48:358 / 366 (85.0%), covers 84.2% of PF03478, 99.2 bits
- Neofunctionalization of Mitochondrial Proteins and Incorporation into Signaling Networks in Plants
Lama, Molecular biology and evolution 2019 - “...Eud AT5G55870 AtDOB15 + + mito Ang Eud AT5G55880 AtDOB16 + + mito Ang Eud AT5G55890 AtDOB17 + + mito Ang Eud Note . A. trich , conserved in Amborella trichopoda ; Mono/Dicot, conserved in monocots and dicots; Brassic-only, only conserved in Brassicaceae; F-box, protein contains...”
- Joint Analysis of Dependent Features within Compound Spectra Can Improve Detection of Differential Features
Trutschel, Frontiers in bioengineering and biotechnology 2015 - “...population (Schneider et al., 2005 ). This particular mutant has an over-expression of the AT5G55880 AT5G55890 genetic region with unknown function. Plants were grown on soil in a growth chamber under controlled conditions as biological replicates. The frozen leaf material of each plant was ground and...”
- Neofunctionalization of Mitochondrial Proteins and Incorporation into Signaling Networks in Plants
Lama, Molecular biology and evolution 2019 - “...+ Land AT5G55270 AtDOB14 + + plastid Eud AT5G55870 AtDOB15 + + mito Ang Eud AT5G55880 AtDOB16 + + mito Ang Eud AT5G55890 AtDOB17 + + mito Ang Eud Note . A. trich , conserved in Amborella trichopoda ; Mono/Dicot, conserved in monocots and dicots; Brassic-only,...”
- Joint Analysis of Dependent Features within Compound Spectra Can Improve Detection of Differential Features
Trutschel, Frontiers in bioengineering and biotechnology 2015 - “...TAMARA population (Schneider et al., 2005 ). This particular mutant has an over-expression of the AT5G55880 AT5G55890 genetic region with unknown function. Plants were grown on soil in a growth chamber under controlled conditions as biological replicates. The frozen leaf material of each plant was ground...”
LOC106438264 uncharacterized protein LOC106438264 from Brassica napus
Aligns to 51:348 / 383 (77.8%), covers 93.8% of PF03478, 99.1 bits
GRMZM2G052817 uncharacterized protein LOC100192569 from Zea mays
Aligns to 80:343 / 371 (71.2%), covers 94.2% of PF03478, 97.3 bits
AT4G14260 hypothetical protein from Arabidopsis thaliana
Aligns to 84:358 / 379 (72.6%), covers 74.9% of PF03478, 95.5 bits
AT3G03720 CAT4 (CATIONIC AMINO ACID TRANSPORTER 4); cationic amino acid transmembrane transporter from Arabidopsis thaliana
Aligns to 2:182 / 801 (22.6%), covers 65.3% of PF03478, 95.1 bits
- Cellular export of sugars and amino acids: role in feeding other cells and organisms
Kim, Plant physiology 2021 - “...-coexpressed UmamiTs , AAP family protein PUT1 (At1g31820), AAP1 (At1g58360), cationic amino acid transporters CAT4 (At3g03720), CAT9 (At1g05940), and CAT2 (At1g58030) is indicated. The logit score for UmamiT45 was 14.2. Figure 4 The role of SWEETs and UmamiTs in Arabidopsis, rice, and maize. A, The role...”
- Transcription of putative tonoplast transporters in response to glyphosate and paraquat stress in Conyza bonariensis and Conyza canadensis and selection of reference genes for qRT-PCR
Moretti, PloS one 2017 - “...amino acid transporter (CAT), [ 22 ]. In Arabidopsis , both CAT2 (AT1G58030) and CAT4 (AT3G03720) encode CATs which are primarily localized to the tonoplast [ 23 ], making them appropriate candidates for the vacuolar sequestration of paraquat. In glyphosate-paraquat-resistant (GPR) Conyza spp ., reduced translocation...”
- “...MRP8 (M11) NM_112148.3 AT3G13090 JSWR01014711.1 67 4e -105 CATIONIC AMINO ACID TRANSPORTER 4 (CAT4) NM_111243.7 AT3G03720 JSWR01002601.1 77 2e -37 NM_179491.2 AT1G58030 83 5-ENOL-PYRUVYLSHIKIMATE-3-PHOSPHATE SYNTHASE (EPSPS) NM_130093.2 AT2G45300 AY545666; JSWR01004464.1 78 7e -41 AY545667; JSWR01002887.1 77 3e -39 AY545668; JSWR01015937.1 71 2e -23 a Gene nomenclature...”
- Transcriptome-wide high-throughput deep m(6)A-seq reveals unique differential m(6)A methylation patterns between three organs in Arabidopsis thaliana
Wan, Genome biology 2015 - “...AT5G53530, AT5G01990, AT3G55320, AT4G13750, AT1G16820, AT1G77140, AT5G05570, AT5G07770, AT2G21340, AT2G27460, AT1G74720, AT1G47550, AT5G66380, AT5G47490, AT5G08470, AT3G03720, AT5G61310, AT5G62600, AT5G11980, AT1G56290, AT2G20840, AT2G15240, AT4G39420, AT5G07980, [ 15 21 ] Defense or stress response AT1G63770, AT1G64790, AT1G67090, AT1G80030, AT2G05580, AT2G27380, AT2G35510, AT2G42560, AT3G20290, AT3G22640, AT3G49600, AT4G01210, AT4G04920, AT4G08230,...”
- The AAP gene family for amino acid permeases contributes to development of the cyst nematode Heterodera schachtii in roots of Arabidopsis
Elashry, Plant physiology and biochemistry : PPB 2013 - “...0.2 0.43 At1g58032 AtCAT2 not available on GeneChip At5g36940 AtCAT3 7.8 6 1.8 a 0.00 At3g03720 AtCAT4 6.7 5.4 1.3 0.03 At2g34960 AtCAT5 3.5 3.1 0.4 0.24 At5g04770 AtCAT6 5.3 5.9 0.6 0.03 At3g10600 AtCAT7 3.3 3 0.3 0.20 At1g17120 AtCAT8 6.5 5.6 0.9 a 0.00...”
- A proteomics dissection of Arabidopsis thaliana vacuoles isolated from cell culture
Jaquinod, Molecular & cellular proteomics : MCP 2007 - “...2d Transp. NF NF At5g40670 At1g05940 At1g58030 At3g03720 At1g17120 At3g30390 At2g41190 At2g39130 At2g40420 At3g28960 At1g70330 31,007 60,138 67,072 63,597...”
AT1G64840 F-box family protein from Arabidopsis thaliana
Aligns to 53:344 / 384 (76.0%), covers 76.1% of PF03478, 92.8 bits
- Neofunctionalization of Mitochondrial Proteins and Incorporation into Signaling Networks in Plants
Lama, Molecular biology and evolution 2019 - “...Phylostratum AT1G44080 AtFDA1 + + + nu Ang Eud AT1G57906 AtFDA2 + + + cyt AT1G64840 AtFDA3 + + + cyt, pm + Vir At1g65375 AtFDA4 + + + AT1G65740 AtFDA5/UCL1 + + + cyt + Eud Brass AT1G65760 AtFDA6 + + + pm AT1G65770 AtFDA7...”
- Identifying stably expressed genes from multiple RNA-Seq data sets
Zhuo, PeerJ 2016 - “...these 10 genes from Czechowski et al. (2005) to the expression profiles of five genes (AT1G64840, AT1G75420, AT2G32910, AT3G51310, AT5G48340) that we randomly selected from the top 100 most stably expressed genes identified from the multi-tissue group RNA-Seq data according the total variance \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym}...”
- “...AT1G75420 0.0012 0.0014 0.0050 5 AT5G48340 0.0042 0.0019 0.0074 46 AT2G32910 0.0007 0.0019 0.0113 53 AT1G64840 0.0051 0.0008 0.0095 72 AT3G51310 0.0028 0.0025 0.0100 73 Microarray AT2G28390 0.0034 0.0000 0.0111 62 AT1G13320 0.0036 0.0003 0.0258 513 AT4G34270 0.0063 0.0000 0.0365 1074 AT1G59830 0.0044 0.0039 0.0370 1211...”
- A comprehensive analysis of interaction and localization of Arabidopsis SKP1-like (ASK) and F-box (FBX) proteins
Kuroda, PloS one 2012 - “...6L ), implying that they were localized in the cytosol or vacuole. Five proteins (At1g23390, At1g64840, At3g03360, At3g24760 and At5g52880) showed a preferential speckled localization in the cytoplasm ( Figure 6C, 6F, 6K, 6M and 6U ). Six (At1g21760, At1g47730, At2g25490, At4g05460, At4g27050 and At5g21040) localized...”
- “...FBX proteins. GFP-fused FBX proteins; At1g21410 (A), At1g21760 (B), At1g23390 (C), At1g30790 (D), At1g47730 (E), At1g64840 (F), At1g67190 (G), At2g24250 (H), At2g25490 (I and J), At3g03360 (K), At3g04660 (L), At3g24760 (M), At4g02440 (N), At4g05460 (O and P), At4g27050 (Q and R), At5g21040 (S and T) and...”
AT1G30160 hypothetical protein from Arabidopsis thaliana
Aligns to 34:345 / 366 (85.2%), covers 88.0% of PF03478, 91.6 bits
- Neofunctionalization of Mitochondrial Proteins and Incorporation into Signaling Networks in Plants
Lama, Molecular biology and evolution 2019 - “...pm Land AT1G05540 AtDOA1 + + mito Land AT1G05550 AtDOA2 + + pm Land Ang AT1G30160 AtDOA3 + + cyt + Eud AT1G30170 AtDOA4 + + mito Ang AT1G68960 AtDOA5 + + mito Ang Eud AT2G45940 AtDOA6 + + cyt Land Vir AT4G14260 AtDOA7 + +...”
- “...(CTTGnnnnnCAAG or similar) was found ( Kulkarni et al. 2018 ). Only for AtDOA3 ( At1g30160 ) no MDM could be found, which is in line with its ANAC017-independent gene expression ( supplementary table 2 , Supplementary Material online). Furthermore, by using DNA affinity purification sequencing...”
AT5G46130 hypothetical protein from Arabidopsis thaliana
Aligns to 107:346 / 376 (63.8%), covers 74.9% of PF03478, 91.0 bits
AT5G24040 F-box family protein from Arabidopsis thaliana
Aligns to 157:343 / 373 (50.1%), covers 59.1% of PF03478, 90.8 bits
AT4G16080 hypothetical protein from Arabidopsis thaliana
Aligns to 23:325 / 354 (85.6%), covers 95.8% of PF03478, 90.8 bits
- Neofunctionalization of Mitochondrial Proteins and Incorporation into Signaling Networks in Plants
Lama, Molecular biology and evolution 2019 - “...Eud AT2G45940 AtDOA6 + + cyt Land Vir AT4G14260 AtDOA7 + + nu Brass Eud AT4G16080 AtDOA8 + + mito mito AT4G25920 AtDOA9 + + mito Eud AT4G25930 AtDOA10 + + mito + Ang Eud AT5G03390 AtDOA11 + + mito plastid Land AT5G46130 AtDOA12 + +...”
- “...evidence for organellar location of the DOA and DOB proteins was very limited. AtDOA8 ( At4g16080 ) was identified in purified mitochondria by mass spectrometry (MS) ( Senkler etal. 2017 ), whereas AtDOA11 ( AT5G03390 ) was identified by MS in purified chloroplasts ( Zybailov etal....”
GRMZM2G446921 uncharacterized protein LOC100273748 from Zea mays
Aligns to 121:403 / 431 (65.7%), covers 82.2% of PF03478, 88.1 bits
- Unravelling the genetic framework associated with grain quality and yield-related traits in maize (Zea mays L.)
Sethi, Frontiers in genetics 2023 - “...three genes associated with kernel number per row ( viz. , GRMZM2G049091 , GRMZM2G138067 , GRMZM2G446921 ), one gene associated with kernel thickness (i.e., Zm00001d041972 ), two genes associated with kernel weight ( viz. , GRMZM2G010933 , GRMZM2G464985 ), one gene associated with moisture content (i.e.,...”
- Genome wide association analysis for yield related traits in maize
Zeng, BMC plant biology 2022 - “...GRMZM2G049091 GRMZM2G138067 Transcription initiation factor IIF beta subunit Protein LURP-one-related 5 KNR 7_13586175 8.49E-05 7.77 GRMZM2G446921 F-box domain containing protein HKW 2_206427709 2.45E-05 8.72 GRMZM2G418343 GRMZM2G117900 Cell wall protein precursor putative Translation initiation factor family protein HKW 6_67617018 4.05E-04 5.59 GRMZM2G430902 C3HC4-type RING finger family protein...”
AT4G13680 hypothetical protein from Arabidopsis thaliana
Aligns to 55:351 / 354 (83.9%), covers 80.3% of PF03478, 87.3 bits
AT5G25300 hypothetical protein from Arabidopsis thaliana
Aligns to 12:277 / 477 (55.8%), covers 78.0% of PF03478, 87.1 bits
AT4G25930 hypothetical protein from Arabidopsis thaliana
Aligns to 34:348 / 367 (85.8%), covers 83.0% of PF03478, 86.7 bits
- Neofunctionalization of Mitochondrial Proteins and Incorporation into Signaling Networks in Plants
Lama, Molecular biology and evolution 2019 - “...nu Brass Eud AT4G16080 AtDOA8 + + mito mito AT4G25920 AtDOA9 + + mito Eud AT4G25930 AtDOA10 + + mito + Ang Eud AT5G03390 AtDOA11 + + mito plastid Land AT5G46130 AtDOA12 + + mito AT5G46140 AtDOA13 + + cyt AT5G53780 AtDOA14 + + cyt Eud...”
- “...were published for any of the predicted mitochondrial isoforms, we cloned three representatives AtDOA10 ( At4g25930 ), AtDOB5 ( At5g52940 ), and AtDOB12 ( At5g54550 ) into C-terminal GFP-fusion vectors (see below for more information on why these were selected). The localization of the fusion proteins...”
AT4G22035 F-box only protein from Arabidopsis thaliana
Aligns to 56:236 / 243 (74.5%), covers 59.1% of PF03478, 86.2 bits
AT5G46140 hypothetical protein from Arabidopsis thaliana
Aligns to 3:259 / 289 (88.9%), covers 70.3% of PF03478, 85.0 bits
AT4G00893 hypothetical protein from Arabidopsis thaliana
Aligns to 88:353 / 388 (68.6%), covers 95.0% of PF03478, 84.7 bits
- Study of natural diversity in response to a key pathogenicity regulator of Ralstonia solanacearum reveals new susceptibility genes in Arabidopsis thaliana
Demirjian, Molecular plant pathology 2022 - “...score=107.3; Table S5 ). It underlies a large genomic region containing 10 candidate genes ( At4g00893 , At4g00895 , At4g00900 , At4g00905 , At4g00910 , At4g00920 , At4g00930 , At4g00940 , At4g00950 , and At4g00955 ). Noteworthy, 22 out of these 38 QTLs were identified at...”
A0ME24 F-box domain-containing protein (Fragment) from Arabidopsis thaliana
Aligns to 88:353 / 389 (68.4%), covers 95.0% of PF03478, 84.6 bits
AT1G65760 F-box family protein from Arabidopsis thaliana
Aligns to 57:344 / 362 (79.6%), covers 81.9% of PF03478, 83.1 bits
- Neofunctionalization of Mitochondrial Proteins and Incorporation into Signaling Networks in Plants
Lama, Molecular biology and evolution 2019 - “...Vir At1g65375 AtFDA4 + + + AT1G65740 AtFDA5/UCL1 + + + cyt + Eud Brass AT1G65760 AtFDA6 + + + pm AT1G65770 AtFDA7 + + + mito + Eud Brass AT2G16290 AtFDA8 + + + pm Ang Eud Brass AT2G16300 AtFDA9 + + (+) pm Ang...”
- Control of Paternally Expressed Imprinted UPWARD CURLY LEAF1, a Gene Encoding an F-Box Protein That Regulates CURLY LEAF Polycomb Protein, in the Arabidopsis Endosperm
Jeong, PloS one 2015 - “...per well. Samples were normalized against 2 tubulin or actin levels. Sequencing of At1g65750 and At1g65760 in different Arabidopsis ecotypes To amplify At1g65750 and At1g65760 in different Arabidopsis ecotypes, the primer sets JCW637/638 and JCW639/640 ( S2 Table ) were used. Agarose gel electrophoresis revealed that...”
- Expression-based and co-localization detection of arabinogalactan protein 6 and arabinogalactan protein 11 interactors in Arabidopsis pollen and pollen tubes
Costa, BMC plant biology 2013 - “...(Pathogenesis-related protein, putative) At2g19970 +23.34 + C2 domain-containing protein At3g57880 +16.93 + F-box family protein At1g65760 +11.8 + Beta glucosidase 36 At1g51490 +4.95 + CAP (allergen V5) At2g19980 +4.79 + Hypothetical protein At2g22340 -141.79 - Pentatricopeptide (PPR) At5g28380 -44.55 - Avirulence-responsive family protein At4g09950 -25.77 -...”
- “...AGI locus LBFC a Gene annotation b 29.5.11.4.3.2: protein. degradation. ubiquitin. E3. SCF. F-box Up-regulated At1g65760 11.8 Protein of unknown function (DUF295) At2g27520 6.63 F-box and associated interaction domains-containing protein At5g38390 5.43 F-box/RNI-like superfamily protein At3g52030 3.92 F-box family protein with WD40/YVTN repeat domain At2g24080 3.52...”
- An E3 ligase complex regulates SET-domain polycomb group protein activity in Arabidopsis thaliana
Jeong, Proceedings of the National Academy of Sciences of the United States of America 2011 - “...RT-PCR (qRT-PCR) showed that expression of At1g65740, At1g65760, and At1g65770 was elevated in ucl1-D homozygous plants (Fig. S1B). Among these three...”
AT3G03726 hypothetical protein from Arabidopsis thaliana
Aligns to 33:238 / 264 (78.0%), covers 75.3% of PF03478, 81.5 bits
AT5G14160 F-box family protein from Arabidopsis thaliana
Aligns to 61:307 / 352 (70.2%), covers 100.0% of PF03478, 79.7 bits
- Arabidopsis thaliana Accessions from the Chernobyl Exclusion Zone Show Decreased Sensitivity to Additional Acute Irradiation
Podlutskii, Plants (Basel, Switzerland) 2022 - “...Among the most upregulated genes were AT5G49420 (MADS-box transcription factor family protein), AT1G15640 (unknown protein), AT5G14160 (F-box family protein), and AT4G37990 (elicitor-activated gene 3-2). The strongest repression levels were observed for AT2G27402 (unknown protein), AT2G29000 (leucine-rich repeat protein kinase family protein), AT3G61030 (calcium-dependent lipid-binding family protein),...”
- “...2 log 2 FC AT4G05235 Long non-coding RNA 10.77 8.45 AT1G15640 Transmembrane protein 7.93 8.59 AT5G14160 F-box family protein 7.28 7.58 AT3G21330 Basic helixloophelix (bHLH) DNA-binding superfamily protein 4.00 AT5G18010 SAUR-like auxin-responsive protein family 3.10 AT5G39860 Basic helixloophelix (bHLH) DNA-binding family protein 2.74 AT5G18050 SAUR-like auxin-responsive...”
- Neofunctionalization of Mitochondrial Proteins and Incorporation into Signaling Networks in Plants
Lama, Molecular biology and evolution 2019 - “...Eud AT4G22180 AtFDB32 + + + cyt AT4G22660 AtFDB33 + + + cyt Ang Eud AT5G14160 AtFDB34 + + + cyt Land AT5G25290 AtFDB35 + + + pm Ang Eud AT5G25300 AtFDB36 + + + nu Ang Eud AT5G38270 AtFDB37 + + + cyt Ang Eud...”
AT2G24250 F-box family protein from Arabidopsis thaliana
Aligns to 73:339 / 374 (71.4%), covers 74.9% of PF03478, 78.6 bits
AT4G12370 hypothetical protein from Arabidopsis thaliana
Aligns to 1:271 / 300 (90.3%), covers 88.4% of PF03478, 71.0 bits
- A novel locus (Bnsdt2) in a TFL1 homologue sustaining determinate growth in Brassica napus
Li, BMC plant biology 2021 - “...biosynthesis family protein chrC09g006427 AT5G03900 Unknown chrC09g006428 AT5G03890 Unknown chrC09g006429 AT5G03880 Thioredoxin family protein chrC09g006430 AT4G12370 Unknown chrC09g006431 AT5G03850 Nucleic acid binding, OB-fold-like protein chrC09g006432 AT4G30340 Diacylglycerol kinase 7 chrC09g006433 AT5G03850 Nucleic acid binding, OB-fold-like protein chrC09g006434 AT5G03840 PEBP (phosphatidylethanolamine-binding protein) family protein ( TFL1 )...”
AT5G67040 hypothetical protein from Arabidopsis thaliana
Aligns to 1:147 / 165 (89.1%), covers 35.5% of PF03478, 70.8 bits
AT2G24255 hypothetical protein from Arabidopsis thaliana
Aligns to 29:317 / 336 (86.0%), covers 64.9% of PF03478, 69.2 bits
AT4G22030 F-box family protein from Arabidopsis thaliana
Aligns to 444:594 / 626 (24.1%), covers 36.3% of PF03478, 69.1 bits
- Molecular cloning and functional characterization of the promoter of a novel Aspergillus flavus inducible gene (AhOMT1) from peanut
Zhuang, Frontiers in plant science 2023 - “...upregulation GFBZZHF02GJYBV 40S ribosomal protein S5 (Fragment) 12 14 9194 656.71 GALJ6PP01B5DBY Probable F-box protein At4g22030 15 13 3562 274.00 GAYHEI101EGW7N Protein GLUTAMINE DUMPER 1 888 31 7672 247.48 GALJ6PP01DP2GR EG45-like domain containing protein 13 11 2751 250.09 GD3IWDR02CZXC6 Uncharacterized protein 19 22 4752 216.00 GFBZZHF01DILSM...”
- Transcriptome analysis and functional validation reveal a novel gene, BcCGF1, that enhances fungal virulence by promoting infection-related development and host penetration
Zhang, Molecular plant pathology 2020 - “...Cytochrome P450 84A1 Solyc01g095080.2 ACS2 161.1 1aminocyclopropane1carboxylate synthase 2 Solyc02g080840.1 LOC101256060 157.3 Probable Fbox protein At4g22030 Solyc09g066400.1 LOC101248046 156.6 Premnaspirodiene oxygenase Solyc02g070110.1 LOC101263972 136.4 Cannabidiolic acid synthase Solyc04g016000.2 LOC101266325 136.4 Heat stress transcription factor B3 Solyc01g101170.2 TPS31 133.2 Probable 5epiaristolochene synthase 4 Solyc07g062370.1 LOC101249107 122.5 Hypothetical...”
- Neofunctionalization of Mitochondrial Proteins and Incorporation into Signaling Networks in Plants
Lama, Molecular biology and evolution 2019 - “...AT4G17565 AtFDB26 + + + cyt Ang Eud AT4G22035 AtFDB27 + + + Eud Brass AT4G22030 AtFDB28 + + + plastid Ang AT4G22060 AtFDB29 + + + pm, golgi Ang Eud AT4G22165 AtFDB30 + + + cyt Ang Eud AT4G22170 AtFDB31 + + + cyt Ang...”
- “...genes spread over 10 tandems. Also here tandems of up to six genes were found (At4g22030 to At4g22180). Finally, also the ancestral FDA family contained many tandem duplications, with 10 of 20 genes (50%) spread over 4 tandems. In conclusion, it appears that the DUF295 family...”
- Whole genome-wide transcript profiling to identify differentially expressed genes associated with seed field emergence in two soybean low phytate mutants
Yuan, BMC plant biology 2017 - “...down gene43660 polygalacturonase inhibitor-like up gene37153 polyphenol oxidase A1, chloroplastic-like up gene24050 probable F-box protein At4g22030 down gene18907 probable glutathione S-transferase up gene36822 probable glycosyltransferase At5g03795 down gene42818 reticuline oxidase-like protein up gene51756 soyasapogenol B glucuronide galactosyltransferase-like up gene53209 two-component response regulator ARR14-like up gene6319 UDP-glycosyltransferase...”
- Hyperosmotic priming of Arabidopsis seedlings establishes a long-term somatic memory accompanied by specific changes of the epigenome
Sani, Genome biology 2013 - “...18 protein Down 600 400 Down AT4G19740 Catalytic/ cation binding/chitinase/ hydrolase Down 1,600 200 Down AT4G22030 F-box family protein Down 200 200 Down AT4G22070 WRKY31; transcription factor Down 200 200 Down AT4G28840 Unknown protein Down 800 200 Down AT4G29033 Encodes a defensin-like (DEFL) family protein. Down...”
AT2G16300 F-box family protein from Arabidopsis thaliana
Aligns to 47:318 / 322 (84.5%), covers 62.5% of PF03478, 67.2 bits
- Neofunctionalization of Mitochondrial Proteins and Incorporation into Signaling Networks in Plants
Lama, Molecular biology and evolution 2019 - “...+ + mito + Eud Brass AT2G16290 AtFDA8 + + + pm Ang Eud Brass AT2G16300 AtFDA9 + + (+) pm Ang Eud Brass AT2G16365 AtFDA10 + + (+) nu Vir AT2G17030 AtFDA11/SKIP23 + + + golgi + Vir AT2G17036 AtFDA12 + + + cyt AT2G17690...”
- “...genes in this group AtFDA1-20 (F-box/DUF295 Ancestral) ( fig.1 and table1 ). Interestingly, AtFDA9 ( At2g16300 ) is nearly identical to the adjacent gene AtFDA8 ( At2g16290 ), however a frameshift has occurred due to a single base deletion just before the start of the DUF295...”
AT4G14165 F-box family protein-related from Arabidopsis thaliana
Aligns to 11:235 / 268 (84.0%), covers 56.8% of PF03478, 66.7 bits
AT1G57906 hypothetical protein from Arabidopsis thaliana
Aligns to 11:228 / 228 (95.6%), covers 59.1% of PF03478, 63.4 bits
AT4G10820 F-box family protein from Arabidopsis thaliana
Aligns to 1:234 / 273 (85.7%), covers 87.3% of PF03478, 60.0 bits
AT3G22333 F-box/kelch-repeat protein from Arabidopsis thaliana
Aligns to 63:203 / 203 (69.5%), covers 42.5% of PF03478, 57.4 bits
M8A4C9 laccase from Triticum urartu
Aligns to 526:735 / 780 (26.9%), covers 53.3% of PF03478, 56.4 bits
Q84V03 F-box protein At2g16365 from Arabidopsis thaliana
Aligns to 559:777 / 778 (28.1%), covers 39.8% of PF03478, 50.6 bits
- De-novo transcriptome assembly and analysis of lettuce plants grown under red, blue or white light
Kumar, Scientific reports 2022 - “...9.12 3.81E-06 DN16893_c1_g2_i4 Q9FN11 (53.0) LBD37 9.12 9.88E-07 DN17027_c2_g4_i3 Q39033 (71.0) PLC2 11.91 9.32E-11 DN16948_c2_g1_i10 Q84V03 (31.2) F16F14.15 11.06 1.41E-23 DN17343_c1_g9_i1 Q9LP46 (32.0) SCAR3 10.51 1.06E-11 DN17642_c0_g1_i13 P45739 (94.0) Catalase 10.11 9.22E-09 DN18289_c4_g2_i9 Q8LCQ4 (82.2) LHCA6 9.90 1.73E-11 DN18008_c4_g1_i6 Q9SWF9 (79.5) 9.89 1.81E-11 DN17073_c1_g1_i7 Q8GYW8 (32.8)...”
AT2G16365 F-box family protein from Arabidopsis thaliana
NP_001118329 F-box family protein from Arabidopsis thaliana
Aligns to 522:726 / 727 (28.2%), covers 39.0% of PF03478, 50.6 bits
- The Function, Regulation, and Mechanism of Protein Turnover in Circadian Systems in Neurospora and Other Species
, International journal of molecular sciences 2024 - TANDEM ZINC-FINGER/PLUS3 regulates phytochrome B abundance and signaling to fine-tune hypocotyl growth
Fang, The Plant cell 2022 - “...in Supplemental Data Set S1 . Accession numbers TZP (At5g43630), PHYB (At2g18790), PIF4 (At2g43010), PCH1 (AT2G16365), ATHB2 (AT4G16780), HFR1 (AT1G02340), UGP (AT3G03250), and ISU1 (AT4G22220). Supplemental data The following materials are available in the online version of this article. Supplemental Figure S1 . Synergistic interaction between...”
- PIFs- and COP1-HY5-mediated temperature signaling in higher plants
Bian, Stress biology 2022 - “...PAR1 AT2G42870 Positive ND Negative Zhou et al. 2014 ; Ikeda et al. 2021 PCH1 AT2G16365 Positive ND Negative Enderle et al. 2017 ; Murcia et al. 2021 PCHL AT4G34550 Positive ND Negative Enderle et al. 2017 phyB AT2G18790 Positive Positive Negative Wagner et al. 1991...”
- Illuminating the COP1/SPA Ubiquitin Ligase: Fresh Insights Into Its Structure and Functions During Plant Photomorphogenesis
Ponnu, Frontiers in plant science 2021 - “...al., 2014 PAR2 AT3G58850 bHLH transcription factor Yes Nd Photomorphogenesis Zhou et al., 2014 PCH1 AT2G16365 F-box protein Yes Nd Phytochrome signaling Cheng et al., 2020 PCHL AT4G34550 F-box protein Yes Nd Phytochrome signaling Cheng et al., 2020 PHYA AT1G09570 Phytochrome Yes Yes Light perception Seo...”
- Identification of small RNAs during cold acclimation in Arabidopsis thaliana
Tiwari, BMC plant biology 2020 - “...genes and oxidative stress signaling [ 129 ]. Transcripts encoding F-Box containing proteins (AT2G33655, AT1G11270, AT2G16365) that are known to be co-expressed with several abiotic stress related genes [ 130 ] or to activate stress-responsive genes [ 131 ] showed pairing with pre-tRNA transcripts to produce...”
- Neofunctionalization of Mitochondrial Proteins and Incorporation into Signaling Networks in Plants
Lama, Molecular biology and evolution 2019 - “...+ + pm Ang Eud Brass AT2G16300 AtFDA9 + + (+) pm Ang Eud Brass AT2G16365 AtFDA10 + + (+) nu Vir AT2G17030 AtFDA11/SKIP23 + + + golgi + Vir AT2G17036 AtFDA12 + + + cyt AT2G17690 AtFDA13 + + + cyt cyto + Ang Eud...”
- “...that AtFDA9 was originally a DUF295-containing gene. The structure of the close-by gene AtFDA10 ( At2g16365 ) appeared even more complex. In the current TAIR10 annotation, At2g16365 is named photoperiodic control of hypocotyl 1 ( PCH1 ), which is 778 amino acids long. The PCH1 domain...”
- De novo transcriptome assembly reveals high transcriptional complexity in Pisum sativum axillary buds and shows rapid changes in expression of diurnally regulated genes
Kerr, BMC genomics 2017 - “...Protein TRANSPORT INHIBITOR RESPONSE 1 comp35285_c0 AT1G14450 NADH dehydrogenase comp35297_c0 AT4G26470 Calcium-binding protein CML21 comp35867_c0 AT2G16365 F-box protein comp36828_c0 AT3G48770 ATP/DNA binding protein comp42921_c0 AT1G68050 Kelch repeat-containing protein comp54867_c0 AT1G02070 Uncharacterized protein comp55051_c0 AT1G27480 Lecithin-cholesterol acyltransferase-like 1 comp55149_c0 AT3G24150 Uncharacterized protein comp55670_c2 ATMG00030 Uncharacterized mitochondrial protein...”
- PCH1 integrates circadian and light-signaling pathways to control photoperiod-responsive growth in Arabidopsis
Huang, eLife 2016 - “...providing a molecular mechanism for prolonging red-light signaling after prior light exposure. Results PCH1 ( At2g16365 .2) encodes a conserved, evening-peaked, EC-associated protein A protein encoded by At2g16365, a gene that was described as required for transcriptional responses to lincomycin-induced chloroplast damage ( Ruckle et al.,...”
- “...et al., 2015 ). According to the TAIR10 database ( Lamesch et al., 2011 ), At2g16365 has four splice variants encoding different protein products, three of which contain an F-box domain ( At2g16365.1, 3 and 4 ) ( Figure 1figure supplement 1A ). All peptides from...”
- More
- PCH1 and PCHL Directly Interact with PIF1, Promote Its Degradation, and Inhibit Its Transcriptional Function during Photomorphogenesis.
Cheng, Molecular plant 2020 - GeneRIF: PCH1 and PCHL Directly Interact with PIF1, Promote Its Degradation, and Inhibit Its Transcriptional Function during Photomorphogenesis.
- PCH1 regulates light, temperature, and circadian signaling as a structural component of phytochrome B-photobodies in Arabidopsis.
Huang, Proceedings of the National Academy of Sciences of the United States of America 2019 - GeneRIF: Investigated and present evidence of function of PHOTOPERIODIC CONTROL OF HYPOCOTYL 1 (PCH1) as an essential structural component of phytochrome B-containing photobodies in photomorphogenesis and thermomorphogenesis of Arabidopsis.
- PCH1 integrates circadian and light-signaling pathways to control photoperiod-responsive growth in Arabidopsis.
Huang, eLife 2016 - GeneRIF: PCH1 is a new factor that regulates photoperiod-responsive growth by integrating the clock with light perception pathways through modulating daily phyB-signaling.[PCH1]
AT1G05550 hypothetical protein from Arabidopsis thaliana
Aligns to 38:193 / 236 (66.1%), covers 41.7% of PF03478, 44.9 bits
- Differential root and shoot magnetoresponses in Arabidopsis thaliana
Paponov, Scientific reports 2021 - “...with heme binding, peroxidase activity ( At5g58400 ) and 5 genes on unknown function ( At1g05550 , At1g67865 , At3g49230 , At4g19430 , At5g43240 ). Table 6 Group F, genes characterized by a late upregulation in the shoots. Selected genes showing a fold change>2 and P...”
- “...OGOX4 1.14 1.19 1.20 1.19 1.80 1.14 1.00 1.50 1.01 1.22 1.26 3.33 4.13 3.28 At1g05550 DUF295 ORGANELLAR A 2 1.08 1.07 1.22 1.09 1.31 1.39 1.51 1.11 1.18 1.11 1.20 1.26 2.83 2.92 At1g67865 hypothetical protein 1.04 1.01 1.03 1.06 1.03 1.02 1.04 1.08 1.41...”
- High-throughput single-cell transcriptomics reveals the female germline differentiation trajectory in Arabidopsis thaliana
Hou, Communications biology 2021 - “...subcluster at the AC stage included the known gene AGO9 and unknown genes such as AT1G05550 , LTP6 , PDF1 , and AT4G29030 and were enriched for biological processes such as translation, gene expression, and peptide biosynthetic and metabolic processes (Supplementary Figs. 7 and 8 and...”
- Neofunctionalization of Mitochondrial Proteins and Incorporation into Signaling Networks in Plants
Lama, Molecular biology and evolution 2019 - “...AT5G55150 AtFDR2 + + + Not clear pm Land AT1G05540 AtDOA1 + + mito Land AT1G05550 AtDOA2 + + pm Land Ang AT1G30160 AtDOA3 + + cyt + Eud AT1G30170 AtDOA4 + + mito Ang AT1G68960 AtDOA5 + + mito Ang Eud AT2G45940 AtDOA6 + +...”
- A spatial dissection of the Arabidopsis floral transcriptome by MPSS
Peiffer, BMC plant biology 2008 - “...with ovule-inclusive, gynoecium enrichment as predicted by relaxed MPSS parameters. A gene of unknown function, At1g05550, was identified within the integuments (Figure 5a ). At5g24420 was characterized within the funiculus and both integuments of the ovule, confirming MPSS-based predictions of ovule expression (Figure 5b ). Expression...”
- “...for At2g47470 that shows expression in the carpel walls and stigma (data not shown). (A) At1g05550; GUS is expressed in both integuments and the nucellus, at the chalazal region. (B) At5g24420; GUS is expressed in the funiculus and both integuments throughout the ovule. (C) At5g49180; GUS...”
AT2G04830 F-box family protein from Arabidopsis thaliana
Aligns to 1:72 / 100 (72.0%), covers 22.8% of PF03478, 42.6 bits
AT5G43190 F-box family protein (FBX6) from Arabidopsis thaliana
Aligns to 95:346 / 403 (62.5%), covers 78.0% of PF03478, 41.8 bits
- The Identification and Expression Analysis of the Liriodendron chinense F-Box Gene Family
He, Plants (Basel, Switzerland) 2024 - “...AT1G21890 enables transmembrane transporter activity Lchi03271 2 AT5G57360 flower development and protein ubiquitination Lchi14963 6 AT5G43190 ubiquitin-dependent protein catabolic process Lchi15076 6 AT5G43190 ubiquitin-dependent protein catabolic process Lchi17591 3 AT3G54460 enables ATP-dependent chromatin remodeling activity Lchi23560 2 AT2G17020 ubiquitin-dependent protein catabolic process Lchi26033 2 AT1G12870 regulation...”
- Comparative de novo Transcriptome Analysis of Two Cultivars With Contrasting Content of Oil and Fatty Acids During Kernel Development in Torreya grandis
Zhang, Frontiers in plant science 2022 - “...homolog 2.44E-13 2.426790509 Up c91980.graph_c0 0.005208433 1.21416289 Down c94509.graph_c0 2.48E-05 1.337339018 Up c89303.graph_c0 F-box/kelch-repeat protein At5g43190 9.65E-20 1.97495432 Down c90340.graph_c0 MAR-binding filament-like protein 1 (MFP1) 1.52E-11 1.31606418 Down c99307.graph_c0 Probable WRKY transcription factor 11 (WRKY11) 0.00384533 1.57568211 Up c81605.graph_c0 (R,S)-reticuline 7-O-methyltransferase (PSOMT1) 0.001091065 2.283869688 Up 2.61E-13...”
- Chromosomal Evolution and Apomixis in the Cruciferous Tribe Boechereae
Mandáková, Frontiers in plant science 2020 - “...placing the Boe5 centromere close to the chromosome terminus between BACs K24F5 (At5g43211) and MNL12 (At5g43190). Localization of rDNA Loci In P. micrantha , NORs (35S rDNA loci) were localized on the termini of five chromosomes (Hal1, Hal3, Hal4, Hal6, and Hal7) and two 5S rDNA...”
- A Conserved Carbon Starvation Response Underlies Bud Dormancy in Woody and Herbaceous Species
Tarancón, Frontiers in plant science 2017 - “...RING-H2 FINGER PROTEIN ATL7 II At5g27920 F-box protein III At2g17450 RING-H2 FINGER PROTEIN ATL44 I-IV At5g43190 F-box protein III At2g18670 RING-H2 FINGER PROTEIN ATL56 IV At1g21760 F-box protein 7 II-IV At5g66160 RMR1 IV At2g42620 F-box protein MAX2 II, IV At3g60300 RWD domain-containing protein IV At4g03030 F-box...”
- Expression-based and co-localization detection of arabinogalactan protein 6 and arabinogalactan protein 11 interactors in Arabidopsis pollen and pollen tubes
Costa, BMC plant biology 2013 - “...1.36 F-box family protein At1g55590 1.35 RNI-like superfamily protein At1g23780 1.34 F-box family protein Down-regulated At5g43190 7.32 Galactose oxidase/kelch repeat superfamily protein At1g68050 4.00 Flavin-binding, kelch repeat, F-box 1 At1g12490 3.55 F-box associated ubiquitination effector family protein At1g55000 1.99 Peptidoglycan-binding LysM domain-containing protein At1g78840 1.96 F-box/RNI-like/FBD-like...”
- A comprehensive analysis of interaction and localization of Arabidopsis SKP1-like (ASK) and F-box (FBX) proteins
Kuroda, PloS one 2012 - “...Plasmids carrying ORFs of FBXs (At1g68050, At1g78730, At2g25490, At2g42720, At3g16740, At3g18980, At3g23260, At3g57590, At4g38870, At5g39250, At5g43190, At5g49610 and At5g56370) and ASKs (14, 714 and 1619) were constructed previously [15] , [16] . Y2H Each FBX ORF fragment in pDONR207 was transferred to a pGBK-RC-Gateway vector [16]...”
- “...carrying the ORFs of FBXs (At1g68050, At1g78730, At2g25490, At2g42720, At3g16740, At3g18980, At3g23260, At3g57590, At4g38870, At5g39250, At5g43190, At5g49610 and At5g56370) and ASKs (14, 714 and 1619) were constructed previously [15] , [16] . Transformation and mating of yeasts were performed as described previously [16] . Selection was...”
- VH1/BRL2 receptor-like kinase interacts with vascular-specific adaptor proteins VIT and VIK to influence leaf venation
Ceserani, The Plant journal : for cell and molecular biology 2009 - “...M H M At5g17190 Expressed protein sp, tmd H M At5g15230 GASA4 sp, tmd M At5g43190 FBx6 tmd 1 H H M At5g65440 Expressed protein H H M H Table II Coimmunoprecipitation of VH1-partner complexes. Interactions were detected using the indicated antibodies to pull down complexes...”
AT4G33160 ubiquitin-protein ligase from Arabidopsis thaliana
Q9SMZ3 F-box only protein 13 from Arabidopsis thaliana
Aligns to 117:382 / 457 (58.2%), covers 82.6% of PF03478, 41.0 bits
- In silico insights on diverse interacting partners and phosphorylation sites of respiratory burst oxidase homolog (Rbohs) gene families from Arabidopsis and rice
Kaur, BMC plant biology 2018 - “...Abscisic acid 8'-hydroxylase 4; involved in ABA catabolism Q9LJK2 a 468 P 0.405 AtRbohJ 1. AT4G33160 AT4G33160.1 Ubiquitin-protein ligase (F-box only protein 13) Q9SMZ3 a 457 P 0.823 2. AT3G28220 AT3G28220.1 Meprin and TRAF homology domain-containing protein / MATH domain-containing protein; response to salt stress Q9LHA6...”
- Transcriptional programs regulated by both LEAFY and APETALA1 at the time of flower formation
Winter, Physiologia plantarum 2015 - “..., Nomura et al. 2013 ). The biological function of the F-box protein we identified (At4G33160) has not yet been elucidated. The UNUSUAL FLORAL ORGANS (UFO) F-box protein acts as an LFY co-factor for the activation of the class B floral homeotic genes ( Levin and...”
- “...et al. 2008 , Souer et al. 2008 ). Besides the high-confidence target gene F-box (AT4G33160), the 196 LFY/AP1 targets contained another F-box protein (AT1G78100). It is possible that UFO is not required for all LFY activity in Arabidopsis because of the presence of other F-box...”
- An activated form of UFO alters leaf development and produces ectopic floral and inflorescence meristems
Risseeuw, PloS one 2013 - “...F-box genes most similar to UFO ( LEAF CURLING RESPONSIVENESS [ LCR ; At1g27340], At1g76920, At4g33160) with or without VP16 did not result in the production of aberrant phenotypes (not shown), whereas LCR has been implicated in the expansion of the leaf margin [40] , suggesting...”
- The genetic basis of zinc tolerance in the metallophyte Arabidopsis halleri ssp. halleri (Brassicaceae): an analysis of quantitative trait loci
Willems, Genetics 2007 - “...halleri (At1g46768, HMA4, NRAMP3, At2g40140, At2g43010, MTP1, At3g28220, At4g33160, At4g38220, and At5g08160) (Becher et al. 2004; Weber et al. 2004; Craciun et...”
- “...At2g43010, At3g28220, At3g33530, At3g45810, At5g08160, At4g38220, At2g40140, At4g33160, and HMA4), one primer was designed in an exonic region of the gene...”
- In silico insights on diverse interacting partners and phosphorylation sites of respiratory burst oxidase homolog (Rbohs) gene families from Arabidopsis and rice
Kaur, BMC plant biology 2018 - “...Q9LJK2 a 468 P 0.405 AtRbohJ 1. AT4G33160 AT4G33160.1 Ubiquitin-protein ligase (F-box only protein 13) Q9SMZ3 a 457 P 0.823 2. AT3G28220 AT3G28220.1 Meprin and TRAF homology domain-containing protein / MATH domain-containing protein; response to salt stress Q9LHA6 370 P 0.823 3. AT4G38220 AT4G38220.2 Aminoacylase, putative...”
AT2G44735 hypothetical protein from Arabidopsis thaliana
Aligns to 60:287 / 367 (62.1%), covers 40.2% of PF03478, 39.7 bits
NP_001234215 DOUBLE TOP from Solanum lycopersicum
Aligns to 115:351 / 455 (52.1%), covers 74.5% of PF03478, 39.0 bits
UFO_ARATH / Q39090 Protein UNUSUAL FLORAL ORGANS; F-box only protein 1; AtFBX1 from Arabidopsis thaliana (Mouse-ear cress) (see 6 papers)
NP_564368 F-box family protein from Arabidopsis thaliana
AT1G30950 UFO (UNUSUAL FLORAL ORGANS); transcription factor binding / ubiquitin-protein ligase from Arabidopsis thaliana
Aligns to 112:346 / 442 (53.2%), covers 78.8% of PF03478, 37.9 bits
- function: Component of SCF(ASK-cullin-F-box) E3 ubiquitin ligase complexes, which may mediate the ubiquitination and subsequent proteasomal degradation of target proteins (By similarity). Considered as a meristem identity factor required for normal growth of the young floral meristem. Acts together with LEAFY to positively regulate the B class floral homeotic genes APETALA3 and PISTILLATA. In this way, operates as a region-specific regulator for petal and stamen development. Alternatively, may play a role as a negative regulator of the C class floral homeotic genes. Interacts together with the SKP1- like protein ASK1 to form a ubiquitin E3 ligase complex and could indirectly promote the ubiquitination and degradation of specific proteins controlling the floral primordia development like repressors of B class floral homeotic genes.
subunit: Part of a putative SCF (ASK/Cullin/F-box) ubiquitin ligase complex. Interacts with SKP1A/ASK1, SKP1B/ASK2 and ASK11. - An activated form of UFO alters leaf development and produces ectopic floral and inflorescence meristems.
Risseeuw, PloS one 2013 - GeneRIF: UFO alters leaf development and produces ectopic floral and inflorescence meristems
- An Arabidopsis F-box protein acts as a transcriptional co-factor to regulate floral development.
Chae, Development (Cambridge, England) 2008 (PubMed)- GeneRIF: UFO physically interacts with LFY, a necessary interaction to recruit UFO to the AP3 promoter.
- UFO in the Arabidopsis inflorescence apex is required for floral-meristem identity and bract suppression.
Hepworth, Planta 2006 (PubMed)- GeneRIF: This study suggests that UFO and LFY are jointly required in the inflorescence meristem to both promote floral meristem development and inhibit, in a non-cell autonomous manner, growth of the bract.
- GmUFO1 Regulates Floral Organ Number and Shape in Soybean
Yu, International journal of molecular sciences 2023 - “...) Phylogenetic analysis of the selected 11 UFO proteins from nine species, namely Arabidopsis thaliana (AT1G30950), Glycine max (Glyma.05G134000, Glyma.08G088700), Medicago truncatula (Medtr4g094748), Vigna unguiculate (Vigun03g153100), Phaseolus vulgaris (Phvul.002G188300), Gossypium raimondii (Gorai.002G139700), Oryza sativa (Os06g45460), Zea mays (GRMZM2G109966, GRMZM2G360081), and Hordeum vulgare (Hr1G108970). The neighbor-joining tree...”
- Nitric oxide controls shoot meristem activity via regulation of DNA methylation
Zeng, Nature communications 2023 - “...AGO6 (AT2G32940); AGO9 (AT5G21150); DRM1 (AT5G15380); DRM2 (AT5G14620); MET1 (AT5G49160); ARR7 (AT1G19050); RDM1 (AT3G22680); UFO (AT1G30950); CUC2 (AT5G53950); AP1 (AT1G69120); CAL (AT1G26310). Statistical analysis Differences between groups were identified using two-sided Students t -test, and p-values less than 0.05 were considered statistically significant. Details and sample...”
- ARR17 controls dioecy in Populus by repressing B-class MADS-box gene expression
Leite, Philosophical transactions of the Royal Society of London. Series B, Biological sciences 2022 - “...Potra2n2c5701 3.56 1.99 10 24 Potri.002G079000 AT5G20240 pistillata (PI) Potra2n1c1412 1.62 1.01 10 20 Potri.001G160900 AT1G30950 unusual floral organs (UFO) Potra2n10c20292 2.05 3.17 10 11 Potri.010G236300 AT3G21510 histidine-containing phosphotransmiter 1 (AHP1) Potra2n2c4152 2.10 7.15 10 10 Potri.002G250000 AT3G25400 dCTP pyrophosphatase Potra2n4c8755 1.65 7.41 10 7 Potri.004G040700...”
- The founder-cell transcriptome in the Arabidopsis apetala1 cauliflower inflorescence meristem
Frerichs, BMC genomics 2016 - “.../ MYB37 RAX1 At5g23000 +1.86 BASIC PENTACYSTEINE 3 BPC3 At1g68120 +1.85 UNUSUAL FLORAL ORGANS UFO At1g30950 +1.85 BRCA1-ASSOCIATED RING DOMAIN1 BARD1 At1g04020 +1.83 CAULIFLOWER CAL At1g26310 +1.82 REPRODUCTIVE MERISTEM3 REM3 At5g58280 +1.82 LATERAL MERISTEM IDENTITY1 LMI1 At5g03790 +1.79 ULTRAPETALA1 ULT1 At4g28190 +1.77 APETALA1 AP1 At1g69120 +1.60...”
- Genome-wide transcriptomic analysis uncovers the molecular basis underlying early flowering and apetalous characteristic in Brassica napus L
Yu, Scientific reports 2016 - “...AXR1 protein ubiquitination Activator 1.3034 0.0061456 BnaA02g17620D AT1G75950 ASK1 protein ubiquitination Activator 1.6267 3.00E-07 BnaC08g09370D AT1G30950 UFO protein ubiquitination Activator 2.0059 8.83E-05 BnaA04g10140D AT5G40280 WIG protein farnesylation Repressor 0.99166 0.010723 BnaA01g18430D AT3G59380 PLP protein farnesylation Repressor 0.81325 0.026371 Activator indicates that gene positively regulates petal development....”
- Analysis of the transcriptional responses in inflorescence buds of Jatropha curcas exposed to cytokinin treatment
Chen, BMC plant biology 2014 - “...CUST_10026 APETALA 2 -1.52 1.19 1.30 1.46 AT4G36920 CUST_10541 APETALA 3 -1.35 -4.33 -1.08 1.22 AT1G30950 CUST_34715 AUXIN RESPONSE FACTOR -1.62 1.03 -1.34 1.66 AT5G60450 CUST_41624 AUXIN RESPONSE FACTOR 6 -1.07 -1.07 -1.03 -1.33 AT1G30330 CUST_31291 ASYMMETRIC LEAVES 1 -1.44 -1.13 -1.28 -1.20 AT2G37630 CUST_36781 CONSTITUTIVE...”
- Tissue-specific clocks in Arabidopsis show asymmetric coupling
Endo, Nature 2014 - “...LHY (At1g01060), ELF3 (At2g25930), ELF4 (At2g40080), LUX (At3g46640), PRR7 (At5g02810), PRR9 (At2g46790), CER6 (At1g68530), UFO (At1g30950), and TPS-CIN (At3g25820 / At3g25830). Extended Data Extended Data Figure 1 Optimization and validation of gene expression analysis in isolated tissues a, b, Relationship between enzyme concentration and opacity of...”
- Composition, roles, and regulation of cullin-based ubiquitin e3 ligases
Choi, The arabidopsis book 2014 - “...Gray et al 2001; Greenham et al 2011 UFO At1g30950 Flower organogenesis, floral meristem development Levin & Meyerowitz 1995; Chae et al 2008; ZTL At5g57360...”
- “...in this process is UNUSUAL FLORAL ORGANS (UFO; At1g30950), which is critical for normal development of both the floral meristem and floral organs. Consequently,...”
- More
LOC100795488 F-box only protein 6 from Glycine max
Aligns to 151:423 / 450 (60.7%), covers 82.6% of PF03478, 36.8 bits
LOC104116922 F-box only protein 6 from Nicotiana tomentosiformis
Aligns to 169:432 / 465 (56.8%), covers 82.6% of PF03478, 35.2 bits
AT3G07870 F-box family protein from Arabidopsis thaliana
Aligns to 74:331 / 417 (61.9%), covers 70.3% of PF03478, 33.8 bits
- Silencing of StRIK in potato suggests a role in periderm related to RNA processing and stress
Boher, BMC plant biology 2021 - “...C-terminal catalytic domain containing protein - PGSC0003DMT400040325 16 2 1 > 2 F-box family protein AT3G07870 Signaling PGSC0003DMT400047864 5 37 2 > 1 Signal transducer AT1G67900 PGSC0003DMT400001990 2 8 2 >1 Calcium/calmodulin-dependent protein kinase CaMK3 AT3G50530 PGSC0003DMT400047866 16 79 2 > 1 Signal transducer AT1G67900 PGSC0003DMT400054991...”
- Molecular networks regulating cell division during Arabidopsis leaf growth
Vercruysse, Journal of experimental botany 2020 - “...AT1G08560 KNOLLE/SYP111 SYNTAXIN OF PLANTS 111 Cell cycle machinery AT1G32310 SAMBA SAMBA Cell cycle machinery AT3G07870 FBX92 F-BOX PROTEIN 92 Cell cycle machinery AT3G54650 FBL17 F-BOX LIKE 17 Cell cycle machinery Gene group APC/C ANAPHASE PROMOTING COMPLEX/CYCLOSOME Cell cycle machinery Gene group CCS52A CELL CYCLE SWITCH...”
- Integrative transcriptomics reveals genotypic impact on sugar beet storability
Madritsch, Plant molecular biology 2020 - “...et al. 2002 ) as well as genes positive regulating cell proliferation ( Arabidopsis homolog At3g07870, Baute et al. 2017 ; ELP4, Zhou et al. 2009 ) and one gene involved in sterol biosynthesis (probable 3-beta-hydroxysteroid-Delta(8),Delta(7)-isomerase). Highly downregulated (top 20, sorted by padj-value) were genes important...”
- Genes Modulating the Increase in Sexuality in the Facultative Diplosporous Grass Eragrostis curvula under Water Stress Conditions
Selva, Genes 2020 - “...under stress conditions are the SNF1-related protein kinase regulatory subunit -1 and F-box proteins (At2g14290, At3g07870, and At5g07610). Regarding genes previously related to apomixis and upregulated under stress, the transcription factor NAC10 should be mentioned. 3.9. Validation by qRT-PCR qRT-PCR assays were used to corroborate the...”
- F-Box Protein FBX92 Affects Leaf Size in Arabidopsis thaliana
Baute, Plant & cell physiology 2017 - “...identified using PLAZA ( Proost et al. 2015 ), and is further designated At FBX92 (At3g07870). To examine the function of this gene in Arabidopsis, we generated plants with altered At FBX92 expression levels. Transgenic Arabidopsis plants were generated that ectopically overexpressed At FBX92 under the...”
- “...Proost et al. 2015 ) ( https://plaza.psb.ugent.be ) and the coding region of this gene, At3g07870 (At FBX92 ), was amplified with Phusion High-Fidelity DNA polymerase (Thermo Fischer Scientific) from cDNA generated from leaf tissue of Arabidopsis ecotype Col-0. In addition, a fragment consisting of the...”
LOC109010064 F-box only protein 6-like from Juglans regia
Aligns to 170:443 / 469 (58.4%), covers 82.6% of PF03478, 33.2 bits
LOC101312115 F-box only protein 6 from Fragaria vesca subsp. vesca
Aligns to 151:421 / 450 (60.2%), covers 82.6% of PF03478, 32.3 bits
AT3G06240 F-box family protein from Arabidopsis thaliana
Aligns to 133:384 / 427 (59.0%), covers 68.3% of PF03478, 32.1 bits
- Genome-Wide Association Study of Brown Rot (Monilinia spp.) Tolerance in Peach
Fu, Frontiers in plant science 2021 - “...peroxidase P7 1(0) Prupe.6G046300 LOC18773643 wound-induced protein 1 1(0) 6_2 SNP_IGA_695629 Prupe.6G319800 LOC18774388 F-box/kelch-repeat protein At3g06240 1(0) 8_1 Peach_AO_0860807 Prupe.8G173200 LOC18768962 dehydrin ERD10 1(0) Prupe.8G173600 LOC18768999 TMV resistance protein N 1(0) Prupe.8G173700 LOC18768999 TMV resistance protein N 1(0) W 6_3 Peach_AO_0692414 Prupe.6G352100 LOC18775270 leucine-rich repeat receptor-like...”
- F-Box Family Genes, LTSF1 and LTSF2, Regulate Low-Temperature Stress Tolerance in Pepper (Capsicum chinense)
Venkatesh, Plants (Basel, Switzerland) 2020 - “...2425% with the FBA motif-containing Arabidopsis At4g12560 protein (CPR1; CONSTITUTIVE EXPRESSER OF PR GENES 1); At3g06240 (a F-box/kelch-repeat protein); and rice Os02g54240, a stress-responsive F-box protein. A comparison of the genomic structures revealed that both the LTSF1 and LTSF2 genes contain two introns ( Figure 2...”
- Regulation of gene expression in roots of the pH-sensitive Vaccinium corymbosum and the pH-tolerant Vaccinium arboreum in response to near neutral pH stress using RNA-Seq
Payá-Milans, BMC genomics 2017 - “...D7UCW0_VITVI 0 Laccase B. Vaccinium arboreum CUFF.1549 2.29 3.15 1.31E-07 1.73E-03 A0A151STL0_CAJCA 3.00E-36 F-box/kelch-repeat protein At3g06240 family CUFF.13406 4.13 5.11 3.82E-07 2.35E-03 A0A103YHW1_CYNCS 1.00E-19 Stigma-specific protein Stig1 CUFF.34224 4.07 3.56 4.32E-07 2.35E-03 B9GWH1_POPTR 5.00E-41 Putative copper-transporting atpase 3 family protein CUFF.4259 2.50 5.45 4.47E-07 2.35E-03 A0A103XEL9_CYNCS...”
- The Histone Deacetylase Inhibitor Suberoylanilide Hydroxamic Acid Alleviates Salinity Stress in Cassava
Patanun, Frontiers in plant science 2016 - “...RknMes02_051803 AT3G09270 Glutathione S-transferase TAU 8 4.369 1.29E-05 RknMes02_037654 AT4G29110 Unknown protein 4.337 7.18E-06 RknMes02_051464 AT3G06240 F-box family protein 4.284 2.95E-06 RknMes02_053782 AT4G17380 MUTS-like protein 4 4.231 1.34E-05 RknMes02_049288 AT5G52060 BCL-2-associated athanogene 1 4.218 2.22E-05 RknMes02_000416 AT2G26870 Non-specific phospholipase C2 4.138 1.20E-07 RknMes02_051638 AT4G22660 F-box family...”
- Targeted sequence capture provides insight into genome structure and genetics of male sterility in a gynodioecious diploid strawberry, Fragaria vesca ssp. bracteata (Rosaceae)
Tennessen, G3 (Bethesda, Md.) 2013 - “...oligomeric Golgi complex subunit 8 (COG complex subunit 8) (probable) 1725631 1727100 04138 F-box/kelch-repeat protein At3g06240 (probable) 1730662 1732093 04139 a Probable receptor protein kinase TMK1, Precursor (putative) 1737410 1740919 04140 a Probable receptor protein kinase TMK1, Precursor (putative) 1741738 1745245 04141 a U-box domain-containing protein...”
- A spatial dissection of the Arabidopsis floral transcriptome by MPSS
Peiffer, BMC plant biology 2008 - “...however, it was not expressed within the female gametophyte (Figure 5c ). Transcriptional activity of At3g06240, a gene encoding an F-box protein was identified in the anatropous integumentary ridge and a small region of the dorsal outer integuments (Figure 5d ) but not in other fully...”
- “...is expressed in both integuments and the funiculus, but not in the female gametophyte. (D) At3g06240; GUS is expressed in the anatropus integumentary ridge and a small region of the dorsal outer integument. (E) At1g27330: GUS is expressed in the micropylar pole and both integuments. (F)...”
LOC104591738 F-box only protein 6-like from Nelumbo nucifera
Aligns to 196:455 / 496 (52.4%), covers 82.6% of PF03478, 32.0 bits
LOC103972833 F-box only protein 6 from Musa acuminata subsp. malaccensis
Aligns to 147:405 / 446 (58.1%), covers 82.6% of PF03478, 31.5 bits
LOC109003194 F-box only protein 6 from Juglans regia
Aligns to 162:437 / 461 (59.9%), covers 82.6% of PF03478, 31.5 bits
LOC109175636 F-box only protein 6-like from Ipomoea nil
Aligns to 168:444 / 471 (58.8%), covers 83.0% of PF03478, 31.4 bits
LOC104415679 F-box only protein 6 from Eucalyptus grandis
Aligns to 172:425 / 471 (53.9%), covers 83.8% of PF03478, 31.2 bits
LOC105133704 F-box only protein 6-like from Populus euphratica
Aligns to 169:440 / 468 (58.1%), covers 82.6% of PF03478, 30.7 bits
LOC107482128 F-box only protein 6 from Arachis duranensis
Aligns to 155:402 / 454 (54.6%), covers 83.4% of PF03478, 30.6 bits
LOC108809705 F-box only protein 6 from Raphanus sativus
Aligns to 175:409 / 475 (49.5%), covers 82.6% of PF03478, 30.4 bits
LOC109152509 F-box only protein 6-like from Ipomoea nil
Aligns to 162:417 / 460 (55.7%), covers 82.6% of PF03478, 30.2 bits
LOC107631986 F-box only protein 6 from Arachis ipaensis
Aligns to 125:423 / 454 (65.9%), covers 83.4% of PF03478, 30.0 bits
LOC100242085 F-box only protein 6 from Vitis vinifera
Aligns to 161:433 / 460 (59.3%), covers 82.6% of PF03478, 29.0 bits
- Identification and co-evolution pattern of stem cell regulator miR394s and their targets among diverse plant species
Kumar, BMC evolutionary biology 2019 - “...1 16.78 POPTR_0001s13770g Ptc-F-box family protein Cleavage 1 17.38 POPTR_0003s16980g Ptc-hypo (F-box) Cleavage 1 16.82 LOC100242085 Vvi-F-box family protein Cleavage 1 15.82 LOC100800464 Gma-F-box only protein 6-like (1) Cleavage 1 13.67 LOC100810179 Gma-F-box only protein 6-like (2) Cleavage 1 15.65 LOC100795488 Gma-F-box only protein 6-like (3)...”
- “...16.33 LOC105123018 Peu-F-box only protein 6-like (2) Cleavage 2 vvi-miR394a,c,mes-miR394c UUGGCAUUCUGUCCACCUCCAU 2 AAGGAGGUUGACAGAAUGCCAA 1 16.82 LOC100242085 Vvi-F-box family protein Cleavage 3 ptc-miR394a-3p,ptc-miR394b-3p CUGUUGGUCUCUCUUUGUAA 3 UUACAAAGAGAGACCAACAG 0 17.4 POPTR_0002s11320g Ptc-Hypo1 (DUF1005) Cleavage 4 gma-miR394a-3p AGCUCUGUUGGCUACACUUU 4 UGAGUGCAGCCAGCAGAGCU 3 14.74 LOC100306608 Gma-Unch (DUF3774) Cleavage 5 zma-miR394a-3p,zma-miR394b-3p,ata-miR3943p AGGUGGGCAUACUGCCAAUG 5...”
Sb09g018050 No description from Sorghum bicolor
Aligns to 69:306 / 392 (60.7%), covers 48.6% of PF03478, 28.9 bits
LOC104741342 F-box only protein 6 from Camelina sativa
Aligns to 94:322 / 395 (58.0%), covers 82.6% of PF03478, 28.6 bits
LOC100193727 uncharacterized protein LOC100193727 from Zea mays
Aligns to 144:402 / 443 (58.5%), covers 83.0% of PF03478, 28.3 bits
AT1G27340 F-box family protein from Arabidopsis thaliana
NP_564278 Galactose oxidase/kelch repeat superfamily protein from Arabidopsis thaliana
Aligns to 167:395 / 467 (49.0%), covers 82.6% of PF03478, 28.3 bits
- QTL mapping of drought-related traits in the hybrids of Populus deltoides 'Danhong'×Populus simonii 'Tongliao1'
Du, BMC plant biology 2022 - “...environment [ 55 57 ]. Potri.003G171300 encodes the F-box protein, and its homologous gene ( At1g27340 ) in A. thaliana negatively regulates the drought stress response by binding to mRNA394 [ 56 ]. In addition, F-box family proteins have been reported to be involved in regulating...”
- Spatiotemporal expression profile of novel and known small RNAs throughout rice plant development focussing on seed tissues
Meijer, BMC genomics 2022 - “...role in shoot apical meristem (SAM) formation by targeting F-box protein AtLCR (LEAF CURLING RESPONSIVENESS, AT1G27340) [ 18 ]. Also on Brassica napus , miR394 targets BnLCR regulating seed development and oil content [ 19 ]. In rice, OsLC4 (LEAF INCLINCATION 4, Os01g0923900) is a homologue...”
- Genetic regulators of leaf size in Brassica crops
Karamat, Horticulture research 2021 - “...pekinensis miR319a MicroRNA Positive GenBank ID KJ130320 AT4G23713 73 B. napus miR394 MicroRNA Positive BnaC05g21250D AT1G27340 76 B. napus LCR F-box protein Negative GenBank ID CDX84930.1 AT1G27340 76 B. napus DA1 Ubiquitin-dependent protease Negative BnaC05g14930D AT1G19270 80 B. napus FCA-RRM2 RRM domain Positive BnaC01g21860D AT5G54580 88...”
- Identification and co-evolution pattern of stem cell regulator miR394s and their targets among diverse plant species
Kumar, BMC evolutionary biology 2019 - “...16 , 20 , 21 ]. Interestingly, miR394 only targets one F-box protein gene LCR (At1g27340) in Arabidopsis . Since miR394- LCR module play important physiological and developmental role, it is imperative to study its presence and evolutionary pattern among diverse plant species Therefore, a comprehensive...”
- “...Accessibility (UPE) Target Accession Target Description Inhibition 1 ath-miR394a,ath-miR394b-5p,osa-miR394,sbi-miR394a,b,zma-miR394a-5p,zma-miR394b-5p,ptc-miR394a-5p,ptc-miR394b-5p,vvi-miR394b,ghr-miR394a,b,aly-miR394a-5p,aly-miR394b-5p,ahy-miR394,gma-miR394b-5p,gma-miR394a-5p,gma-miR394c-5p,d,e,f,g,csi-miR394,tcc-miR394a,b,bdi-miR394,ssl-miR394,bna-miR394a,b,mes-miR394a,b,cca-miR394,lus-miR394a,b,nta-miR394,ppe-miR394a,b,mdm-miR394a,b,cme-miR394a,b,cpa-miR394a,b,atr-miR394,sly-miR3945p,ata-miR3945p,ini-miR394,csa-miR394a,b,c,nnu-miR394,jre-miR394,mac-miR394,era-miR394,nto-miR394,rsa-miR394a,b,c,aip-miR394,adu-miR394,egu-miR394 cst-miR394a,b,fve-miR394,peu-miR394a,b UUGGCAUUCUGUCCACCUCC 1a GGAGGUUGACAGAAUGCCAA 1 14.87 AT1G27340 Ath-LCR , LEAF CURLING RESPONSIVENESS Cleavage 1 16.78 POPTR_0001s13770g Ptc-F-box family protein Cleavage 1 17.38 POPTR_0003s16980g Ptc-hypo (F-box) Cleavage 1 16.82 LOC100242085 Vvi-F-box family protein Cleavage 1 15.82 LOC100800464 Gma-F-box...”
- RNA-Seq using bulked recombinant inbred line populations uncovers the importance of brassinosteroid for seed longevity after priming treatments
Sano, Scientific reports 2017 - “...73.1 0.0 Gypsy-like retrotransposon chr 1 AT1G22110 138.4 73.7 302.8 114.6 Structural constituent of ribosome AT1G27340 99.0 46.2 74.1 61.1 LCR (leaf curing responsiveness) AT1G68560 268.6 141.9 237.2 49.3 TRG1 (thermoinhibition resistant1) AT1G69530 766.3 454.3 1154.1 173.6 EXPA1 (expansin A1) AT1G80530 238.3 149.6 229.7 186.4 Major...”
- Novel Insights into miRNA Regulation of Storage Protein Biosynthesis during Wheat Caryopsis Development under Drought Stress
Chen, Frontiers in plant science 2017 - “...et al. ( 2012 ) identified the target of miR394 which encoded an F-box protein (At1g27340) involved in the regulation of leaf curling-related morphology in Arabidopsis. Additionally, miRNA can affect plant growth under stress conditions by regulating signaling pathways. MiR393 was found to target transport inhibitor...”
- Role of microRNAs in plant drought tolerance
Ferdous, Plant biotechnology journal 2015 - “...2010 ). One of the miR394's targets has been identified to encode an Fbox protein (At1g27340) involved in the regulation of leaf curlingrelated morphology in Arabidopsis (Song etal ., 2012 ). miR393 is another key miRNA for the regulation of the Fbox genes in many plant...”
- Characterization of miRNAs associated with Botrytis cinerea infection of tomato leaves
Jin, BMC plant biology 2015 - “...et al. [ 51 ] have reported that miR394 and its target, the F-box gene At1g27340 , are involved in the regulation of leaf curling-related morphology of Arabidopsis . The available data suggest that miR394 is involved in the development and abiotic stress regulation. Furthermore, transgenic...”
- More
- Proteomic Identification of Putative MicroRNA394 Target Genes in Arabidopsis thaliana Identifies Major Latex Protein Family Members Critical for Normal Development
Litholdo, Molecular & cellular proteomics : MCP 2016 - “...(aa) F-Box motif (aa region) NP_564278 XP_002890723 ACL51019 XP_003538543 ACI13687 Nbv3K765635121a XP_002297845 XP_004239218 XP_002271194 NP_001045243 AFW84117...”
- miR394 and LCR are involved in Arabidopsis salt and drought stress responses in an abscisic acid-dependent manner.
Song, BMC plant biology 2013 - GeneRIF: miR394-regulated LCR abundance may allow plants to fine-tune their responses to abscissic acid and abiotic stress.
- Regulation of leaf morphology by microRNA394 and its target LEAF CURLING RESPONSIVENESS.
Song, Plant & cell physiology 2012 (PubMed)- GeneRIF: miR394 and its target LCR are involved in the regulation of leaf development.
- Identification and characterization of 27 conserved microRNAs in citrus
Song, Planta 2009 - “...was similar to AT3G26810 (NP_566800) AFB2 (AUXIN SIGNALING F-BOX 2); UC46-8268 was similar to AT1G27340 (NP_564278) F-box family protein Discussion Although miRNAs have been extensively studied in the past several years, no systematic study has been performed on citrus, one of the most important fruits crops...”
LOC104776781 F-box only protein 6-like from Camelina sativa
Aligns to 160:394 / 461 (51.0%), covers 82.6% of PF03478, 28.2 bits
LOC103636344 F-box only protein 6 from Zea mays
Aligns to 144:403 / 443 (58.7%), covers 83.0% of PF03478, 28.2 bits
LOC104757055 F-box only protein 6-like from Camelina sativa
Aligns to 166:394 / 467 (49.0%), covers 82.6% of PF03478, 28.1 bits
AT5G54420 hypothetical protein from Arabidopsis thaliana
Aligns to 1:79 / 91 (86.8%), covers 21.6% of PF03478, 27.8 bits
LOC112940016 putative F-box protein At1g50870 from Solanum lycopersicum
Aligns to 147:428 / 462 (61.0%), covers 52.1% of PF03478, 27.8 bits
- Transcriptome Analysis to Explore the Cause of the Formation of Different Inflorescences in Tomato
Yang, International journal of molecular sciences 2022 - “...LOC101261442 1.12 1.16 Chloroplastic 101266861 LOC101266861 1.08 1.56 Chloroplastic 104649068 LOC104649068 1.26 1.3 F-box 112940016 LOC112940016 6.79 6.53 F-box 101250115 LOC101250115 12.31 12.13 F-box 101244792 LOC101244792 9.56 9.4 F-box family protein 101261682 LOC101261682 3.65 5.77 F-box protein CPR1 778295 CHS2 2.73 2.18 Circadian rhythm 101246029 SFT...”
AT2G32470 F-box family protein-related from Arabidopsis thaliana
Aligns to 8:248 / 288 (83.7%), covers 46.7% of PF03478, 27.7 bits
- MicroR159 regulation of most conserved targets in Arabidopsis has negligible phenotypic effects
Allen, Silence 2010 - “...sequence that included, 3.2 kb of 5' flanking region extending to the adjacent upstream gene (At2g32470), and 1.9 kb of the transcribed region of MYB101 (yellow arrow) that includes introns (black boxes) and the miR159 binding site (purple box) fused in frame to the -glucuronidase (GUS)...”
- Altered gene expression changes in Arabidopsis leaf tissues and protoplasts in response to Plum pox virus infection
Babu, BMC genomics 2008 - “...gene (AIG) protein, related CAATGCACAGTGTCTTCGTCTA TTCGGTAAATTCAACTCTTCAGC 254582_at At4g19470 Disease resistance protein, related CAGAAACGAAGACGGTGATTAC TCTTCCTTTATTCTTTTCCTGTTC 267056_at At2g32470 F-box family protein, related TGGGGTTTCACAGTCAATAATAGT TTCGCATACCAATCCCACAAC 248188_at At5g54070 Heat shock transcription factor TGAGTCATTGAAGGAGGAACAGAG GAGCCACCGTCAACAAGTAGG 253366_at At4g33180 Hydrolase family protein TCGCAGACGCTTTCCATAGACT GAAGAAGACAAGATCGGGAGAATA 260699_at At1g32320 MAP kinase, putative GACATAAAGCCTTCAAATCTCC ATCTCCCAACAAAATCTCTAAACT 249440_at At5g40030...”
Or search for genetic data about PF03478 in the Fitness Browser
by Morgan Price,
Arkin group
Lawrence Berkeley National Laboratory