Family Search for PF03479 (PCC)
PaperBLAST, GapMind, SitesBLAST, and Sites on a Tree will be down for server maintenance on Friday March 29.
Running HMMer for PF03479
PF03479 hits 106 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.
2h6lA / O30132 X-ray crystal structure of the metal-containing protein af0104 from archaeoglobus fulgidus. Northeast structural genomics consortium target gr103.
Aligns to 10:122 / 140 (80.7%), covers 97.4% of PF03479, 121.0 bits
PF0619 hypothetical protein from Pyrococcus furiosus DSM 3638
Aligns to 6:119 / 134 (85.1%), covers 100.0% of PF03479, 120.9 bits
CTC_01209 PPC domain-containing DNA-binding protein from Clostridium tetani E88
Aligns to 8:121 / 139 (82.0%), covers 94.9% of PF03479, 111.3 bits
- More than a Toxin: Protein Inventory of Clostridium tetani Toxoid Vaccines
Möller, Proteomes 2019 - “...CTC_01332 Transketolase U Q895G9 CTC_01305 Uncharacterized protein U Q895P6 CTC_01225 Serine/threonine protein kinase M Q895R2 CTC_01209 Uncharacterized protein U Q895T9 CTC_01178 NADH oxidase M, C Q896G9 CTC_01036 Uncharacterized protein U Q896I3 CTC_01021 Electron transport complex subunit G M Q896J5 CTC_01009 Conserved protein, putative N-acetylmuramoyl-L-alanine amidase M...”
Q895R2 PPC domain-containing protein from Clostridium tetani (strain Massachusetts / E88)
Aligns to 21:134 / 152 (75.0%), covers 94.9% of PF03479, 110.9 bits
- More than a Toxin: Protein Inventory of Clostridium tetani Toxoid Vaccines
Möller, Proteomes 2019 - “...Q895E4 CTC_01332 Transketolase U Q895G9 CTC_01305 Uncharacterized protein U Q895P6 CTC_01225 Serine/threonine protein kinase M Q895R2 CTC_01209 Uncharacterized protein U Q895T9 CTC_01178 NADH oxidase M, C Q896G9 CTC_01036 Uncharacterized protein U Q896I3 CTC_01021 Electron transport complex subunit G M Q896J5 CTC_01009 Conserved protein, putative N-acetylmuramoyl-L-alanine amidase...”
G3PDP5 PPC domain-containing protein from Gasterosteus aculeatus
Aligns to 11:123 / 148 (76.4%), covers 98.3% of PF03479, 105.0 bits
- Dietary Creatine Supplementation in Gilthead Seabream (Sparus aurata): Comparative Proteomics Analysis on Fish Allergens, Muscle Quality, and Liver
Schrama, Frontiers in physiology 2018 - “...A OS Danio rerio 2,170 26,836/26,776 4.72/4.7 6 25 0.002 0.0023 2.03 CR2>CR5> CR8>CTRL 1,214 G3PDP5 Uncharacterized protein OS Gasterosteus aculeatus [after blast on 28-04-2017 bifunctional protein GlmU-like ( Salmo salar )] 1,661 15,732/13,637 5.34/5.0 1 9 0.016 0.0462 1.73 CR8>CR2> CR5>CTRL Mw, molecular weight; pI,...”
SA0649 hypothetical protein from Staphylococcus aureus subsp. aureus N315
BJI72_0645 PPC domain-containing DNA-binding protein from Staphylococcus aureus
Aligns to 8:121 / 140 (81.4%), covers 96.6% of PF03479, 103.6 bits
- Novel Nucleoside Diphosphatase Contributes to Staphylococcus aureus Virulence
Imae, The Journal of biological chemistry 2016 - “...values. The LD50 values of the gene-deletion mutants of SA0649, SA0873, SA0949, and SA1292 were more than 2-fold that of the parent strain (Fig. 1B). The LD50...”
- “...the parent strain (Fig. 1B). These findings suggest that SA0649, SA0873, SA0949, and SA1292 contribute to S. aureus virulence and that SA1684 plays a critical...”
- Genome-wide analysis of ruminant Staphylococcus aureus reveals diversification of the core genome
Ben, Journal of bacteriology 2008 - “...2017 by University of California, Berkeley SA0584 SA0648 SA0649 Classification by functionb Description 6314 BEN ZAKOUR ET AL. J. BACTERIOL. and transposon and...”
- Effect of promoter region mutations and mgrA overexpression on transcription of norA, which encodes a Staphylococcus aureus multidrug efflux transporter
Kaatz, Antimicrobial agents and chemotherapy 2005 - “...Bmr, Blt, and QacA/B. There is an open reading frame (SA0649 in the S. aureus N315 genome) on the opposite strand and immediately upstream of norA that encodes...”
- “...a number of DNA-binding proteins. The putative promoter of SA0649 overlaps with that of norA, suggesting that the two genes may be coordinately regulated. No...”
- Analyzing genomic alterations involved in fluoroquinolone-resistant development inStaphylococcus aureus
Huynh, 2023 - Genomic alterations involved in fluoroquinolone resistance development in Staphylococcus aureus
Huynh, PloS one 2023 - “...and sigS ); acetyltransferase ( rimI ); methicillin resistance ( fmtB ); and hypothetical protein BJI72_0645 were overexpressed in FQ-exposed strains. Conclusion The emergence of MDR S . aureus was associated with the mutations in the FQ-target sequences and the overexpression of efflux pump systems and...”
- “...ATTGCGTCCTCACCTTCACC CTGAGGCGGAACGAAATTGG 453 This study fmtB ACTGCTGTTGCTAATTGTTGA GCACAAGTTGATGAAGCGAA 191 This study Gene encoding hypothetical protein BJI72_0645 GCGAGATGTCCGCTAAAAGT TGGTGCATGTGATGACGTTG 191 This study sigB ATGTACGTTTATTGAAGGATTG TAATTTCTTAATTGCCGTTCTC 103 [ 46 ] sigS ACCTTGAAGGATACAAGCAA GGCATTTACGCTTAACGGAC 96 [ 47 ] 16S rRNA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 492 [ 45 ] Statistical analysis The...”
BT_RS05630 PPC domain-containing DNA-binding protein from Bacteroides thetaiotaomicron VPI-5482
BT1116, BT_1116 conserved hypothetical protein from Bacteroides thetaiotaomicron VPI-5482
Aligns to 52:166 / 185 (62.2%), covers 96.6% of PF03479, 98.6 bits
VCA0587 conserved hypothetical protein from Vibrio cholerae O1 biovar eltor str. N16961
Aligns to 3:111 / 130 (83.8%), covers 96.6% of PF03479, 98.6 bits
- The transcriptional regulator VqmA increases expression of the quorum-sensing activator HapR in Vibrio cholerae
Liu, Journal of bacteriology 2006 - “...VC0491, VC0669, VC0770, VC1492, VC2155, VCA0324, VCA0367, VCA0483, VCA0587, VCA0887 VC0669, VC1492, VC2155, VCA1097 2 2 ZLV102 and ZLV104 were grown in AKI...”
HVO_RS00630 PPC domain-containing DNA-binding protein from Haloferax volcanii DS2
Aligns to 8:117 / 135 (81.5%), covers 95.7% of PF03479, 98.0 bits
Z4267 orf; hypothetical protein from Escherichia coli O157:H7 EDL933
ECs3799 hypothetical protein from Escherichia coli O157:H7 str. Sakai
Aligns to 13:121 / 143 (76.2%), covers 99.1% of PF03479, 97.5 bits
- Genomic island-encoded regulatory proteins in enterohemorrhagic Escherichia coli O157:H7
Wang, Virulence 2024 (no snippet) - Magnesium Sensing Regulates Intestinal Colonization of Enterohemorrhagic Escherichia coli O157:H7
Liu, mBio 2020 - “...PhoQ/PhoP two-component regulatory system senses low magnesium levels and signals to the O island 119-encoded Z4267 (LmiA; low magnesium-induced regulator A), directly activating loci of enterocyte effacement genes to promote EHEC O157:H7 adherence in the large intestine. Disruption of this pathway significantly decreased EHEC O157:H7 adherence...”
- “...that can prevent enteric infections. KEYWORDS bacterial adherence magnesium locus of enterocyte effacement (LEE) virulence Z4267 gene regulation Natural Science Foundation of Tianjin City (Tianjin Natural Science Foundation) https://doi.org/10.13039/501100006606 20JCQNJC11700 17JCQNJC09300 Yang Bin National Natural Science Foundation of China (NSFC) https://doi.org/10.13039/501100001809 31800125 31530083 Yang Bin cover-date...”
- Disruption of rcsB by a duplicated sequence in a curli-producing Escherichia coli O157:H7 results in differential gene expression in relation to biofilm formation, stress responses and metabolism
Sharma, BMC microbiology 2017 - “...Unknown 4.58 9.0E-09 Z3965 Unknown 2.33 1.5E-03 Z4126 Unknown 4.31 3.0E-04 Z4151 Unknown 3.84 7.4E-07 Z4267 Unknown +5.52 2.3E-03 Z4268 Unknown +4.92 4.3E-06 yggG Z4280 Unknown 1.71 0.02 Z4318 Unknown +1.30 0.04 ygjT Z4441 Unknown 2.25 5.0E-03 yhaM Z4462 Unknown +2.34 0.03 yiaB Z4988 Unknown 4.71...”
- The interacting Cra and KdpE regulators are involved in the expression of multiple virulence factors in enterohemorrhagic Escherichia coli
Njoroge, Journal of bacteriology 2013 - “...from E. coli K-12), such as Z0639, Z0640, Z3388, Z4267, and espFu (encoding an effector necessary for formation of attaching and effacing lesions on epithelial...”
- “...Z0640* Z1163*** Z1602*** Z2077 Z3388 Z3934 Z4267 espG** Z5890 Consensus TGAAGCGGTTC TGAAGCGGTTC TGAATCGATC TGAATCGATC TGAATGGATTA TGAATCGCTTAT TGAATGGTTTAT...”
- Lateral gene transfer (LGT) between Archaea and Escherichia coli is a contributor to the emergence of novel infectious disease
Faguy, BMC infectious diseases 2003 - “...O157:H7 designation Location (O island) Best BLAST hit to ORF from: Best guess at function Z4267 119 Methanobacterium thermoautotrophicum ABC transporter : cations? Z4271 119 Methanobacterium thermoautotrophicum ABC transporter : cations? Z5331 155 Helicobacter pylori ? Z0509 25 Yersinia pestis ? Z5989 172 Halobacterium sp. NRC-1...”
- Global transcriptional response of Escherichia coli O157:H7 to growth transitions in glucose minimal medium
Bergholz, BMC microbiology 2007 - “...2.10 6 ECs3586 hypE plays structural role in maturation of all 3 hydrogenases 2.10 6 ECs3799 O157 orf; hypothetical protein 2.92 6 ECs3800 O157 orf; hypothetical protein 2.33 6 ECs3802 O157 putative ATP-binding protein of ABC transport system 2.40 6 ECs3833 ansB periplasmic L-asparaginase II 3.41...”
- “...ygeW 2.08 2 ECs4759 metE -2.76 1 ECs3749 yqeC 2.45 2 ECs4791 glnL -2.80 1 ECs3799 O157 -2.69 6 ECs4870 metF -3.65 1 ECs3800 O157 -2.43 6 ECs4885 ppc -3.62 1 ECs3802 O157 -2.43 6 ECs4887 argC -3.99 1 ECs3811 yggG 2.28 2 ECs4888 argB -3.62...”
2hx0A / Q57K43 Three-dimensional structure of the hypothetical protein from salmonella cholerae-suis (aka salmonella enterica) at the resolution 1.55 a. Northeast structural genomics target scr59.
Aligns to 8:116 / 138 (79.0%), covers 99.1% of PF03479, 96.4 bits
- Ligand: magnesium ion (2hx0A)
HMPREF0357_11250 PPC domain-containing DNA-binding protein from Erysipelothrix rhusiopathiae ATCC 19414
Aligns to 2:110 / 138 (79.0%), covers 98.3% of PF03479, 96.2 bits
2p6yA / Q9KM02 X-ray structure of the protein q9km02_vibch from vibrio cholerae at the resolution 1.63 a. Northeast structural genomics consortium target vcr80.
Aligns to 3:110 / 131 (82.4%), covers 96.6% of PF03479, 95.1 bits
c3506 Hypothetical protein from Escherichia coli CFT073
Aligns to 13:121 / 142 (76.8%), covers 98.3% of PF03479, 95.1 bits
D7UDF0 AT-hook motif nuclear-localized protein from Vitis vinifera
Aligns to 163:279 / 353 (33.1%), covers 97.4% of PF03479, 92.5 bits
- Grape ASR-Silencing Sways Nuclear Proteome, Histone Marks and Interplay of Intrinsically Disordered Proteins
Atanassov, International journal of molecular sciences 2022 - “...CBI33736.3 VIT_07s0129g00610.t01 FRIGIDA-like isoform 2 1.28 F6I111 (F6I111_VITVI) CBI37898.3 VIT_03s0038g02130.t01 Cold-shock DNA binding protein 1.47 D7UDF0 (D7UDF0_VITVI) CBI40765.3 Not available AT-hook protein 1 1.36 D7SK51 (D7SK51_VITVI) CBI16027.3 VIT_06s0004g05830.t01 DNA-directed RNA polymerases I and III subunit RPAC2 isoform 1 1.25 F6HZB5 (F6HZB5_VITVI) CBI36973.3 VIT_07s0005g01740.t01 Zinc knuckle (CCHC-type)...”
CPM_0795 DUF296 domain-containing protein from Cuniculiplasma divulgatum
Aligns to 8:119 / 138 (81.2%), covers 95.7% of PF03479, 92.4 bits
LOC108193220 AT-hook motif nuclear-localized protein 13-like from Daucus carota subsp. sativus
Aligns to 193:308 / 382 (30.4%), covers 97.4% of PF03479, 91.8 bits
- Characteristics of the AT-Hook Motif Containing Nuclear Localized (AHL) Genes in Carrot Provides Insight into Their Role in Plant Growth and Storage Root Development
Machaj, Genes 2021 - “...XP_017256806.1 chr6 DcAHL14 LOC108208477 XP_017234499.1 chr2 DcAHL37 LOC108194210 XP_017216623.1 chr7 DcAHL15 LOC108206866 XP_017232780.1 chr2 DcAHL38 LOC108193220 XP_017215280.1 chr7 DcAHL16/ LOC108209748 XP_017236315.1 chr2 DcAHL39 LOC108195339 XP_017217789.1 chr7 DcAHLc1 DcAHL40 LOC108196714 XP_017219609.1 chr7 DcAHL17 LOC108208096 XP_017234068.1 chr2 DcAHL41 LOC108197690 XP_017220869.1 chr8 DcAHL18 LOC108206857 XP_017232768.1 chr2 DcAHL42 LOC108201885 XP_017225711.1...”
- “...6 1076.25 DcAHL1 LOC108209315 1 0.66 4 788.75 DcAHL10 LOC108207579 1 0.00 1 237.00 DcAHL38 LOC108193220 2 16,399.50 825 6140.50 DcAHL26 LOC108216162 2 6491.57 566 5180.00 DcAHL13 LOC108206084 2 10,024.21 372 5299.75 DcAHL27 LOC108219725 2 63,411.36 271 5842.75 DcAHL30 LOC108224107 2 6394.09 263 4611.25 DcAHL33 LOC108224386...”
3htnB / Q8A8Q1 Crystal structure of a putative DNA binding protein (bt_1116) from bacteroides thetaiotaomicron vpi-5482 at 1.50 a resolution
Aligns to 10:120 / 139 (79.9%), covers 96.6% of PF03479, 90.6 bits
- Ligand: fe (iii) ion (3htnB)
Q6Z8N9 AT-hook motif nuclear-localized protein from Oryza sativa subsp. japonica
Aligns to 167:283 / 354 (33.1%), covers 98.3% of PF03479, 90.1 bits
LOC108224107 AT-hook motif nuclear-localized protein 7 from Daucus carota subsp. sativus
Aligns to 121:237 / 359 (32.6%), covers 97.4% of PF03479, 89.9 bits
- Characteristics of the AT-Hook Motif Containing Nuclear Localized (AHL) Genes in Carrot Provides Insight into Their Role in Plant Growth and Storage Root Development
Machaj, Genes 2021 - “...XP_017250863.1 chr5 DcAHL6 LOC108197834 XP_017221076.1 chr1 DcAHL29 LOC108220764 XP_017250109.1 chr5 DcAHL7 LOC108207567 XP_017233492.1 chr2 DcAHL30 LOC108224107 XP_017254151.1 chr5 DcAHL8 LOC108207571 XP_017233496.1 chr2 DcAHL31 LOC108224586 XP_017254744.1 chr6 DcAHL9 LOC108207572 XP_017233497.1 chr2 DcAHL32 LOC108225124 XP_017255428.1 chr6 DcAHL10 LOC108207579 XP_017233502.1 chr2 DcAHL33 LOC108224386 XP_017254467.1 chr6 DcAHL11 LOC108210006 XP_017236725.1 chr2...”
- “...566 5180.00 DcAHL13 LOC108206084 2 10,024.21 372 5299.75 DcAHL27 LOC108219725 2 63,411.36 271 5842.75 DcAHL30 LOC108224107 2 6394.09 263 4611.25 DcAHL33 LOC108224386 2 22.44 81 2234.00 DcAHL34 LOC108224931 2 961.10 31 2474.00 DcAHL25 LOC108215787 2 48.34 7 1299.25 DcAHL19 LOC108210904 3 253.15 17 1894.25 DcAHL42 LOC108201885...”
AHL1_ARATH / Q8VYJ2 AT-hook motif nuclear-localized protein 1 from Arabidopsis thaliana (Mouse-ear cress) (see 2 papers)
AHL1 / BAF37220.1 AT-hook motif nuclear localized protein 1 from Arabidopsis thaliana (see paper)
AT4G12080 DNA-binding family protein from Arabidopsis thaliana
Aligns to 171:287 / 356 (32.9%), covers 97.4% of PF03479, 89.7 bits
- function: Transcription factor that specifically binds AT-rich DNA sequences related to the nuclear matrix attachment regions (MARs). May play a function in the positioning of chromatin fibers within the nucleus.
- Chromatin attachment to the nuclear matrix represses hypocotyl elongation in Arabidopsis thaliana
Xu, Nature communications 2024 - “...19.6 3 221 19.6 3 197 AHL3 AT4G25320 15.3 4 215 16.3 4 297 AHL1 AT4G12080 29.2 4 199 39.3 8 425 AHL4 AT5G51590 14.8 3 121 6.9 2 90 HTA7 AT5G27670 34.7 2 119 42.7 3 151 FRS12 AT5G18960 9.1 3 98 4.9 2 78...”
- Identification of QTLs and allelic effect controlling lignan content in sesame (Sesamum indicum L.) using QTL-seq approach
Kim, Frontiers in genetics 2023 - “...0 AT1G12420 ACT domain repeat 8 (ACR8) SIN_1015669 0 0 0 0 0 0 6 AT4G12080 AT-hook motif nuclear-localized protein 1 (AHL1) SIN_1015671 1 0 0 0 0 0 3 AT1G12410 CLP protease proteolytic subunit 2 SIN_1015672 0 0 1 0 0 0 2 AT3G05100 S-adenosyl-L-methionine-dependent...”
- Genetic dissection of maize (Zea mays L.) chlorophyll content using multi-locus genome-wide association studies
Xiong, BMC genomics 2023 - “...activity. [ 92 ] chr5.S_73045639 5 73,045,639 NA BLINK YY NA NA 7.8610 7 GRMZM2G029065 AT4G12080 (AHL1) AT-hook motif nuclear-localized protein 1 [ 93 ] NA MLMM YY NA NA 7.6910 7 GRMZM2G029087 AT5G47120 (ATBI-1) a homolog of mammalian Bax inhibitor 1 (BI-1) [ 94 ]...”
- Spatial and temporal regulation of parent-of-origin allelic expression in the endosperm
van, Plant physiology 2023 - “...2.1 0.1 Protein phosphatase 2C family protein 0.3 AT4G09970 2.6 0.1 Transmembrane protein 1.0 d AT4G12080 2.6 0.1 AHL1 AT-hook motif nuclear-localized protein 1 1.0 AT2G23470 3.9 0.3 RUS4 Root UV-B sensitive 4 0.7 AT4G12690 4.5 0.3 DUF868 family protein 0.1 B AT2G38480 0.1 3.2 CASPL4B1...”
- Dissection of Functional Modules of AT-HOOK MOTIF NUCLEAR LOCALIZED PROTEIN 4 in the Development of the Root Xylem
Seo, Frontiers in plant science 2021 - “...can be found in the GenBank/EMBL data libraries under the following accession numbers: AHL1 ( AT4G12080 ), AHL2 ( AT4G22770 ), AHL3 ( AT4G25320 ), AHL4 ( AT5G51590 ), AHL6 ( AT5G62260 ), AHL7 ( AT4G00200 ), AHL15 ( AT3G55560 ), AHL16 ( AT2G42940 ), AHL17...”
- SWATH-MS based quantitive proteomics reveal regulatory metabolism and networks of androdioecy breeding system in Osmanthus fragrans
Duan, BMC plant biology 2021 - “...TIP21 0.026 ofr.gene26948 AT2G21100 Dirigent protein 23 0.023 ofr.gene58659 AT5G07440 Glutamate dehydrogenase 2 0.023 ofr.gene6023 AT4G12080 AT-hook motif nuclear-localized protein 1 0.021 ofr.gene30313 AT4G39830 L-ascorbate oxidase 0.006 ofr.gene35198 AT4G19420 Pectin acetylesterase 8 0.005 ofr.gene47658 AT3G54040 PAR1 protein 0.004 ofr.gene51778 AT1G06620 1-aminocyclopropane-1-carboxylate oxidase homolog 1 0.003 ofr.gene37522...”
- Lasting consequences of psyllid (Bactericera cockerelli L.) infestation on tomato defense, gene expression, and growth
Harrison, BMC plant biology 2021 - “...abscisic acid signalling pathway to cause disease." The EMBO journal 26.5 (2007): 1434-1443. Solyc08g007530.2 AHL1 AT4G12080 0.90 AT-hook motif nuclear-localized protein 1 Specifically binds AT-rich DNA sequences related to the nuclear matrix attachment regions; Functions in the positioning of chromatin fibers within the nucleus Increased transcription;...”
- De novo computational identification of stress-related sequence motifs and microRNA target sites in untranslated regions of a plant translatome
Munusamy, Scientific reports 2017 - “...determines the activity of the miRNA in either cleaving or inhibiting the mRNA expression. Genes AT4G12080, AT1G53160 and AT2G03750 had target sites for the miR156/miR157 in their 3 UTRs. The AT1G53160 encodes the transcription factor SPL (SQUAMOSA promoter binding protein-like), which is involved in the regulation...”
- More
B6TI42 AT-hook motif nuclear-localized protein from Zea mays
Aligns to 180:296 / 377 (31.0%), covers 98.3% of PF03479, 89.7 bits
AHL7_ARATH / Q4V3E0 AT-hook motif nuclear-localized protein 7 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
AT4G00200 DNA binding from Arabidopsis thaliana
Aligns to 124:240 / 318 (36.8%), covers 98.3% of PF03479, 89.1 bits
- function: Transcription factor that specifically binds AT-rich DNA sequences related to the nuclear matrix attachment regions (MARs).
- Coregulation of glutamine synthetase1;2 (GLN1;2) and NADH-dependent glutamate synthase (GLT1) gene expression in Arabidopsis roots in response to ammonium supply
Kojima, Frontiers in plant science 2023 - “...in GLN1;2 promoter. Clone ID of yeast colonies Locus ID name 1 AT5G23260 TT16 2 AT4G00200 AHL7 3 AT1G14490 AHL28 4 AT1G76880 DF1 5 AT1G14490 AHL28 12 AT4G35390 AHL25 13 AT3G55560 AHL15 19 AT1G76880 DF1 11 AT3G55560 AHL15 15 AT4G17800 AHL23 17 AT5G24520 TTG1 18 AT1G14490...”
- Dissection of Functional Modules of AT-HOOK MOTIF NUCLEAR LOCALIZED PROTEIN 4 in the Development of the Root Xylem
Seo, Frontiers in plant science 2021 - “...), AHL3 ( AT4G25320 ), AHL4 ( AT5G51590 ), AHL6 ( AT5G62260 ), AHL7 ( AT4G00200 ), AHL15 ( AT3G55560 ), AHL16 ( AT2G42940 ), AHL17 ( AT5G49700 ), AHL19 ( AT3G04570 ), AHL20 ( AT4G14465 ), AHL21 ( AT2G35270 ), AHL22 ( AT2G45430 ), AHL23...”
LOC108208096 AT-hook motif nuclear-localized protein 26-like from Daucus carota subsp. sativus
Aligns to 112:225 / 291 (39.2%), covers 99.1% of PF03479, 88.8 bits
LS25_1541 PPC domain-containing DNA-binding protein from Latilactobacillus sakei subsp. sakei LS25
Aligns to 8:121 / 140 (81.4%), covers 95.7% of PF03479, 88.7 bits
LSA1467 Hypothetical protein from Lactobacillus sakei subsp. sakei 23K
Aligns to 8:121 / 140 (81.4%), covers 95.7% of PF03479, 88.7 bits
- Global transcriptome response in Lactobacillus sakei during growth on ribose
McLeod, BMC microbiology 2011 - “...protein -0.9 -0.5 LSA1446 lsa1446 Hypothetical protein -0.6 -0.6 -0.7 LSA1466 lsa1466 Hypothetical protein 0.6 LSA1467 lsa1467 Hypothetical protein -0.6 -1.1 LSA1524 lsa1524 Hypothetical protein 0.7 LSA1540 lsa1540 Hypothetical extracellular protein precursor 0.7 LSA1563 lsa1563 Hypothetical integral membrane protein -0.6 -0.6 LSA1610 lsa1610 Hypothetical integral membrane...”
LOC108216162 AT-hook motif nuclear-localized protein 10-like from Daucus carota subsp. sativus
Aligns to 172:288 / 359 (32.6%), covers 97.4% of PF03479, 88.6 bits
- Characteristics of the AT-Hook Motif Containing Nuclear Localized (AHL) Genes in Carrot Provides Insight into Their Role in Plant Growth and Storage Root Development
Machaj, Genes 2021 - “...XP_017245648.1 chr4 DcAHL2 LOC108205011 XP_017230247.1 chr1 DcAHL25 LOC108215787 XP_017243846.1 chr4 DcAHL3 LOC108197227 XP_017220279.1 chr1 DcAHL26 LOC108216162 XP_017244339.1 chr4 DcAHL4 LOC108205501 XP_017230972.1 chr1 DcAHL27 LOC108219725 XP_017248716.1 chr5 DcAHL5 LOC108215664 XP_017243692.1 chr1 DcAHL28 LOC108221500 XP_017250863.1 chr5 DcAHL6 LOC108197834 XP_017221076.1 chr1 DcAHL29 LOC108220764 XP_017250109.1 chr5 DcAHL7 LOC108207567 XP_017233492.1 chr2...”
- “...4 788.75 DcAHL10 LOC108207579 1 0.00 1 237.00 DcAHL38 LOC108193220 2 16,399.50 825 6140.50 DcAHL26 LOC108216162 2 6491.57 566 5180.00 DcAHL13 LOC108206084 2 10,024.21 372 5299.75 DcAHL27 LOC108219725 2 63,411.36 271 5842.75 DcAHL30 LOC108224107 2 6394.09 263 4611.25 DcAHL33 LOC108224386 2 22.44 81 2234.00 DcAHL34 LOC108224931...”
I1K0I8 AT-hook motif nuclear-localized protein from Glycine max
Aligns to 143:259 / 327 (35.8%), covers 97.4% of PF03479, 87.9 bits
LOC108206857 AT-hook motif nuclear-localized protein 24-like from Daucus carota subsp. sativus
Aligns to 118:231 / 295 (38.6%), covers 98.3% of PF03479, 87.4 bits
AHL13_ARATH / Q940I0 AT-hook motif nuclear-localized protein 13; AT-hook protein 2 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
NP_567546 AT hook motif DNA-binding family protein from Arabidopsis thaliana
AT4G17950 DNA-binding family protein from Arabidopsis thaliana
Aligns to 222:340 / 439 (27.1%), covers 97.4% of PF03479, 86.8 bits
- function: Transcription factor that specifically binds AT-rich DNA sequences related to the nuclear matrix attachment regions (MARs).
- Chromatin phosphoproteomics unravels a function for AT-hook motif nuclear localized protein AHL13 in PAMP-triggered immunity.
Rayapuram, Proceedings of the National Academy of Sciences of the United States of America 2021 - GeneRIF: Chromatin phosphoproteomics unravels a function for AT-hook motif nuclear localized protein AHL13 in PAMP-triggered immunity.
- Chromatin attachment to the nuclear matrix represses hypocotyl elongation in Arabidopsis thaliana
Xu, Nature communications 2024 - “...49 10 934 52.3 11 1223 AHL17 AT5G49700 44.2 6 476 20.7 4 331 AHL13 AT4G17950 18.7 5 358 21.2 5 305 AHL19 AT3G04570 25.1 4 306 21 4 255 SPFH AT5G51570 27.7 5 231 19.5 4 273 AHL27 AT1G20900 19.6 3 221 19.6 3 197...”
- Telomerase Interaction Partners-Insight from Plants
Fulnečková, International journal of molecular sciences 2021 - “...transcription was not affected. These results suggest that the mutations in mtssb , at2g04520 , at4g17950 , at2g40660 , at4g23540 , at5g12410, and at2g42270 lines were not effective in influencing the maintenance of telomere length. As well, the three lines that produced only heterozygous progeny (...”
- “..., at3g57940 , at4g23540 , chr19-1 , rli2 , at5g12410 , at2g04520 , at2g40660 , at4g17950 , rh2 , rh42 , at2g42270 , and deah3 is in Supplementary Materials . The terminal restriction fragment (TRF) method was performed as described in [ 90 ]. Briefly, genomic...”
- Chromatin phosphoproteomics unravels a function for AT-hook motif nuclear localized protein AHL13 in PAMP-triggered immunity
Rayapuram, Proceedings of the National Academy of Sciences of the United States of America 2021 (secret) - Phosphoproteomics of Arabidopsis Highly ABA-Induced1 identifies AT-Hook-Like10 phosphorylation required for stress growth regulation
Wong, Proceedings of the National Academy of Sciences of the United States of America 2019 - “...(6, 7, 26, 32-38). Interestingly, a phosphopeptide from AHL13 (AT4G17950) was also putatively (but not significantly) increased in hai1-2 at low w (Fig. 1A, SI...”
LOC108208112 AT-hook motif nuclear-localized protein 26 from Daucus carota subsp. sativus
Aligns to 104:217 / 298 (38.3%), covers 99.1% of PF03479, 86.7 bits
AHL4_ARATH / Q9FHM5 AT-hook motif nuclear-localized protein 4 from Arabidopsis thaliana (Mouse-ear cress) (see 2 papers)
NP_199972 AT hook motif DNA-binding family protein from Arabidopsis thaliana
AT5G51590 DNA-binding protein-related from Arabidopsis thaliana
Aligns to 179:295 / 419 (27.9%), covers 97.4% of PF03479, 85.9 bits
- function: Transcription factor that specifically binds AT-rich DNA sequences related to the nuclear matrix attachment regions (MARs) (By similarity). Acts redundantly with AHL3 to regulate the formation of tissue boundary between the xylem and procambium in the root meristem. Cell-to-cell movement of AHL4 from the procambium to the xylem is critical for its function in root vascular patterning (PubMed:23335615).
subunit: Homodimer. Interacts with AHL3.
disruption phenotype: Misspecification of tissue boundaries between the xylem and procambium. - Cell-to-cell movement of two interacting AT-hook factors in Arabidopsis root vascular tissue patterning.
Zhou, The Plant cell 2013 - GeneRIF: The cell-to-cell communication mediated by mobile AHL3 and AHL4 is critical for establishing the boundary between the procambium and xylem.
- Chromatin attachment to the nuclear matrix represses hypocotyl elongation in Arabidopsis thaliana
Xu, Nature communications 2024 - “...15.3 4 215 16.3 4 297 AHL1 AT4G12080 29.2 4 199 39.3 8 425 AHL4 AT5G51590 14.8 3 121 6.9 2 90 HTA7 AT5G27670 34.7 2 119 42.7 3 151 FRS12 AT5G18960 9.1 3 98 4.9 2 78 VRN1 AT3G18990 8.8 3 93 8.5 2 113...”
- Dissection of Functional Modules of AT-HOOK MOTIF NUCLEAR LOCALIZED PROTEIN 4 in the Development of the Root Xylem
Seo, Frontiers in plant science 2021 - “...numbers: AHL1 ( AT4G12080 ), AHL2 ( AT4G22770 ), AHL3 ( AT4G25320 ), AHL4 ( AT5G51590 ), AHL6 ( AT5G62260 ), AHL7 ( AT4G00200 ), AHL15 ( AT3G55560 ), AHL16 ( AT2G42940 ), AHL17 ( AT5G49700 ), AHL19 ( AT3G04570 ), AHL20 ( AT4G14465 ), AHL21...”
- Vascular Cambium Development
Nieminen, The arabidopsis book 2015 - “...TIF NUCLEAR LOCALIZED PROTEIN3 (AHL3; At4g25320) and AHL4 (At5g51590), which also move to the xylem axis from the surrounding tissues, regulate the boundary...”
LOC108197690 AT-hook motif nuclear-localized protein 20-like from Daucus carota subsp. sativus
Aligns to 93:206 / 281 (40.6%), covers 99.1% of PF03479, 85.6 bits
B4FRV0 AT-hook motif nuclear-localized protein from Zea mays
Aligns to 180:296 / 391 (29.9%), covers 97.4% of PF03479, 85.3 bits
- Phosphoproteomic analysis of the response of maize leaves to drought, heat and their combination stress.
Hu, Frontiers in plant science 2015 - “...27 37040 574595 5.17 H 1 xxxxxxx R xx S xxxxxxxxxx BF4F7Z5; BF4F976; B4FI93; B4FRF2; B4FRV0; B4FUV7; B6SRZ6; B6SXN6; B6T1H0; B6T2A6; B6TDN3; B6TQS9; B6TWH2; B6U787; B8A0K2; C0HIM6; C0P3W9; C0P4D8; C0P9L7; C0PCR0; C0PDN0; C0PD30; K7TRK2; K7U573; K7V0H0; K7VBI0; K7VBA5; K7W2Z7; K7WC16; Q41729; Q9ATN2 11.33 31 132 55507...”
- “...C0P3W9; C0PD66 13.09 7 36 2559 574595 43.66 4 xxxxxxxxx RT xxxxxxxxxx B4FB20; B4FGQ4; B4FQU2; B4FRV0; BF4F7W7; B6SRZ6; C0HE61; C0PLM8; C0PLZ2; K7V4D9; K7VD18 7.28 11 29 27693 572036 7.84 DH 1 xxxxxxx R xx S xxxxxxxxx A3KLI0; BF4F976; B4FI93; B4FRF2; B4FUV7; B4FXQ9; B6SJ15; B6SRZ6; B6SXN6; B6T1H0;...”
LOC108195339 AT-hook motif nuclear-localized protein 24-like from Daucus carota subsp. sativus
Aligns to 120:233 / 310 (36.8%), covers 98.3% of PF03479, 85.2 bits
AHL2_ARATH / O49658 AT-hook motif nuclear-localized protein 2 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
AT4G22770 DNA-binding family protein from Arabidopsis thaliana
Aligns to 151:267 / 334 (35.0%), covers 97.4% of PF03479, 84.5 bits
- function: Transcription factor that specifically binds AT-rich DNA sequences related to the nuclear matrix attachment regions (MARs).
- Genome-Wide Identification and Expression Analysis under Abiotic Stress of BrAHL Genes in Brassica rapa
Zhang, International journal of molecular sciences 2023 - “...inferred that BrAHL16 is probably involved in regulation under drought stress ( Figure 9 A). AT4G22770 (homologous gene of BrAHL02 ) interacted with AT-HSFA5, a heat shock protein (HSP). HSPs are induced by unfavorable environments, suggesting that BrAHL02 potentially affects the process under cold conditions (...”
- “...at 12 h. From the protein-protein interaction networks, the homologous gene in A. thaliana ( AT4G22770 ) interacted with AT-HSFA5. HSFA4 and HSFA5 belong to distinct subgroups within the class A HSF, characterized by identical DNA-binding domains and conserved C-terminal motifs [ 53 ]. Heat shock...”
- Overexpression of AHL9 accelerates leaf senescence in Arabidopsis thaliana
Zhou, BMC plant biology 2022 - “...PAO4 (AT1G65840), WRKY63 (AT1G66600), EBF2 (AT5G25350), NAC003 (AT1G02220), NAC100 (AT5G61430), AP2 (AT4G36920), ERS1 (AT2G40940), AHL2 (AT4G22770), SAUR41 (AT1G16510), IAA7 (AT3G23050), IAA29 (AT4G32280), IAA14 (AT4G14550), IPT3 (AT3G63110). Supplementary information Additional file 1 Fig. S1 Phylogenic analysis of AHLs clade B family proteins in Arabidopsis thanalia and orthologs...”
- Dissection of Functional Modules of AT-HOOK MOTIF NUCLEAR LOCALIZED PROTEIN 4 in the Development of the Root Xylem
Seo, Frontiers in plant science 2021 - “...the GenBank/EMBL data libraries under the following accession numbers: AHL1 ( AT4G12080 ), AHL2 ( AT4G22770 ), AHL3 ( AT4G25320 ), AHL4 ( AT5G51590 ), AHL6 ( AT5G62260 ), AHL7 ( AT4G00200 ), AHL15 ( AT3G55560 ), AHL16 ( AT2G42940 ), AHL17 ( AT5G49700 ), AHL19...”
- NOVOMIR: De Novo Prediction of MicroRNA-Coding Regions in a Single Plant-Genome
Teune, Journal of nucleic acids 2010 - “...but no explicit annotation. One novoMIR hit is located on chromosome 4 between At4G22760 and At4G22770 close to the 3 terminus of the latter, but on the opposite strand; for further details, see Figure 3 and Figure S9. The next hit (see Figure 3 and Figure...”
G7KG44 AT-hook motif nuclear-localized protein from Medicago truncatula
Aligns to 128:241 / 325 (35.1%), covers 99.1% of PF03479, 84.3 bits
AHL10_ARATH / O22812 AT-hook motif nuclear-localized protein 10; AT-hook protein 1 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
AT2G33620 DNA-binding family protein / AT-hook protein 1 (AHP1) from Arabidopsis thaliana
Aligns to 164:280 / 351 (33.3%), covers 97.4% of PF03479, 83.9 bits
- function: Transcription factor that specifically binds AT-rich DNA sequences related to the nuclear matrix attachment regions (MARs).
- Genome-Wide Identification and Expression Analysis under Abiotic Stress of BrAHL Genes in Brassica rapa
Zhang, International journal of molecular sciences 2023 - “...to AtAHL genes, protein interactions were predicted to reveal the potential functions of these proteins. AT2G33620 (homologous gene of BrAHL16 ) was observed to interact with HAI1, which functions as a negative regulator in response to osmotic stress and drought [ 11 ]. It is inferred...”
- “...4 may undergo regulation under Cd conditions. Notably, the protein-protein interaction network prediction demonstrated that AT2G33620 (homologous gene of BrAHL16 ) interacted with HAI1. It is speculated that BrAHL16 participates in the regulation under drought stress. AT4G22770 (homologous gene of BrAHL02 ) was revealed to interact...”
- The Proteome and Phosphoproteome Uncovers Candidate Proteins Associated With Vacuolar Phosphate Signal Multipled by Vacuolar Phosphate Transporter 1 (VPT1) in Arabidopsis
Zhang, Molecular & cellular proteomics : MCP 2023 - “...At1g45145), U1 SMALL NUCLEAR RIBONUCLEOPROTEIN-70K (RNU1; At3g50670), and AT-HOOK MOTIF NUCLEAR LOCALIZED PROTEIN 10 (AHL10; At2g33620). These six overlapped proteins of phosphoproteome and proteome exhibited opposing patterns of phosphorylation and abundance changes, suggesting that phosphorylation may impact their turnover ( Fig.3 D ). BSL3 is one...”
- Recruitment of an ancient branching program to suppress carpel development in maize flowers
Klein, Proceedings of the National Academy of Sciences of the United States of America 2022 - “...PAB1 Proteolysis GRMZM2G145554 AT4G18170 (WRKY28) WRKY DNA-binding domain protein Leaf senescence ( 98 ) GRMZM2G104299 AT2G33620 AT-hook motif nuclear-localized protein 10 ABA response; senescence (maize) ( 99 , 100 ) GRMZM5G858784 AT1G30100 (NCED5) Nine- cis -epoxycarotenoid dioxygenase 3 ABA biosynthesis ( 101 ) GRMZM2G052902 AT2G24360 (RAF22)...”
- Chromatin phosphoproteomics unravels a function for AT-hook motif nuclear localized protein AHL13 in PAMP-triggered immunity
Rayapuram, Proceedings of the National Academy of Sciences of the United States of America 2021 (secret) - AtDRO1 is nuclear localized in root tips under native conditions and impacts auxin localization
Waite, Plant molecular biology 2020 - “...domain 5.79 5.66E03 AT2G31810 AT2G31810 ACT domain-containing small subunit of acetolactate synthase protein 5.53 4.03E02 AT2G33620 AT2G33620 AT hook motif DNA-binding family protein 5.07 4.23E02 AT3G59430 AT3G59430 Unknown protein 4.85 2.25E03 AT3G42725 AT3G42725 Putative membrane lipoprotein 4.73 4.18E03 AT5G12330 LRP1 Encodes LRP1 (LATERAL ROOT PRIMORDIUM 1)...”
- Greenbug (Schizaphis graminum) herbivory significantly impacts protein and phosphorylation abundance in switchgrass (Panicum virgatum)
Zogli, Scientific reports 2020 - “...DEGs-up DPs-up Pavir.1NG430900 AT4G13940 S-adenosyl- l -homocysteine hydrolase 1 L T KSQADYISVPIEGPYKPAHYR DEGs-up DPs-up Pavir.2KG411435 AT2G33620 AT hook motif DNA-binding family protein VAPAAPS S PPSR DEGs-up DPs-up Pavir.2KG484600 AT4G05150 Octicosapeptide/Phox/Bem1p family protein SDAAE T PRQHGDEDEASVPAR DEGs-up DPs-down Pavir.2KG572300 AT1G53050 Protein kinase superfamily protein IADFGLASFFDPNHKQPM T SR...”
- Epigenetic signatures associated with imprinted paternally expressed genes in the Arabidopsis endosperm
Moreno-Romero, Genome biology 2019 - “...of seven genes belonging to the highest score category but predicted to be maternally ( AT2G33620 , AT1G43580 , AT1G47530 , AT1G64660 , AT2G30590 , AT4G15390 ) or biallelically expressed ( AT5G53160 ). We detected a GFP signal in the endosperm only for construct AT1G64660 (Fig....”
- “...we used the ClonExpress MultiS One Step Cloning kit. Promoters (2kb) and genic sequences of AT2G33620 , AT1G43580 , AT1G47530 , AT1G64660 , AT2G30590 , AT4G15390 , and AT5G53160 were amplified from WT Col-0 genomic DNA using primers specified in Additionalfile 1 : Table S6 and...”
- cDNA-AFLP analysis reveals differential gene expression in incompatible interaction between infected non-heading Chinese cabbage and Hyaloperonospora parasitica
Xiao, Horticulture research 2016 - “...x 72 AB474716 126 AT5G42220 AT5G42220 Bra027974 AT5G42220 _A09 ST x x 73 AB474644 121 AT2G33620 AHL10 Bra021865 BcAHL10 _A04 ST x x x 74 AB474713 129 AT3G15290 AT3G15290 Bra027263 AT3G15290 _A05 EM X X x 75 AB474703 127 AT3G48990 AAE3 Bra018019 BcAAE3 _A06 EM x...”
- More
LOC108200218 AT-hook motif nuclear-localized protein 20-like from Daucus carota subsp. sativus
Aligns to 64:177 / 263 (43.3%), covers 99.1% of PF03479, 83.4 bits
- Characteristics of the AT-Hook Motif Containing Nuclear Localized (AHL) Genes in Carrot Provides Insight into Their Role in Plant Growth and Storage Root Development
Machaj, Genes 2021 - “...XP_017226814.1 chr9 DcAHL21 LOC108212236 XP_017239451.1 chr3 DcAHL45 LOC108202271 XP_017226151.1 chr9 DcAHL22 LOC108211560 XP_017238682.1 chr3 DcAHL46 LOC108200218 XP_017223772.1 chr9 DcAHL23 LOC108211115 XP_017238115.1 chr3 DcAHL47 LOC108192665 XP_017227697.1 chrUn_LNRQ01000029 * the largest isoform. genes-12-00764-t002_Table 2 Table 2 A list of AHL genes showing significant interactions in the coexpression network...”
- “...62 2695.25 DcAHL11 LOC108210006 1 757.12 51 2626.50 DcAHL40 LOC108196714 1 3490.89 46 3168.00 DcAHL46 LOC108200218 1 1361.78 41 2700.25 DcAHL32 LOC108225124 1 5.90 12 1268.00 DcAHL2 LOC108205011 1 1.70 6 951.75 DcAHL29 LOC108220764 1 9.82 6 1076.25 DcAHL1 LOC108209315 1 0.66 4 788.75 DcAHL10 LOC108207579...”
LOC108211115 AT-hook motif nuclear-localized protein 20-like from Daucus carota subsp. sativus
Aligns to 119:232 / 315 (36.2%), covers 98.3% of PF03479, 82.8 bits
LOC108201885 AT-hook motif nuclear-localized protein 23-like from Daucus carota subsp. sativus
Aligns to 91:204 / 278 (41.0%), covers 99.1% of PF03479, 82.7 bits
LOC108209315 AT-hook motif nuclear-localized protein 5-like from Daucus carota subsp. sativus
Aligns to 157:273 / 354 (33.1%), covers 97.4% of PF03479, 82.1 bits
- Characteristics of the AT-Hook Motif Containing Nuclear Localized (AHL) Genes in Carrot Provides Insight into Their Role in Plant Growth and Storage Root Development
Machaj, Genes 2021 - “...Gene ID Protein ID * Chromosome Gene Name Gene ID Protein ID * Chromosome DcAHL1 LOC108209315 XP_017235643.1 chr1 DcAHL24 LOC108217323 XP_017245648.1 chr4 DcAHL2 LOC108205011 XP_017230247.1 chr1 DcAHL25 LOC108215787 XP_017243846.1 chr4 DcAHL3 LOC108197227 XP_017220279.1 chr1 DcAHL26 LOC108216162 XP_017244339.1 chr4 DcAHL4 LOC108205501 XP_017230972.1 chr1 DcAHL27 LOC108219725 XP_017248716.1 chr5...”
- “...12 1268.00 DcAHL2 LOC108205011 1 1.70 6 951.75 DcAHL29 LOC108220764 1 9.82 6 1076.25 DcAHL1 LOC108209315 1 0.66 4 788.75 DcAHL10 LOC108207579 1 0.00 1 237.00 DcAHL38 LOC108193220 2 16,399.50 825 6140.50 DcAHL26 LOC108216162 2 6491.57 566 5180.00 DcAHL13 LOC108206084 2 10,024.21 372 5299.75 DcAHL27 LOC108219725...”
LOC108206866 AT-hook motif nuclear-localized protein 23-like from Daucus carota subsp. sativus
Aligns to 97:210 / 285 (40.0%), covers 99.1% of PF03479, 81.9 bits
AHL24_ARATH / O49662 AT-hook motif nuclear-localized protein 24 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
AT4G22810 DNA-binding protein-related from Arabidopsis thaliana
Aligns to 133:249 / 324 (36.1%), covers 99.1% of PF03479, 81.8 bits
- function: Transcription factor that specifically binds AT-rich DNA sequences related to the nuclear matrix attachment regions (MARs).
- Genome-wide dissection of AT-hook motif nuclear-localized gene family and their expression profiling for drought and salt stress in rice (Oryza sativa)
Ambadas, Frontiers in plant science 2023 - “...of OsAHLs. After filtration, seven unique interactions of OsAHL proteins with diverse proteins such as AT4G22810 (AHL24), AHL20, GAINT KILLER (GIK), AHL22, AT4G17800 (AHL23), AT4G17760, and AT4G17440 are depicted in Figure11 . The protein AT4G17800 exhibits the highest number of nodes and is shared in its...”
- “...Further, the PPI network also depicts the activation of stress-related proteins including AHL20, AT4G17800 (AHL23), AT4G22810 (AHL24), and GIK. Further, the interaction of different OsAHL proteins with developmental proteins regulates processes such as flowering and differentiation of reproductive organs. Figure11 Predicted proteinprotein interaction network of OsAHL...”
- Identification of QTNs and their candidate genes for flowering time and plant height in soybean using multi-locus genome-wide association studies
Han, Molecular breeding : new strategies in plant improvement 2021 - “...MM47999 MM85086 FT1 13 Glyma.10g037600 Glyma.03g227300 GmPHYA4 AT4G22810 AT2G31160 Gene name Homologous gene Candidate gene QTN Trait Position (bp) Comparative...”
C6TMY6 PPC domain-containing protein from Glycine max
Aligns to 84:197 / 268 (42.5%), covers 99.1% of PF03479, 81.7 bits
AHL3_ARATH / Q9SB31 AT-hook motif nuclear-localized protein 3 from Arabidopsis thaliana (Mouse-ear cress) (see 2 papers)
AT4G25320 DNA-binding protein-related from Arabidopsis thaliana
NP_194262 AT hook motif DNA-binding family protein from Arabidopsis thaliana
Aligns to 167:283 / 404 (29.0%), covers 97.4% of PF03479, 81.6 bits
- function: Transcription factor that specifically binds AT-rich DNA sequences related to the nuclear matrix attachment regions (MARs) (By similarity). Acts redundantly with AHL4 to regulate the formation of tissue boundary between the xylem and procambium in the root meristem (PubMed:23335615).
subunit: Homodimer. Interacts with AHL4.
disruption phenotype: Misspecification of tissue boundaries between the xylem and procambium. - Chromatin attachment to the nuclear matrix represses hypocotyl elongation in Arabidopsis thaliana
Xu, Nature communications 2024 - “...27.7 5 231 19.5 4 273 AHL27 AT1G20900 19.6 3 221 19.6 3 197 AHL3 AT4G25320 15.3 4 215 16.3 4 297 AHL1 AT4G12080 29.2 4 199 39.3 8 425 AHL4 AT5G51590 14.8 3 121 6.9 2 90 HTA7 AT5G27670 34.7 2 119 42.7 3 151...”
- Dissection of Functional Modules of AT-HOOK MOTIF NUCLEAR LOCALIZED PROTEIN 4 in the Development of the Root Xylem
Seo, Frontiers in plant science 2021 - “...under the following accession numbers: AHL1 ( AT4G12080 ), AHL2 ( AT4G22770 ), AHL3 ( AT4G25320 ), AHL4 ( AT5G51590 ), AHL6 ( AT5G62260 ), AHL7 ( AT4G00200 ), AHL15 ( AT3G55560 ), AHL16 ( AT2G42940 ), AHL17 ( AT5G49700 ), AHL19 ( AT3G04570 ), AHL20...”
- Vascular Cambium Development
Nieminen, The arabidopsis book 2015 - “...Vascular Cambium Development TIF NUCLEAR LOCALIZED PROTEIN3 (AHL3; At4g25320) and AHL4 (At5g51590), which also move to the xylem axis from the surrounding...”
- Cell-to-cell movement of two interacting AT-hook factors in Arabidopsis root vascular tissue patterning.
Zhou, The Plant cell 2013 - GeneRIF: The cell-to-cell communication mediated by mobile AHL3 and AHL4 is critical for establishing the boundary between the procambium and xylem.
AHL21_ARATH / O82166 AT-hook motif nuclear-localized protein 21; Protein GIANT KILLER from Arabidopsis thaliana (Mouse-ear cress) (see 2 papers)
NP_181070 Putative AT-hook DNA-binding family protein from Arabidopsis thaliana
AT2G35270 DNA-binding protein-related from Arabidopsis thaliana
Aligns to 106:219 / 285 (40.0%), covers 99.1% of PF03479, 81.5 bits
- function: Transcription factor that specifically binds AT-rich DNA sequences related to the nuclear matrix attachment regions (MARs). Binds to the MARs present in the ETTIN (ETT) promoter leading to a negative regulation of its gene expression. Functions as a molecular node downstream of the homeotic protein AGAMOUS (AG), regulating patterning and differentiation of reproductive organs. Acts as a chromatin remodeling factor that modifies the architecture of ETTIN (ETT) chromatin by modulating H3 methylation leading to the regulation of ETT expression. Seems to be involved in the regulation of a set of reproductives genes including CRABS CLAW (CRC), JAGGED (JAG) and KNUCKLES (KNU).
disruption phenotype: Reproductive defects. - AGAMOUS controls GIANT KILLER, a multifunctional chromatin modifier in reproductive organ patterning and differentiation.
Ng, PLoS biology 2009 - GeneRIF: GIANT KILLER (AT2G35270) acts as a molecular node downstream of AGAMOUS, regulating patterning and differentiation of reproductive organs through chromatin organization
- Dissection of Functional Modules of AT-HOOK MOTIF NUCLEAR LOCALIZED PROTEIN 4 in the Development of the Root Xylem
Seo, Frontiers in plant science 2021 - “...), AHL17 ( AT5G49700 ), AHL19 ( AT3G04570 ), AHL20 ( AT4G14465 ), AHL21 ( AT2G35270 ), AHL22 ( AT2G45430 ), AHL23 ( AT4G17800 ), AHL27 ( AT1G20900 ), and AHL29 ( AT1G76500 ). Author Contributions J-YL and MS: conceptualization, validation, investigation, resources, writingoriginal draft, and...”
- Transcriptome and epigenome analyses of vernalization in Arabidopsis thaliana
Xi, The Plant journal : for cell and molecular biology 2020 - “...Reported function AT1G51860 - LRR, protein kinase - AT2G45430 AHL22 AT-hook DNA-binding regulation of flowering AT2G35270 AHL21 AT-hook DNA-binding patterning and differentiation of reproductive organs AT4G37390 AUR3 GH3 auxin-responsive negative component in auxin signaling AT5G06800 - Myb-like DNA-binding - AT3G26760 - glucose dehydrogenase - AT1G74770 BTSL1...”
- Mediator of tolerance to abiotic stress ERF6 regulates susceptibility of Arabidopsis to Meloidogyne incognita
Warmerdam, Molecular plant pathology 2019 - “...At2G34300 8 2 14848612 G:T 150:199 4 4.28 At2G35250 At2G35215, At2G35220, At2G35230, At2G35240, At2G35250. At2G35260, At2G35270 9 2 18338888 A:G 211:138 4.6 4.56 At2G44440 At2G44400, At2G44410, At2G44420, At2G44430, At2G44440, At2G44450, At2G44460 10 3 287272 C:T 131:218 4.4 4.19 At3G01800 At3G01770, At3G01780, At3G01790, At3G01800, At3G01810, At3G01820, At3G01830....”
- Network component analysis provides quantitative insights on an Arabidopsis transcription factor-gene regulatory network
Misra, BMC systems biology 2013 - “...Arabidopsis gene model are: 1 - NAP (At1g69490), 2 - CRC (At1g69180), 3 - GIK (At2g35270), 4 - APL (At2g27330), 5 - AGL2 (At5g15800), 6 - AGL4 (At3g02310), 7 - AGL8 (At5g60910), 8 - AGL3 (At2g03710), 9 - ACS8 (At4g37770), 10 - ADR1 (At1g33560), 11 -...”
- AGAMOUS controls GIANT KILLER, a multifunctional chromatin modifier in reproductive organ patterning and differentiation
Ng, PLoS biology 2009 - “...multiple downstream targets in plants. Results GIK Is a Direct Target of AG We identified At2G35270 (isolation name, 2-ATH ; AHL21 [32] ) as a putative direct target of AG using bioinformatics screening ( Figure 1A, B ) of the Arabidopsis genome for potential AG binding...”
- “...article are as follows: AGAMOUS ( AG , At4g18960 ), GIANT KILLER ( GIK , At2g35270 ), ETTIN (ETT , At2g33860 ), CRABS CLAW ( CRC , At1g69180 ), JAGGED ( JAG , At1g68480 ), KNUCKLES ( KNU , At5g14010 ), LEUNIG ( LUG , At4g32551...”
G7KSI4 AT hook motif DNA-binding family protein from Medicago truncatula
Aligns to 85:198 / 269 (42.4%), covers 99.1% of PF03479, 81.4 bits
AT3G04590 DNA-binding family protein from Arabidopsis thaliana
Aligns to 172:285 / 309 (36.9%), covers 98.3% of PF03479, 81.3 bits
- Genome-Wide Identification and Expression Analysis under Abiotic Stress of BrAHL Genes in Brassica rapa
Zhang, International journal of molecular sciences 2023 - “...environments, suggesting that BrAHL02 potentially affects the process under cold conditions ( Figure 9 B). AT3G04590 (homologous gene of BrAHL24 ) was found to have interactions with far-red elongated hypocotyls (FRSs) in regulating the light control of plant development. Notably, photosynthesis is the primary process affected...”
- “...at 6 h, and peaked at 12 h. Considering protein-protein interaction networks, the homologous gene AT3G04590 interacted with far-red elongated hypocotyls (FRSs). FRSs are crucial in the light control process that regulates the development of roots and flowers [ 59 ]. It is concluded that BrAHL24...”
- Natural variation in rosette size under salt stress conditions corresponds to developmental differences between Arabidopsis accessions and allelic variation in the LRR-KISS gene
Julkowska, Journal of experimental botany 2016 - “...salt stress tolerance ( Fig. 4C ). In control conditions, one T-DNA insertion line in At3g04590 ( fw2 ) and two T-DNA insertion lines in At3g04610 ( fw5 and fw6 ) developed significantly smaller rosettes than reference line Col-0. Measuring the relative effect of salt stress...”
- “...encoding flowering locus KH domain. Considering the linkage disequilibrium, putative candidate genes were extended to At3g04590, encoding AT hook motif DNA-binding family protein. The association was further confirmed by studying five available T-DNA insertion lines, whose location is indicated in the graph representing the ORFs. The...”
- Comprehensive analysis of alternative splicing in Digitalis purpurea by strand-specific RNA-Seq
Wu, PloS one 2014 - “...that an alternative position ( Figure S1B ) could be misclassified as intron retention (e.g., AT3G04590). The minor deviations only affected the AS classification rather than the downstream functional analysis. To further validate the AS results by experimental methods, 14 genes were randomly selected and validated...”
LOC108213708 AT-hook motif nuclear-localized protein 16 from Daucus carota subsp. sativus
Aligns to 66:176 / 246 (45.1%), covers 99.1% of PF03479, 81.3 bits
AHL19_ARATH / Q9SR17 AT-hook motif nuclear-localized protein 19 from Arabidopsis thaliana (Mouse-ear cress) (see 3 papers)
AT3G04570 DNA-binding protein-related from Arabidopsis thaliana
NP_566232 AT-hook motif nuclear-localized protein 19 from Arabidopsis thaliana
Aligns to 108:229 / 315 (38.7%), covers 98.3% of PF03479, 81.2 bits
- function: Transcription factor that specifically binds AT-rich DNA sequences related to the nuclear matrix attachment regions (MARs) (By similarity). Negatively regulates plant innate immunity (PTI) to pathogens through the down-regulation of the PAMP-triggered FRK1 expression (PubMed:20738724). Positively regulates defense against fungal Verticillium infection (PubMed:21864046).
disruption phenotype: Enhanced susceptibility to Verticillium wilt resulting in wilting, stunting and chlorosis. - Chromatin attachment to the nuclear matrix represses hypocotyl elongation in Arabidopsis thaliana
Xu, Nature communications 2024 - “...44.2 6 476 20.7 4 331 AHL13 AT4G17950 18.7 5 358 21.2 5 305 AHL19 AT3G04570 25.1 4 306 21 4 255 SPFH AT5G51570 27.7 5 231 19.5 4 273 AHL27 AT1G20900 19.6 3 221 19.6 3 197 AHL3 AT4G25320 15.3 4 215 16.3 4 297...”
- Overexpression of AHL proteins enhances root hair production by altering the transcription of RHD6-downstream genes
Zeng, Plant direct 2023 - “...in The Arabidopsis Information Resource under the following accession numbers: AHL17 (AT5G49700), AHL28 (AT1G14490), AHL19 (AT3G04570), RHD6 (AT1G66470), PRP3 (AT3G62680), LRX1 (AT1G12040), COW1 (AT4G34580), RHS15 (AT4G25220), HSP701 (AT5G02500), HSP702 (AT5G02490), HSP704 (AT3G12580), HSP705 (AT1G16030), and UBQ5 (AT3G62250). REFERENCES Aravind , L. , & Landsman , D....”
- Coregulation of glutamine synthetase1;2 (GLN1;2) and NADH-dependent glutamate synthase (GLT1) gene expression in Arabidopsis roots in response to ammonium supply
Kojima, Frontiers in plant science 2023 - “...AT5G25160 ZFP3 23 AT1G14490 AHL28 24 AT4G17800 AHL23 26 ST1G76880 DF1 27 AT3G55580 AHL15 28 AT3G04570 AHL19 29 AT1G94490 AHL28 31 AT5G65410 ZFHD2 32 AT3G13850 LBD22 33 unknown IV Figure4 Ammonium responsive regions (ARRs) with DF1 binding sequence signatures. (A) The 41-bp (3,604 to 3,564) ARR...”
- Dissection of Functional Modules of AT-HOOK MOTIF NUCLEAR LOCALIZED PROTEIN 4 in the Development of the Root Xylem
Seo, Frontiers in plant science 2021 - “...), AHL15 ( AT3G55560 ), AHL16 ( AT2G42940 ), AHL17 ( AT5G49700 ), AHL19 ( AT3G04570 ), AHL20 ( AT4G14465 ), AHL21 ( AT2G35270 ), AHL22 ( AT2G45430 ), AHL23 ( AT4G17800 ), AHL27 ( AT1G20900 ), and AHL29 ( AT1G76500 ). Author Contributions J-YL and...”
- An Arabidopsis AT-hook motif nuclear protein mediates somatic embryogenesis and coinciding genome duplication
Karami, Nature communications 2021 - “...pART27 70 . To generate the other overexpression constructs, the full-length cDNA clones of AHL19 (At3g04570), AHL20 (At4g14465), and AHL29 (At1g76500) from Arabidopsis Col-0 were used to amplify the open reading frames (ORFs) using primers indicated in Supplementary Table 1 . The ORFs were cloned into...”
- Function annotation of an SBP-box gene in Arabidopsis based on analysis of co-expression networks and promoters
Wang, International journal of molecular sciences 2009 - “...GDSL-motif lipase/hydrolase family protein AT2G45430 DNA-binding protein-related AT4G21650 subtilase family protein UCC2__UCC2 (UCLACYANIN 2); copper AT3G04570 DNA-binding protein-related AT2G44790 ion binding AT4G32650 ARABIDOPSIS THALIANA K+ RECTIFYING CHANNEL 1 AT3G28500 60S acidic ribosomal protein P2 (RPP2C) AT3G14680 CYP72A14 AT4G12550 Auxin-Induced in Root cultures 1 AT1G20900 ESCAROLA AT4G20860...”
- The Arabidopsis thaliana DNA-binding protein AHL19 mediates verticillium wilt resistance.
Yadeta, Molecular plant-microbe interactions : MPMI 2011 (PubMed)- GeneRIF: AHL19 acts as a positive regulator of plant defense.
LOC108208477 AT-hook motif nuclear-localized protein 24-like from Daucus carota subsp. sativus
Aligns to 101:214 / 281 (40.6%), covers 98.3% of PF03479, 80.8 bits
AHL16_ARATH / Q9SJG4 AT-hook motif nuclear-localized protein 16; Protein TRANSPOSABLE ELEMENT SILENCING VIA AT-HOOK; Protein TEK from Arabidopsis thaliana (Mouse-ear cress) (see 6 papers)
AT2G42940 DNA-binding family protein from Arabidopsis thaliana
NP_181822 Putative AT-hook DNA-binding family protein from Arabidopsis thaliana
Aligns to 81:194 / 257 (44.4%), covers 96.6% of PF03479, 80.8 bits
- function: Transcription factor that specifically binds AT-rich DNA sequences related to the nuclear matrix attachment regions (MARs) (PubMed:25336567). Encodes a nuclear matrix protein that acts in the maintenance of genomic integrity by silencing TEs and repeat-containing genes through epigenetic machinery. Acts as a chromatin remodeling factor that modifies the architecture of FLC and FWA chromatin by modulating both H3 acetylation and methylation leading to the regulation of FLC and FWA expression (PubMed:23394836, PubMed:23836195). Negatively regulates floral repressors including MAF4 and MAF5 (PubMed:23733063). Plays a transcription activation role in anther development. Regulates the expression of arabinogalactan proteins (AGPs) involved in the formation of the nexine layer of the pollen wall (PubMed:25336567, PubMed:24804694). Binds AGP6, AGP11, AGP23 and AGP40 promoters (PubMed:25336567).
subunit: Interacts with FVE/MSI4 and MSI5 which are components of HDAC corepressor complexes.
disruption phenotype: Abnormal pollen wall with the absence of the nexine and intine layers causing microspore abortion and male sterility. - Dissection of Functional Modules of AT-HOOK MOTIF NUCLEAR LOCALIZED PROTEIN 4 in the Development of the Root Xylem
Seo, Frontiers in plant science 2021 - “...), AHL6 ( AT5G62260 ), AHL7 ( AT4G00200 ), AHL15 ( AT3G55560 ), AHL16 ( AT2G42940 ), AHL17 ( AT5G49700 ), AHL19 ( AT3G04570 ), AHL20 ( AT4G14465 ), AHL21 ( AT2G35270 ), AHL22 ( AT2G45430 ), AHL23 ( AT4G17800 ), AHL27 ( AT1G20900 ), and...”
- Comparative transcriptome profiling of the fertile and sterile flower buds of a dominant genic male sterile line in sesame (Sesamum indicum L.)
Liu, BMC plant biology 2016 - “...stilbene synthase 1.00 4.242.36 SIN_1001388 AT4G21330 2E-36 129 DYT1, bHLH transcription factor 2.07 0.480.15 SIN_1003502 AT2G42940 1E-90 272 AT-hook DNA-binding protein 3.82 7.001.23 SIN_1007695 AT2G19070 0 540 SHT 7.68 13.911.03 SIN_1013713 AT3G27730 0 1274 ROCK-N-ROLLERS/AtMER3 1.57 0.740.15 SIN_1020712 AT4G29250 2E-141 416 acyl-transferase family protein 4.40 3.454.02...”
- Identification of tapetum-specific genes by comparing global gene expression of four different male sterile lines in Brassica oleracea
Ma, Plant molecular biology 2015 - “...0.969 A AT2G38240 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein 3.035 1.621 1.630 0.377 A AT2G42940 Predicted AT-hook DNA-binding family protein 36.341 0.336 0.086 2.476 A AT2G45630 d -isomer specific 2-hydroxyacid dehydrogenase family protein 3.502 1.118 1.133 1.450 A AT3G05780 LON3 lon protease 3 3.075 0.311...”
- The tapetal AHL family protein TEK determines nexine formation in the pollen wall
Lou, Nature communications 2014 - “...was isolated in a collection of T-DNA-tagged lines 30 . The T-DNA is inserted in At2g42940 (see below), which was previously designated as TRANSPOSABLE ELEMENT SILENCING VIA AT-HOOK ( TEK ). Knockdown of TEK led to late flowering 31 . Here we focus on the mechanism...”
- “...of the TAILPCR product showed that the T-DNA was inserted in the only exon of At2g42940, which completely abolished the expression of At2g42940 ( Fig. 3b ). For genetic complementation, we cloned the 2,277-bp genomic region, including the promoter and 3-untranslated region of At2g42940 from wild...”
- Prediction of components of the sporopollenin synthesis pathway in peach by genomic and expression analyses
Ríos, BMC genomics 2013 - “...BURP domain protein 4 PpB89 Glycine-rich protein 3 PpB88 3 PpB71 DNA-binding protein (AT-hook) 3 At2g42940 [ 28 ] ppa025857m Protease inhibitor/seed storage/LTP 3 PpB79 Cupin 3 ppa014645m Carboxyl-terminal peptidase 3 ppa009110m Chlorophyll A-B binding protein 3 ppa008777m Cinnamoyl-CoA reductase 3 TKPR2/CCRL6 [ 11 ] ppa005633m...”
- “...late tapetum development and pollen wall biosynthesis [ 15 , 16 , 18 ]. Interestingly, At2g42940 gene, coding for an AT-hook DNA-binding protein highly similar to peach PpB71, was found specifically expressed in the wild-type tapetum after meiosis, and unexpectedly up-regulated in the ms1 mutant [...”
- The bZIP Transcription Factor PERIANTHIA: A Multifunctional Hub for Meristem Control
Maier, Frontiers in plant science 2011 - “...[ Vitis vinifera ] (GB:CAO70018.1); contains InterPro domain Plant Basic Secretory Protein (InterPro:IPR007541) 265263_at 0.56 AT2G42940 DNA-binding family protein 266814_at 0.38 AT2G44910 Homeobox-leucine zipper protein 4 (HB-4)/HD-ZIP protein 4 258704_at 0.47 AT3G09780 Protein kinase family protein 256283_at 0.52 AT3G12540 Similar to unknown protein [ Arabidopsis thaliana...”
- Mitochondrially-targeted expression of a cytoplasmic male sterility-associated orf220 gene causes male sterility in Brassica juncea
Yang, BMC plant biology 2010 - “...an alcohol dehydrogenase (At3g42960) were also down-regulated in transgenic stem mustard, as were some genes (At2g42940, At1g76470, At3g07450, At1g20370, At4g30470 and At4g34850) that have been reported to be associated with pollen development. All of the down-regulated genes detected in transgenic plants are listed in supplementary data...”
- “...expressed genes in transgenic stem mustard observed in this study Gene ID Gene Description Fold At2g42940 DNA-binding family protein 2.5 At2g42840 protodermal factor 1 (PDF1) 4.6 At1g75940 glycosyl hydrolase family 1 protein/anther-specific protein ATA27 2.09 At1g01280 cytochrome P450 family protein 3.59 At1g76470 cinnamoyl-CoA reductase family 3.41...”
- The ASH1 HOMOLOG 2 (ASHH2) histone H3 methyltransferase is required for ovule and anther development in Arabidopsis
Grini, PloS one 2009 - “...PLoS 2 (7): e117 (2006) buds 0.72 1.65 At2g42660 MYB TF - pollen 1.11 2.15 At2g42940 AHL16 Fujimoto et al., Plant Mol Biol 56: 225239 (2004) flower 1.23 2.35 At2g46020 BRM Hurtado et al., Plant Mol Biol 62: 291304 (2006) n.t. 0.99 1.98 At2g46770 NST1 Mitsuda...”
- More
- The temporal regulation of TEK contributes to pollen wall exine patterning.
Xiong, PLoS genetics 2020 - GeneRIF: Results showed that the correct regulation of timing of TEK expression is required for pollen wall exine patterning and is coordinated with other pollen developmental events for the processes of pollen wall formation and pollen grain maturation.
- The AT-hook/PPC domain protein TEK negatively regulates floral repressors including MAF4 and MAF5.
Xu, Plant signaling & behavior 2013 - GeneRIF: MADS AFFECTING FLOWERING 4 (MAF4) and MAF5 are upregulated in TEK knockdown plants. TEK negatively regulates floral repressors including MAF4 and MAF5. [TEK]
AHL22_ARATH / O22130 AT-hook motif nuclear-localized protein 22 from Arabidopsis thaliana (Mouse-ear cress) (see 3 papers)
AT2G45430 DNA-binding protein-related from Arabidopsis thaliana
NP_182067 AT-hook motif nuclear-localized protein 22 from Arabidopsis thaliana
Aligns to 117:234 / 317 (37.2%), covers 97.4% of PF03479, 80.4 bits
- function: Transcription factor that specifically binds AT-rich DNA sequences related to the nuclear matrix attachment regions (MARs). Binds an AT-rich DNA sequences in the FLOWERING LOCUS T (FT) promoter (PubMed:22442143). Acts redundantly with AHL18, AHL27 and AHL29 in the regulation of flowering and regulation of the hypocotyl elongation. Plays a role in both photo- and skotomorphogenesis (PubMed:19517252). Acts as a chromatin remodeling factor that modifies the architecture of FLOWERING LOCUS T (FT) chromatin by modulating both H3 acetylation and methylation leading to the regulation of FT expression during flowering induction (PubMed:22442143).
subunit: Homodimer. Interacts with HDA1/HDA19, HDA6 and HDA9.
disruption phenotype: Slightly longer hypocotyls. - Chromatin attachment to the nuclear matrix represses hypocotyl elongation in Arabidopsis thaliana
Xu, Nature communications 2024 - “...% coverage (rep 2) No. of protein sequences (rep 2) Protein Score (rep 2) AHL22 AT2G45430 12 3 241 21.5 5 298 AHL15 AT3G55560 49 10 934 52.3 11 1223 AHL17 AT5G49700 44.2 6 476 20.7 4 331 AHL13 AT4G17950 18.7 5 358 21.2 5 305...”
- “...of transgenic plants The full-length coding sequences (CDS) with or without stop codon of AHL22 (AT2G45430), HDA15 (AT3G18520), FRS7 (AT3G06250), FRS12 (AT5G18960), and H3.3 (AT4G40030), were cloned into TSK108, pDonar201 or pENTR/D (Invitrogen) entry vectors. For AHL22 overexpression lines (35S::AHL22), the constructs were recombined into a...”
- Dissection of Functional Modules of AT-HOOK MOTIF NUCLEAR LOCALIZED PROTEIN 4 in the Development of the Root Xylem
Seo, Frontiers in plant science 2021 - “...), AHL19 ( AT3G04570 ), AHL20 ( AT4G14465 ), AHL21 ( AT2G35270 ), AHL22 ( AT2G45430 ), AHL23 ( AT4G17800 ), AHL27 ( AT1G20900 ), and AHL29 ( AT1G76500 ). Author Contributions J-YL and MS: conceptualization, validation, investigation, resources, writingoriginal draft, and writingreview and editing. MS:...”
- The pip1s Quintuple Mutants Demonstrate the Essential Roles of PIP1s in the Plant Growth and Development of Arabidopsis
Wang, International journal of molecular sciences 2021 - “...1.700 0.006492 AT5G59570 BOA UDPGT GO:0009909|regulation of flower development 1055 112 3.351 4.67 10 202 AT2G45430 AHL22 DUF296 GO:0009908|flower development 79 174 1.024 1.07 10 7 AT1G77950 AGL67 SRF-TF GO:0009555|pollen development; GO:0010152|pollen maturation; GO:0080092|regulation of pollen tube growth 60 7 3.214 9.68 10 13 AT2G01200 IAA32...”
- Transcriptome and epigenome analyses of vernalization in Arabidopsis thaliana
Xi, The Plant journal : for cell and molecular biology 2020 - “...course of vernalization. Locus Name Protein domain Reported function AT1G51860 - LRR, protein kinase - AT2G45430 AHL22 AT-hook DNA-binding regulation of flowering AT2G35270 AHL21 AT-hook DNA-binding patterning and differentiation of reproductive organs AT4G37390 AUR3 GH3 auxin-responsive negative component in auxin signaling AT5G06800 - Myb-like DNA-binding -...”
- Overexpression of a Novel Arabidopsis Gene SUPA Leads to Various Morphological and Abiotic Stress Tolerance Alternations in Arabidopsis and Poplar
Cai, Frontiers in plant science 2020 - “...and overexpression of MAF4 leads to delayed flowering ( Ratcliffe et al., 2003 ). AHL22 (At2g45430) which encodes a nuclear localized AT-hook domain containing protein binds to an AT-rich sequence stretches in the FT locus ( Yun et al., 2012 ). Overexpression of AHL22 leads to...”
- The AT-hook motif-containing protein AHL22 regulates flowering initiation by modifying FLOWERING LOCUS T chromatin in Arabidopsis
Yun, The Journal of biological chemistry 2012 - “...University of California, Berkeley on February 8, 2017 At2g45430 locus in the mutant (Fig. 1B). Genomic Southern blot hybridization confirmed that there was a...”
- “...Fig. S2A). Gene expression assays showed that the At2g45430 gene was activated significantly in the mutant (supplemental Fig. S2B), suggesting that activation...”
- Function annotation of an SBP-box gene in Arabidopsis based on analysis of co-expression networks and promoters
Wang, International journal of molecular sciences 2009 - “...AT5G60910 FUL AT3G06220 DNA binding / transcription factor AT2G42200 SPL9 AT5G45960 GDSL-motif lipase/hydrolase family protein AT2G45430 DNA-binding protein-related AT4G21650 subtilase family protein UCC2__UCC2 (UCLACYANIN 2); copper AT3G04570 DNA-binding protein-related AT2G44790 ion binding AT4G32650 ARABIDOPSIS THALIANA K+ RECTIFYING CHANNEL 1 AT3G28500 60S acidic ribosomal protein P2 (RPP2C)...”
- The AT-hook motif-containing protein AHL22 regulates flowering initiation by modifying FLOWERING LOCUS T chromatin in Arabidopsis.
Yun, The Journal of biological chemistry 2012 - GeneRIF: Data suggest that AHL22 acts as a chromatin remodeling factor that modifies the architecture of FLOWERING LOCUS T (FT) chromatin by modulating both H3 acetylation and methylation.
AHL14_ARATH / A1L4X7 AT-hook motif nuclear-localized protein 14 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
Aligns to 172:285 / 411 (27.7%), covers 98.3% of PF03479, 80.4 bits
- function: Transcription factor that specifically binds AT-rich DNA sequences related to the nuclear matrix attachment regions (MARs).
LOC108212236 AT-hook motif nuclear-localized protein 10-like from Daucus carota subsp. sativus
Aligns to 53:168 / 216 (53.7%), covers 98.3% of PF03479, 80.3 bits
AHL26_ARATH / Q9SZ70 AT-hook motif nuclear-localized protein 26 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
AT4G12050 DNA-binding protein-related from Arabidopsis thaliana
Aligns to 146:260 / 339 (33.9%), covers 99.1% of PF03479, 80.2 bits
- function: Transcription factor that specifically binds AT-rich DNA sequences related to the nuclear matrix attachment regions (MARs).
- Mediator of tolerance to abiotic stress ERF6 regulates susceptibility of Arabidopsis to Meloidogyne incognita
Warmerdam, Molecular plant pathology 2019 - “...At3G56750, At3G56760, At3G770 12 4 7211220 C:T 104:245 4.2 4.15 At4G12030 At4G12010, At4G12020, At4G12030, At4G12040, At4G12050 13 4 9765013 C:T 133:216 4 3.83 At4G17505 At4G17490, At4G17500, At4G17505, At4G17510, At4G17520, At4G17530 14 4 9843096 C:T 96:253 4.1 4.30 At4G17680 At4G17660, At4G17670, At4G17670, At4G17680, At4G17690, At4G17695 15 4...”
LOC108209748 AT-hook motif nuclear-localized protein 5-like from Daucus carota subsp. sativus
Aligns to 161:276 / 345 (33.6%), covers 97.4% of PF03479, 80.1 bits
- Characteristics of the AT-Hook Motif Containing Nuclear Localized (AHL) Genes in Carrot Provides Insight into Their Role in Plant Growth and Storage Root Development
Machaj, Genes 2021 - “...XP_017234499.1 chr2 DcAHL37 LOC108194210 XP_017216623.1 chr7 DcAHL15 LOC108206866 XP_017232780.1 chr2 DcAHL38 LOC108193220 XP_017215280.1 chr7 DcAHL16/ LOC108209748 XP_017236315.1 chr2 DcAHL39 LOC108195339 XP_017217789.1 chr7 DcAHLc1 DcAHL40 LOC108196714 XP_017219609.1 chr7 DcAHL17 LOC108208096 XP_017234068.1 chr2 DcAHL41 LOC108197690 XP_017220869.1 chr8 DcAHL18 LOC108206857 XP_017232768.1 chr2 DcAHL42 LOC108201885 XP_017225711.1 chr9 DcAHL19 LOC108210904 XP_017237852.1...”
- “...differentially expressed in the carrot storage roots. Gene Name GeneID Cluster Betweenness Degree Rank_stat DcAHL16//DcAHLc1 LOC108209748 1 632.31 62 2695.25 DcAHL11 LOC108210006 1 757.12 51 2626.50 DcAHL40 LOC108196714 1 3490.89 46 3168.00 DcAHL46 LOC108200218 1 1361.78 41 2700.25 DcAHL32 LOC108225124 1 5.90 12 1268.00 DcAHL2 LOC108205011...”
- Comparative Transcriptomics of Root Development in Wild and Cultivated Carrots
Machaj, Genes 2018 - “...expression (log2FCh = 3.3 and 1.689) in two comparisons (cDEG.1.3 and cDEG.2.3, respectively). Also, AHL5-like (LOC108209748) was found among differentially expressed AHLs. Previously, it has been proposed as a candidate domestication gene in carrot ( DcAHLc1 ), likely involved in the storage root development [ 6...”
LOC108197227 LOW QUALITY PROTEIN: AT-hook motif nuclear-localized protein 24 from Daucus carota subsp. sativus
Aligns to 98:211 / 283 (40.3%), covers 99.1% of PF03479, 80.1 bits
LOC108224586 AT-hook motif nuclear-localized protein 16-like from Daucus carota subsp. sativus
Aligns to 66:176 / 246 (45.1%), covers 99.1% of PF03479, 80.0 bits
AHL6_ARATH / Q9LVB0 AT-hook motif nuclear-localized protein 6 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
AT5G62260 DNA binding from Arabidopsis thaliana
Aligns to 161:277 / 404 (29.0%), covers 97.4% of PF03479, 79.7 bits
- function: Transcription factor that specifically binds AT-rich DNA sequences related to the nuclear matrix attachment regions (MARs).
- Dissection of Functional Modules of AT-HOOK MOTIF NUCLEAR LOCALIZED PROTEIN 4 in the Development of the Root Xylem
Seo, Frontiers in plant science 2021 - “...), AHL2 ( AT4G22770 ), AHL3 ( AT4G25320 ), AHL4 ( AT5G51590 ), AHL6 ( AT5G62260 ), AHL7 ( AT4G00200 ), AHL15 ( AT3G55560 ), AHL16 ( AT2G42940 ), AHL17 ( AT5G49700 ), AHL19 ( AT3G04570 ), AHL20 ( AT4G14465 ), AHL21 ( AT2G35270 ), AHL22...”
- Development of iFOX-hunting as a functional genomic tool and demonstration of its use to identify early senescence-related genes in the polyploid Brassica napus
Ling, Plant biotechnology journal 2018 - “...86% Early leaf senescence rsl1375 AT1G20693 High mobility group B2 87% Early leaf senescence rsl1436 AT5G62260 AT hook motif DNAbinding family protein 77% Early leaf senescence rsl1472 AT1G04270 Cytosolic ribosomal protein S15 93% Pale silique rsl1479 AT1G33680 KH domaincontaining protein 70% Early leaf senescence rsl1512 AT5G56500...”
- Disruption of Rpp1-mediated soybean rust immunity by virus-induced gene silencing
Cooper, Plant signaling & behavior 2013 - “...No No Not tested Glyma16 g32940 M DUF296 superfamily AT5G62260 (7e-56) Unknown Yes Yes Yes Glyma17 g04670 N None identified AT1G09520 (3e-10) TF No No No...”
AHL23_ARATH / O23620 AT-hook motif nuclear-localized protein 23 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
AT4G17800 DNA-binding protein-related from Arabidopsis thaliana
Aligns to 110:223 / 292 (39.0%), covers 99.1% of PF03479, 79.5 bits
- function: Transcription factor that specifically binds AT-rich DNA sequences related to the nuclear matrix attachment regions (MARs).
- Genome-wide dissection of AT-hook motif nuclear-localized gene family and their expression profiling for drought and salt stress in rice (Oryza sativa)
Ambadas, Frontiers in plant science 2023 - “...of OsAHL proteins with diverse proteins such as AT4G22810 (AHL24), AHL20, GAINT KILLER (GIK), AHL22, AT4G17800 (AHL23), AT4G17760, and AT4G17440 are depicted in Figure11 . The protein AT4G17800 exhibits the highest number of nodes and is shared in its interactions with most other proteins. Further, the...”
- “...Kumar etal. (2023) showed expression of OsAHL20 under salinity conditions and reported enhanced expression of AT4G17800 (AHL23) and AT4G22810 (AHL24) in leaves and roots, indicating their potential involvement in the plants response to drought stress. Another study suggested the overexpression of Arabidopsis ATHG1/AHL23 and ATPG3/AHL20 genes...”
- Coregulation of glutamine synthetase1;2 (GLN1;2) and NADH-dependent glutamate synthase (GLT1) gene expression in Arabidopsis roots in response to ammonium supply
Kojima, Frontiers in plant science 2023 - “...AT1G14490 AHL28 12 AT4G35390 AHL25 13 AT3G55560 AHL15 19 AT1G76880 DF1 11 AT3G55560 AHL15 15 AT4G17800 AHL23 17 AT5G24520 TTG1 18 AT1G14490 AHL28 20 AT1G20900 AHL27 21 unknown IV 22 AT5G25160 ZFP3 23 AT1G14490 AHL28 24 AT4G17800 AHL23 26 ST1G76880 DF1 27 AT3G55580 AHL15 28 AT3G04570...”
- Dissection of Functional Modules of AT-HOOK MOTIF NUCLEAR LOCALIZED PROTEIN 4 in the Development of the Root Xylem
Seo, Frontiers in plant science 2021 - “...), AHL20 ( AT4G14465 ), AHL21 ( AT2G35270 ), AHL22 ( AT2G45430 ), AHL23 ( AT4G17800 ), AHL27 ( AT1G20900 ), and AHL29 ( AT1G76500 ). Author Contributions J-YL and MS: conceptualization, validation, investigation, resources, writingoriginal draft, and writingreview and editing. MS: methodology, software, formal analysis,...”
- Use of transcriptomics and co-expression networks to analyze the interconnections between nitrogen assimilation and photorespiratory metabolism
Pérez-Delgado, Journal of experimental botany 2016 - “...Number of connections Gene (Kazusa 3.0 ) Ortholog gene in Arabidopsis Ljwgs_121486.1_at Unknown 31 Lj2g3v1984810.1 At4g17800 Ljwgs_035337.1_at* Trihelix 31 Lj0g3v0261399.1 At5g63420 Ljwgs_142668.1_at* mTERF 30 Lj2g3v2197630.1 At4g02990 chr2.CM0132.46_at bHLH 23 Lj2g3v1984450.1 At4g37850 Ljwgs_149102.1_s_at Unknown 17 Lj4g3v3015070.1 At4g12750 chr5.CM0048.61_at bHLH 17 Lj5g3v1533330.1 At1g09530 Ljwgs_015129.1_at* bHLH 16 Lj3g3v0028580.1 At2g22770...”
- Conserved microstructure of the Brassica B Genome of Brassica nigra in relation to homologous regions of Arabidopsis thaliana, B. rapa and B. oleracea
Navabi, BMC genomics 2013 - “...10 3 3.3 At4g17730 DL 4900 67 1 67 At4g17760 DL 4915 19 2 9.5 At4g17800 DL 4935 85 3 28.3 Contigs of overlapping BAC clones were assembled based on common digestion patterns observed for two or more genes. In addition, all 483 BAC clones were...”
- “...the presence or absence of eight genes (At4g17260, At4g17300, At4g17380, At4g17440, At4g17650, At4g17750, At4g17760, and At4g17800) that are present in the chromosome 4 region, but not in the chromosome 5 region [ 29 , 44 ]. At this macro-level the only apparent major difference between the...”
- Expression profiling of tomato pre-abscission pedicels provides insights into abscission zone properties including competence to respond to abscission signals
Nakano, BMC plant biology 2013 - “...TA54084_4081 AT3G23240 ERF1 (ETHYLENE RESPONSE FACTOR 1) 4.9 0.014 2.3 0.019 Solyc01g080960 a A_96_P017531 AK330067 AT4G17800 DNA-binding protein-related | Predicted AT-hook DNA-binding family protein 4.7 0.014 4.1 0.009 Solyc08g076010 A_96_P172039 BE431711 AT5G45580 transcription factor | Homeodomain-like superfamily protein 3.6 0.017 3.1 0.011 Solyc02g085500 a A_96_P013166 OVATE...”
- Expression Cassettes For Root-Preferential Expression In Plants
KEETMAN, 2010 - AGAMOUS controls GIANT KILLER, a multifunctional chromatin modifier in reproductive organ patterning and differentiation
Ng, PLoS biology 2009 - “...[32] , [33] , we produced an RNAi silencing construct for the highly similar gene At4g17800 (67% amino acid identity) and created the transgenic plants on the gik mutant background. However, we did not observe any obvious enhanced effects in the transgenic plants (unpublished data). The...”
- “...showed reproductive defects. To generate the 35S::GIK2-RNAi construct, an N-terminal fragment of the GIK2 ( AT4g17800 ; 39260 bp) coding region was amplified using UltraPfu-High-Fidelity DNA polymerase to produce BamHI-GIK2-Nter-ClaI and XhoI-GIK2-Nter-KpnI fragments. These fragments were cloned into the pKANNIBAL vector and later into the pMLBART...”
- More
G7JGG2 AT-hook motif nuclear-localized protein from Medicago truncatula
Aligns to 104:217 / 296 (38.5%), covers 99.1% of PF03479, 79.5 bits
- Widely conserved AHL transcription factors are essential for NCR gene expression and nodule development in Medicago
Zhang, Nature plants 2023 - “...ID UniProt ID Proteins interacting with 1,181 bp NCR169 promoter in Y1H screening MtAHL-1 Medtr4g098450 G7JGG2 Basic helixloophelix domain class transcription factor Medtr4g081370 B7FHK4 MYB-like transcription factor Medtr5g037080 G7K6Z9 TCP family transcription factor Medtr7g028160 G7L283 Transcription factor VOZ1-like protein Medtr4g088125 A0A072UMQ9 BEL1-related homeotic protein Medtr8g098815 A0A072TUA6...”
- “...M. truncatula proteins interacting with 382 bp NCR169 promoter in DNA pull-down assay MtAHL1 Medtr4g098450 G7JGG2 MtAHL2 Medtr7g080980 G7KSI4 MtPHD1 Medtr4g015830 A0A072UGM4 MtPHD2 Medtr1g015185 A0A072VDQ0 Myb protein Medtr7g020870 G7KSV7 Myb protein Medtr7g103390 A0A072U4N3 MtPur Medtr4g083230 G7JHJ7 Zinc finger protein Medtr1g053960 A0A072VIQ3 G. max proteins interacting with...”
LOC105121577 putative DNA-binding protein ESCAROLA from Populus euphratica
Aligns to 109:222 / 298 (38.3%), covers 99.1% of PF03479, 79.4 bits
- An eco-evo-devo genetic network model of stress response
Feng, Horticulture research 2022 - “...ribosomes, whose marked effect on salt resistance is due to strong up-regulation by S722 (at LOC105121577 encoding protein transport) as a positive regulator ( Fig. S4 ). This result suggests that, to precisely implement Q3147 into the improvement of salt resistance, marker-assisted selection or gene editing...”
AHL8_ARATH / Q9FIR1 AT-hook motif nuclear-localized protein 8 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
Aligns to 181:297 / 386 (30.3%), covers 98.3% of PF03479, 78.9 bits
- function: Transcription factor that specifically binds AT-rich DNA sequences related to the nuclear matrix attachment regions (MARs).
AHL5_ARATH / Q8GXB3 AT-hook motif nuclear-localized protein 5 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
AT1G63470 DNA-binding family protein from Arabidopsis thaliana
Aligns to 178:293 / 378 (30.7%), covers 97.4% of PF03479, 77.4 bits
LOC104718987 AT-hook motif nuclear-localized protein 20 from Camelina sativa
Aligns to 95:208 / 283 (40.3%), covers 99.1% of PF03479, 77.3 bits
GRMZM2G119168 DNA-binding protein from Zea mays
Aligns to 82:197 / 273 (42.5%), covers 98.3% of PF03479, 77.0 bits
- Transcriptional analyses of natural leaf senescence in maize
Zhang, PloS one 2014 - “...[83] GRMZM2G088212 AT1G20620 Catalase 3(CAT3), SENESCENCE 2 Induced by age and senescence [84] , [85] GRMZM2G119168 AT1G20900 AHL27, AT-HOOK MOTIF NUCLEAR-LOCALIZED PROTEIN 27 Delayed leaf senescence [86] GRMZM2G047404 AT1G61800 GLUCOSE-6-PHOSPHATE/PHOSPHATE TRANSLOCATOR 2 (GPT2) Senescence associated gene [41] , [87] AC207347.3_FG005 AT1G73220 ORGANIC CATION/CARNITINE TRANSPORTER1 (OCT1) Strong...”
LOC108210006 AT-hook motif nuclear-localized protein 5-like from Daucus carota subsp. sativus
Aligns to 163:279 / 347 (33.7%), covers 97.4% of PF03479, 77.0 bits
- Characteristics of the AT-Hook Motif Containing Nuclear Localized (AHL) Genes in Carrot Provides Insight into Their Role in Plant Growth and Storage Root Development
Machaj, Genes 2021 - “...XP_017233497.1 chr2 DcAHL32 LOC108225124 XP_017255428.1 chr6 DcAHL10 LOC108207579 XP_017233502.1 chr2 DcAHL33 LOC108224386 XP_017254467.1 chr6 DcAHL11 LOC108210006 XP_017236725.1 chr2 DcAHL34 LOC108224931 XP_017255185.1 chr6 DcAHL12 LOC108208112 XP_017234087.1 chr2 DcAHL35 LOC108226353 XP_017256784.1 chr6 DcAHL13 LOC108206084 XP_017231753.1 chr2 DcAHL36 LOC108226375 XP_017256806.1 chr6 DcAHL14 LOC108208477 XP_017234499.1 chr2 DcAHL37 LOC108194210 XP_017216623.1 chr7...”
- “...roots. Gene Name GeneID Cluster Betweenness Degree Rank_stat DcAHL16//DcAHLc1 LOC108209748 1 632.31 62 2695.25 DcAHL11 LOC108210006 1 757.12 51 2626.50 DcAHL40 LOC108196714 1 3490.89 46 3168.00 DcAHL46 LOC108200218 1 1361.78 41 2700.25 DcAHL32 LOC108225124 1 5.90 12 1268.00 DcAHL2 LOC108205011 1 1.70 6 951.75 DcAHL29 LOC108220764...”
LOC108220764 AT-hook motif nuclear-localized protein 9-like from Daucus carota subsp. sativus
Aligns to 140:255 / 349 (33.2%), covers 97.4% of PF03479, 77.0 bits
- Characteristics of the AT-Hook Motif Containing Nuclear Localized (AHL) Genes in Carrot Provides Insight into Their Role in Plant Growth and Storage Root Development
Machaj, Genes 2021 - “...XP_017248716.1 chr5 DcAHL5 LOC108215664 XP_017243692.1 chr1 DcAHL28 LOC108221500 XP_017250863.1 chr5 DcAHL6 LOC108197834 XP_017221076.1 chr1 DcAHL29 LOC108220764 XP_017250109.1 chr5 DcAHL7 LOC108207567 XP_017233492.1 chr2 DcAHL30 LOC108224107 XP_017254151.1 chr5 DcAHL8 LOC108207571 XP_017233496.1 chr2 DcAHL31 LOC108224586 XP_017254744.1 chr6 DcAHL9 LOC108207572 XP_017233497.1 chr2 DcAHL32 LOC108225124 XP_017255428.1 chr6 DcAHL10 LOC108207579 XP_017233502.1 chr2...”
- “...41 2700.25 DcAHL32 LOC108225124 1 5.90 12 1268.00 DcAHL2 LOC108205011 1 1.70 6 951.75 DcAHL29 LOC108220764 1 9.82 6 1076.25 DcAHL1 LOC108209315 1 0.66 4 788.75 DcAHL10 LOC108207579 1 0.00 1 237.00 DcAHL38 LOC108193220 2 16,399.50 825 6140.50 DcAHL26 LOC108216162 2 6491.57 566 5180.00 DcAHL13 LOC108206084...”
AHL20_ARATH / Q8GWQ2 AT-hook motif nuclear-localized protein 20 from Arabidopsis thaliana (Mouse-ear cress) (see 2 papers)
NP_567432 AT-hook motif nuclear-localized protein 20 from Arabidopsis thaliana
AT4G14465 DNA-binding protein-related from Arabidopsis thaliana
Aligns to 95:208 / 281 (40.6%), covers 99.1% of PF03479, 77.0 bits
- function: Transcription factor that specifically binds AT-rich DNA sequences related to the nuclear matrix attachment regions (MARs) (By similarity). Negatively regulates plant innate immunity (PTI) to pathogens through the down-regulation of the PAMP-triggered NHO1 and FRK1 expression (PubMed:20738724).
- Overexpression of AtAHL20 causes delayed flowering in Arabidopsis via repression of FT expression.
Tayengwa, BMC plant biology 2020 - GeneRIF: Overexpression of AtAHL20 causes delayed flowering in Arabidopsis via repression of FT expression.
- Dissection of Functional Modules of AT-HOOK MOTIF NUCLEAR LOCALIZED PROTEIN 4 in the Development of the Root Xylem
Seo, Frontiers in plant science 2021 - “...), AHL16 ( AT2G42940 ), AHL17 ( AT5G49700 ), AHL19 ( AT3G04570 ), AHL20 ( AT4G14465 ), AHL21 ( AT2G35270 ), AHL22 ( AT2G45430 ), AHL23 ( AT4G17800 ), AHL27 ( AT1G20900 ), and AHL29 ( AT1G76500 ). Author Contributions J-YL and MS: conceptualization, validation, investigation,...”
- An Arabidopsis AT-hook motif nuclear protein mediates somatic embryogenesis and coinciding genome duplication
Karami, Nature communications 2021 - “.... To generate the other overexpression constructs, the full-length cDNA clones of AHL19 (At3g04570), AHL20 (At4g14465), and AHL29 (At1g76500) from Arabidopsis Col-0 were used to amplify the open reading frames (ORFs) using primers indicated in Supplementary Table 1 . The ORFs were cloned into plasmid pJET1/blunt...”
- Molecular Targets and Biological Functions of cAMP Signaling in Arabidopsis
Xu, Biomolecules 2021 - “...(bHLH), AT5G11060 (TALE), AT1G46480 (WOX), AT3G10590 (MYB-related), AT5G66350 (SRS), AT2G17040 (NAC), AT3G21150 (C2C2 $ ), AT4G14465 (AT-hook $ ) AT1G22810 (ERF), AT1G43160 (ERF), AT1G72360 (ERF), AT4G06746 (ERF), AT4G32800 (ERF), AT5G25810 (ERF), AT5G53290 (ERF), AT5G64750 (ERF),AT5G67190 (ERF), AT1G12540 (bHLH), AT1G18400 (bHLH), AT1G62975 (bHLH), AT1G73830 (bHLH), AT2G22770 (bHLH),...”
- Overexpression of AtAHL20 causes delayed flowering in Arabidopsis via repression of FT expression
Tayengwa, BMC plant biology 2020 - “...(LOC104718987) coding sequence was extracted from the NCBI database after a BLAST search using AtAHL20 (AT4G14465) sequence as a query. Primers (Table 2 ) were designed from the extracted sequence and were used to amplify CsAHL20s coding sequence. The amplified PCR product was cloned into pDONR221...”
- The Trithorax Group Factor ULTRAPETALA1 Regulates Developmental as Well as Biotic and Abiotic Stress Response Genes in Arabidopsis
Tyler, G3 (Bethesda, Md.) 2019 - “...0.90 6.42E-04 Homeobox HD-Zip I At3g01220 ATHB20 1.09 6.68E-06 BEL At1g19700 BEL10 0.65 0.000809994 AT-hook At4g14465 AHL20 0.89 3.69E-04 bZIP At1g06850 bZIP52 0.88 1.83E-04 bHLH At3g19860 bHLH121 1.01 1.17E-04 C2H2 At1g27730 STZ, ZAT10 1.67 7.16E-04 DOF At1g69570 CDF5 0.86 5.95E-05 HSF At3g24520 HSFC1 1.35 0.00101 LBD...”
- Engineering d-limonene synthase down-regulation in orange fruit induces resistance against the fungus Phyllosticta citricarpa through enhanced accumulation of monoterpene alcohols and activation of defence
Rodríguez, Molecular plant pathology 2018 (secret) - Identification of miRNAs and Their Targets in the Liverwort Marchantia polymorpha by Integrating RNA-Seq and Degradome Analyses
Lin, Plant & cell physiology 2016 - “...novel miRNAs Target ID Target name Homolog AGI/EMBL Function miRNA Precursor ID LW4492 NA a AT4G14465 AT-hook motif nuclear-localized 20 Mpo-miR11685.1 LW2962 LW14289 Mp MADS2 EDQ77973 MIKC C MADS domain Mpo-miR11681.1 LW11075 LW7948 NA AT5G50840 NA LW6190 NA EFJ17613 NA LW8165 NA AT3G27820 Peroxisome membrane-bound monodehydroascorbate...”
AHL9_ARATH / O80834 AT-hook motif nuclear-localized protein 9 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
AT2G45850 DNA-binding family protein from Arabidopsis thaliana
Aligns to 163:279 / 348 (33.6%), covers 97.4% of PF03479, 76.9 bits
- function: Transcription factor that specifically binds AT-rich DNA sequences related to the nuclear matrix attachment regions (MARs).
- Overexpression of AHL9 accelerates leaf senescence in Arabidopsis thaliana
Zhou, BMC plant biology 2022 - “...Arabidopsis Genome Initiative identifiers for the genes described in this article are as follows: AHL9 (At2g45850), AHL11 (At3g61310), LOX1 (AT1G55020), IAA1 (AT4G14560), UBQ10 (AT4G05320), ACO2 (AT1G62380), NAC079 (AT5G07680), anac048 (AT3G04420), ERF039 (AT4G16750), PCAP2 (AT5G44610), SAUR72 (AT3G12830), LTP4 (AT5G59310), UGT85A1 (AT1G22400), PAO4 (AT1G65840), WRKY63 (AT1G66600), EBF2 (AT5G25350),...”
- Intrusive Growth of Phloem Fibers in Flax Stem: Integrated Analysis of miRNA and mRNA Expression Profiles
Gorshkov, Plants (Basel, Switzerland) 2019 - “...inflorescence meristem receptor-like kinase 2 3.04 3.50 10 12 2.87 8.73 10 11 a,c,d,e,f,g,h,i,j,k Lus10030381 AT2G45850 AT hook motif DNA-binding family protein 2.87 4.96 10 33 2.56 4.37 10 26 a,b,c,d,e,f,g,h,i,j,k Lus10027060 AT3G59680 2.67 4.26 10 4 3.39 4.96 10 6 a,b,c,d,e,f,g,h,i,j,k Lus10023357 AT2G34710 HB14,PHB Homeobox-leucine...”
AHL15_ARATH / Q9M2S3 AT-hook motif nuclear-localized protein 15; AT-hook protein of GA feedback 2 from Arabidopsis thaliana (Mouse-ear cress) (see 3 papers)
AT3G55560 AGF2 (AT-hook protein of GA feedback 2) from Arabidopsis thaliana
NP_191115 AT-hook protein of GA feedback 2 from Arabidopsis thaliana
Aligns to 116:230 / 310 (37.1%), covers 97.4% of PF03479, 75.9 bits
- function: Transcription factor that specifically binds AT-rich DNA sequences related to the nuclear matrix attachment regions (MARs) (By similarity). Binds the DNA sequence GNFEI (GA-negative feedback element I) in the GA3OX1 promoter (PubMed:17277098). Negatively regulates plant innate immunity (PTI) to pathogens through the down-regulation of the PAMP-triggered FRK1 expression (PubMed:20738724).
- Chromatin attachment to the nuclear matrix represses hypocotyl elongation in Arabidopsis thaliana
Xu, Nature communications 2024 - “...(rep 2) Protein Score (rep 2) AHL22 AT2G45430 12 3 241 21.5 5 298 AHL15 AT3G55560 49 10 934 52.3 11 1223 AHL17 AT5G49700 44.2 6 476 20.7 4 331 AHL13 AT4G17950 18.7 5 358 21.2 5 305 AHL19 AT3G04570 25.1 4 306 21 4 255...”
- Coregulation of glutamine synthetase1;2 (GLN1;2) and NADH-dependent glutamate synthase (GLT1) gene expression in Arabidopsis roots in response to ammonium supply
Kojima, Frontiers in plant science 2023 - “...AT4G00200 AHL7 3 AT1G14490 AHL28 4 AT1G76880 DF1 5 AT1G14490 AHL28 12 AT4G35390 AHL25 13 AT3G55560 AHL15 19 AT1G76880 DF1 11 AT3G55560 AHL15 15 AT4G17800 AHL23 17 AT5G24520 TTG1 18 AT1G14490 AHL28 20 AT1G20900 AHL27 21 unknown IV 22 AT5G25160 ZFP3 23 AT1G14490 AHL28 24 AT4G17800...”
- Dissection of Functional Modules of AT-HOOK MOTIF NUCLEAR LOCALIZED PROTEIN 4 in the Development of the Root Xylem
Seo, Frontiers in plant science 2021 - “...), AHL4 ( AT5G51590 ), AHL6 ( AT5G62260 ), AHL7 ( AT4G00200 ), AHL15 ( AT3G55560 ), AHL16 ( AT2G42940 ), AHL17 ( AT5G49700 ), AHL19 ( AT3G04570 ), AHL20 ( AT4G14465 ), AHL21 ( AT2G35270 ), AHL22 ( AT2G45430 ), AHL23 ( AT4G17800 ), AHL27...”
- An Arabidopsis AT-hook motif nuclear protein mediates somatic embryogenesis and coinciding genome duplication
Karami, Nature communications 2021 - “...and plant transformation The 35S:AHL15 construct was generated by PCR amplification of the full-length AHL15 (At3g55560) cDNA from ecotype Columbia (Col-0) using primers 35S:AHL15-F and 35S:AHL15-R (Supplementary Table 1 ). The resulting PCR product was cloned as a Sma I/ Bgl II fragment into the p35S:3OCS...”
- Transcriptional programs regulated by both LEAFY and APETALA1 at the time of flower formation
Winter, Physiologia plantarum 2015 - “...using gene annotations downloaded from TAIR on August 28, 2014. The genes AT5G24910, AT4G23060 and AT3G55560 were manually added to the GO term response to GA stimulus. P -values were adjusted for multiple testing using the BenjaminiHochberg method ( Benjamini and Hochberg 1995 ) implemented in...”
- Transcriptomic characterization of a synergistic genetic interaction during carpel margin meristem development in Arabidopsis thaliana
Wynn, PloS one 2011 - “...in the CMM or in CMM-derived tissues (e.g. ovules). These include AT1G02800 ( ATCEL2 ), AT3G55560 ( AGF2 ), AT5g57720 ( REM15 ) AT2g46870 ( NGA1 ), AT1G68640 ( PAN ), AT2G34710 ( PHB ), AT4G37750 ( ANT ), AT1G70560 ( TAA1 ), AT5G18000 ( VDD...”
- “...9.49 9.21 8.95 8.24 2.90 At3g13960 AtGRF5, transcriptional regulator + 9.21 9.30 8.25 7.84 1.61 At3g55560 AGF2, DNA-binding protein + 8.47 8.00 8.22 7.26 2.18 At4g00180 YABBY3 , transcription factor + 9.27 8.38 8.64 7.05 2.50 At4g37750 AINTEGUMENTA, DNA binding + 10.80 9.65 10.69 8.91 2.18...”
- Expression-based discovery of candidate ovule development regulators through transcriptional profiling of ovule mutants
Skinner, BMC plant biology 2009 - “...-4.78 -1.26 -2.59 (8) At1g68640 PAN bZIP family (floral organ nmber) -2.16 -1.17 1.31 (2) At3g55560 AGF2 DNA-binding At-hook family -2.69 -1.16 -1.54 (10) At4g24150 ATGRF8 growth-regulating factor family -2.70 -1.10 -1.13 (9) At1g76110 --- HMG1/2, ARID/BRIGHT DNA-binding domain -3.01 -1.20 -1.14 (4) At1g04880 --- HMG1/2,...”
- “...groups and provides important information for understanding gene function. In situ hybridizations were performed for At3g55560 ( AT-HOOK PROTEIN OF GA FEEDBACK 2 , AGF2 ), that encodes an At-hook DNA binding protein [ 102 ]. This gene showed a 2.7 fold decrease in ant relative...”
- A suppressor of axillary meristem maturation promotes longevity in flowering plants.
Karami, Nature plants 2020 (PubMed)- GeneRIF: A suppressor of axillary meristem maturation promotes longevity in flowering plants.
LOC101508336, XP_027189914 AT-hook motif nuclear-localized protein 14 from Cicer arietinum
Aligns to 103:216 / 322 (35.4%), covers 97.4% of PF03479, 75.8 bits
- Breeding and Genomics Interventions for Developing Ascochyta Blight Resistant Grain Legumes
Jha, International journal of molecular sciences 2022 - “...SNAKIN2 antimicrobial peptide, leucine-zipper protein [ 193 ] ICC3996, FLIP94-508C, ILWC245 RT-PCR, Microarray technology Chickpea LOC101508336 , LOC101508648 , LOC101508966 , LOC101509280 [ 142 ] FLIP8492C, PI359075 qRT-PCR Chickpea 6767 differentially expressed genes, 651 miRNAs, chitinases ( Ca_04405 ), CC-NBS-LRR ( Ca_08361 ), CC-NBS-LRR ( Ca_08122...”
- mQTL-seq and classical mapping implicates the role of an AT-HOOK MOTIF CONTAINING NUCLEAR LOCALIZED (AHL) family gene in Ascochyta blight resistance of chickpea.
Kumar, Plant, cell & environment 2018 (PubMed)- GeneRIF: CaAHL17 encoded by LOC101508336 gene interacts with CaAHL18 in plant cell nucleus and falls under the genetically identified qABR4.1 genomic region that is known to provide resistance/susceptibility against Ascochyta blight of chickpea.
AHL18_ARATH / Q9LZX7 AT-hook motif nuclear-localized protein 18 from Arabidopsis thaliana (Mouse-ear cress) (see 2 papers)
AT3G60870 DNA-binding protein-related from Arabidopsis thaliana
NP_191646 AT-hook motif nuclear-localized protein 18 from Arabidopsis thaliana
Aligns to 87:198 / 265 (42.3%), covers 98.3% of PF03479, 75.7 bits
- function: Transcription factor that specifically binds AT-rich DNA sequences related to the nuclear matrix attachment regions (MARs) (By similarity). Acts redundantly with AHL22, AHL27 and AHL29 in the regulation of flowering and regulation of the hypocotyl elongation (PubMed:19517252).
- Comparative RNA-Seq Analysis between Monoecious and Androecious Plants Reveals Regulatory Mechanisms Controlling Female Flowering in Cucurbita pepo
Segura, International journal of molecular sciences 2023 - “...protein RSI-1-like are also related to flowering transition in Arabidopsis. AT-hook motif nuclear-localized protein 22-like (AT3G60870) participates in flowering initiation by modifying FLOWERING LOCUS T chromatin [ 76 ]. RSI-1-like (AT3G09950) is allelic to FLOWERING LOCUS D that in turn represses FLOWERING LOCUS C , that...”
- “...0.00 100 50.00 AT5G43580 CpUPI 111779138 AT-hook motif nuclear-localized protein 22-like 4.97 0.00 100 52.38 AT3G60870 CpAHL22 111809214 protein RSI-1-like 6.24 0.00 72 63.89 AT3G09950 CpRSI1 Up-regulated DEGs are highlighted in green and down-regulated DEGs in red. Higher to lower intensities of color correspond to higher...”
- At-Hook Motif Nuclear Localised Protein 18 as a Novel Modulator of Root System Architecture
Širl, International journal of molecular sciences 2020 - “...activity. They modulate gene expression and affect various developmental processes in plants. We identify AHL18 (At3G60870) as a developmental modulator of root system architecture and growth. AHL18 is involved in regulation of the length of the proliferation domain and number of dividing cells in the root...”
- “...these correspond well with expression pattern of AHL18 . AT-hook motif nuclear protein 18 AHL18 At3G60870 Arabidopsis Lateral root development Root apical meristem Cell proliferation 1. Introduction The root system is essential for plant anchorage, water and nutrition acquisition, and mediating interactions with the soil environment...”
- At-Hook Motif Nuclear Localised Protein 18 as a Novel Modulator of Root System Architecture.
Širl, International journal of molecular sciences 2020 - GeneRIF: At-Hook Motif Nuclear Localised Protein 18 as a Novel Modulator of Root System Architecture.
XP_015641725 AT-hook motif nuclear-localized protein 18 from Oryza sativa Japonica Group
Aligns to 139:253 / 328 (35.1%), covers 98.3% of PF03479, 75.3 bits
AHL27_ARATH / Q9S7C9 AT-hook motif nuclear-localized protein 27; DNA-binding protein ESCAROLA; Protein ORESARA 7 from Arabidopsis thaliana (Mouse-ear cress) (see 6 papers)
NP_173514 Putative AT-hook DNA-binding family protein from Arabidopsis thaliana
AT1G20900 ESC (ESCAROLA); double-stranded DNA binding from Arabidopsis thaliana
Aligns to 114:236 / 311 (39.5%), covers 99.1% of PF03479, 75.2 bits
- function: Transcription factor that specifically binds AT-rich DNA sequences related to the nuclear matrix attachment regions (MARs) (PubMed:17971039, PubMed:19517252). Negatively regulates plant innate immunity (PTI) to pathogens through the down-regulation of the PAMP- triggered FRK1 expression (PubMed:20738724). Acts redundantly with AHL18, AHL22 and AHL29 in the regulation of flowering and regulation of the hypocotyl elongation (PubMed:19517252). Acts as a chromatin remodeling factor that negatively regulates the leaf senescence (PubMed:17971039). Acts redundantly with AHL29/SOB3 to modulate hypocotyl growth inhibition in response to light (PubMed:18088311).
subunit: Homodimer. Interacts with AHL12, AHL25, AHL29, TCP4, TCP13, EF114, ATAF2/NAC081, histone H2B.1, histone H3.3 and histone H4.
disruption phenotype: AHL27 and AHL29 double mutant exhibit a long hypocotyl phenotype in the light. - Coordination of matrix attachment and ATP-dependent chromatin remodeling regulate auxin biosynthesis and Arabidopsis hypocotyl elongation.
Lee, PloS one 2017 - GeneRIF: Data show that the light-inducible AHL proteins ESCAROLA (ESC)/AHL27 and SUPPRESSOR OF PHYTOCHROME B-4 #3 (SOB3)/AHL29 bind directly to an scaffold/matrix attachment regions (S/MARs) region of the YUCCA 9 (YUC9) promoter and suppress its expression to inhibit hypocotyl growth in light-grown seedlings.
- The AT-hook-containing proteins SOB3/AHL29 and ESC/AHL27 are negative modulators of hypocotyl growth in Arabidopsis.
Street, The Plant journal : for cell and molecular biology 2008 (PubMed)- GeneRIF: These data indicate that SOB3 and ESC act redundantly to modulate hypocotyl growth inhibition in response to light.
- Transcriptome Analysis of Calcium- and Hormone-Related Gene Expressions during Different Stages of Peanut Pod Development
Li, Frontiers in plant science 2017 - “...protein 2 Arabidopsis 0 comp45947 Q298L5 Mitochondrial Rho GTPase Sophophora 5.00 e - 87 comp42934 Q9S7C9 Putative DNA-binding protein ESCAROLA Arabidopsis 5.00 e - 6 Hormone Related Unigenes and Their Functional Categories Genes related to hormone response were screened out by GO analysis. There were 40...”
- Chromatin attachment to the nuclear matrix represses hypocotyl elongation in Arabidopsis thaliana
Xu, Nature communications 2024 - “...25.1 4 306 21 4 255 SPFH AT5G51570 27.7 5 231 19.5 4 273 AHL27 AT1G20900 19.6 3 221 19.6 3 197 AHL3 AT4G25320 15.3 4 215 16.3 4 297 AHL1 AT4G12080 29.2 4 199 39.3 8 425 AHL4 AT5G51590 14.8 3 121 6.9 2 90...”
- Coregulation of glutamine synthetase1;2 (GLN1;2) and NADH-dependent glutamate synthase (GLT1) gene expression in Arabidopsis roots in response to ammonium supply
Kojima, Frontiers in plant science 2023 - “...AT1G76880 DF1 11 AT3G55560 AHL15 15 AT4G17800 AHL23 17 AT5G24520 TTG1 18 AT1G14490 AHL28 20 AT1G20900 AHL27 21 unknown IV 22 AT5G25160 ZFP3 23 AT1G14490 AHL28 24 AT4G17800 AHL23 26 ST1G76880 DF1 27 AT3G55580 AHL15 28 AT3G04570 AHL19 29 AT1G94490 AHL28 31 AT5G65410 ZFHD2 32 AT3G13850...”
- Rapid Investigation of Functional Roles of Genes in Regulation of Leaf Senescence Using Arabidopsis Protoplasts
Doan, Frontiers in plant science 2022 - “...the transfection control. For the overexpression effectors, the full-length coding sequence of ORE1 (At5g39610), ORE7 (At1g20900), RAV1 (At1g13260), and RPK1 (At1g69270) was amplified using PCR from Arabidopsis cDNA pools with Pfu DNA polymerase and gene-specific primers ( Supplementary Table 1 ). Further, we subcloned the amplified...”
- Dissection of Functional Modules of AT-HOOK MOTIF NUCLEAR LOCALIZED PROTEIN 4 in the Development of the Root Xylem
Seo, Frontiers in plant science 2021 - “...), AHL21 ( AT2G35270 ), AHL22 ( AT2G45430 ), AHL23 ( AT4G17800 ), AHL27 ( AT1G20900 ), and AHL29 ( AT1G76500 ). Author Contributions J-YL and MS: conceptualization, validation, investigation, resources, writingoriginal draft, and writingreview and editing. MS: methodology, software, formal analysis, and visualization. J-YL: supervision,...”
- Lasting consequences of psyllid (Bactericera cockerelli L.) infestation on tomato defense, gene expression, and growth
Harrison, BMC plant biology 2021 - “...differentially affected by the pleiotropic cop/det/fus mutations." The Plant Cell 10.11 (1998): 1779-1790. Solyc04g082810.2 AHL27 AT1G20900 0.35 AT-hook motif nuclear-localized protein 27 Specifically binds AT-rich DNA sequences related to the nuclear matrix attachment regions; Negatively regulates plant innate immunity to pathogens through the down-regulation of PAMP-triggered...”
- “...gene of Arabidopsis encodes a developmental regulator." Genes & development 7.3 (1993): 367-379. Solyc04g082810.2 AHL27 AT1G20900 0.35 AT-hook motif nuclear-localized protein 27 Negatively regulates innate immunity to pathogens through the down-regulation of PAMP-triggered FRK1 expression; Regulates flowering and hypocotyl elongation; Chromatin remodeling factor that negatively regulates...”
- Transcriptional analyses of natural leaf senescence in maize
Zhang, PloS one 2014 - “...GRMZM2G088212 AT1G20620 Catalase 3(CAT3), SENESCENCE 2 Induced by age and senescence [84] , [85] GRMZM2G119168 AT1G20900 AHL27, AT-HOOK MOTIF NUCLEAR-LOCALIZED PROTEIN 27 Delayed leaf senescence [86] GRMZM2G047404 AT1G61800 GLUCOSE-6-PHOSPHATE/PHOSPHATE TRANSLOCATOR 2 (GPT2) Senescence associated gene [41] , [87] AC207347.3_FG005 AT1G73220 ORGANIC CATION/CARNITINE TRANSPORTER1 (OCT1) Strong senescence...”
- Function annotation of an SBP-box gene in Arabidopsis based on analysis of co-expression networks and promoters
Wang, International journal of molecular sciences 2009 - “...AT3G28500 60S acidic ribosomal protein P2 (RPP2C) AT3G14680 CYP72A14 AT4G12550 Auxin-Induced in Root cultures 1 AT1G20900 ESCAROLA AT4G20860 FAD-binding domain-containing protein AT1G60680 ARF-GAP DOMAIN 2 AT4G28680 tyrosine decarboxylase, putative AT3G53130 LUTEIN DEFICIENT 1 AT5G63600 flavonol synthase, putative AT3G51895 SULFATE TRANSPORTER 1 AT2G01760 ARABIDOPSIS RESPONSE REGULATOR 14...”
LOC108211560 AT-hook motif nuclear-localized protein 10-like from Daucus carota subsp. sativus
Aligns to 274:389 / 453 (25.6%), covers 98.3% of PF03479, 74.9 bits
NATL1_13731 No description from Prochlorococcus marinus str. NATL1A
Aligns to 4:110 / 200 (53.5%), covers 93.2% of PF03479, 74.7 bits
- Acclimation and stress response of Prochlorococcus to low salinity
He, Frontiers in microbiology 2022 - “...of NATL1A, many genes were highly inhibited, which were related to posttranslational modification (NATL1_02111 and NATL1_13731), signal transduction mechanisms ( typA ), cell envelope biogenesis, outer membrane (NATL1_08371 and NATL1_04491), translation, ribosomal structure and biogenesis ( rpsR ), coenzyme metabolism ( folE ), energy production and...”
XP_003590926 AT-hook motif nuclear-localized protein 14 from Medicago truncatula
Aligns to 110:223 / 329 (34.7%), covers 97.4% of PF03479, 74.1 bits
AHL29_ARATH / Q9C9K7 AT-hook motif nuclear-localized protein 29; Protein SUPPRESSOR OF PHYB-4#3 from Arabidopsis thaliana (Mouse-ear cress) (see 3 papers)
NP_177776 Putative AT-hook DNA-binding family protein from Arabidopsis thaliana
AT1G76500 SOB3 (SUPPRESSOR OF PHYB-4#3); DNA binding from Arabidopsis thaliana
Aligns to 100:222 / 302 (40.7%), covers 99.1% of PF03479, 74.0 bits
- function: Transcription factor that specifically binds AT-rich DNA sequences related to the nuclear matrix attachment regions (MARs) (By similarity). Acts redundantly with AHL18, AHL22 and AHL27 in the regulation of flowering and regulation of the hypocotyl elongation (PubMed:19517252). Acts redundantly with AHL27/ESC to modulate hypocotyl growth inhibition in response to light (PubMed:18088311).
subunit: Homodimer. Interacts with AHL5, AHL12, AHL25, AHL27, TCP4, TCP13 and EF114.
disruption phenotype: AHL27 and AHL29 double mutant exhibit a long hypocotyl phenotype in the light. - AT-Hook Transcription Factors Restrict Petiole Growth by Antagonizing PIFs.
Favero, Current biology : CB 2020 (PubMed)- GeneRIF: AT-Hook Transcription Factors Restrict Petiole Growth by Antagonizing PIFs.
- Brassinosteroid signaling converges with SUPPRESSOR OF PHYTOCHROME B4-#3 to influence the expression of SMALL AUXIN UP RNA genes and hypocotyl growth.
Favero, The Plant journal : for cell and molecular biology 2017 - GeneRIF: The results indicate that SOB3 and BR signaling converge to influence the transcription of hypocotyl growth-promoting SAUR19 subfamily members.
- Coordination of matrix attachment and ATP-dependent chromatin remodeling regulate auxin biosynthesis and Arabidopsis hypocotyl elongation.
Lee, PloS one 2017 - GeneRIF: Data show that the light-inducible AHL proteins ESCAROLA (ESC)/AHL27 and SUPPRESSOR OF PHYTOCHROME B-4 #3 (SOB3)/AHL29 bind directly to an scaffold/matrix attachment regions (S/MARs) region of the YUCCA 9 (YUC9) promoter and suppress its expression to inhibit hypocotyl growth in light-grown seedlings.
- SUPPRESSOR OF PHYTOCHROME B4-#3 Represses Genes Associated with Auxin Signaling to Modulate Hypocotyl Growth.
Favero, Plant physiology 2016 - GeneRIF: SOB3 modulates hypocotyl elongation in young seedlings by directly repressing the transcription of genes associated with auxin signaling.
- The AT-hook-containing proteins SOB3/AHL29 and ESC/AHL27 are negative modulators of hypocotyl growth in Arabidopsis.
Street, The Plant journal : for cell and molecular biology 2008 (PubMed)- GeneRIF: These data indicate that SOB3 and ESC act redundantly to modulate hypocotyl growth inhibition in response to light.[SOB3]
- Chromatin attachment to the nuclear matrix represses hypocotyl elongation in Arabidopsis thaliana
Xu, Nature communications 2024 - “...9.1 3 98 4.9 2 78 VRN1 AT3G18990 8.8 3 93 8.5 2 113 AHL29 AT1G76500 10.6 2 88 20.5 4 147 Fig. 1 AHL22 interacts with FRS7 and FRS12. a Bimolecular fluorescence complementation (BiFC) analysis of AHL22 and FRS7 or FRS12 interaction in planta ....”
- Dissection of Functional Modules of AT-HOOK MOTIF NUCLEAR LOCALIZED PROTEIN 4 in the Development of the Root Xylem
Seo, Frontiers in plant science 2021 - “...AHL22 ( AT2G45430 ), AHL23 ( AT4G17800 ), AHL27 ( AT1G20900 ), and AHL29 ( AT1G76500 ). Author Contributions J-YL and MS: conceptualization, validation, investigation, resources, writingoriginal draft, and writingreview and editing. MS: methodology, software, formal analysis, and visualization. J-YL: supervision, project administration, and funding acquisition....”
- An Arabidopsis AT-hook motif nuclear protein mediates somatic embryogenesis and coinciding genome duplication
Karami, Nature communications 2021 - “...the other overexpression constructs, the full-length cDNA clones of AHL19 (At3g04570), AHL20 (At4g14465), and AHL29 (At1g76500) from Arabidopsis Col-0 were used to amplify the open reading frames (ORFs) using primers indicated in Supplementary Table 1 . The ORFs were cloned into plasmid pJET1/blunt (GeneJET PCR Cloning...”
- Genome-Wide Discriminatory Information Patterns of Cytosine DNA Methylation
Sanchez, International journal of molecular sciences 2016 - “...K08819 cyclin-dependent kinase 12/13 (EC:2.7.11.22 2.7.11.23) 0.81 AT1G69940 PPME1; pectinesterase PPME1; K01051 pectinesterase (EC:3.1.1.11) 0.55 AT1G76500 SOB3; AT-hook motif nuclear localized protein 29 0.42 AT2G05990 MOD1; K00208 enoyl-[acyl-carrier protein] reductase I (EC:1.3.1.9 1.3.1.10) 0.77 AT2G11000 MAK10; MAK10-like protein 1.07 AT2G28660 chloroplast-targeted copper chaperone protein 1.43 AT2G30750...”
LOC108224931 AT-hook motif nuclear-localized protein 28-like from Daucus carota subsp. sativus
Aligns to 103:217 / 283 (40.6%), covers 98.3% of PF03479, 73.8 bits
- Characteristics of the AT-Hook Motif Containing Nuclear Localized (AHL) Genes in Carrot Provides Insight into Their Role in Plant Growth and Storage Root Development
Machaj, Genes 2021 - “...XP_017255428.1 chr6 DcAHL10 LOC108207579 XP_017233502.1 chr2 DcAHL33 LOC108224386 XP_017254467.1 chr6 DcAHL11 LOC108210006 XP_017236725.1 chr2 DcAHL34 LOC108224931 XP_017255185.1 chr6 DcAHL12 LOC108208112 XP_017234087.1 chr2 DcAHL35 LOC108226353 XP_017256784.1 chr6 DcAHL13 LOC108206084 XP_017231753.1 chr2 DcAHL36 LOC108226375 XP_017256806.1 chr6 DcAHL14 LOC108208477 XP_017234499.1 chr2 DcAHL37 LOC108194210 XP_017216623.1 chr7 DcAHL15 LOC108206866 XP_017232780.1 chr2...”
- “...271 5842.75 DcAHL30 LOC108224107 2 6394.09 263 4611.25 DcAHL33 LOC108224386 2 22.44 81 2234.00 DcAHL34 LOC108224931 2 961.10 31 2474.00 DcAHL25 LOC108215787 2 48.34 7 1299.25 DcAHL19 LOC108210904 3 253.15 17 1894.25 DcAHL42 LOC108201885 3 0.00 1 237.00 DcAHL37 LOC108194210 4 14,455.31 12 3685.00...”
SYNW0765 conserved hypothetical protein from Synechococcus sp. WH 8102
Aligns to 2:109 / 202 (53.5%), covers 99.1% of PF03479, 73.8 bits
- Computational prediction of the osmoregulation network in Synechococcus sp. WH8102
Mao, BMC genomics 2010 - “...candidates for GgtB (b0529) of E. coli , and probably involved in glucosylglycerol synthesis. SYNW0754, SYNW0765, SYNW1250, SYNW2099 and SYNW2471 are added since they have very similar phylogenetic profiles with those of GpgSP (SYNW2436, 2434), and they are probably involved in glucosylglycerate synthesis. Figure 2 Genes...”
LOC108221500 AT-hook motif nuclear-localized protein 29-like from Daucus carota subsp. sativus
Aligns to 48:159 / 230 (48.7%), covers 98.3% of PF03479, 73.6 bits
LOC108210904 AT-hook motif nuclear-localized protein 28-like from Daucus carota subsp. sativus
Aligns to 97:207 / 271 (41.0%), covers 98.3% of PF03479, 73.0 bits
- Characteristics of the AT-Hook Motif Containing Nuclear Localized (AHL) Genes in Carrot Provides Insight into Their Role in Plant Growth and Storage Root Development
Machaj, Genes 2021 - “...XP_017234068.1 chr2 DcAHL41 LOC108197690 XP_017220869.1 chr8 DcAHL18 LOC108206857 XP_017232768.1 chr2 DcAHL42 LOC108201885 XP_017225711.1 chr9 DcAHL19 LOC108210904 XP_017237852.1 chr3 DcAHL43 LOC108202788 XP_017226816.1 chr9 DcAHL20 LOC108213708 XP_017240992.1 chr3 DcAHL44 LOC108202787 XP_017226814.1 chr9 DcAHL21 LOC108212236 XP_017239451.1 chr3 DcAHL45 LOC108202271 XP_017226151.1 chr9 DcAHL22 LOC108211560 XP_017238682.1 chr3 DcAHL46 LOC108200218 XP_017223772.1 chr9...”
- “...81 2234.00 DcAHL34 LOC108224931 2 961.10 31 2474.00 DcAHL25 LOC108215787 2 48.34 7 1299.25 DcAHL19 LOC108210904 3 253.15 17 1894.25 DcAHL42 LOC108201885 3 0.00 1 237.00 DcAHL37 LOC108194210 4 14,455.31 12 3685.00...”
- Comparative Transcriptomics of Root Development in Wild and Cultivated Carrots
Machaj, Genes 2018 - “...[ 29 ], defense response [ 30 ], and flowering [ 31 ]. Notably, AHL28-like (LOC108210904) showed a very high change in its level of expression (log2FCh = 3.3 and 1.689) in two comparisons (cDEG.1.3 and cDEG.2.3, respectively). Also, AHL5-like (LOC108209748) was found among differentially expressed...”
AHL12_ARATH / Q8LPN5 AT-hook motif nuclear-localized protein 12 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
AT1G63480 DNA-binding family protein from Arabidopsis thaliana
Aligns to 161:276 / 361 (32.1%), covers 97.4% of PF03479, 72.2 bits
- function: Transcription factor that specifically binds AT-rich DNA sequences related to the nuclear matrix attachment regions (MARs).
subunit: Homodimer. Interacts with AHL27, AHL29 and ATAF2/NAC081. - Cytokinin-overinduced transcription factors and thalianol cluster genes in CARBOXYL-TERMINAL DOMAIN PHOSPHATASE-LIKE 4-silenced Arabidopsis roots during de novo shoot organogenesis
Fukudome, Plant signaling & behavior 2018 - “...cluster, and two are each from independent clusters (AT1G63480 and AT3G16430). Therefore, the thalianol cluster is the sole operon-like cluster over-induced in...”
- Electromagnetic Field Seems to Not Influence Transcription via CTCT Motif in Three Plant Promoters
Sztafrowski, Frontiers in plant science 2017 - “...transposase family 24 3.5 0.0035 1.0000 AT3G13140 Hydroxyproline-rich glycoprotein family protein 23 5.6 0.0005 1.0000 AT1G63480 DNA-binding family protein 23 5.0 0.0009 1.0000 AT5G58550 Paralog of ETO1, a negative regulator of ACS5 involved in ethylene biosynthesis pathway 23 4.2 0.0019 1.0000 AT1G36403 Transposable element gene; mutator-like...”
- Comparative analysis of plant immune receptor architectures uncovers host proteins likely targeted by pathogens
Sarris, BMC biology 2016 - “...OEC115 AT3G21490 HMA Heavy metal-associated domain OEC115 AT3G10480 NAM No apical meristem (NAM) protein OEC45 AT1G63480 DUF296 Domain of unknown function (DUF296) OEC45 AT4G00120 HLH Helix-loop-helix DNA-binding domain OEC45 AT1G12520 HMA Heavy metal-associated domain OEC45 AT3G22420 Pkinase Protein kinase domain OEC59 AT4G08320 TPR_11 TPR repeat OEC67...”
- The peroxiredoxin and glutathione peroxidase families in Chlamydomonas reinhardtii
Dayer, Genetics 2008 - “...At2g48150; GPX5, At3g63080; GPX6, At4g11600; GPX7, At4g31870; GPX8, At1g63480; Cr, Chlamydomonas reinhardtii as in Table 2; Hs, Homo sapiens GPX1, P07203; GPX2,...”
AHL11_ARATH / Q8L7L5 AT-hook motif nuclear-localized protein 11 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
AT3G61310 DNA-binding family protein from Arabidopsis thaliana
Aligns to 165:281 / 354 (33.1%), covers 97.4% of PF03479, 71.3 bits
- function: Transcription factor that specifically binds AT-rich DNA sequences related to the nuclear matrix attachment regions (MARs).
- Overexpression of AHL9 accelerates leaf senescence in Arabidopsis thaliana
Zhou, BMC plant biology 2022 - “...Initiative identifiers for the genes described in this article are as follows: AHL9 (At2g45850), AHL11 (At3g61310), LOX1 (AT1G55020), IAA1 (AT4G14560), UBQ10 (AT4G05320), ACO2 (AT1G62380), NAC079 (AT5G07680), anac048 (AT3G04420), ERF039 (AT4G16750), PCAP2 (AT5G44610), SAUR72 (AT3G12830), LTP4 (AT5G59310), UGT85A1 (AT1G22400), PAO4 (AT1G65840), WRKY63 (AT1G66600), EBF2 (AT5G25350), NAC003 (AT1G02220),...”
- A Conserved Long Intergenic Non-coding RNA Containing snoRNA Sequences, lncCOBRA1, Affects Arabidopsis Germination and Development
Kramer, Frontiers in plant science 2022 - “...active 16 PLASTID TRANSCRIPTIONALLY ACTIVE 16 AT3G51800 Putative nuclear DNA-binding protein G2p (AtG2) mRNA ATG2 AT3G61310 AT hook motif DNA-binding family protein AT-HOOK MOTIF NUCLEAR AT4G22140 Encodes a chromatin remodeling factor that regulates flowering time. EARLY BOLTING IN SHORT DAYS (EBS) AT4G35800 Encodes the unique largest...”
- Transcriptional regulatory framework for vascular cambium development in Arabidopsis roots
Zhang, Nature plants 2019 - “...AT3G50650; AGL14 , AT4G11880; ATHB53 , AT5G66700; ATHB5 , AT5G65310; WRI3 , AT1G16060; AHL11 , AT3G61310; MYB47 , AT1G18710; MYB95 , AT1G74430; MYB87 , AT4G37780; STY2 , AT4G36260; RAS1 , AT1G09950; AtERF019 , AT1G22810; AtERF021 , AT1G71450; AtERF029 , AT4G25490; AtERF032 , AT1G63030; AtERF043 , AT4G32800;...”
- The hunt for hypoxia responsive natural antisense short interfering RNAs
Moldovan, Plant signaling & behavior 2010 - “...natsiRNA. The three associated hypoxia upregulated genes AT3g61310 (DNA binding protein), At2g38470 (WRKY33) and At5g42270 (VAR1; ATP-dependent peptidase) are...”
- “...0.37 0.53 AT3G56940 1.53 1.87 AT3G56950 0.38 0.44 AT3G61310 1.73 2.08 AT3G61300 0.45 0.22 AT4G03080 1.73 1.69 AT4G03070 0.46 0.31 0.68 AT4G05460 1.50 1.37...”
- UV-B responsive microRNA genes in Arabidopsis thaliana
Zhou, Molecular systems biology 2007 - “...transcription factor CAATNATTG At4g32880 (ATHB-8), At5g60690 (REV) At1g30490 miR167 At5g37020, At5g19950 ARF transcription factor At1g02800, At3g61310 miR169 At1g17590, At1g54160, At1g72830 CBF HAP2-like factors CCAAT At3g20910, At5g12840 At1g70700, At1g80770 miR170/171 At4g00150, At5g61480 Scarecrow-like transcription factor At2g45160, At3g60630 miR172 At2g28550 (TOE1), At4g36920 (AP2) APETALA2-like factor At5g60120 (TOE2), At5g67180...”
AHL17_ARATH / Q9LTA2 AT-hook motif nuclear-localized protein 17 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
AT5G49700 DNA-binding protein-related from Arabidopsis thaliana
Aligns to 84:204 / 276 (43.8%), covers 98.3% of PF03479, 70.9 bits
- function: Transcription factor that specifically binds AT-rich DNA sequences related to the nuclear matrix attachment regions (MARs).
- Chromatin attachment to the nuclear matrix represses hypocotyl elongation in Arabidopsis thaliana
Xu, Nature communications 2024 - “...12 3 241 21.5 5 298 AHL15 AT3G55560 49 10 934 52.3 11 1223 AHL17 AT5G49700 44.2 6 476 20.7 4 331 AHL13 AT4G17950 18.7 5 358 21.2 5 305 AHL19 AT3G04570 25.1 4 306 21 4 255 SPFH AT5G51570 27.7 5 231 19.5 4 273...”
- Overexpression of AHL proteins enhances root hair production by altering the transcription of RHD6-downstream genes
Zeng, Plant direct 2023 - “...the wild type (WT, Columbia0 background). When one of the upregulated genes, that is, AHL17 (AT5G49700) was overexpressed in WT plants under a strong constitutive CaMV 35S promoter (Figure S1B ), the transgenic plants ( 35S::AHL17 ) exhibited enhanced root hair production, in terms of both...”
- “...study can be found in The Arabidopsis Information Resource under the following accession numbers: AHL17 (AT5G49700), AHL28 (AT1G14490), AHL19 (AT3G04570), RHD6 (AT1G66470), PRP3 (AT3G62680), LRX1 (AT1G12040), COW1 (AT4G34580), RHS15 (AT4G25220), HSP701 (AT5G02500), HSP702 (AT5G02490), HSP704 (AT3G12580), HSP705 (AT1G16030), and UBQ5 (AT3G62250). REFERENCES Aravind , L. ,...”
- Dissection of Functional Modules of AT-HOOK MOTIF NUCLEAR LOCALIZED PROTEIN 4 in the Development of the Root Xylem
Seo, Frontiers in plant science 2021 - “...), AHL7 ( AT4G00200 ), AHL15 ( AT3G55560 ), AHL16 ( AT2G42940 ), AHL17 ( AT5G49700 ), AHL19 ( AT3G04570 ), AHL20 ( AT4G14465 ), AHL21 ( AT2G35270 ), AHL22 ( AT2G45430 ), AHL23 ( AT4G17800 ), AHL27 ( AT1G20900 ), and AHL29 ( AT1G76500 )....”
- Molecular Targets and Biological Functions of cAMP Signaling in Arabidopsis
Xu, Biomolecules 2021 - “...AT5G01380 (Trihelix), AT1G25560 (RAV), AT3G25730 (RAV)AT1G14920 (GRAS), AT3G50650 (GRAS), AT3G02150 (TCP), AT2G28550 (AP2), AT1G69570 (Dof), AT5G49700 (AT-hook $ ) Regulation of Transcription (gene description) GO:0006355~regulation of transcription AT1G61470 (CCR4-ASSOCIATED FACTOR 1E, CAF1E), AT2G40130 (SMAX1-LIKE 8, SMXL8), AT3G04930 (DNA-binding storekeeper protein-related transcriptional regulator), AT5G36740 (Acyl-CoA N-acyltransferase with...”
- Genome-Wide Transcriptome Analysis Reveals Conserved and Distinct Molecular Mechanisms of Al Resistance in Buckwheat (Fagopyrum esculentum Moench) Leaves
Chen, International journal of molecular sciences 2017 - “...box protein with ARID/BRIGHT DNA-binding domain ARID Karyogamy, polar nucleus fusion comp13872_c0_seq1 1.257 comp28434_c0_seq1 1.029 AT5G49700 AT-HOOK motif nuclear localized protein 17 AT-hook Unknown comp20160_c0_seq1 1.651 AT5G43700 IAA4 AUX/IAA Response to auxin comp32831_c0_seq1 1.326 comp27076_c0_seq2 1.084 AT1G09530 Phytochrome interacting factor 3 bHLH De-etiolation, gibberellic acid-mediated signaling...”
- AtRD22 and AtUSPL1, members of the plant-specific BURP domain family involved in Arabidopsis thaliana drought tolerance
Harshavardhan, PloS one 2014 - “...[52] : up-regulated by 12 fold in both rd22-1 and uspl1 compared to wild type); At5g49700 (encoding a DNA-binding protein associated with moisture stress [53] : up-regulated by 56 fold in rd22-1 and by 40 fold in uspl1 ); At2g27550 (encoding ATC, a systemic inhibitor of...”
- “...AGI ID put. Function 257162_s_at 59 At3G24290 amm. transporter 265364_at 45 At2G13330 Transposon 248564_at 56 At5G49700 DNA binding 246908_at 40 RD22 At5G25610 Disease Defense 249052_at 47 PDF1.2 At5G44420 Disease Defense 251677_at 38 ORG3 At3G56980 DNA bind 245276_at 41 ATHB-2 At4G16780 257453_at 30 At1G65130 hydrolase 265102_at 39...”
- Differential regulation of closely related R2R3-MYB transcription factors controls flavonol accumulation in different parts of the Arabidopsis thaliana seedling
Stracke, The Plant journal : for cell and molecular biology 2007 - “...Hypothetical protein 253669_at At4g30000 37.1 P 12.6 P 2.9 Dihydropterin pyrophosphokinase, putative dihydropteroate synthase 248564_at At5g49700 24.1 P 8.3 A 2.9 DNA-binding protein-related 252123_at At3g51240 2102 P 728 P 2.9 F3H; flavanone 3-hydroxylase (TT6) 253195_at At4g35420 94.7 P 32.9 P 2.9 Dihydroflavonol 4-reductase family protein 252215_at...”
LOC108197834 AT-hook motif nuclear-localized protein 5-like from Daucus carota subsp. sativus
Aligns to 131:246 / 316 (36.7%), covers 97.4% of PF03479, 70.8 bits
NP_001159201 uncharacterized protein LOC100304287 from Zea mays
Aligns to 138:251 / 341 (33.4%), covers 98.3% of PF03479, 70.4 bits
AHL25_ARATH / Q6DBQ1 AT-hook motif nuclear-localized protein 25; AT-hook protein of GA feedback 1 from Arabidopsis thaliana (Mouse-ear cress) (see 2 papers)
AT4G35390 AGF1 (AT-hook protein of GA feedback 1); transcription factor from Arabidopsis thaliana
NP_195265 AT-hook protein of GA feedback 1 from Arabidopsis thaliana
Aligns to 91:206 / 299 (38.8%), covers 99.1% of PF03479, 70.3 bits
- function: Transcription factor that specifically binds AT-rich DNA sequences related to the nuclear matrix attachment regions (MARs) (By similarity). Binds the DNA sequence GNFEI (GA-negative feedback element I) in the GA3OX1 promoter. Binding to GNFEI sequence is required for GA-negative feedback regulation of GA3OX1.
subunit: Homodimer. Interacts with AHL27 and AHL29. - Poor shoot and leaf growth in Huanglongbing-affected sweet orange is associated with increased investment in defenses
Neupane, Frontiers in plant science 2023 - “...GAST1 protein homolog 1 (GASA1) orange1. 1g009215m AT1G66350 3.71 Repressor of GA (RGA1) orange1. 1g042221m AT4G35390 2.10 AT-hook protein of GA feedback 1 (AGF1) orange1. 1g033495m AT1G74670 1.42 Gibberellin-regulated family protein (GASA 6) orange1. 1g041881m AT1G67030 1.61 Zinc finger protein 6 (ZFP6) orange1. 1g005279m AT1G12240 2.02...”
- Coregulation of glutamine synthetase1;2 (GLN1;2) and NADH-dependent glutamate synthase (GLT1) gene expression in Arabidopsis roots in response to ammonium supply
Kojima, Frontiers in plant science 2023 - “...AT5G23260 TT16 2 AT4G00200 AHL7 3 AT1G14490 AHL28 4 AT1G76880 DF1 5 AT1G14490 AHL28 12 AT4G35390 AHL25 13 AT3G55560 AHL15 19 AT1G76880 DF1 11 AT3G55560 AHL15 15 AT4G17800 AHL23 17 AT5G24520 TTG1 18 AT1G14490 AHL28 20 AT1G20900 AHL27 21 unknown IV 22 AT5G25160 ZFP3 23 AT1G14490...”
- The Expression Profiles of the Salvia miltiorrhiza 3-Hydroxy-3-methylglutaryl-coenzyme A Reductase 4 Gene and Its Influence on the Biosynthesis of Tanshinones
Majewska, Molecules (Basel, Switzerland) 2022 - “...TF Family Name TF Gene Name and Locus TFBSs Number GA 3 AT-Hook AHL25 ; At4g35390 6 MYB-related CCA1 ; At2g46830 1 RVE8 ; At3g09600 2 RVE4 ; At5g02840 Homeodomain; HD-ZIP ATHB-23 ; At1g26960 1 bHLH PIF3 ; At1g09530 2 GATA GATA22 ; At4g26150 62 GATA21...”
- Polycomb repressive complex 2 controls the embryo-to-seedling phase transition
Bouyer, PLoS genetics 2011 - “...AT1G03790), SQUAMOSA PROMOTER BINDING PROTEIN-LIKE 8 (SPL8, AT1G02065), AT-hook protein of GA feedback 1 (AGF1, AT4G35390), GIBBERELLIC ACID METHYLTRANSFERASE 2 (GAMT2, AT5G56300). The up-regulation of many important seed regulatory genes raised the hypothesis that fie seedlings, albeit macroscopically resembling wild type seedlings, display seed phase characteristics....”
- AGF1, an AT-hook protein, is necessary for the negative feedback of AtGA3ox1 encoding GA 3-oxidase.
Matsushita, Plant physiology 2007 - GeneRIF: AGF1 plays a role in the homeostasis of gibberellins through binding to the cis-acting sequence of the GA-negative feedback of AtGA3ox1. [AGF1]
AHL28_ARATH / Q9M9R4 AT-hook motif nuclear-localized protein 28 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
AT1G14490 DNA-binding protein-related from Arabidopsis thaliana
Aligns to 31:151 / 206 (58.7%), covers 98.3% of PF03479, 67.5 bits
- function: Transcription factor that specifically binds AT-rich DNA sequences related to the nuclear matrix attachment regions (MARs).
- Coregulation of glutamine synthetase1;2 (GLN1;2) and NADH-dependent glutamate synthase (GLT1) gene expression in Arabidopsis roots in response to ammonium supply
Kojima, Frontiers in plant science 2023 - “...Clone ID of yeast colonies Locus ID name 1 AT5G23260 TT16 2 AT4G00200 AHL7 3 AT1G14490 AHL28 4 AT1G76880 DF1 5 AT1G14490 AHL28 12 AT4G35390 AHL25 13 AT3G55560 AHL15 19 AT1G76880 DF1 11 AT3G55560 AHL15 15 AT4G17800 AHL23 17 AT5G24520 TTG1 18 AT1G14490 AHL28 20 AT1G20900...”
- Overexpression of AHL proteins enhances root hair production by altering the transcription of RHD6-downstream genes
Zeng, Plant direct 2023 - “...analyses (Figure 1de ) and quantification of ectopically produced root hairs (Table S1 ). AHL28 (AT1G14490) is the closest homolog of AHL17 in the Arabidopsis AHL protein family (Figure S1A ). The overexpression of AHL28 (Figure S1B ) also caused ectopic root hair formation and increased...”
- “...be found in The Arabidopsis Information Resource under the following accession numbers: AHL17 (AT5G49700), AHL28 (AT1G14490), AHL19 (AT3G04570), RHD6 (AT1G66470), PRP3 (AT3G62680), LRX1 (AT1G12040), COW1 (AT4G34580), RHS15 (AT4G25220), HSP701 (AT5G02500), HSP702 (AT5G02490), HSP704 (AT3G12580), HSP705 (AT1G16030), and UBQ5 (AT3G62250). REFERENCES Aravind , L. , & Landsman...”
AT2G36560 DNA-binding protein-related from Arabidopsis thaliana
Aligns to 106:224 / 574 (20.7%), covers 97.4% of PF03479, 63.3 bits
- Genome-wide association analysis reveals genes controlling an antagonistic effect of biotic and osmotic stress on Arabidopsis thaliana growth
Huang, Molecular plant pathology 2024 - Perturbation of parentally biased gene expression during interspecific hybridization
Burkart-Waco, PloS one 2015 - “...8 173 11.47 3.7 AT2G32370 HDG3 1 13740 63.05 0.0 0 431 e NA NA AT2G36560 DNA-binding 3 51959 85.27 0.1 2 113 6.63 0.5 AT2G40520 Nucleotidyltransferase 3 2961 70.89 1.6 6 123 47.67 18.9 AT4G11940 ADM 4 42576 78.70 0.1 0 468 e NA NA...”
- Paternally expressed imprinted genes establish postzygotic hybridization barriers in Arabidopsis thaliana
Wolff, eLife 2015 - “...in reciprocal crosses between Col and Bur-0 accessions ( Wolff et al., 2011 ). While At2g36560 (PEG5), At4g05470 (PEG8), At1g67830 (FXG1), At1g17770 (SUVH7), At1g57800 (VIM5) and AT1g48910 (YUC10) were also identified to be imprinted in Col and L er accessions, At1g11810 (PEG1), At1g49290 (PEG2), At1g60400 (PEG3),...”
- Regulation of imprinted gene expression in Arabidopsis endosperm
Hsieh, Proceedings of the National Academy of Sciences of the United States of America 2011 - “...al. Number AT1G17770 AT1G31640 AT1G48910 AT1G57800 AT1G60410 AT2G21930 AT2G36560 AT4G11940 AT5G63740 Annotation CxL M/P #/F/D/M F/M F/D/M F/D F/M F/M F/D/M F/D...”
- “...genes (SUVH7, AGL92, At1g60410 F-box, At2g21930 F-box, YUC10, At2g36560, and HDG3) is reduced in endosperm fertilized with met1 pollen, indicating that DNA...”
- Transcriptional profiles underlying parent-of-origin effects in seeds of Arabidopsis thaliana
Tiwari, BMC plant biology 2010 - “...ligase activity) At2g26050 zinc ion binding unknown At2g30810 gibberellin-regulated family protein response to gibberellin stimulus At2g36560 DNA-binding protein-related unknown At2g39640 glycosyl hydrolase family 17 protein carbohydrate metabolic processes At2g43670 glycosyl hydrolase family 17 protein unknown At2g45110 ATEXPB4 beta-expansin cellulose and pectin-containing cell wall loosening At3g02670 proline-rich...”
LOC108217323 AT-hook motif nuclear-localized protein 1-like from Daucus carota subsp. sativus
Aligns to 56:171 / 200 (58.0%), covers 95.7% of PF03479, 61.5 bits
LOC108215787 AT-hook motif nuclear-localized protein 27 from Daucus carota subsp. sativus
Aligns to 78:189 / 264 (42.4%), covers 99.1% of PF03479, 61.5 bits
- Characteristics of the AT-Hook Motif Containing Nuclear Localized (AHL) Genes in Carrot Provides Insight into Their Role in Plant Growth and Storage Root Development
Machaj, Genes 2021 - “...* Chromosome DcAHL1 LOC108209315 XP_017235643.1 chr1 DcAHL24 LOC108217323 XP_017245648.1 chr4 DcAHL2 LOC108205011 XP_017230247.1 chr1 DcAHL25 LOC108215787 XP_017243846.1 chr4 DcAHL3 LOC108197227 XP_017220279.1 chr1 DcAHL26 LOC108216162 XP_017244339.1 chr4 DcAHL4 LOC108205501 XP_017230972.1 chr1 DcAHL27 LOC108219725 XP_017248716.1 chr5 DcAHL5 LOC108215664 XP_017243692.1 chr1 DcAHL28 LOC108221500 XP_017250863.1 chr5 DcAHL6 LOC108197834 XP_017221076.1 chr1...”
- “...263 4611.25 DcAHL33 LOC108224386 2 22.44 81 2234.00 DcAHL34 LOC108224931 2 961.10 31 2474.00 DcAHL25 LOC108215787 2 48.34 7 1299.25 DcAHL19 LOC108210904 3 253.15 17 1894.25 DcAHL42 LOC108201885 3 0.00 1 237.00 DcAHL37 LOC108194210 4 14,455.31 12 3685.00...”
LOC108202787 AT-hook motif nuclear-localized protein 15-like from Daucus carota subsp. sativus
2 alignments in 65:321 / 322 (71.1%), covering up to 94.0% of PF03479, 59.6 bits
LOC108202788 AT-hook motif nuclear-localized protein 15-like from Daucus carota subsp. sativus
2 alignments in 65:321 / 322 (71.1%), covering up to 94.0% of PF03479, 59.6 bits
LOC108202271 AT-hook motif nuclear-localized protein 15-like from Daucus carota subsp. sativus
2 alignments in 63:319 / 320 (71.6%), covering up to 94.0% of PF03479, 59.0 bits
LOC105173174 AT-hook motif nuclear-localized protein 9 from Sesamum indicum
Aligns to 157:269 / 301 (37.5%), covers 96.6% of PF03479, 57.8 bits
msl6857 hypothetical protein from Mesorhizobium loti MAFF303099
Aligns to 1:75 / 94 (79.8%), covers 62.4% of PF03479, 57.0 bits
SMc00259 hypothetical protein from Sinorhizobium meliloti 1021
Aligns to 178:285 / 285 (37.9%), covers 97.4% of PF03479, 56.0 bits
- Members of the Sinorhizobium meliloti ChvI regulon identified by a DNA binding screen
Bélanger, BMC microbiology 2013 - “...3 A). These results suggest that ChvI acts by repressing the transcription of the SMc00264 SMc00259 operon. Figure 3 Transcriptional fusion assays and the SMc00261 operon. ( A ) GusA activities were measured for fusions in genes SMc00262 and SMc00261 in wild-type (Rm1021) and chvI261 mutant...”
- “...ligase. These genes are also followed by SMc00260 coding for a putative short-chain dehydrogenase and SMc00259 coding for a hypothetical protein. Upstream of these genes lay genes for a transcriptional regulator of the IclR family (SMc00263) and another short-chain dehydrogenase (SMc00264). Our earlier studies failed to...”
LOC108215664 AT-hook motif nuclear-localized protein 7-like from Daucus carota subsp. sativus
Aligns to 272:388 / 454 (25.8%), covers 97.4% of PF03479, 52.6 bits
LOC101509190 AT-hook motif nuclear-localized protein 16-like from Cicer arietinum
Aligns to 117:239 / 303 (40.6%), covers 94.9% of PF03479, 49.9 bits
LOC108226353 AT-hook motif nuclear-localized protein 29-like from Daucus carota subsp. sativus
Aligns to 155:264 / 277 (39.7%), covers 88.9% of PF03479, 32.2 bits
LOC108226375 AT-hook motif nuclear-localized protein 27-like from Daucus carota subsp. sativus
Aligns to 43:150 / 163 (66.3%), covers 78.6% of PF03479, 30.1 bits
LOC108207567 AT-hook motif nuclear-localized protein 28-like from Daucus carota subsp. sativus
Aligns to 38:150 / 157 (72.0%), covers 94.0% of PF03479, 29.0 bits
Or search for genetic data about PF03479 in the Fitness Browser
by Morgan Price,
Arkin group
Lawrence Berkeley National Laboratory