Family Search for PF04338 (DUF481)
April 2024: See Interactive Tools for Functional Annotation of Bacterial Genomes for advice on using these tools.
PF04338 hits 21 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.
XCC3510 conserved hypothetical protein from Xanthomonas campestris pv. campestris str. ATCC 33913
XC_0650 hypothetical protein from Xanthomonas campestris pv. campestris str. 8004
Aligns to 46:265 / 266 (82.7%), covers 99.5% of PF04338, 200.7 bits
- A MLVA genotyping scheme for global surveillance of the citrus pathogen Xanthomonas citri pv. citri suggests a worldwide geographical expansion of a single genetic lineage
Pruvost, PloS one 2014 - “...+ hypothetical protein 5 VIC-TGATCGAAGCACCGAGCAGT 3 5 GCAACCGGGCAGACCGTTGT 3 66.0 0.2 8 23 2 (0.116) Xcc3510 24 + aminopeptidase N 5 NED-ACCGCTCTACCGAATACGTCA 3 5 ATCGGCATTGTCCATCAACGTC 3 66.0 0.2 8 13 3 (0.031) Xcc3522 10 NA 5 NED-CCCAGCCACCGAACAGATCCG 3 5 AAATCCCTATCGCGCCCAGGT 3 64.0 0.2 1 25 3...”
- “...from 0.015 to 0.843 ( Table 1 ). Nine TR loci (Xcc1014, Xcc1662, Xcc2229, Xcc3088, Xcc3510, Xcc4071, Xcc4279, Xcc4927 and Xcc4946) had very low levels of polymorphism and differentiated a single isolate or haplotype ( Table 1 ). Strains sharing an identical MLVA-31 allelic profile always...”
- Identification of c-di-GMP Signaling Components in Xanthomonas oryzae and Their Orthologs in Xanthomonads Involved in Regulation of Bacterial Virulence Expression
Yang, Frontiers in microbiology 2019 - “...DNA replication. Among them, the elongation factor P (XC_2359) and a putative outer membrane protein (XC_0650), both widely conserved in bacteria, were characterized as the novel virulence factors regulated by the RpfC/RpfG/RpfF system at post-transcriptional but not transcriptional level (O'Connell et al., 2013 ). RpfG was...”
VIBR0546_03992 DUF481 domain-containing protein from Vibrio brasiliensis LMG 20546
Aligns to 39:254 / 254 (85.0%), covers 100.0% of PF04338, 200.7 bits
- Effects of NaCl Concentration on the Behavior of Vibrio brasiliensis and Transcriptome Analysis
Hu, Foods (Basel, Switzerland) 2022 - “...1.527 2.87 10 5 up ompR osmolarity response regulator 2.471 1.305 9.71 10 5 up VIBR0546_03992 putative salt-induced outer membrane protein 2.567 1.360 4.52 10 4 up VIBR0546_17778 OmpR family two-component response regulator 2.039 1.028 9.87 10 3 up VIBR0546_02830 choline/carnitine/betaine transporter 0.079 3.660 3.18 10...”
- “...7 up VIBR0546_21600 putative sodium-type flagellar protein MotY precursor 6.971 2.801 5.54 10 6 up VIBR0546_03992 putative salt-induced outer membrane protein 2.468 1.304 3.57 10 5 up VIBR0546_06697 sodium/glutamate symporter 2.705 1.435 1.36 10 4 up VIBR0546_12742 sodium/alanine symporter 2.326 1.218 2.10 10 4 up VIBR0546_12482...”
XAC0623 conserved hypothetical protein from Xanthomonas axonopodis pv. citri str. 306
XAUB_17400 DUF481 domain-containing protein from Xanthomonas citri pv. aurantifolii str. ICPB 11122
Aligns to 46:265 / 266 (82.7%), covers 99.5% of PF04338, 200.6 bits
- Periplasm-enriched fractions from Xanthomonas citri subsp. citri type A and X. fuscans subsp. aurantifolii type B present distinct proteomic profiles under in vitro pathogenicity induction
Zandonadi, PloS one 2020 - “...41 III (XAC0951) C XAUB_17400 Conserved hypothetical protein (11) 29.1 5.2 25 2 5 VIII (XAC0623) OM+ 18 XauB 2,67E-01 Unique 0,0126284 XAUB_17400 Conserved hypothetical protein (11) 29.1 5.2 30.1 4.7 505 23 42 VIII (XAC0623) OM+ 19 XauB 1,43E-01 Unique 0,0212073 XAUB_08010 ATP synthase subunit...”
- Proteomics-based identification of differentially abundant proteins reveals adaptation mechanisms of Xanthomonas citri subsp. citri during Citrus sinensis infection
Moreira, BMC microbiology 2017 - “...8.09 A/B/LPS 40 XAC3966 Outer membrane lipoprotein SlyB slyB Up 2.45 3.17 4.10 A/B/LPS 42 XAC0623 Putative salt-induced outer membrane protein YdiY ydiY Up 6.83 8.70 1.38 A/B/LPS 43 XAC0190 Uncharacterized lipoprotein ---- Up 2.21 1.30 4.24 A/B/LPS 44 XAC0834 Two-component system regulatory protein colR Up...”
- “...up-regulated during the infectious process. XAC3966 and XAC0190 encode membrane lipoproteins with similar expression profiles. XAC0623 is a salt-induced putative outer membrane protein (YdiY) with expression peak at 1DAI (6,83) while XAC4219 corresponds to a protein with a lipid-binding SYLF domain. The last and most interesting...”
- Periplasm-enriched fractions from Xanthomonas citri subsp. citri type A and X. fuscans subsp. aurantifolii type B present distinct proteomic profiles under in vitro pathogenicity induction
Zandonadi, PloS one 2020 - “...50S ribosomal protein L25 (6) 23.3 5.2 25.7 5.3 500 12 41 III (XAC0951) C XAUB_17400 Conserved hypothetical protein (11) 29.1 5.2 25 2 5 VIII (XAC0623) OM+ 18 XauB 2,67E-01 Unique 0,0126284 XAUB_17400 Conserved hypothetical protein (11) 29.1 5.2 30.1 4.7 505 23 42 VIII...”
PP1357 conserved hypothetical protein from Pseudomonas putida KT2440
Aligns to 167:375 / 375 (55.7%), covers 100.0% of PF04338, 199.4 bits
c2120 YdiY family protein from Escherichia coli CFT073
Aligns to 47:252 / 252 (81.7%), covers 99.0% of PF04338, 197.6 bits
YdiY / b1722 acid-inducible putative outer membrane protein YdiY from Escherichia coli K-12 substr. MG1655 (see 4 papers)
TC 1.B.75.1.3 / P76206 YdiY OMP of 252 aas from Escherichia coli (strain K12)
b1722 hypothetical protein from Escherichia coli str. K-12 substr. MG1655
Aligns to 47:252 / 252 (81.7%), covers 99.0% of PF04338, 197.6 bits
- substrates: small molecules
tcdb comment: Acid induces its synthesis (Stancik et al. 2002) - The Escherichia coli proteome: past, present, and future prospects
Han, Microbiology and molecular biology reviews : MMBR 2006 - “...P76177 P0AC69 P77552 P0ACX3 P0A8A4 P77748 P76206 P0ACY1 P39173 P76256 5.38/59,928.8 5.07/54,689 9.1/31,910.83 4.75/12,878.76 4.96/9,928 (4.5-5.5) 4.42/42,876.01...”
- Whole-Transcriptome Analysis of Verocytotoxigenic Escherichia coli O157:H7 (Sakai) Suggests Plant-Species-Specific Metabolic Responses on Exposure to Spinach and Lettuce Extracts
Crozier, Frontiers in microbiology 2016 - “...for high levels of differential expression: e.g., in spinach leaf lysates two hypothetical genes (b3238, b1722) were ranked as #2 and 3 for level of induction, at 50-fold. Probes corresponding to Z5022 and ECs4474 were induced 270- to 300-fold in spinach root exudates, but repressed in...”
- 18th Congress of the European Hematology Association, Stockholm, Sweden, June 13–16, 2013
, Haematologica 2013 - Gene expression analysis indicates extensive genotype-specific crosstalk between the conjugative F-plasmid and the E. coli chromosome
Harr, BMC microbiology 2006 - “...(MG1655)* F vs nonF (DH5)* MG1655 vs. DH5 # P (F-effect) P (strain-effect) Function Process b1722 3.03 2.36 -2.03 0.005 0.012 Conserved-Hypothetical-ORF flhD 2.34 2.61 -5.22 0.002 0.0002 regulator of flagellar biosynthesis, transcriptional initiation factor Motility, chemotaxis, energytaxis (i.e. aerotaxis, redoxtaxis) leuQ 2.78 2.19 3.50 0.050...”
- DNA microarray analyses of the long-term adaptive response of Escherichia coli to acetate and propionate
Polen, Applied and environmental microbiology 2003 - “...or block biosynthesis 0.38* 0.53* 0.57* 0.66* 0.82* 0.60 b1722 b1722 1 ORF, hypothetical protein 2.32* 2.21 0.89 b1729 b1729 2 Part of a kinase 0.96 2.28*...”
- Metabolic context and possible physiological themes of sigma(54)-dependent genes in Escherichia coli
Reitzer, Microbiology and molecular biology reviews : MMBR 2001 - “...caiF, xseB-ispA-dxs, hcaA1, xdhABC (b2866-2868), ndh, pgpB, b1722, tolC, galETKM, ymcC, degQ, yheB, b0540, aer, glyQS, cadCBA, b2374, arsR, mviN, yieP,...”
t1207 putative outer membrane protein from Salmonella enterica subsp. enterica serovar Typhi Ty2
Aligns to 47:252 / 252 (81.7%), covers 99.0% of PF04338, 197.3 bits
- Prevalence and Diversity of Staphylococcus aureus and Staphylococcal Enterotoxins in Raw Milk From Northern Portugal
Oliveira, Frontiers in microbiology 2022 - “...CI: 0.07.6%) distinct isolates, while t002, t108, t117, t127, t189, t208, t267, t843, t899, t1200, t1207, t1334, t2383, t3585, t9216, and t19272, were associated to one (1.6%, 95% CI: 0.04.7%) S. aureus isolate ( Figure 2 ). FIGURE 2 Minimum spanning tree of the spa typing...”
- “...t011 and one t2383. S. aureus t1403, t2802, t571, t108, t189. t208, t267, t843, t1200, t1207, t1334, and t19272 were exclusively associated with strains that did not contain any of the virulence/resistance genes evaluated. In total, S. aureus t1403-none (16.1%, 95% CI: 7.025.3%) is the predominant...”
VF_0300 DUF481 domain-containing protein from Aliivibrio fischeri ES114
Aligns to 16:231 / 231 (93.5%), covers 100.0% of PF04338, 197.3 bits
STM1327 putative salt-induced outer membrane protein from Salmonella typhimurium LT2
Aligns to 47:252 / 252 (81.7%), covers 99.0% of PF04338, 197.1 bits
VF_0300 putative salt-induced outer membrane protein from Vibrio fischeri ES114
Aligns to 118:333 / 333 (64.9%), covers 100.0% of PF04338, 195.4 bits
Z2751 orf, hypothetical protein from Escherichia coli O157:H7 EDL933
Aligns to 47:252 / 252 (81.7%), covers 98.1% of PF04338, 192.9 bits
PA4390 hypothetical protein from Pseudomonas aeruginosa PAO1
PAK_04850 DUF481 domain-containing protein from Pseudomonas aeruginosa PAK
Aligns to 128:335 / 335 (62.1%), covers 100.0% of PF04338, 192.8 bits
ZMO1563 hypothetical protein from Zymomonas mobilis subsp. mobilis ZM4
Aligns to 111:322 / 327 (64.8%), covers 99.5% of PF04338, 190.6 bits
- Systems-Level Analysis of Oxygen Exposure in Zymomonas mobilis: Implications for Isoprenoid Production
Martien, mSystems 2019 - “...location in the genome, many are still completely uncharacterized. In particular, ZMO0122, ZMO0286, ZMO0994, ZMO1007, ZMO1563, ZMO1603, and ZMO1750 displayed trends in mRNA and protein levels that strongly suggest that they are involved in the response to oxygen, and yet they have no functional annotation (...”
PSPTO_4381 conserved hypothetical protein from Pseudomonas syringae pv. tomato str. DC3000
Aligns to 127:335 / 335 (62.4%), covers 100.0% of PF04338, 188.4 bits
XF1628 hypothetical protein from Xylella fastidiosa 9a5c
Aligns to 63:282 / 283 (77.7%), covers 99.5% of PF04338, 179.9 bits
Pro1529 Homolog of salt-induced outer membrane prototein from Prochlorococcus marinus str. SS120
Aligns to 81:296 / 296 (73.0%), covers 100.0% of PF04338, 122.3 bits
PA14_57070 hypothetical protein from Pseudomonas aeruginosa UCBPP-PA14
PA4391 hypothetical protein from Pseudomonas aeruginosa PAO1
Aligns to 128:333 / 333 (61.9%), covers 97.6% of PF04338, 119.3 bits
- Sequence diversity of the Pseudomonas aeruginosa population in loci that undergo microevolution in cystic fibrosis airways
Fischer, Access microbiology 2021 - “...PA2647 1848 NADH dehydrogenase I chain L PA4391 1002 Hypothetical protein (orthologue in PA14 strain: PA14_57070) PA5048 768 Probable nuclease (orthologue in PA14 strain: PA14_66700) pagL PA4661 522 Lipid A 3-O-deacylase pelA PA3064 2847 PelA (multi-domain enzyme with PEL deacetylase and hydrolase activities) pelF PA3059 1524...”
- Sequence diversity of the Pseudomonas aeruginosa population in loci that undergo microevolution in cystic fibrosis airways
Fischer, Access microbiology 2021 - “...LasR lepA PA0767 1800 GTP-binding protein LepA nuoL PA2647 1848 NADH dehydrogenase I chain L PA4391 1002 Hypothetical protein (orthologue in PA14 strain: PA14_57070) PA5048 768 Probable nuclease (orthologue in PA14 strain: PA14_66700) pagL PA4661 522 Lipid A 3-O-deacylase pelA PA3064 2847 PelA (multi-domain enzyme with...”
- “...for 7 of the 19 genes, namely algG , gacA , lepA , nuoL , PA4391, pelA , spuF ( Table 3 ). Table 2. Normalized frequency of sequence variants in the strain panel (%)* Gene Compared to PA14 reference genome Absent in a reference panel...”
- Screening for quorum-sensing inhibitors (QSI) by use of a novel genetic system, the QSI selector
Rasmussen, Journal of bacteriology 2005 - “...PA4304 PA4305 PA4306 PA4342 PA4345 PA4346 PA4354 PA4377 PA4391 PA4397 PA4435 PA4456 PA4573 PA4648 PA4649 PA4650 PA4651 PA4653 PA4738 PA4739 PA4785 PA4786 PA4788...”
2f1cX / P76045 Crystal structure of the monomeric porin ompg (see paper)
Aligns to 60:178 / 252 (47.2%), covers 49.5% of PF04338, 33.4 bits
- Ligand: (hydroxyethyloxy)tri(ethyloxy)octane (2f1cX)
2iwvA / P76045 Structure of the monomeric outer membrane porin ompg in the open and closed conformation (see paper)
Aligns to 70:188 / 277 (43.0%), covers 49.5% of PF04338, 33.1 bits
- Ligand: calcium ion (2iwvA)
OmpG / b1319 outer membrane porin G from Escherichia coli K-12 substr. MG1655 (see 17 papers)
ompG / P76045 outer membrane porin G from Escherichia coli (strain K12) (see 27 papers)
OMPG_ECOLI / P76045 Outer membrane porin G; Outer membrane protein G from Escherichia coli (strain K12) (see paper)
TC 1.B.21.1.1 / P76045 Non-specific, 14 from Escherichia coli (see 4 papers)
b1319 outer membrane porin from Escherichia coli str. K-12 substr. MG1655
NP_415835 outer membrane porin G from Escherichia coli str. K-12 substr. MG1655
Aligns to 94:212 / 301 (39.5%), covers 49.5% of PF04338, 32.8 bits
- function: Forms channels functionally larger than those of classical porins.
function: May act as a regulator of the RCS-phosphorelay signal transduction pathway.
subunit: Monomer - substrates: small molecules
tcdb comment: β-stranded monomeric OmpG porin (Conlan et al. 2000). pH-induced conformational changes of OmpG have been studied after reconstitution in native E. colilipids (Mari et al., 2010). Encoded by a gene in a gene cluster also encoding an ABC sugar uptake system (TC# 3.A.1.1.46), a glucosyl hydrolase and two oxidoreductases. Therefore it's phsiological function may be glucoside uptake. At neutral/high pH, the channel is open and permeable to substrates of size up to 900Da. At acidic pH, loop L6 folds across the channel and blocks the pore. The channel blockage at acidic pH appears to be triggered by the protonation of a histidine pair on neighboring β-strands, which repel one another, resulting in the rearrangement of loop L6 and channel closure (Köster et al. 2015). Crystallization and analysis by electron microscopy and X-ray crystallography revealed the fundamental mechanisms essential for channel activity. A 28 aa extension has been added to the 14 β-TMS barrel to make a 16 β-TMS barrel with normal activity and stability but differing pH sensitivity (Korkmaz et al. 2015). A minimized OmpG porin of only 220 aas still exhibits gating, but it was 5-fold less frequent than in native OmpG. The residual gating of the minimal pore is independent of L6 rearrangements and involves narrowing of the ion conductance pathway, most probably driven by global stretching-flexing deformations of the membrane-embedded β-barrel (Grosse et al. 2014). pH-dependent gating is controlled by an electrostatic interaction network formed between the gating loop and charged residues in the lumen (Perez-Rathke et al. 2018). 3-d structures of the protein in lipid bilayers have been solved (Retel et al. 2017). OmpG may provide a route for D-lactate/D-3-hydroxybutyrate oligo-ester secretion as well as sugar uptake (Utsunomia et al. 2017). OmpG lacks a central constriction and has an exceptionally wide pore diameter of about 13 Å. The equatorial plane of OmpG harbors an annulus of four alternating basic and acidic patches, and manipulation of charge distribution in the arginine and glutamate clusters alters sugar specificity and ion selectivity (Schmitt et al. 2019) - 18th Congress of the European Hematology Association, Stockholm, Sweden, June 13–16, 2013
, Haematologica 2013 - Further tests of a recombination model in which chi removes the RecD subunit from the RecBCD enzyme of Escherichia coli
Stahl, Genetics 1990 - “...1 1 Bts 1 Jsus6 cosML int4 red? gam210 = ysus AC b1453 b1319 imm4J4 imm" x+ c cII68 Psus80 nin5 X+ D Rsus5 Rts129 AB cos aft red .. .. int Sam CII J mML b1453 0...”
- “...These recombinants are scored for AC yms us. b1319 to determine whether the exchange that generateu the Ts' recombinant occurred in the left interval...”
- Novel bacteriophage lambda cloning vector
Karn, Proceedings of the National Academy of Sciences of the United States of America 1980 - “...was substituted to give h80 Alatt 80 - cIIII cI 857 pad P.P' b1319 81 cIts chi 3. This was then crossed with A sBam 10 b189 int 29 nin L44 cI 857 to give X sBam...”
- “...10; A. Parkinson, b189; M. Gottesman,loint cIIIj; J. Weir, b1319 and chi 3; J. Salstrom, ninL44; F. Blattner, KH54. Rich Roberts kindly supplied us with strains...”
- The isolation and partial characterization of a new restriction endonuclease from Providencia stuartii
Smith, Nucleic acids research 1976 - “...lambda b189 lambda b515 lambda b511 lambda b519 lambda b1319 lambda KH100 nin 5 lambda KH70 lambda imm 434 Reznikoff, W. Parkinson, S. Parkinson, S. Parkinson,...”
- Recombination-deficient deletions in bacteriophage lambda and their interaction with chi mutations
Henderson, Genetics 1975 - “...c1857 chi) derivatives were obtained. Apparently the integration of b1319 is infrequent i n MS1138 and during growth of a plaque new chi derivatives arise which...”
- “...quantitative liquid cross to Ab1319 ~ 1 8 5 7 . The b1319 parent was used a t an MO1 = 0.01 to enhance the frequency of b1319 chi recombinants compared to b1319...”
- Role of genetic recombination in DNA replication of bacteriophage lambda. I. Genetic characterization of the delta gene
Barta, Journal of virology 1974 - “...of 1 to 2%. Backcrossing of these recombinants with either b1319 or red,gam again yields Spi- phage, indicating that del is to the left and outside of the b1319...”
- “...the original isolate maps to the left and outside the b1319 deletion. Crosses between red,gam and A b2, a TABLE 4. Burst-size after infection of a recA hosta...”
- Rec-mediated recombinational hot spot activity in bacteriophage lambda. I. Hot spot activity associated with spi-deletions and bio substitutions
McMilin, Genetics 1974 - “...The portion of the X chromosome deleted in phage carrying either b1319, b1453, bioi or b i d 9 is indicated. The extent of the bio deletions is taken from the...”
- “...of HRADECNA and SZYBALSKI (1969) ;the extent of the b1319 and b1453 deletions is determined from the following evidence: b1319 and b1453 are missing 12% and 11%...”
- Formation and function of OmpG or OmpA-incorporated liposomes using an in vitro translation system.
Kamiya, Scientific reports 2022 - GeneRIF: Formation and function of OmpG or OmpA-incorporated liposomes using an in vitro translation system.
- A pH-independent quiet OmpG pore with enhanced electrostatic repulsion among the extracellular loops.
Pham, Biochimica et biophysica acta. Biomembranes 2021 - GeneRIF: A pH-independent quiet OmpG pore with enhanced electrostatic repulsion among the extracellular loops.
- Correlation of membrane protein conformational and functional dynamics.
Sanganna, Nature communications 2021 - GeneRIF: Correlation of membrane protein conformational and functional dynamics.
- pH-induced conformational change of the beta-barrel-forming protein OmpG reconstituted into native E. coli lipids.
Mari, Journal of molecular biology 2010 (PubMed)- GeneRIF: Upon lowering the pH to 5.0, the conformation of OmpG molecules changed to close the extracellular entrance of their channel.
- pH-dependent interactions guide the folding and gate the transmembrane pore of the beta-barrel membrane protein OmpG.
Damaghi, Journal of molecular biology 2010 (PubMed)- GeneRIF: At acidic pH, the authors detected a pH-dependent interaction at loop L6. This interaction changed the (un)folding of loop L6 and of beta-strands 11 and 12, which connect loop L6.
- Correlation between the OmpG secondary structure and its pH-dependent alterations monitored by FTIR.
Korkmaz-Ozkan, Journal of molecular biology 2010 (PubMed)- GeneRIF: The X-ray structure of the alanine-substituted OmpG mutant obtained at pH 6.5 confirms the constitutively open conformation.
- Outer membrane protein G: Engineering a quiet pore for biosensing.
Chen, Proceedings of the National Academy of Sciences of the United States of America 2008 - GeneRIF: Molecular dynamics simulations were used to identify regions of OmpG implicated in the gating.
- Structure of outer membrane protein G by solution NMR spectroscopy.
Liang, Proceedings of the National Academy of Sciences of the United States of America 2007 - GeneRIF: Complete backbone assignments were obtained for 234 of 280 residues based on CA, CB, and CO connection pathways determined from a series of TROSY-based 3D experiments at 800 MHz.
- More
- ContactPFP: Protein function prediction using predicted contact information.
Kagaya, Frontiers in bioinformatics 2022 - “...first example shows a successful prediction by ContactPFP for outer membrane porin G (UniProt ID: P76045). This protein is present in the outer membrane of E. coli , for which GO terms such as cell outer membrane (GO: 0009279) are annotated in the CC category. This...”
- “...scores over 0.9. TABLE 3 Predicted GO terms for outer membrane porin G (UniProt ID: P76045). Correct GO terms Confidence Score ContactPFP Phylo-PFP ESG PFP MF GO:0015481 Maltose transporting porin activity - - - - MF GO:0015478 oligosaccharide transporting porin activity - - 0.001 - MF...”
- Participation of the Salmonella OmpD porin in the infection of RAW264.7 macrophages and BALB/c mice
Ipinza, PloS one 2014 - “...Q8XE41, Q8CVW1, P06996, Q48473, P09888, O33507, P0A264, Q54471, P0A263, A0RZH5, P02931, Q56113, O33980, Q56828, P37432, P76045, O54339, O54340, P29739, Q9CNN9, P77747, Q56110, Q56111, A5F934, Q8DBX0, Q87LZ1, P0C6Q6, P20149, P46026, P46027, Q48216, P43839, Q48218, Q48221, P46025, Q48217, Q48219, Q48220, P80672, P38369). To avoid redundance in the searches,...”
- PONDR-FIT: a meta-predictor of intrinsically disordered amino acids.
Xue, Biochimica et biophysica acta 2010 - “...residues in a -structural transmembrane protein, outer membrane protein G from E. coli (Swissprot id: P76045). The transmembrane regions are shown by black lines. Information about these regions is extracted from SwissProt. Structured regions are shown by brown horizontal lines. Brakes between these brown lines correspond...”
PG1685 hypothetical protein from Porphyromonas gingivalis W83
Aligns to 48:260 / 260 (81.9%), covers 73.3% of PF04338, 21.8 bits
Or search for genetic data about PF04338 in the Fitness Browser
by Morgan Price,
Arkin group
Lawrence Berkeley National Laboratory