Family Search for PF04535 (DUF588)
PF04535.12 hits 40 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.
CASP5_ARATH / Q9LXF3 Casparian strip membrane protein 5; AtCASP5 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
AT5G15290 integral membrane family protein (RefSeq) from Arabidopsis thaliana
Aligns to 22:171 / 187 (80.2%), covers 99.3% of PF04535, 163.5 bits
- function: Regulates membrane-cell wall junctions and localized cell wall deposition. Required for establishment of the Casparian strip membrane domain (CSD) and the subsequent formation of Casparian strips, a cell wall modification of the root endodermis that determines an apoplastic barrier between the intraorganismal apoplasm and the extraorganismal apoplasm and prevents lateral diffusion.
subunit: Homodimer and heterodimers with other CASP proteins. Interacts with CASP1, CASP3 and CASP4. - MYB36 regulates the transition from proliferation to differentiation in the Arabidopsis root
Liberman, Proceedings of the National Academy of Sciences of the United States of America 2015 - “...AT3G11550 CASP2; AT2G27370 CASP3; AT5G06200 CASP4; AT5G15290 CASP5; AT5G03150 JACKDAW; AT1G03840 MAGPIE; AT5G44160 NUTCRACKER; AT4G11290 PER39; AT5G42180 PER64;...”
- Apoplastic diffusion barriers in Arabidopsis
Nawrath, The arabidopsis book 2013 - “...CASP2, At3g11550; CASP3, At2g27370; CASP4, At5g06200; and CASP5, At5g15290). CASPs have all the expected features for structural proteins of the CSD. They show...”
AT2G35760 integral membrane family protein (RefSeq) from Arabidopsis thaliana
Aligns to 24:174 / 201 (75.1%), covers 98.7% of PF04535, 154.2 bits
CASP1_LOTJA / P0DKC2 Casparian strip membrane protein 1; LjCASP1 from Lotus japonicus (Lotus corniculatus var. japonicus) (see paper)
Aligns to 22:171 / 186 (80.6%), covers 98.0% of PF04535, 153.9 bits
- function: Regulates membrane-cell wall junctions and localized cell wall deposition. Required for establishment of the Casparian strip membrane domain (CSD) and the subsequent formation of Casparian strips, a cell wall modification of the root endodermis that determines an apoplastic barrier between the intraorganismal apoplasm and the extraorganismal apoplasm and prevents lateral diffusion (By similarity).
subunit: Homodimer and heterodimers.
CASP2_ARATH / Q9CAX3 Casparian strip membrane protein 2; AtCASP2 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
AT3G11550 integral membrane family protein (RefSeq) from Arabidopsis thaliana
Aligns to 40:189 / 204 (73.5%), covers 99.3% of PF04535, 151.1 bits
- function: Regulates membrane-cell wall junctions and localized cell wall deposition. Required for establishment of the Casparian strip membrane domain (CSD) and the subsequent formation of Casparian strips, a cell wall modification of the root endodermis that determines an apoplastic barrier between the intraorganismal apoplasm and the extraorganismal apoplasm and prevents lateral diffusion.
subunit: Homodimer and heterodimers with other CASP proteins. Interacts with CASP1, CASP3 and CASP4. - MYB36 regulates the transition from proliferation to differentiation in the Arabidopsis root
Liberman, Proceedings of the National Academy of Sciences of the United States of America 2015 - “...selected genes are as follows: AT2G36100 CASP1; AT3G11550 CASP2; AT2G27370 CASP3; AT5G06200 CASP4; AT5G15290 CASP5; AT5G03150 JACKDAW; AT1G03840 MAGPIE;...”
- Apoplastic diffusion barriers in Arabidopsis
Nawrath, The arabidopsis book 2013 - “...PROTEINS (CASPs) (encoded by CASP1, At2g36100; CASP2, At3g11550; CASP3, At2g27370; CASP4, At5g06200; and CASP5, At5g15290). CASPs have all the expected features...”
CASP4_ARATH / Q9FFZ7 Casparian strip membrane protein 4; AtCASP4 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
AT5G06200 integral membrane family protein (RefSeq) from Arabidopsis thaliana
NP_196238 Uncharacterized protein family (UPF0497) from Arabidopsis thaliana
Aligns to 38:187 / 202 (74.3%), covers 98.7% of PF04535, 150.9 bits
- function: Regulates membrane-cell wall junctions and localized cell wall deposition. Required for establishment of the Casparian strip membrane domain (CSD) and the subsequent formation of Casparian strips, a cell wall modification of the root endodermis that determines an apoplastic barrier between the intraorganismal apoplasm and the extraorganismal apoplasm and prevents lateral diffusion.
subunit: Homodimer and heterodimers with other CASP proteins. Interacts with CASP1, CASP2, CASP3 and CASP5. - MYB36 regulates the transition from proliferation to differentiation in the Arabidopsis root
Liberman, Proceedings of the National Academy of Sciences of the United States of America 2015 - “...AT2G36100 CASP1; AT3G11550 CASP2; AT2G27370 CASP3; AT5G06200 CASP4; AT5G15290 CASP5; AT5G03150 JACKDAW; AT1G03840 MAGPIE; AT5G44160 NUTCRACKER; AT4G11290 PER39;...”
- A receptor-like kinase mutant with absent endodermal diffusion barrier displays selective nutrient homeostasis defects
Pfister, eLife 2014 - “..., At1g07940 ) 5-GTCGATTCTGGAAAGTCGACC-3 and 5-AATGTCAATGGTGATACCACGC-3; CASP1 ( At2g36100 ) 5-AGAGAGGTTTGGCTATATT-3 and 5-CTACGGCTATCACAAAGTA-3; CASP4 ( At5g06200 ) 5-AGACTTCTCTTGCTTGTTCT-3 and 5-GACAGAAATCTCCAAACTG-3; AKT1 ( At2G26650 ) 5-TCTAAATTGTGTTCTTCTTCTGTTGGA-3 and 5-CCTTCCGCGTCTCTGCAA-3; HAK5 ( At4g13420 ) 5-CGAGACGGACAAAGAAGAGGAACC-3 and 5- CACGACCCTTCCCGACCTAATCT-3. Statistical analysis All statistical analyses were done in the R environment...”
- Apoplastic diffusion barriers in Arabidopsis
Nawrath, The arabidopsis book 2013 - “...CASP1, At2g36100; CASP2, At3g11550; CASP3, At2g27370; CASP4, At5g06200; and CASP5, At5g15290). CASPs have all the expected features for structural proteins of...”
- The Arabidopsis chloroplast protein S-RBP11 is involved in oxidative and salt stress responses.
Lee, Plant cell reports 2014 (PubMed)- GeneRIF: S-RBP11 is a chloroplast protein involved in the responses to salt and oxidative stresses.
CASP1_ARATH / Q9SIH4 Casparian strip membrane protein 1; AtCASP1 from Arabidopsis thaliana (Mouse-ear cress) (see 2 papers)
AT2G36100 integral membrane family protein (RefSeq) from Arabidopsis thaliana
Aligns to 42:191 / 206 (72.8%), covers 98.7% of PF04535, 150.1 bits
- function: Regulates membrane-cell wall junctions and localized cell wall deposition. Required for establishment of the Casparian strip membrane domain (CSD) and the subsequent formation of Casparian strips, a cell wall modification of the root endodermis that determines an apoplastic barrier between the intraorganismal apoplasm and the extraorganismal apoplasm and prevents lateral diffusion.
subunit: Homodimer and heterodimers with other CASP proteins. Interacts with CASP2, CASP3, CASP4 and CASP5.
disruption phenotype: Disorganised deposition of Casparian strips. - Spatial Expression and Functional Analysis of Casparian Strip Regulatory Genes in Endodermis Reveals the Conserved Mechanism in Tomato
Li, Frontiers in plant science 2018 - “...0 Solyc03g112680 SlSGN3b AT4G20140 SGN3 47.48 0 Solyc08g081690 SlSGN4 AT1G64060 RBOHF 77.11 0 Solyc10g083250 SlCASP1a AT2G36100 CASP1 55.5 9.00E-68 Solyc06g074230 SlCASP1b AT2G36100 CASP1 58.91 3.00E-66 Solyc09g010200 SlCASP1c AT2G36100 CASP1 55.14 1E-065 Solyc04g005620 SlCASP1d AT2G36100 CASP1 46.37 2E-050 Solyc06g075630 SlESB1a AT2G28670 ESB1 64.68 1.00E-94 Solyc11g073030 SlESB1b AT2G28670...”
- Diffusible repression of cytokinin signalling produces endodermal symmetry and passage cells
Andersen, Nature 2018 - “...in supplementary table 1 or are as follows: ABI1, At4g26080; AHP6 , At1g80100; CASP1 , At2g36100; CDEF1 , At4g30140; ELTP , At2g48140; GPAT5, At3g11430; LOG3 , At2g37210; LOG4 , At3g53450; SYP122 , At3g52400 Imaging Confocal laser scanning microscopy experiments were performed on a Zeiss LSM 880...”
- Stress-Related Mitogen-Activated Protein Kinases Stimulate the Accumulation of Small Molecules and Proteins in Arabidopsis thaliana Root Exudates
Strehmel, Frontiers in Plant Science 2017 - “...Nguyen-Kim et al., 2016 AT2G22170 Lipase/lipooxygenase, PLAT/LH2 family protein Extracellular/PM De Michele et al., 2016 AT2G36100 Uncharacterised protein (UPF0497), trans-membrane plant subgroup Extracellular Nguyen-Kim et al., 2016 AT3G07470 Protein of unknown function, DUF538 Extracellular (secreted) Charmont et al., 2005 ; Nguyen-Kim et al., 2016 AT5G19860 Protein...”
- MYB36 regulates the transition from proliferation to differentiation in the Arabidopsis root
Liberman, Proceedings of the National Academy of Sciences of the United States of America 2015 - “...identifiers for selected genes are as follows: AT2G36100 CASP1; AT3G11550 CASP2; AT2G27370 CASP3; AT5G06200 CASP4; AT5G15290 CASP5; AT5G03150 JACKDAW; AT1G03840...”
- AtMYB41 activates ectopic suberin synthesis and assembly in multiple plant species and cell types
Kosma, The Plant journal : for cell and molecular biology 2014 - “...3.80.7 CAD5 At4g34230 36.17.7 C4H/REF3 At2g30490 5.31.7 PRXR9/PER30 At3g21770 27.56.8 Casparian strip assembly genes CASP1 At2g36100 20.2 ESB1 At2g28670 10.3 The accumulation of cuticle biosynthetic gene transcripts was either unaffected or slightly lower in AtMYB41 OE-9 leaves (Table 1 ). GPAT4 was the only exception, having...”
- A receptor-like kinase mutant with absent endodermal diffusion barrier displays selective nutrient homeostasis defects
Pfister, eLife 2014 - “...n.a. Baxter I et al. (2009) PLOS Genet, Lahner B et al. (2003) Nat Biotechnol AT2G36100 Col-0 SAIL_265_H05 casp1-1 LP: GCGTTTCAGTACGTCCCTTC RP: CACGTGAGGGAAGTGAGTCTC Roppolo et al. (2011) Nature AT2G27370 Col-0 SALK_011092 casp3-1 LP: GACTCTTCCTTTCTTCACTC RP: GACCAACACAACCGTACGAAC Roppolo et al. (2011) Nature Vector construction and transgenic lines...”
- “...were used EF1 ( At1g07920 , At1g07930 , At1g07940 ) 5-GTCGATTCTGGAAAGTCGACC-3 and 5-AATGTCAATGGTGATACCACGC-3; CASP1 ( At2g36100 ) 5-AGAGAGGTTTGGCTATATT-3 and 5-CTACGGCTATCACAAAGTA-3; CASP4 ( At5g06200 ) 5-AGACTTCTCTTGCTTGTTCT-3 and 5-GACAGAAATCTCCAAACTG-3; AKT1 ( At2G26650 ) 5-TCTAAATTGTGTTCTTCTTCTGTTGGA-3 and 5-CCTTCCGCGTCTCTGCAA-3; HAK5 ( At4g13420 ) 5-CGAGACGGACAAAGAAGAGGAACC-3 and 5- CACGACCCTTCCCGACCTAATCT-3. Statistical analysis All statistical...”
- Apoplastic diffusion barriers in Arabidopsis
Nawrath, The arabidopsis book 2013 - “...STRIP DOMAIN PROTEINS (CASPs) (encoded by CASP1, At2g36100; CASP2, At3g11550; CASP3, At2g27370; CASP4, At5g06200; and CASP5, At5g15290). CASPs have all the...”
CSPLP_ARATH / Q8L9B5 CASP-like protein 2B1; AtCASPL2B1 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
Aligns to 5:155 / 182 (83.0%), covers 99.3% of PF04535, 148.2 bits
- subunit: Homodimer and heterodimers.
CSPL2_ARATH / Q9XI72 CASP-like protein 1A1; AtCASPL1A1 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
Aligns to 45:194 / 209 (71.8%), covers 99.3% of PF04535, 143.1 bits
- subunit: Homodimer and heterodimers.
CASP3_ARATH / Q9ZQI2 Casparian strip membrane protein 3; AtCASP3 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
AT2G27370 integral membrane family protein (RefSeq) from Arabidopsis thaliana
Aligns to 56:205 / 221 (67.9%), covers 98.7% of PF04535, 142.7 bits
- function: Regulates membrane-cell wall junctions and localized cell wall deposition. Required for establishment of the Casparian strip membrane domain (CSD) and the subsequent formation of Casparian strips, a cell wall modification of the root endodermis that determines an apoplastic barrier between the intraorganismal apoplasm and the extraorganismal apoplasm and prevents lateral diffusion.
subunit: Homodimer and heterodimers with other CASP proteins. Interacts with CASP1, CASP2, CASP4 and CASP5.
disruption phenotype: Disorganised deposition of Casparian strips. - MYB36 regulates the transition from proliferation to differentiation in the Arabidopsis root
Liberman, Proceedings of the National Academy of Sciences of the United States of America 2015 - “...are as follows: AT2G36100 CASP1; AT3G11550 CASP2; AT2G27370 CASP3; AT5G06200 CASP4; AT5G15290 CASP5; AT5G03150 JACKDAW; AT1G03840 MAGPIE; AT5G44160 NUTCRACKER;...”
- Phylloxera (Daktulosphaira vitifoliae Fitch) alters the carbohydrate metabolism in root galls to allowing the compatible interaction with grapevine (Vitis ssp.) roots
Griesser, Plant science. 2015 - “...Wound-induced protein WI12 at5g01740 TC123291 3.06 1.32E07 15 0.00000 GSVIVT01036085001 VIT_06s0080g00840 Integral membrane family protein at2g27370 TC121390 3.08 4.61E07 112 0.00005 GSVIVT01009902001 VIT_18s0001g14270 Gibberellin-regulated protein 1 (GASA1) at1g75750 TC133463 3.20 7.14E07 178 0.00013 GSVIVT01029241001 VIT_11s0052g00650 Peroxidase at2g18980 TC132265 3.31 8.80E07 230 0.00020 GSVIVT01019452001 VIT_02s0025g00750 Pinoresinol forming...”
- A receptor-like kinase mutant with absent endodermal diffusion barrier displays selective nutrient homeostasis defects
Pfister, eLife 2014 - “...Nat Biotechnol AT2G36100 Col-0 SAIL_265_H05 casp1-1 LP: GCGTTTCAGTACGTCCCTTC RP: CACGTGAGGGAAGTGAGTCTC Roppolo et al. (2011) Nature AT2G27370 Col-0 SALK_011092 casp3-1 LP: GACTCTTCCTTTCTTCACTC RP: GACCAACACAACCGTACGAAC Roppolo et al. (2011) Nature Vector construction and transgenic lines For generation of expression constructs, Gateway Cloning Technology (Invitrogen, Carlsbad, CA) or standard...”
- Apoplastic diffusion barriers in Arabidopsis
Nawrath, The arabidopsis book 2013 - “...(encoded by CASP1, At2g36100; CASP2, At3g11550; CASP3, At2g27370; CASP4, At5g06200; and CASP5, At5g15290). CASPs have all the expected features for structural...”
CSPLM_ARATH / Q9FE29 CASP-like protein 1D1; AtCASPL1D1 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
AT4G15610, NP_567472 integral membrane family protein (RefSeq) from Arabidopsis thaliana
Aligns to 23:176 / 193 (79.8%), covers 99.3% of PF04535, 142.1 bits
- subunit: Homodimer and heterodimers.
- Identification of Candidate Ergosterol-Responsive Proteins Associated with the Plasma Membrane of Arabidopsis thaliana
Khoza, International journal of molecular sciences 2019 - “...protein RABE1c At3g46060 P28186 Signaling GTPase 1071.641 0.7 394.8 8.40 A9, A12 CASP-like protein 1D1 At4g15610 Q9FE29 --- --- 1127.657 0.3 389.4 9.41 A11 Plasma membrane ATPase At4g30190 F4JPJ7 Transport Translocase 1040.574 0.2 381.3 8.04 A11 ATPase 5, plasma membrane-type At2g24520 Q9SJB3 Transport Translocase 1040.574 0.0...”
- Cell Wall Remodeling in Abscission Zone Cells during Ethylene-Promoted Fruit Abscission in Citrus
Merelo, Frontiers in Plant Science 2017 - “...(CADs) CitCAD3 aCL33Contig1 C18001A01 AT4G37970 0.90 CASPARIAN STRIP MEMBRANE DOMAIN PROTEINS (CASPs) CitCASPL1D1a aCL6688Contig1 C04010H11 AT4G15610 0.74 CitCASPL2B2 aCL5933Contig1 C32104D12 AT2G35760 0.82 CitCASPL4A4 aC08028B10SK_c C08028B10 AT4G11655 0.93 0.61 , No significant regulation. Putative gene identifications are based on sequence homology with Arabidopsis thaliana. Additional data are...”
- Systems-wide analysis of manganese deficiency-induced changes in gene activity of Arabidopsis roots
Rodríguez-Celma, Scientific reports 2016 - “...0.93 Robustly Mn-responsive genes (i.e. changed at the mRNA and protein level) with miscellaneous functions AT4G15610 Uncharacterised protein family (UPF0497) 93.23 1.78 AT1G18670 IBS1 Protein kinase superfamily protein 21.49 1.58 AT5G42250 Zinc-binding alcohol dehydrogenase family protein 21.69 1.58 AT1G45145 H5 Thioredoxin H-type 5 107.51 1.5 AT3G26450...”
- Unraveling the iron deficiency responsive proteome in Arabidopsis shoot by iTRAQ-OFFGEL approach
Zargar, Plant signaling & behavior 2013 - “...0.115 1.301 0.146 AT1G02930 glutathione S-transferase 6 1.7 33.2 3.693 0.317 2.091 0.203 0.958 0.121 AT4G15610 Uncharacterised protein family (UPF0497) 3.0 14.5 3.470 1.610 2.406 0.911 0.906 0.102 AT4G38540 FAD/NAD(P)-binding oxidoreductase family protein 2.3 4.8 3.291 0.443 2.702 0.507 1.156 0.177 AT5G67330 natural resistance associated macrophage...”
- Relative abundance of integral plasma membrane proteins in Arabidopsis leaf and root tissue determined by metabolic labeling and mass spectrometry
Bernfur, PloS one 2013 - “...1 1 1.00 2 lR AT2G39530 Unknown molecular functions 19191 3 1 1.00 13 R AT4G15610 Unknown molecular functions 20796 4 1 0.81 12 lR AT5G44550 Unknown molecular functions 21019 4 1 1.00 7 R Proteins are grouped according to function and all annotation is via...”
- Arsenomics: omics of arsenic metabolism in plants
Tripathi, Frontiers in physiology 2012 - “...() 1.55 Os12g05394 () 3.27 Os09g12240 () 3.49 Integral membrane family protein Os04g45520 () 18.34 At4g15610 () 1.58 NAC domain-containing protein Os10g21630 (+) 5.81 At5g08790 () 1.53 Os02g15340 () 3.71 Compilation of data based on monocot O. sativa (Chakrabarty et al., 2009 ) and dicot (A....”
- Molecular responses of Lotus japonicus to parasitism by the compatible species Orobanche aegyptiaca and the incompatible species Striga hermonthica
Hiraoka, Journal of experimental botany 2009 - “...Medicago truncatula ; ABD32291) 0.007 BB999957 LjSh15 Integral membrane family protein ( Arabidopsis thaliana ; NP_567472) 1.6E-46 BB999934 LjSh76-1 Uncharacterized Cys-rich domain ( Medicago truncatula ; ABD32291) 7.0E-14 BB999960 LjSh107s UPF0497 membrane protein ( Arabidopsis thaliana ; Q9SQU2) 2.0E-17 BB999935 LjSh11 Integral membrane family protein (...”
- Isolation and functional characterization of cold-regulated promoters, by digitally identifying peach fruit cold-induced genes from a large EST dataset
Tittarelli, BMC plant biology 2009 - “...6 2 Expressed protein (located in mitochondrion); At5g51040 C2267 7 0 Integral membrane family protein; At4g15610 C2315 5 3 Expressed protein; At1g70780 C2318 3 2 Ribosome associated membrane protein RAMP4; At1g27350 C2343 9 9 Novel gene C2560 6 1 Expressed protein; At3g27880 C2591 6 1 Expressed...”
- More
CSPLK_ARATH / Q9ZT81 CASP-like protein 1C1; AtCASPL1C1 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
AT4G03540 integral membrane family protein (RefSeq) from Arabidopsis thaliana
Aligns to 3:143 / 164 (86.0%), covers 97.3% of PF04535, 141.7 bits
AT5G44550 integral membrane family protein (RefSeq) from Arabidopsis thaliana
Aligns to 12:168 / 197 (79.7%), covers 98.0% of PF04535, 139.5 bits
CSPL3_ARATH / Q8VZQ3 CASP-like protein 2A1; AtCASPL2A1 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
AT1G17200 integral membrane family protein (RefSeq) from Arabidopsis thaliana
Aligns to 27:169 / 204 (70.1%), covers 97.3% of PF04535, 139.1 bits
- subunit: Homodimer and heterodimers.
- Membrane Proteomics of Arabidopsis Glucosinolate Mutants cyp79B2/B3 and myb28/29
Mostafa, Frontiers in plant science 2017 - “...Water deficiency response and transport D, H, S, T, M Kammerloher et al., 1994 Q8VZQ3 At1g17200 CASP-like protein At1g17200 AT1G17200 0.590 0.016 Binding activity D, H, S, T, M Tair Q9M386 At3g54200 Late embryogenesis abundant hydroxyproline-rich glycoprotein F24B22.160 0.588 0.004 . D, H, S, T, M...”
- Arabidopsis thaliana resistance to fusarium oxysporum 2 implicates tyrosine-sulfated peptide signaling in susceptibility and resistance to root infection
Shen, PLoS genetics 2013 - “...same gene that correlated with enhanced resistance in 1A3 transformants, whereas insertion in Salk_140524 interrupts At1g17200, a gene outside the overlapping sequence in Kpn1.2 and Sal1.2. Salk_051677, which was previously named Atrlp3-1 without a reported phenotype, was renamed rfo2 [31] . 10.1371/journal.pgen.1003525.g003 Figure 3 T-DNA insertion...”
- “...rfo2 abolishes RFO2 QTL. (A) Fractions of n F 1 hybrids of Ty-0 and Salk_014524 (At1g17200) or Salk_051677 (At1g17250) were susceptible or resistant or had intermediate resistance, according to HI scores at 21 dpi. Median ranks of the two F 1 hybrids are dissimilar, according to...”
CSPLD_ARATH / Q9SQU2 CASP-like protein 1D2; AtCASPL1D2 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
Aligns to 32:185 / 199 (77.4%), covers 97.3% of PF04535, 138.7 bits
- subunit: Homodimer and heterodimers.
CSPLQ_ARATH / Q9SUP0 CASP-like protein 1B2; AtCASPL1B2 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
Aligns to 12:168 / 197 (79.7%), covers 98.7% of PF04535, 137.1 bits
- subunit: Homodimer and heterodimers.
CSPLO_ARATH / Q8L8Z1 CASP-like protein 1E1; AtCASPL1E1 from Arabidopsis thaliana (Mouse-ear cress) (see 2 papers)
AT4G15630 integral membrane family protein (RefSeq) from Arabidopsis thaliana
Aligns to 21:177 / 190 (82.6%), covers 98.0% of PF04535, 135.9 bits
- subunit: Homodimer and heterodimers.
- Membrane Proteomics of Arabidopsis Glucosinolate Mutants cyp79B2/B3 and myb28/29
Mostafa, Frontiers in plant science 2017 - “...and ion transport D, H, S, T, M Rai et al., 2016 ; tair Q8L8Z1 At4g15630 CASP-like protein At4g15630 AT4G15630 0.701 0.024 Binding of protein D, H, S, T, M Tair Q9FYK0 At1g24650 Leucine-rich repeat protein kinase F21J9.31 LRR-RLK 0.701 0.043 Growth process. D, S, T,...”
- Unraveling the iron deficiency responsive proteome in Arabidopsis shoot by iTRAQ-OFFGEL approach
Zargar, Plant signaling & behavior 2013 - “...0.502 0.061 1.073 0.073 AT4G16155 dihydrolipoyl dehydrogenases 3.0 0.2 0.381 0.124 0.507 0.095 0.808 0.351 AT4G15630 Uncharacterised protein family (UPF0497) 2.0 0.1 0.387 0.082 0.544 0.009 0.900 0.063 AT1G68530 3-ketoacyl-CoA synthase 6 1.7 0.0 0.394 0.104 0.600 0.207 1.080 0.396 AT3G16950 lipoamide dehydrogenase 1 2.0 0.2...”
- Transcriptome analyses of early cucumber fruit growth identifies distinct gene modules associated with phases of development
Ando, BMC genomics 2012 - “...3); actin binding 5.0E-63 153 715 766 317 No hits found 12937 953 418 312 AT4G15630 integral membrane family protein 3.0E-37 11169 949 792 284 AT1G28330 DYL1 (DORMANCY-ASSOCIATED PROTEIN-LIKE 1) 3.0E-41 2993 1046 494 270 No hits found 2805 767 757 267 No hits found 13496...”
CSPLN_ARATH / O23413 CASP-like protein 1E2; AtCASPL1E2 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
AT4G15620 integral membrane family protein (RefSeq) from Arabidopsis thaliana
Aligns to 22:177 / 190 (82.1%), covers 97.3% of PF04535, 129.8 bits
- subunit: Homodimer and heterodimers.
- Arabidopsis flower specific defense gene expression patterns affect resistance to pathogens
Ederli, Frontiers in Plant Science 2015 - “...Ribonuclease 1 AT4G24000 CA Cellulose synthase G2 AT4G23680 Polyketide cyclase, lipid transport AT1G02790 CA Exopolygalacturonase AT4G15620 UPF 497 membrane protein AT3G27810 MYB21, R2R3-MYB family AT1G80160 CA Lactoylglutathione lyase AT5G15800 Developmental protein SEPALLATA 1 AT1G54570 CA Acyltransferase-like protein, chloroplast AT2G47030 CA Pectinesterase 4 AT4G33040 CA Glutaredoxin-C6 AT5G02580...”
CSPLF_ARATH / Q3EB59 CASP-like protein 3A1; AtCASPL3A1 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
Aligns to 41:196 / 212 (73.6%), covers 98.7% of PF04535, 126.9 bits
- subunit: Homodimer and heterodimers.
GRMZM5G806387 CASP-like protein 2A1 from Zea mays
Aligns to 36:177 / 213 (66.7%), covers 98.7% of PF04535, 126.6 bits
- Genome-wide association study Identified multiple Genetic Loci on Chilling Resistance During Germination in Maize
Hu, Scientific reports 2017 - “...RDT50/RGI ss196436428 GRMZM2G178486 *# exon 248.98 0.81 Zinc finger proteins: C3HC4-type family proteins RDT50/RGI ss196436428 GRMZM5G806387 *# exon 366.49 0.8 Casp-like protein 2a1 RDT50/RGI ss196436428 GRMZM2G148793 # intron 216.19 0.86 TPA: hypothetical protein ZEAMMB73_617749 All candidate genes contain either an associated SNP or a SNP in...”
- “...GRMZM2G462797 ZEAMMB73_597353 AT1G12650.1 LOC_Os09g35670.1 12 GRMZM2G704005 ZEAMMB73_876334 AT2G32090.1 LOC_Os03g45720 13 GRMZM5G802338 NA NA NA 14 GRMZM5G806387 ZEAMMB73_117651 AT1G17200.1 LOC_Os04g21320 15 GRMZM2G113158 ZEAMMB73_572941 AT1G34300.1 LOC_Os03g62180 16 GRMZM2G318156 ZEAMMB73_082780 NA NA 17 GRMZM5G871707 NA NA NA 18 GRMZM2G148793 NA NA NA Functional prediction of candidate genes We found...”
N24_MEDTR / O24088 CASP-like protein N24; CASP-like protein 4A1; MtCASPL4A1; Nodulin 24; MtN24 from Medicago truncatula (Barrel medic) (Medicago tribuloides) (see paper)
Aligns to 61:218 / 234 (67.5%), covers 98.0% of PF04535, 122.6 bits
- subunit: Homodimer and heterodimers.
AT4G25830 integral membrane family protein (RefSeq) from Arabidopsis thaliana
Aligns to 1:147 / 175 (84.0%), covers 98.0% of PF04535, 121.5 bits
BLE3_ORYSJ / Q84UT5 CASP-like protein BLE3; CASP-like protein 1C2; OsCASPL1C2; Protein brassinolide-enhanced 3; OsBLE3; Protein BL-enhanced 3 from Oryza sativa subsp. japonica (Rice) (see paper)
XP_015638091 CASP-like protein BLE3 from Oryza sativa Japonica Group
Aligns to 2:142 / 162 (87.0%), covers 97.3% of PF04535, 121.3 bits
Sb09g008190 No description from Sorghum bicolor
Aligns to 2:142 / 162 (87.0%), covers 97.3% of PF04535, 120.3 bits
CSPLR_ARATH / Q9M0L3 CASP-like protein 1F1; AtCASPL1F1 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
Aligns to 14:155 / 170 (83.5%), covers 96.0% of PF04535, 118.3 bits
- subunit: Homodimer and heterodimers.
AT3G55390 integral membrane family protein (RefSeq) from Arabidopsis thaliana
Aligns to 31:168 / 194 (71.1%), covers 97.3% of PF04535, 112.1 bits
- A Casparian strip domain-like gene, CASPL, negatively alters growth and cold tolerance
Yang, Scientific reports 2015 - “...membrane protein in watermelon 13 . The orthologue to this gene was identified to be At3g55390 in Arabidopsis thaliana , where it is annotated as the CASP-LIKE PROTEIN 4C1. At3g55390 belongs to the CASP protein family containing the five CASP genes ( CASP1/2/3/4/5) , which are...”
- “...of Arabidopsis ( Arabidopsis thaliana) (Col-0) were used for amplification of ClCASPL and AtCASPL4C1 ( At3G55390 ) genes. WT Arabidopsis thaliana (Col-0) was used for transformation to construct OX-ClCASPL of Arabidopsis. The SALK_034800C line was used for screening of homozygous Atcaspl4c1 knock-out mutant plants. 3-week-old plants...”
- Requirement of the C3HC4 zinc RING finger of the Arabidopsis PEX10 for photorespiration and leaf peroxisome contact with chloroplasts
Schumann, Proceedings of the National Academy of Sciences of the United States of America 2007 - “...a prokaryotic membrane lipoprotein with a lipid attachment site (At3g55390). In Zn2, the integration was found 140 bp downstream of the stop codon within the 3...”
- “...809777 with an insertion in the third exon of the gene At3g55390 affected in the Zn1 line, and SALK line 537722 with an insertion in the fifth exon of the gene...”
CSPLE_ARATH / Q9LUL1 CASP-like protein 2A2; AtCASPL2A2 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
AT3G14380 integral membrane family protein (RefSeq) from Arabidopsis thaliana
Aligns to 17:172 / 178 (87.6%), covers 98.0% of PF04535, 109.8 bits
- function: Involved in floral organ shedding.
subunit: Homodimer and heterodimers.
disruption phenotype: Delayed timing of petal abscission. - In silico analysis of high affinity potassium transporter (HKT) isoforms in different plants
Zamani, Aquatic biosystems 2014 - “...response MYB21 MYB3 Lipase class 3 family protein MYB24 DNA binding-jasmonic & giberellic acid response At3g14380 Integral membrane family protein At5g49130 MATE efflux family protein AtUGT85A3 Glucuronosyl transferase CYP76C3 Electron carrier activity At1g29490 Auxin-responsive family protein At3g55870 Anthranilate synthase, alpha subunit, putative AtMYB57 DNA binding-jasmonic &...”
- A novel approach to dissect the abscission process in Arabidopsis
González-Carranza, Plant physiology 2012 (PubMed)- “...and an IDA-overexpressing line. Phenotypic analysis of an At3g14380 transfer DNA insertion line indicates that this gene plays a functional role in floral organ...”
- “...expression of seven genes, At1g64405, At2g23630, At2g44010, At3g14380, At3g53040, At3g56350, and At5g50540, four of which (At1g64405, At2g44010, At3g53040, and...”
LOC110788005 CASP-like protein XL3 from Spinacia oleracea
Aligns to 1:155 / 190 (81.6%), covers 96.7% of PF04535, 109.7 bits
CSPLX_ARATH / Q9FFT2 CASP-like protein 2D1; AtCASPL2D1 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
Aligns to 26:166 / 194 (72.7%), covers 98.0% of PF04535, 109.5 bits
- subunit: Homodimer and heterodimers.
CSPLU_ARATH / Q9LZM5 CASP-like protein 5B1; AtCASPL5B1 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
AT5G02060 integral membrane protein, putative (RefSeq) from Arabidopsis thaliana
Aligns to 6:139 / 152 (88.2%), covers 99.3% of PF04535, 106.0 bits
- subunit: Homodimer and heterodimers.
- Using intron position conservation for homology-based gene prediction
Keilwagen, Nucleic acids research 2016 - “...matches the sequenced cDNA confirming among others the alternative splicing for At3g57910. In case of At5g02060, we found a 1 bp deletion in the reference sequence leading two a 4 bp difference at the donor splice site of exon 2, which GeMoMa is conceptually unable to...”
- “...Sc_19.43 () 367369 missing gene as predicted At4g16566 Sc_29.148 () 15591575 missing gene as predicted At5g02060 Sc_33 () 16651673 missing gene well matching At3g57910 Sc_85 () 586589 1 missing exon as predicted At4g38240 Sc_28580 () 411 2 missing exons well matching At3g13120 Sc_12 (+) 15681570 2...”
CSPLI_ARATH / Q945M8 CASP-like protein 5B2; AtCASPL5B2 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
AT3G53850 hypothetical protein (RefSeq) from Arabidopsis thaliana
Aligns to 6:139 / 154 (87.0%), covers 98.0% of PF04535, 103.3 bits
- subunit: Homodimer and heterodimers.
- Genetical genomics identifies the genetic architecture for growth and weevil resistance in spruce
Porth, PloS one 2012 - “...WS00912_K11 0.080 2.1E47 AT2G19680 mitochondrial ATP synthase g subunit family protein miscellaneous WS00927_K21 0.082 2.10E026 AT3G53850 similar to integral membrane protein, putative [Arabidopsis thaliana] miscellaneous WS00712_A12 0.091 8.40E084 AT1G60420 DC1 domain-containing protein miscellaneous WS0032_G24 0.095 3.90E057 AT2G37270 ATRPS5B ATRPS5B (RIBOSOMAL PROTEIN 5B); structural constituent of ribosome...”
CSPL6_ARATH / Q9SKN3 CASP-like protein 5A2; AtCASPL5A2 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
AT2G28370 hypothetical protein (RefSeq) from Arabidopsis thaliana
Aligns to 34:164 / 179 (73.2%), covers 99.3% of PF04535, 97.7 bits
- subunit: Homodimer and heterodimers.
- Transcriptome analysis of resistant soybean roots infected by Meloidogyne javanica
de, Genetics and molecular biology 2012 - “...Positives = 39/80 (48%) Plasmodium yoelii ref|XP_730210.1| 3.0 0 2 2 Contig62 UPF0497 membrane protein At2g28370, Positives = 49/55 (89%) Arabidopsis thaliana sp|Q9SKN3.1|U4977_ARATH 1e-20 0 2 2 Contig63 MADS-box protein SOC1 (protein suppressor of constans overexpression 1) Positives = 77/82 (93%) Glycine max gb|ABC75835.1| 3e-33 0...”
- A single Banana streak virus integration event in the banana genome as the origin of infectious endogenous pararetrovirus
Gayral, Journal of virology 2008 - “...found No significant similarity found Hypothetical protein At2g28370 (Arabidopsis thaliana) NA ATPase subunit (Calycanthus fertilis) NA 1e.15 8e.07 Result NA No...”
- Conserved features of germination and polarized cell growth: a few insights from a pollen-fern spore comparison
Bushart, Annals of Botany 2007 - “...AT1G23750, AT2G21870, AT2G29040, AT2G32910, AT4G10440, AT1G64980, AT2G28370, AT4G22310, AT4G28050, AT4G31420, AT4G39230, AT5G67490 No. of Ceratopteris ESTs* 4 3...”
AT2G38480 integral membrane protein, putative (RefSeq) from Arabidopsis thaliana
Aligns to 41:170 / 188 (69.1%), covers 98.0% of PF04535, 92.1 bits
- Overexpression and cosuppression of xylem-related genes in an early xylem differentiation stage-specific manner by the AtTED4 promoter
Endo, Plant biotechnology journal 2018 - “...0.194 0.018 20 At5g17600 7.397 3.301 0 At1g70550 0.225 0.023 5 At1g75410 15.512 2.736 3 At2g38480 0.231 0.021 2 At4g28500 18.555 0.095 2 At5g26330 0.263 ( n =2) 1 At5g03170 23.441 3.623 0 At5g08370 0.311 ( n =2) 13 At2g38080 27.376 0.503 5 At1g78340 0.386 0.077...”
- Extra Large G-Protein Interactome Reveals Multiple Stress Response Function and Partner-Dependent XLG Subcellular Localization
Liang, Frontiers in Plant Science 2017 - “...ATP synthase subunit gamma 0.235 5.8E-28 Y2H SAL XLG3 At2g34410 O-acetyltransferase-like protein Y2H GLUC XLG3 At2g38480 * CASP-like protein 0.135 1.3E-12 Y2H/BiFC GLUC XLG3 At2g40140 * Zinc finger CCCH domain-containing protein 29 0.137 1.1E-35 Y2H/BiFC GLUC XLG3 At2g41430 * Dehydration-induced protein ERD15 0.162 2.0E-32 Y2H GLUC...”
- “...XLG1 and 3 interacting proteins outside the nucleus. (A) At1g71030 (B) At1g44170 (C) At4g02380 (D) At2g38480 (E) At3g19640 (F) At5g66240. The XLGs were fused to the N-terminus of YFP and the prey proteins were fused to the C-terminus of YFP. The bait constructs nYFP-XLG1 and XLG3...”
- Membrane Proteomics of Arabidopsis Glucosinolate Mutants cyp79B2/B3 and myb28/29
Mostafa, Frontiers in plant science 2017 - “...kinase AT1G11410 0.733 0.049 Kinase and binding activities D, H, S, T, M Tair Q8LE26 At2g38480 CASP-like protein At2g38480 AT2G38480 0.729 0.002 D, H, T, M Tair P43287 At2g37170 Aquaporin PIP2-2 PIP2-2 0.725 0.011 Water deficiency response and transport D, H, S, T, M Javot, 2003...”
- The hunt for hypoxia responsive natural antisense short interfering RNAs
Moldovan, Plant signaling & behavior 2010 - “...under hypoxia. The results showed that three genes AT2G38480, AT3G61300 and AT1G55390 had lost repression under hypoxia in the nrpd1a mutant by at least...”
- “...between genes was found, although none belonging to AT2G38480, AT3G61300 or AT1G55390. However, the deep sequencing had not reached saturation, and most of the...”
NP_001237047 uncharacterized protein LOC100527764 from Glycine max
Aligns to 37:167 / 182 (72.0%), covers 98.0% of PF04535, 87.3 bits
CSPLG_ARATH / Q8L7R5 CASP-like protein 5B3; AtCASPL5B3 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
AT3G23200 hypothetical protein (RefSeq) from Arabidopsis thaliana
Aligns to 6:137 / 152 (86.8%), covers 98.0% of PF04535, 85.7 bits
- subunit: Homodimer and heterodimers.
- miRNA and Degradome Sequencing Reveal miRNA and Their Target Genes That May Mediate Shoot Growth in Spur Type Mutant "Yanfu 6"
Song, Frontiers in Plant Science 2017 - “...novel_mir_249 MDP0000540293 Protein phosphatase 2A subunit A2 AT3G25800 PP2AA2 novel_mir_249 MDP0000541775 Uncharacterised protein family (UPF0497) AT3G23200 novel_mir_249 MDP0000651056 AT5G05800 novel_mir_249 MDP0000674456 novel_mir_249 MDP0000690147 ARM repeat superfamily protein AT4G16490 novel_mir_249 MDP0000701629 novel_mir_263 MDP0000165935 Nucleotide/sugar transporter family protein AT5G17630 novel_mir_266 MDP0000368249 novel_mir_292 MDP0000530198 EXORDIUM like 3 AT5G51550 EXL3...”
CSPL4_ARATH / Q3ECT8 CASP-like protein 5C3; AtCASPL5C3 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
Aligns to 6:136 / 152 (86.2%), covers 98.7% of PF04535, 85.0 bits
- subunit: Homodimer and heterodimers.
PIMP1_CAPAN / A1XGB4 CASP-like protein PIMP1; CASP-like protein 4D1; CaCASPL4D1; Pathogen-induced membrane protein 1; CaPIMP1 from Capsicum annuum (Capsicum pepper) (see 2 papers)
Aligns to 9:157 / 166 (89.8%), covers 96.0% of PF04535, 83.3 bits
- function: Required for defense response to Xanthomonas campestris pv. vesicatoria (Xcv). In heterologous systems, confers resistance to bacterial pathogens such as Pseudomonas syringae pv. tomato but susceptibility to pathogenic oomycetes such as Hylaloperonospora parasitica when expressed in Arabidopsis thaliana. May be involved in the regulation of responses to bitoic and abiotic stresses.
subunit: Homodimer and heterodimers.
AT4G11655 transmembrane protein, putative (RefSeq) from Arabidopsis thaliana
Aligns to 49:190 / 208 (68.3%), covers 98.7% of PF04535, 82.6 bits
CSPLC_ARATH / Q8GWD5 CASP-like protein 4D1; AtCASPL4D1 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
AT2G39530 integral membrane protein, putative (RefSeq) from Arabidopsis thaliana
Aligns to 10:158 / 178 (83.7%), covers 98.0% of PF04535, 79.6 bits
AT2G39518 hypothetical protein (RefSeq) from Arabidopsis thaliana
Aligns to 10:158 / 174 (85.6%), covers 98.7% of PF04535, 74.5 bits
LOC103976748 CASP-like protein 4D1 from Musa acuminata subsp. malaccensis
Aligns to 5:165 / 180 (89.4%), covers 76.0% of PF04535, 71.9 bits
- Banana (Musa acuminata) transcriptome profiling in response to rhizobacteria: Bacillus amyloliquefaciens Bs006 and Pseudomonas fluorescens Ps006
Gamez, BMC genomics 2019 - “...81 CACCTGAGTGCATGGGGATT CCCTAGAGCAAGCTACAGCC 60 5560 LOC103971548 Cyclic dof factor 3-like 86 GCACAGGCTTCTGATCTGGT GCCTTGACAAACCTTGCCTG 60 55 LOC103976748 CASP-like protein 4D1 89 AATGGCCTCTTCGACCAAGG TGACGACGAGGGAAACCAAG 60 55 LOC103987539 U-Box domain-containing protein 21-like 89 CCACGCGATACGGAAGATGA TCACCGGAATCTTAGGCGTG 60 55 LOC103990849 Serine/threonine-protein kinase 115 AACTGATCGGGTACTGCTGC GACCACGGCAACGAAGAAAC 60 55 LOC103972371 Cycle dof factor...”
- “...Protein family and a transmembrane protein involved in plant growth [ 27 ]. CASP-like 4D1, LOC103976748 was transcriptionally regulated in the presence of Bs006, with a fold change value of 6.03 (Fig. 7 b). CASP-like 4D1, as well as the extensin LRX3, are influenced by the...”
Or search for genetic data about PF04535 in the Fitness Browser
by Morgan Price,
Arkin group
Lawrence Berkeley National Laboratory