Family Search for PF04535 (DUF588)

PF04535.12 hits 35 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.

CASP5_ARATH / Q9LXF3 Casparian strip membrane protein 5; AtCASP5 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
AT5G15290 integral membrane family protein (RefSeq) from Arabidopsis thaliana
Aligns to 22:171 / 187 (80.2%), covers 99.3% of PF04535, 163.5 bits

• function: Regulates membrane-cell wall junctions and localized cell wall deposition. Required for establishment of the Casparian strip membrane domain (CSD) and the subsequent formation of Casparian strips, a cell wall modification of the root endodermis that determines an apoplastic barrier between the intraorganismal apoplasm and the extraorganismal apoplasm and prevents lateral diffusion.
  subunit: Homodimer and heterodimers with other CASP proteins. Interacts with CASP1, CASP3 and CASP4.
• MYB36 regulates the transition from proliferation to differentiation in the Arabidopsis root
  Liberman, Proceedings of the National Academy of Sciences of the United States of America 2015
  • “...AT3G11550 CASP2; AT2G27370 CASP3; AT5G06200 CASP4; AT5G15290 CASP5; AT5G03150 JACKDAW; AT1G03840 MAGPIE; AT5G44160 NUTCRACKER; AT4G11290 PER39; AT5G42180 PER64;...”
• Apoplastic diffusion barriers in Arabidopsis
  Nawrath, The Arabidopsis book 2013
  • “...CASP2, At3g11550; CASP3, At2g27370; CASP4, At5g06200; and CASP5, At5g15290). CASPs have all the expected features for structural proteins of the CSD. They show...”

CASP1_LOTJA / P0DKC2 Casparian strip membrane protein 1; LjCASP1 from Lotus japonicus (Lotus corniculatus var. japonicus) (see paper)
Aligns to 22:171 / 186 (80.6%), covers 98.0% of PF04535, 153.9 bits

• function: Regulates membrane-cell wall junctions and localized cell wall deposition. Required for establishment of the Casparian strip membrane domain (CSD) and the subsequent formation of Casparian strips, a cell wall modification of the root endodermis that determines an apoplastic barrier between the intraorganismal apoplasm and the extraorganismal apoplasm and prevents lateral diffusion (By similarity).
  subunit: Homodimer and heterodimers.

CASP2_ARATH / Q9CAX3 Casparian strip membrane protein 2; AtCASP2 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
AT3G11550 integral membrane family protein (RefSeq) from Arabidopsis thaliana
Aligns to 40:189 / 204 (73.5%), covers 99.3% of PF04535, 151.1 bits

• function: Regulates membrane-cell wall junctions and localized cell wall deposition. Required for establishment of the Casparian strip membrane domain (CSD) and the subsequent formation of Casparian strips, a cell wall modification of the root endodermis that determines an apoplastic barrier between the intraorganismal apoplasm and the extraorganismal apoplasm and prevents lateral diffusion.
  subunit: Homodimer and heterodimers with other CASP proteins. Interacts with CASP1, CASP3 and CASP4.
• MYB36 regulates the transition from proliferation to differentiation in the Arabidopsis root
  Liberman, Proceedings of the National Academy of Sciences of the United States of America 2015
  • “...selected genes are as follows: AT2G36100 CASP1; AT3G11550 CASP2; AT2G27370 CASP3; AT5G06200 CASP4; AT5G15290 CASP5; AT5G03150 JACKDAW; AT1G03840 MAGPIE;...”
• Apoplastic diffusion barriers in Arabidopsis
  Nawrath, The Arabidopsis book 2013
  • “...PROTEINS (CASPs) (encoded by CASP1, At2g36100; CASP2, At3g11550; CASP3, At2g27370; CASP4, At5g06200; and CASP5, At5g15290). CASPs have all the expected features...”

CASP4_ARATH / Q9FFZ7 Casparian strip membrane protein 4; AtCASP4 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
AT5G06200 integral membrane family protein (RefSeq) from Arabidopsis thaliana
NP_196238 Uncharacterized protein family (UPF0497) from Arabidopsis thaliana
Aligns to 38:187 / 202 (74.3%), covers 98.7% of PF04535, 150.9 bits

• function: Regulates membrane-cell wall junctions and localized cell wall deposition. Required for establishment of the Casparian strip membrane domain (CSD) and the subsequent formation of Casparian strips, a cell wall modification of the root endodermis that determines an apoplastic barrier between the intraorganismal apoplasm and the extraorganismal apoplasm and prevents lateral diffusion.
  subunit: Homodimer and heterodimers with other CASP proteins. Interacts with CASP1, CASP2, CASP3 and CASP5.
• MYB36 regulates the transition from proliferation to differentiation in the Arabidopsis root
  Liberman, Proceedings of the National Academy of Sciences of the United States of America 2015
  • “...AT2G36100 CASP1; AT3G11550 CASP2; AT2G27370 CASP3; AT5G06200 CASP4; AT5G15290 CASP5; AT5G03150 JACKDAW; AT1G03840 MAGPIE; AT5G44160 NUTCRACKER; AT4G11290 PER39;...”
• A receptor-like kinase mutant with absent endodermal diffusion barrier displays selective nutrient homeostasis defects
  Pfister, eLife 2014
  • “..., At1g07940 ) 5-GTCGATTCTGGAAAGTCGACC-3 and 5-AATGTCAATGGTGATACCACGC-3; CASP1 ( At2g36100 ) 5-AGAGAGGTTTGGCTATATT-3 and 5-CTACGGCTATCACAAAGTA-3; CASP4 ( At5g06200 ) 5-AGACTTCTCTTGCTTGTTCT-3 and 5-GACAGAAATCTCCAAACTG-3; AKT1 ( At2G26650 ) 5-TCTAAATTGTGTTCTTCTTCTGTTGGA-3 and 5-CCTTCCGCGTCTCTGCAA-3; HAK5 ( At4g13420 ) 5-CGAGACGGACAAAGAAGAGGAACC-3 and 5- CACGACCCTTCCCGACCTAATCT-3. Statistical analysis All statistical analyses were done in the R environment...”
• Apoplastic diffusion barriers in Arabidopsis
  Nawrath, The Arabidopsis book 2013
  • “...CASP1, At2g36100; CASP2, At3g11550; CASP3, At2g27370; CASP4, At5g06200; and CASP5, At5g15290). CASPs have all the expected features for structural proteins of...”
• The Arabidopsis chloroplast protein S-RBP11 is involved in oxidative and salt stress responses.
  Lee, Plant cell reports 2014 (PubMed)
  • GeneRIF: S-RBP11 is a chloroplast protein involved in the responses to salt and oxidative stresses.

CASP1_ARATH / Q9SIH4 Casparian strip membrane protein 1; AtCASP1 from Arabidopsis thaliana (Mouse-ear cress) (see 2 papers)
AT2G36100 integral membrane family protein (RefSeq) from Arabidopsis thaliana
Aligns to 42:191 / 206 (72.8%), covers 98.7% of PF04535, 150.1 bits

• function: Regulates membrane-cell wall junctions and localized cell wall deposition. Required for establishment of the Casparian strip membrane domain (CSD) and the subsequent formation of Casparian strips, a cell wall modification of the root endodermis that determines an apoplastic barrier between the intraorganismal apoplasm and the extraorganismal apoplasm and prevents lateral diffusion.
  subunit: Homodimer and heterodimers with other CASP proteins. Interacts with CASP2, CASP3, CASP4 and CASP5.
  disruption phenotype: Disorganised deposition of Casparian strips.
• Diffusible repression of cytokinin signalling produces endodermal symmetry and passage cells
  Andersen, Nature 2018
  • “...in supplementary table 1 or are as follows: ABI1, At4g26080; AHP6 , At1g80100; CASP1 , At2g36100; CDEF1 , At4g30140; ELTP , At2g48140; GPAT5, At3g11430; LOG3 , At2g37210; LOG4 , At3g53450; SYP122 , At3g52400 Imaging Confocal laser scanning microscopy experiments were performed on a Zeiss LSM 880...”
• MYB36 regulates the transition from proliferation to differentiation in the Arabidopsis root
  Liberman, Proceedings of the National Academy of Sciences of the United States of America 2015
  • “...identifiers for selected genes are as follows: AT2G36100 CASP1; AT3G11550 CASP2; AT2G27370 CASP3; AT5G06200 CASP4; AT5G15290 CASP5; AT5G03150 JACKDAW; AT1G03840...”
• A receptor-like kinase mutant with absent endodermal diffusion barrier displays selective nutrient homeostasis defects
  Pfister, eLife 2014
  • “...n.a. Baxter I et al. (2009) PLOS Genet, Lahner B et al. (2003) Nat Biotechnol AT2G36100 Col-0 SAIL_265_H05 casp1-1 LP: GCGTTTCAGTACGTCCCTTC RP: CACGTGAGGGAAGTGAGTCTC Roppolo et al. (2011) Nature AT2G27370 Col-0 SALK_011092 casp3-1 LP: GACTCTTCCTTTCTTCACTC RP: GACCAACACAACCGTACGAAC Roppolo et al. (2011) Nature Vector construction and transgenic lines...”
  • “...were used EF1 ( At1g07920 , At1g07930 , At1g07940 ) 5-GTCGATTCTGGAAAGTCGACC-3 and 5-AATGTCAATGGTGATACCACGC-3; CASP1 ( At2g36100 ) 5-AGAGAGGTTTGGCTATATT-3 and 5-CTACGGCTATCACAAAGTA-3; CASP4 ( At5g06200 ) 5-AGACTTCTCTTGCTTGTTCT-3 and 5-GACAGAAATCTCCAAACTG-3; AKT1 ( At2G26650 ) 5-TCTAAATTGTGTTCTTCTTCTGTTGGA-3 and 5-CCTTCCGCGTCTCTGCAA-3; HAK5 ( At4g13420 ) 5-CGAGACGGACAAAGAAGAGGAACC-3 and 5- CACGACCCTTCCCGACCTAATCT-3. Statistical analysis All statistical...”
• Apoplastic diffusion barriers in Arabidopsis
  Nawrath, The Arabidopsis book 2013
  • “...STRIP DOMAIN PROTEINS (CASPs) (encoded by CASP1, At2g36100; CASP2, At3g11550; CASP3, At2g27370; CASP4, At5g06200; and CASP5, At5g15290). CASPs have all the...”

CSPLP_ARATH / Q8L9B5 CASP-like protein 2B1; AtCASPL2B1 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
Aligns to 5:155 / 182 (83.0%), covers 99.3% of PF04535, 148.2 bits

• subunit: Homodimer and heterodimers.

CSPL2_ARATH / Q9XI72 CASP-like protein 1A1; AtCASPL1A1 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
Aligns to 45:194 / 209 (71.8%), covers 99.3% of PF04535, 143.1 bits

• subunit: Homodimer and heterodimers.

CASP3_ARATH / Q9ZQI2 Casparian strip membrane protein 3; AtCASP3 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
AT2G27370 integral membrane family protein (RefSeq) from Arabidopsis thaliana
Aligns to 56:205 / 221 (67.9%), covers 98.7% of PF04535, 142.7 bits

• function: Regulates membrane-cell wall junctions and localized cell wall deposition. Required for establishment of the Casparian strip membrane domain (CSD) and the subsequent formation of Casparian strips, a cell wall modification of the root endodermis that determines an apoplastic barrier between the intraorganismal apoplasm and the extraorganismal apoplasm and prevents lateral diffusion.
  subunit: Homodimer and heterodimers with other CASP proteins. Interacts with CASP1, CASP2, CASP4 and CASP5.
  disruption phenotype: Disorganised deposition of Casparian strips.
• MYB36 regulates the transition from proliferation to differentiation in the Arabidopsis root
  Liberman, Proceedings of the National Academy of Sciences of the United States of America 2015
  • “...are as follows: AT2G36100 CASP1; AT3G11550 CASP2; AT2G27370 CASP3; AT5G06200 CASP4; AT5G15290 CASP5; AT5G03150 JACKDAW; AT1G03840 MAGPIE; AT5G44160 NUTCRACKER;...”
• Apoplastic diffusion barriers in Arabidopsis
  Nawrath, The Arabidopsis book 2013
  • “...(encoded by CASP1, At2g36100; CASP2, At3g11550; CASP3, At2g27370; CASP4, At5g06200; and CASP5, At5g15290). CASPs have all the expected features for structural...”

CSPLM_ARATH / Q9FE29 CASP-like protein 1D1; AtCASPL1D1 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
NP_567472 integral membrane family protein (RefSeq) from Arabidopsis thaliana
Aligns to 23:176 / 193 (79.8%), covers 99.3% of PF04535, 142.1 bits

• subunit: Homodimer and heterodimers.
• Molecular responses of Lotus japonicus to parasitism by the compatible species Orobanche aegyptiaca and the incompatible species Striga hermonthica
  Hiraoka, Journal of experimental botany 2009
  • “...Medicago truncatula ; ABD32291) 0.007 BB999957 LjSh15 Integral membrane family protein ( Arabidopsis thaliana ; NP_567472) 1.6E-46 BB999934 LjSh76-1 Uncharacterized Cys-rich domain ( Medicago truncatula ; ABD32291) 7.0E-14 BB999960 LjSh107s UPF0497 membrane protein ( Arabidopsis thaliana ; Q9SQU2) 2.0E-17 BB999935 LjSh11 Integral membrane family protein (...”

CSPLK_ARATH / Q9ZT81 CASP-like protein 1C1; AtCASPL1C1 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
Aligns to 3:143 / 164 (86.0%), covers 97.3% of PF04535, 141.7 bits

• subunit: Homodimer and heterodimers.

CSPL3_ARATH / Q8VZQ3 CASP-like protein 2A1; AtCASPL2A1 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
AT1G17200 integral membrane family protein (RefSeq) from Arabidopsis thaliana
Aligns to 27:169 / 204 (70.1%), covers 97.3% of PF04535, 139.1 bits

• subunit: Homodimer and heterodimers.
• Membrane Proteomics of Arabidopsis Glucosinolate Mutants cyp79B2/B3 and myb28/29
  Mostafa, Frontiers in plant science 2017
  • “...Water deficiency response and transport D, H, S, T, M Kammerloher et al., 1994 Q8VZQ3 At1g17200 CASP-like protein At1g17200 AT1G17200 0.590 0.016 Binding activity D, H, S, T, M Tair Q9M386 At3g54200 Late embryogenesis abundant hydroxyproline-rich glycoprotein F24B22.160 0.588 0.004 . D, H, S, T, M...”
• Arabidopsis thaliana resistance to fusarium oxysporum 2 implicates tyrosine-sulfated peptide signaling in susceptibility and resistance to root infection
  Shen, PLoS genetics 2013
  • “...same gene that correlated with enhanced resistance in 1A3 transformants, whereas insertion in Salk_140524 interrupts At1g17200, a gene outside the overlapping sequence in Kpn1.2 and Sal1.2. Salk_051677, which was previously named Atrlp3-1 without a reported phenotype, was renamed rfo2 [31] . 10.1371/journal.pgen.1003525.g003 Figure 3 T-DNA insertion...”
  • “...rfo2 abolishes RFO2 QTL. (A) Fractions of n F 1 hybrids of Ty-0 and Salk_014524 (At1g17200) or Salk_051677 (At1g17250) were susceptible or resistant or had intermediate resistance, according to HI scores at 21 dpi. Median ranks of the two F 1 hybrids are dissimilar, according to...”

CSPLD_ARATH / Q9SQU2 CASP-like protein 1D2; AtCASPL1D2 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
Aligns to 32:185 / 199 (77.4%), covers 97.3% of PF04535, 138.7 bits

• subunit: Homodimer and heterodimers.

CSPLQ_ARATH / Q9SUP0 CASP-like protein 1B2; AtCASPL1B2 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
Aligns to 12:168 / 197 (79.7%), covers 98.7% of PF04535, 137.1 bits

• subunit: Homodimer and heterodimers.

CSPLO_ARATH / Q8L8Z1 CASP-like protein 1E1; AtCASPL1E1 from Arabidopsis thaliana (Mouse-ear cress) (see 2 papers)
AT4G15630 integral membrane family protein (RefSeq) from Arabidopsis thaliana
Aligns to 21:177 / 190 (82.6%), covers 98.0% of PF04535, 135.9 bits

• subunit: Homodimer and heterodimers.
• Membrane Proteomics of Arabidopsis Glucosinolate Mutants cyp79B2/B3 and myb28/29
  Mostafa, Frontiers in plant science 2017
  • “...and ion transport D, H, S, T, M Rai et al., 2016 ; tair Q8L8Z1 At4g15630 CASP-like protein At4g15630 AT4G15630 0.701 0.024 Binding of protein D, H, S, T, M Tair Q9FYK0 At1g24650 Leucine-rich repeat protein kinase F21J9.31 LRR-RLK 0.701 0.043 Growth process. D, S, T,...”

CSPLN_ARATH / O23413 CASP-like protein 1E2; AtCASPL1E2 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
Aligns to 22:177 / 190 (82.1%), covers 97.3% of PF04535, 129.8 bits

• subunit: Homodimer and heterodimers.

CSPLF_ARATH / Q3EB59 CASP-like protein 3A1; AtCASPL3A1 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
Aligns to 41:196 / 212 (73.6%), covers 98.7% of PF04535, 126.9 bits

• subunit: Homodimer and heterodimers.

GRMZM5G806387 CASP-like protein 2A1 from Zea mays
Aligns to 36:177 / 213 (66.7%), covers 98.7% of PF04535, 126.6 bits

• Genome-wide association study Identified multiple Genetic Loci on Chilling Resistance During Germination in Maize
  Hu, Scientific reports 2017
  • “...RDT50/RGI ss196436428 GRMZM2G178486 *# exon 248.98 0.81 Zinc finger proteins: C3HC4-type family proteins RDT50/RGI ss196436428 GRMZM5G806387 *# exon 366.49 0.8 Casp-like protein 2a1 RDT50/RGI ss196436428 GRMZM2G148793 # intron 216.19 0.86 TPA: hypothetical protein ZEAMMB73_617749 All candidate genes contain either an associated SNP or a SNP in...”
  • “...GRMZM2G462797 ZEAMMB73_597353 AT1G12650.1 LOC_Os09g35670.1 12 GRMZM2G704005 ZEAMMB73_876334 AT2G32090.1 LOC_Os03g45720 13 GRMZM5G802338 NA NA NA 14 GRMZM5G806387 ZEAMMB73_117651 AT1G17200.1 LOC_Os04g21320 15 GRMZM2G113158 ZEAMMB73_572941 AT1G34300.1 LOC_Os03g62180 16 GRMZM2G318156 ZEAMMB73_082780 NA NA 17 GRMZM5G871707 NA NA NA 18 GRMZM2G148793 NA NA NA Functional prediction of candidate genes We found...”

N24_MEDTR / O24088 CASP-like protein N24; CASP-like protein 4A1; MtCASPL4A1; Nodulin 24; MtN24 from Medicago truncatula (Barrel medic) (Medicago tribuloides) (see paper)
Aligns to 61:218 / 234 (67.5%), covers 98.0% of PF04535, 122.6 bits

• subunit: Homodimer and heterodimers.

BLE3_ORYSJ / Q84UT5 CASP-like protein BLE3; CASP-like protein 1C2; OsCASPL1C2; Protein brassinolide-enhanced 3; OsBLE3; Protein BL-enhanced 3 from Oryza sativa subsp. japonica (Rice) (see paper)
XP_015638091 CASP-like protein BLE3 from Oryza sativa Japonica Group
Aligns to 2:142 / 162 (87.0%), covers 97.3% of PF04535, 121.3 bits

• function: Involved in cell elongation in rice through dual regulation by brassinolide and auxin.
  subunit: Homodimer and heterodimers.
• OsBLE3, a brassinolide-enhanced gene, is involved in the growth of rice.
  Yang, Phytochemistry 2006 (PubMed)
  • GeneRIF: OsBLE3 is involved in cell elongation in rice through dual regulation by brassinolide and IAA

Sb09g008190 No description from Sorghum bicolor
Aligns to 2:142 / 162 (87.0%), covers 97.3% of PF04535, 120.3 bits

• The physical map of wheat chromosome 1BS provides insights into its gene space organization and evolution
  Raats, Genome biology 2013
  • “..., rice Os5 between genes LOC_Os05g01020 through LOC_Os05g15630 and sorghum Sb9 between genes Sb09g000200 through Sb09g008190 [ 35 ]. Brachypodium contains 600 genes in the 1S syntenic region (after filtering for TE sequences and possible annotation artifacts [ 35 ]). To account for genes that might...”

CSPLR_ARATH / Q9M0L3 CASP-like protein 1F1; AtCASPL1F1 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
Aligns to 14:155 / 170 (83.5%), covers 96.0% of PF04535, 118.3 bits

• subunit: Homodimer and heterodimers.

AT3G55390 integral membrane family protein (RefSeq) from Arabidopsis thaliana
Aligns to 31:168 / 194 (71.1%), covers 97.3% of PF04535, 112.1 bits

• A Casparian strip domain-like gene, CASPL, negatively alters growth and cold tolerance
  Yang, Scientific reports 2015
  • “...membrane protein in watermelon 13 . The orthologue to this gene was identified to be At3g55390 in Arabidopsis thaliana , where it is annotated as the CASP-LIKE PROTEIN 4C1. At3g55390 belongs to the CASP protein family containing the five CASP genes ( CASP1/2/3/4/5) , which are...”
  • “...of Arabidopsis ( Arabidopsis thaliana) (Col-0) were used for amplification of ClCASPL and AtCASPL4C1 ( At3G55390 ) genes. WT Arabidopsis thaliana (Col-0) was used for transformation to construct OX-ClCASPL of Arabidopsis. The SALK_034800C line was used for screening of homozygous Atcaspl4c1 knock-out mutant plants. 3-week-old plants...”
• Requirement of the C3HC4 zinc RING finger of the Arabidopsis PEX10 for photorespiration and leaf peroxisome contact with chloroplasts
  Schumann, Proceedings of the National Academy of Sciences of the United States of America 2007
  • “...a prokaryotic membrane lipoprotein with a lipid attachment site (At3g55390). In Zn2, the integration was found 140 bp downstream of the stop codon within the 3...”
  • “...809777 with an insertion in the third exon of the gene At3g55390 affected in the Zn1 line, and SALK line 537722 with an insertion in the fifth exon of the gene...”

CSPLE_ARATH / Q9LUL1 CASP-like protein 2A2; AtCASPL2A2 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
AT3G14380 integral membrane family protein (RefSeq) from Arabidopsis thaliana
Aligns to 17:172 / 178 (87.6%), covers 98.0% of PF04535, 109.8 bits

• function: Involved in floral organ shedding.
  subunit: Homodimer and heterodimers.
  disruption phenotype: Delayed timing of petal abscission.
• A novel approach to dissect the abscission process in Arabidopsis
  González-Carranza, Plant physiology 2012 (PubMed)
  • “...and an IDA-overexpressing line. Phenotypic analysis of an At3g14380 transfer DNA insertion line indicates that this gene plays a functional role in floral organ...”
  • “...expression of seven genes, At1g64405, At2g23630, At2g44010, At3g14380, At3g53040, At3g56350, and At5g50540, four of which (At1g64405, At2g44010, At3g53040, and...”

LOC110788005 CASP-like protein XL3 from Spinacia oleracea
Aligns to 1:155 / 190 (81.6%), covers 96.7% of PF04535, 109.7 bits

• Identification and Initial Characterization of the Effectors of an Anther Smut Fungus and Potential Host Target Proteins
  Kuppireddy, International journal of molecular sciences 2017
  • “...of fungal gene MVLG_06175 interacts with a host CASP-like protein 2C1 orthologue of Spinacia oleracea (LOC110788005), transcript mRNA (XM_021992637.1); it also matched CASP-like protein 2C1, AT4G25830.1 of A. thaliana . The corresponding transcript from Silene expression data (Toh et al. submitted) similarly matched the same S....”

CSPLX_ARATH / Q9FFT2 CASP-like protein 2D1; AtCASPL2D1 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
Aligns to 26:166 / 194 (72.7%), covers 98.0% of PF04535, 109.5 bits

• subunit: Homodimer and heterodimers.

CSPLU_ARATH / Q9LZM5 CASP-like protein 5B1; AtCASPL5B1 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
AT5G02060 integral membrane protein, putative (RefSeq) from Arabidopsis thaliana
Aligns to 6:139 / 152 (88.2%), covers 99.3% of PF04535, 106.0 bits

• subunit: Homodimer and heterodimers.
• Using intron position conservation for homology-based gene prediction
  Keilwagen, Nucleic acids research 2016
  • “...matches the sequenced cDNA confirming among others the alternative splicing for At3g57910. In case of At5g02060, we found a 1 bp deletion in the reference sequence leading two a 4 bp difference at the donor splice site of exon 2, which GeMoMa is conceptually unable to...”
  • “...Sc_19.43 () 367369 missing gene as predicted At4g16566 Sc_29.148 () 15591575 missing gene as predicted At5g02060 Sc_33 () 16651673 missing gene well matching At3g57910 Sc_85 () 586589 1 missing exon as predicted At4g38240 Sc_28580 () 411 2 missing exons well matching At3g13120 Sc_12 (+) 15681570 2...”

CSPLI_ARATH / Q945M8 CASP-like protein 5B2; AtCASPL5B2 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
Aligns to 6:139 / 154 (87.0%), covers 98.0% of PF04535, 103.3 bits

• subunit: Homodimer and heterodimers.

CSPL6_ARATH / Q9SKN3 CASP-like protein 5A2; AtCASPL5A2 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
AT2G28370 hypothetical protein (RefSeq) from Arabidopsis thaliana
Aligns to 34:164 / 179 (73.2%), covers 99.3% of PF04535, 97.7 bits

• subunit: Homodimer and heterodimers.
• Conserved features of germination and polarized cell growth: a few insights from a pollen-fern spore comparison
  Bushart, Annals of botany 2007
  • “...ESTs* AT1G23750, AT2G21870, AT2G29040, AT2G32910, AT4G10440, AT1G64980, AT2G28370, AT4G22310, AT4G28050, AT4G31420, AT4G39230, AT5G67490 4 3 3 2 2 2 2 2...”

AT2G38480 integral membrane protein, putative (RefSeq) from Arabidopsis thaliana
Aligns to 41:170 / 188 (69.1%), covers 98.0% of PF04535, 92.1 bits

• Extra Large G-Protein Interactome Reveals Multiple Stress Response Function and Partner-Dependent XLG Subcellular Localization
  Liang, Frontiers in Plant Science 2017
  • “...ATP synthase subunit gamma 0.235 5.8E-28 Y2H SAL XLG3 At2g34410 O-acetyltransferase-like protein Y2H GLUC XLG3 At2g38480 * CASP-like protein 0.135 1.3E-12 Y2H/BiFC GLUC XLG3 At2g40140 * Zinc finger CCCH domain-containing protein 29 0.137 1.1E-35 Y2H/BiFC GLUC XLG3 At2g41430 * Dehydration-induced protein ERD15 0.162 2.0E-32 Y2H GLUC...”
  • “...XLG1 and 3 interacting proteins outside the nucleus. (A) At1g71030 (B) At1g44170 (C) At4g02380 (D) At2g38480 (E) At3g19640 (F) At5g66240. The XLGs were fused to the N-terminus of YFP and the prey proteins were fused to the C-terminus of YFP. The bait constructs nYFP-XLG1 and XLG3...”
• Membrane Proteomics of Arabidopsis Glucosinolate Mutants cyp79B2/B3 and myb28/29
  Mostafa, Frontiers in plant science 2017
  • “...kinase AT1G11410 0.733 0.049 Kinase and binding activities D, H, S, T, M Tair Q8LE26 At2g38480 CASP-like protein At2g38480 AT2G38480 0.729 0.002 D, H, T, M Tair P43287 At2g37170 Aquaporin PIP2-2 PIP2-2 0.725 0.011 Water deficiency response and transport D, H, S, T, M Javot, 2003...”
• The hunt for hypoxia responsive natural antisense short interfering RNAs
  Moldovan, Plant signaling & behavior 2010
  • “...under hypoxia. The results showed that three genes AT2G38480, AT3G61300 and AT1G55390 had lost repression under hypoxia in the nrpd1a mutant by at least...”
  • “...between genes was found, although none belonging to AT2G38480, AT3G61300 or AT1G55390. However, the deep sequencing had not reached saturation, and most of the...”

NP_001237047 uncharacterized protein LOC100527764 from Glycine max
Aligns to 37:167 / 182 (72.0%), covers 98.0% of PF04535, 87.3 bits

• Transcriptome analysis of resistant and susceptible alfalfa cultivars infected with root-knot nematode Meloidogyne incognita
  Postnikova, PloS one 2015
  • “...qPCRs was made from the same RNA samples that were used for RNA-sequencing. Previously detected NP_001237047, an unknown gene with little variation in expression levels, was used as a reference in all qPCR experiments [ 21 ]. The specificity of all amplifications was confirmed by single-peak...”

CSPLG_ARATH / Q8L7R5 CASP-like protein 5B3; AtCASPL5B3 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
Aligns to 6:137 / 152 (86.8%), covers 98.0% of PF04535, 85.7 bits

• subunit: Homodimer and heterodimers.

CSPL4_ARATH / Q3ECT8 CASP-like protein 5C3; AtCASPL5C3 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
Aligns to 6:136 / 152 (86.2%), covers 98.7% of PF04535, 85.0 bits

• subunit: Homodimer and heterodimers.

PIMP1_CAPAN / A1XGB4 CASP-like protein PIMP1; CASP-like protein 4D1; CaCASPL4D1; Pathogen-induced membrane protein 1; CaPIMP1 from Capsicum annuum (Bell pepper) (see 2 papers)
Aligns to 9:157 / 166 (89.8%), covers 96.0% of PF04535, 83.3 bits

• function: Required for defense response to Xanthomonas campestris pv. vesicatoria (Xcv). In heterologous systems, confers resistance to bacterial pathogens such as Pseudomonas syringae pv. tomato but susceptibility to pathogenic oomycetes such as Hylaloperonospora parasitica when expressed in Arabidopsis thaliana. May be involved in the regulation of responses to bitoic and abiotic stresses.
  subunit: Homodimer and heterodimers.

CSPLC_ARATH / Q8GWD5 CASP-like protein 4D1; AtCASPL4D1 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
Aligns to 10:158 / 178 (83.7%), covers 98.0% of PF04535, 79.6 bits

• subunit: Homodimer and heterodimers.

W5FDE6 CASP-like protein from Triticum aestivum
Aligns to 11:163 / 201 (76.1%), covers 97.3% of PF04535, 69.5 bits

• Transcriptomic Analysis of Soil Grown T. aestivum cv. Root to Reveal the Changes in Expression of Genes in Response to Multiple Nutrients Deficiency
  Gupta, Frontiers in Plant Science 2017
  • “...Medium Low Ta.30668.1.S1_at Q6QF95 Expansin EXPB10 Low Medium TaAffx.60291.1.S1_at W5GG94 Cellulose synthetase Low Medium Ta.19183.2.S1_at W5FDE6 CASP-like protein Medium High Ta.27027.1.S1_at A5JPR1 Leucine-rich repeat protein (LRR2) Medium High TaAffx.111940.1.S1_s_at AAC23502 .1 Vacuolar invertase Low Low Ta.28802.3.S1_at W5FFS4 Histone H2A Protein Low High Ta.2148.1.S1_x_at Q9LKM4 Cold-responsive protein...”