Family Search for PF04577 (DUF563)

PF04577.14 hits 51 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.

PBN151_4312 glycosyltransferase family 61 protein from Paenibacillus sp. NAIST15-1
Aligns to 128:332 / 361 (56.8%), covers 98.6% of PF04577, 153.1 bits

• Surface Sensing for Paenibacillus sp. NAIST15-1 Flagellar Gene Expression on Solid Medium
  Kobayashi, Applied and environmental microbiology 2017
  • “...motility. Of these, disruption of degSU, wsfP, or PBN151_4312 resulted in 26 complete loss of flagellin synthesis. Analysis of flagellar gene promoter activity...”
  • “...important for 148 motility in Paenibacillus sp. 149 PBN151_4312 is a cytoplasmic protein of unknown function that is conserved in many 150 bacteria. PBN151_4312...”

TVAG_376780 hypothetical protein from Trichomonas vaginalis G3
Aligns to 73:280 / 358 (58.1%), covers 99.0% of PF04577, 127.5 bits

• Cysteine biosynthesis in Trichomonas vaginalis involves cysteine synthase utilizing O-phosphoserine
  Westrop, The Journal of biological chemistry 2006
  • “...Not found Not found Not found 2.5.1.47 Cysteine synthase (CS) EST 215 TVAG_439200 TVAG_561470 TVAG_400270 TVAG_376780 TVAG_396280 TVAG_040860 TvCS1 TvCS2 TvCS3 TvCS4 TvCS5 TvCS6 6.6e-155 4.3e-151 1.1e-147 1.8e-145 1.4e-143 1.5e-141 2.7.7.4 Sulphate adenylyl -transferase eco:b2751 pae:PA4442 sce:YJR010W Not found Not found Not found 2.7.1.25 Adenylyl-sulphate kinase...”

EOGT_DROME / Q9VQB7 EGF domain-specific O-linked N-acetylglucosamine transferase; Extracellular O-linked N-acetylglucosamine transferase; EC 2.4.1.255 from Drosophila melanogaster (Fruit fly) (see paper)
Q9VQB7 protein O-GlcNAc transferase (EC 2.4.1.255) from Drosophila melanogaster (see paper)
AAF51259.1 [protein] EGF20 O-β-N-acetylglucosaminyltransferase (Eogt;EOGT;CG9867) (EC 2.4.1.255) (see protein)
NP_608678 EGF-domain O-GlcNAc transferase, isoform A from Drosophila melanogaster
Aligns to 232:458 / 520 (43.7%), covers 98.6% of PF04577, 114.9 bits

• function: Catalyzes the transfer of a single N-acetylglucosamine from UDP-GlcNAc to a serine or threonine residue in extracellular proteins resulting in their modification with a beta-linked N- acetylglucosamine (O-GlcNAc). Specifically glycosylates the Thr residue located between the fifth and sixth conserved cysteines of folded EGF-like domains. Involved in epithelial cell adhesion/interaction with the extracellular matrix by mediating glycosylation of proteins in the secretory pathway, such as Dumpy (Dp).
  catalytic activity: L-seryl-[protein] + UDP-N-acetyl- alpha-D-glucosamine = 3-O-(N-acetyl-beta-D-glucosaminyl)-L-seryl- [protein] + H(+) + UDP (RHEA:48904)
  catalytic activity: L-threonyl-[protein] + UDP-N-acetyl- alpha-D-glucosamine = 3-O-(N-acetyl-beta-D-glucosaminyl)-L- threonyl-[protein] + H(+) + UDP (RHEA:48908)
  cofactor: a divalent metal cation
  disruption phenotype: Defects in apical extracellular matrix. Embryos show defects in the formation of the innermost layer of the apical extracellular matrix and its attachment to the epidermis. Most larvae die during second-instar or second/third- instar interface, but some survive until early third-instar. Surviving larvae display cuticle defect and irregular tracheal morphology. Ultrastructural analysis of larval epidermis reveals disruption of the deposition zone of the endocuticle, leading to separation of the epidermis from the chitin layers.
• EOGT and O-GlcNAc on secreted and membrane proteins.
  Varshney, Biochemical Society transactions 2017 (PubMed)
  • GeneRIF: Studies provide evidence that EOGT plays important roles in drosophila, especially in its development.[review]
• The EGF repeat-specific O-GlcNAc-transferase Eogt interacts with notch signaling and pyrimidine metabolism pathways in Drosophila.
  Müller, PloS one 2013
  • GeneRIF: Data suggest that Eogt knock-down in the wing leads to metabolic and signaling perturbations that increase cytosolic uracil levels, thereby causing wing blister formation.

EOGT_MOUSE / Q8BYW9 EGF domain-specific O-linked N-acetylglucosamine transferase; Extracellular O-linked N-acetylglucosamine transferase; EC 2.4.1.255 from Mus musculus (Mouse) (see 2 papers)
XP_006505321 EGF domain-specific O-linked N-acetylglucosamine transferase isoform X1 from Mus musculus
Aligns to 245:472 / 527 (43.3%), covers 99.0% of PF04577, 99.3 bits

• function: Catalyzes the transfer of a single N-acetylglucosamine from UDP-GlcNAc to a serine or threonine residue in extracellular proteins resulting in their modification with a beta-linked N- acetylglucosamine (O-GlcNAc). Specifically glycosylates the Thr residue located between the fifth and sixth conserved cysteines of folded EGF-like domains.
  catalytic activity: L-seryl-[protein] + UDP-N-acetyl- alpha-D-glucosamine = 3-O-(N-acetyl-beta-D-glucosaminyl)-L-seryl- [protein] + H(+) + UDP (RHEA:48904)
  catalytic activity: L-threonyl-[protein] + UDP-N-acetyl- alpha-D-glucosamine = 3-O-(N-acetyl-beta-D-glucosaminyl)-L- threonyl-[protein] + H(+) + UDP (RHEA:48908)
• O-linked-N-acetylglucosamine modification of mammalian Notch receptors by an atypical O-GlcNAc transferase Eogt1.
  Sakaidani, Biochemical and biophysical research communications 2012 (PubMed)
  • GeneRIF: the characterization of A130022J15Rik, a mouse gene homolog of Drosophila Eogt (Eogt 1), was reported.

EOGT_HUMAN / Q5NDL2 EGF domain-specific O-linked N-acetylglucosamine transferase; Extracellular O-linked N-acetylglucosamine transferase; EC 2.4.1.255 from Homo sapiens (Human) (see 2 papers)
Q5NDL2 protein O-GlcNAc transferase (EC 2.4.1.255) from Homo sapiens (see paper)
Aligns to 245:472 / 527 (43.3%), covers 99.0% of PF04577, 96.6 bits

• function: Catalyzes the transfer of a single N-acetylglucosamine from UDP-GlcNAc to a serine or threonine residue in extracellular proteins resulting in their modification with a beta-linked N- acetylglucosamine (O-GlcNAc). Specifically glycosylates the Thr residue located between the fifth and sixth conserved cysteines of folded EGF-like domains.
  catalytic activity: L-seryl-[protein] + UDP-N-acetyl- alpha-D-glucosamine = 3-O-(N-acetyl-beta-D-glucosaminyl)-L-seryl- [protein] + H(+) + UDP (RHEA:48904)
  catalytic activity: L-threonyl-[protein] + UDP-N-acetyl- alpha-D-glucosamine = 3-O-(N-acetyl-beta-D-glucosaminyl)-L- threonyl-[protein] + H(+) + UDP (RHEA:48908)

CC_0632 hypothetical protein (NCBI ptt file) from Caulobacter crescentus CB15
Aligns to 116:314 / 350 (56.9%), covers 99.0% of PF04577, 95.0 bits

• Mutations in the Lipopolysaccharide biosynthesis pathway interfere with crescentin-mediated cell curvature in Caulobacter crescentus
  Cabeen, Journal of bacteriology 2010
  • “...further. However, a Himar1 insertion in the gene cc_0632 of hypothetical function produced cells with normal lengths but with a considerable reduction of cell...”
  • “...should have no effect on the expression of cc_0632. Additionally, the cc_0632::Himar1 cell shape defect could be rescued with a plasmid bearing the cc_0631...”

LOC109846408 uncharacterized protein LOC109846408 from Asparagus officinalis
Aligns to 286:506 / 571 (38.7%), covers 96.2% of PF04577, 90.1 bits

• Glycosyltransferase Family 61 in Liliopsida (Monocot): The Story of a Gene Family Expansion
  Cenci, Frontiers in plant science 2018
  • “...Figure S1 ). The positions of A. officinalis sequences are, however, sometimes not well-resolved, especially LOC109846408, which is closely related to the GT61-A3, -A4 and -A7 orthogroups. Seven orthogroups commelinid-specific can therefore be defined, and named OG-GT61-A1 to OG-GT61-A7 (Figure 4 ). Additional amplifications were observed...”

HMPREF1204_03307 glycosyltransferase family 61 protein from Bacteroides fragilis HMW 615
Aligns to 148:365 / 395 (55.2%), covers 94.3% of PF04577, 88.5 bits

• Novel large-scale chromosomal transfer in Bacteroides fragilis contributes to its pan-genome and rapid environmental adaptation
  Husain, Microbial genomics 2017
  • “...outer membrane associated proteins. Fig. 6. PSF exchange mediated by tetQ2 435 and tetQ2 482. HMPREF1204_03307, is a gene from the PSF operon of B. fragilis HMW615 (within tetQ2 435 ). BF638R_1544, BF638R_1548, BF638R_1552, and BF638R_1556 are genes within the PSF operon of B. fragilis 638R....”
  • “...HMW615 genome. a: Lane 1: MW Standard, Lanes 26: Template B. fragilis HMW615. Primers for HMPREF1204_03307, BF638R_1544, BF638R_1548, BF638R_1552, and BF638R_1556, respectively. Lanes 711: Template BF 638R. Primers for HMPREF1204_03307, BF638R_1544, BF638R_1548, BF638R_1552, and BF638R_1556, respectively. Lanes 1216: Template BF638R ::tetQ2 435 . Primers for HMPREF1204_03307,...”

XAX1_ORYSJ / Q6Z7I3 Beta-1,2-xylosyltransferease XAX1; Protein XYLOSYL ARABINOSYL SUBSTITUTION OF XYLAN 1; EC 2.4.2.- from Oryza sativa subsp. japonica (Rice) (see paper)
LOC4329203 uncharacterized protein LOC4329203 from Oryza sativa Japonica Group
Aligns to 280:507 / 566 (40.3%), covers 91.9% of PF04577, 84.2 bits

• function: Glycosyltransferase involved in the xylosylation of xylan, the major hemicellulose (non-cellulosic component) of primary and secondary walls of angiosperms (PubMed:23027943). Possesses beta-1,2-xylosyltransferase activity, transferring xylose from UDP-xylose to the xylan backbone (PubMed:23027943).
  disruption phenotype: Dwarf phenotype, decreased levels of xylose, ferulic acid and coumaric acid in leaves, and increased saccharification efficiency.
• Quantitative iTRAQ-based proteomic analysis of rice grains to assess high night temperature stress
  Zhang, Proteomics 2017
  • “...0.664 2.029 0.327 Functional unknown protein Q53M16 LOC_Os11g13690 Putative uncharacterized protein 2.272 0.524 4.337 Q6Z7I3 LOC4329203 Os02g0329800 protein 1.788 0.604 2.96 Q851I5 LOC107278586 Putative uncharacterized protein 1.852 0.648 2.859 Q69MT6 OSJNBb0034B12.21 Putative uncharacterized protein 2.948 1.158 2.546 Q9LWS6 LOC4339919 Os06g0115100 protein 2.349 0.997 2.356 Q0JQP1 Os01g0149200...”

CC0631, CC_0631 hypothetical protein (NCBI ptt file) from Caulobacter crescentus CB15
Aligns to 133:337 / 394 (52.0%), covers 98.1% of PF04577, 83.3 bits

• Mutations in the Lipopolysaccharide biosynthesis pathway interfere with crescentin-mediated cell curvature in Caulobacter crescentus
  Cabeen, Journal of bacteriology 2010
  • “...(Fig. 2A, lane 5). These data indicate that the CC0631 protein plays a role in LPS biosynthesis in C. crescentus and that defects in LPS production are...”
  • “...gene of a predicted operon encompassing cc_0635 to cc_0631 (Fig. 1B), suggesting a potential polar effect on the downstream cc_0631 gene. Consistent with this...”
  • “...m1) was found to have a point mutation in cc_0631 (Fig. 1A, panel v). A cosmid (cos1-10-A) containing Downloaded from http://jb.asm.org/ on February 11, 2017 by...”

AAQ73546.1 β-1,2-xylosyltransferase (EC 2.4.2.38) (see protein)
Aligns to 235:490 / 511 (50.1%), covers 97.1% of PF04577, 82.6 bits

LOC105041138 uncharacterized protein LOC105041138 from Elaeis guineensis
Aligns to 278:484 / 565 (36.6%), covers 88.5% of PF04577, 82.5 bits

• Glycosyltransferase Family 61 in Liliopsida (Monocot): The Story of a Gene Family Expansion
  Cenci, Frontiers in plant science 2018
  • “...Partial LOC103696231, LOC103696210 LOC103697726 LOC103696248 NW_008246831.1 LOC103719015 LOC103719019 E. guineensis NC_025995.1 LOC105041134 LOC105041135, LOC105041136 LOC105041137 LOC105041138, LOC105041140, LOC105041139, LOC105041141, LOC105041144, LOC105041142, LOC105041145 LOC105041157 LOC105041146 M. acuminata Chr01 Ma01_g14150 Ma01_g14160, Ma01_g14170, Ma01_g14180 Ma01_g14190 Ma01_g14200 Chr02 Ma02_g16300 Ma02_g16310 Ma02_g16320 Chr02 Ma02_g24690 Ma02_g24680 Chr04 Ma04_g30890 Ma04_g30880 Ma04_g30870 Chr06 Ma06_g11080...”

LOC103696188 uncharacterized protein LOC103696188 from Phoenix dactylifera
Aligns to 187:394 / 474 (43.9%), covers 89.5% of PF04577, 82.4 bits

• Glycosyltransferase Family 61 in Liliopsida (Monocot): The Story of a Gene Family Expansion
  Cenci, Frontiers in plant science 2018
  • “...of monocot OG-GT61-A genes. Species/sequence A1 A2 A3 A4 A5 A6 P. dactylifera NW_008246516.1 LOC103696170 LOC103696188, LOC103696198 Partial LOC103696231, LOC103696210 LOC103697726 LOC103696248 NW_008246831.1 LOC103719015 LOC103719019 E. guineensis NC_025995.1 LOC105041134 LOC105041135, LOC105041136 LOC105041137 LOC105041138, LOC105041140, LOC105041139, LOC105041141, LOC105041144, LOC105041142, LOC105041145 LOC105041157 LOC105041146 M. acuminata Chr01 Ma01_g14150 Ma01_g14160,...”

AT2G03360 transferase, transferring glycosyl groups (RefSeq) from Arabidopsis thaliana
Aligns to 159:383 / 451 (49.9%), covers 97.1% of PF04577, 82.0 bits

• Re-analysis of RNA-seq transcriptome data reveals new aspects of gene activity in Arabidopsis root hairs
  Li, Frontiers in plant science 2015
  • “...5.34615 5.8301 AT5G42785 Unknown protein 80.0565 1.42305 5.81396 AT2G20030 RING/U-box superfamily protein 8.41905 0.150287 5.80787 AT2G03360 Glycosyltransferase family 61 protein 6.24031 0.112152 5.79809 AT5G12050 Unknown protein 184.136 3.34175 5.78402 AT4G22217 Arabidopsis defensin-like protein 349.124 6.59131 5.72703 AT4G21200 ATGA2OX8, GA2OX8, gibberellin 2-oxidase 8 11.7754 0.22266 5.72479 AT4G08450...”

NP_775925 EGF domain-specific O-linked N-acetylglucosamine transferase isoform b precursor from Homo sapiens
Aligns to 190:388 / 443 (44.9%), covers 75.1% of PF04577, 81.5 bits

• The Glycosyltransferase EOGT Regulates Adropin Expression in Decidualizing Human Endometrium.
  Muter, Endocrinology 2018 (PubMed)
  • GeneRIF: Analysis of midluteal endometrial biopsies revealed an inverse correlation between endometrial EOGT and ENHO expression and body mass index. obesity impairs the EOGT-adropin axis in decidual cells, which in turn points toward a mechanistic link between metabolic disorders and adverse pregnancy outcome.
• O-GlcNAc on NOTCH1 EGF repeats regulates ligand-induced Notch signaling and vascular development in mammals.
  Sawaguchi, eLife 2017
  • GeneRIF: Eogt resulted in defective retinal angiogenesis, with a mild phenotype similar to that caused by reduced Notch signaling in retina. Combined deficiency of different Notch1 mutant alleles exacerbated the abnormalities in Eogt(-/-) retina, and Notch target gene expression was decreased in Eogt(-/-)endothelial cells.
• EOGT and O-GlcNAc on secreted and membrane proteins.
  Varshney, Biochemical Society transactions 2017 (PubMed)
  • GeneRIF: Studies provide evidence that mutations in EOGT lead to autosomal recessive Adams-Oliver Syndrome. [review]
• Autosomal recessive Adams-Oliver syndrome caused by homozygous mutation in EOGT, encoding an EGF domain-specific O-GlcNAc transferase.
  Cohen, European journal of human genetics : EJHG 2014
  • GeneRIF: c.1074delA mutation segregates with Adams-Oliver syndrome in the Bedouin family.
• Mutations in EOGT confirm the genetic heterogeneity of autosomal-recessive Adams-Oliver syndrome.
  Shaheen, American journal of human genetics 2013
  • GeneRIF: Mutations in EOGT confirm the genetic heterogeneity of autosomal-recessive Adams-Oliver syndrome.

XYLT_ARATH / Q9LDH0 Beta-1,2-xylosyltransferase; AtXYLT; EC 2.4.2.38 from Arabidopsis thaliana (Mouse-ear cress) (see 6 papers)
Q9LDH0 glycoprotein 2-beta-D-xylosyltransferase (EC 2.4.2.38) from Arabidopsis thaliana (see 4 papers)
Q9LDH0 β-1,2-xylosyltransferase (EC 2.4.2.38) from Arabidopsis thaliana (see 4 papers)
CAB90610.1 core β-1,2-xylosyltransferase (XylT;AtXYLT;At5g55500) (EC 2.4.2.38) (see protein)
NP_568825 beta-1,2-xylosyltransferase from Arabidopsis thaliana
AT5G55500 XYLT (ARABIDOPSIS THALIANA BETA-1,2-XYLOSYLTRANSFERASE); xylosyltransferase (RefSeq) from Arabidopsis thaliana
Aligns to 247:513 / 534 (50.0%), covers 98.1% of PF04577, 81.4 bits

• function: Glycosyltransferase involved in the xylosylation of N- glycans (PubMed:10781814, PubMed:12943552, PubMed:15013764, PubMed:15686448). Possesses beta-1,2-xylosyltransferase activity, transferring xylose from UDP-xylose to the core beta-linked mannose of N-glycans (PubMed:10781814, PubMed:12943552, PubMed:15013764, PubMed:15686448). Involved in the biosynthesis of glycoprotein bound N-glycans (PubMed:15686448, PubMed:22024534). Does not require metal ions for its activity (PubMed:15686448).
  catalytic activity: N(4)-{beta-D-GlcNAc-(1->2)-alpha-D- Man-(1->3)-[beta-D-GlcNAc-(1->2)-alpha-D-Man-(1->6)]-beta-D-Man- (1->4)-beta-D-GlcNAc-(1->4)-beta-D-GlcNAc}-L-asparaginyl-[protein] + UDP-alpha-D-xylose = H(+) + N(4)-{beta-D-GlcNAc-(1->2)-alpha-D- Man-(1->3)-[beta-D-GlcNAc-(1->2)-alpha-D-Man-(1->6)]-[beta-D-Xyl- (1->2)]-beta-D-Man-(1->4)-beta-D-GlcNAcl-(1->4)-beta-D-GlcNAc}-L- asparaginyl-[protein] + UDP (RHEA:10612)
• Arabidopsis β1,2-xylosyltransferase: substrate specificity and participation in the plant-specific N-glycosylation pathway.
  Kajiura, Journal of bioscience and bioengineering 2012 (PubMed)
  • GeneRIF: AtXYLT acts on protein-bound N-glycans prior to alpha1,3-fucosyltransferase and mannosidase II.
• An antibody produced in tobacco expressing a hybrid beta-1,4-galactosyltransferase is essentially devoid of plant carbohydrate epitopes.
  Bakker, Proceedings of the National Academy of Sciences of the United States of America 2006
  • GeneRIF: Data show that expression of a hybrid enzyme of Arabidopsis thaliana xylosyltransferase and human beta-1,4-galactosyltransferase I in tobacco causes a reduction of N-glycans with potentially immunogenic core-bound xylose and fucose residues.
• Arabidopsis thaliana beta1,2-xylosyltransferase: an unusual glycosyltransferase with the potential to act at multiple stages of the plant N-glycosylation pathway.
  Bencúr, The Biochemical journal 2005
  • GeneRIF: The substrate specificity of XylT permits the enzyme to act at multiple stages of the plant N-glycosylation pathway.
• N-linked Glycan Micro-heterogeneity in Glycoproteins of Arabidopsis
  Zeng, Molecular & cellular proteomics : MCP 2018 (secret)
• Evolution of protein N-glycosylation process in Golgi apparatus which shapes diversity of protein N-glycan structures in plants, animals and fungi
  Wang, Scientific reports 2017
  • “...other plants 31 89 90 . Domain PF04577 was identified in Arabidopsis XylT peptide sequence (AT5G55500). Genes containing the domain PF04577 were not identified in fungi. Only 13 genes were present in each animal genome, while in plants, genes are abundant (as many as over 30...”
  • “...PF07748 CL0158 n/a CL0103 GnTII A. thaliana AT2G05320 GT16 PF05060 CL0110 plants 1,2-XylT A. thaliana AT5G55500 GT61 PF04577 n/a 1,3-FucT A. thaliana AT3G19280 GT10 PF00852 n/a 1,3-GalT A. thaliana AT1G26810 GT31 PF00337 PF01762 CL0004 CL0110 1,4-FucT A. thaliana AT1G71990 GT10 PF00852 n/a animals 1,4-GalT H. sapiens...”
• Exploring the N-glycosylation pathway in Chlamydomonas reinhardtii unravels novel complex structures
  Mathieu-Rivet, Molecular & cellular proteomics : MCP 2013
  • “...(40%) (22%) At3g19280 (20%) At1g30000 (28%) At5g55500 (17%) At5g66680 At1g76400 At4g21150 At1g32210 At1g34130 At5g19960 At1g61790 At5g28460 At2g44660 At5g61790...”
• XAX1 from glycosyltransferase family 61 mediates xylosyltransfer to rice xylan
  Chiniquy, Proceedings of the National Academy of Sciences of the United States of America 2012
  • “...represented by only a single sequence per genome (At5G55500 and Os08g39380 in Arabidopsis and rice, respectively). One member of this clade, At5g55500, has been...”
• Functional UDP-xylose transport across the endoplasmic reticulum/Golgi membrane in a Chinese hamster ovary cell mutant defective in UDP-xylose Synthase
  Bakker, The Journal of biological chemistry 2009
  • “...able to act on xylosides when transferase (AtXylT; AT5G55500) (32) was isolated from the same provided at high concentration but not on the endogenous...”

LOC103696231 uncharacterized protein LOC103696231 from Phoenix dactylifera
Aligns to 274:482 / 561 (37.3%), covers 87.1% of PF04577, 81.1 bits

• Glycosyltransferase Family 61 in Liliopsida (Monocot): The Story of a Gene Family Expansion
  Cenci, Frontiers in plant science 2018
  • “...genes. Species/sequence A1 A2 A3 A4 A5 A6 P. dactylifera NW_008246516.1 LOC103696170 LOC103696188, LOC103696198 Partial LOC103696231, LOC103696210 LOC103697726 LOC103696248 NW_008246831.1 LOC103719015 LOC103719019 E. guineensis NC_025995.1 LOC105041134 LOC105041135, LOC105041136 LOC105041137 LOC105041138, LOC105041140, LOC105041139, LOC105041141, LOC105041144, LOC105041142, LOC105041145 LOC105041157 LOC105041146 M. acuminata Chr01 Ma01_g14150 Ma01_g14160, Ma01_g14170, Ma01_g14180 Ma01_g14190...”

CAI11448.1 β-1,2-xylosyltransferase (Xt1) (EC 2.4.2.38) (see protein)
Aligns to 238:494 / 515 (49.9%), covers 97.1% of PF04577, 80.6 bits

PMGT2_HUMAN / Q8NAT1 Protein O-linked-mannose beta-1,4-N-acetylglucosaminyltransferase 2; POMGnT2; Extracellular O-linked N-acetylglucosamine transferase-like; Glycosyltransferase-like domain-containing protein 2; EC 2.4.1.312 from Homo sapiens (Human) (see 2 papers)
Q8NAT1 protein O-mannose beta-1,4-N-acetylglucosaminyltransferase (EC 2.4.1.312) from Homo sapiens (see paper)
XP_005265572 protein O-linked-mannose beta-1,4-N-acetylglucosaminyltransferase 2 isoform X1 from Homo sapiens
Aligns to 162:395 / 580 (40.3%), covers 96.7% of PF04577, 80.5 bits

• function: O-linked mannose beta-1,4-N- acetylglucosaminyltransferase that transfers UDP-N-acetyl-D- glucosamine to the 4-position of the mannose to generate N-acetyl- D-glucosamine-beta-1,4-O-D-mannosylprotein. Involved in the biosynthesis of the phosphorylated O-mannosyl trisaccharide (N- acetylgalactosamine-beta-3-N-acetylglucosamine-beta-4-(phosphate- 6-)mannose), a carbohydrate structure present in alpha- dystroglycan (DAG1), which is required for binding laminin G-like domain-containing extracellular proteins with high affinity.
  catalytic activity: 3-O-(alpha-D-mannosyl)-L-threonyl- [protein] + UDP-N-acetyl-alpha-D-glucosamine = 3-O-(N-acetyl-beta- D-glucosaminyl-(1->4)-alpha-D-mannosyl)-L-threonyl-[protein] + H(+) + UDP (RHEA:37663)
• Protein O-Linked Mannose β-1,4-N-Acetylglucosaminyl-transferase 2 (POMGNT2) Is a Gatekeeper Enzyme for Functional Glycosylation of α-Dystroglycan.
  Halmo, The Journal of biological chemistry 2017
  • GeneRIF: POMGNT2 when two of the conserved amino acids are replaced. These findings begin to define the selectivity of POMGNT2 and suggest that this enzyme functions as a gatekeeper enzyme to prevent the vast majority of O-mannosylated sites on proteins from becoming modified with glycan structures functional for binding laminin globular domain-containing proteins
• GTDC2 modifies O-mannosylated α-dystroglycan in the endoplasmic reticulum to generate N-acetyl glucosamine epitopes reactive with CTD110.6 antibody.
  Ogawa, Biochemical and biophysical research communications 2013 (PubMed)
  • GeneRIF: GTDC2 generates CTD110.6 antibody-reactive N-acetylglucosamine epitopes on the O-mannosylated alpha-dystroglycan.
• Exome sequencing and functional validation in zebrafish identify GTDC2 mutations as a cause of Walker-Warburg syndrome.
  Manzini, American journal of human genetics 2012
  • GeneRIF: Using WES in consanguineous WWS-affected families, we found multiple deleterious mutations in GTDC2 (also known as AGO61). .

CAI70375.1 β-1,2-xylosyltransferase (PoXYL1) (EC 2.4.2.38) (see protein)
Aligns to 191:447 / 468 (54.9%), covers 97.1% of PF04577, 80.3 bits

NP_705768 protein O-linked-mannose beta-1,4-N-acetylglucosaminyltransferase 2 precursor from Mus musculus
Aligns to 162:395 / 580 (40.3%), covers 97.1% of PF04577, 80.2 bits

• AGO61-dependent GlcNAc modification primes the formation of functional glycans on α-dystroglycan.
  Yagi, Scientific reports 2013
  • GeneRIF: AGO61-KO mice lacked laminin-binding glycans and exhibited phenotypes similar to those of known dystroglycanopathy mutants, as reflected by abnormalities in neural migration and basal lamina formation.

PMGT2_MOUSE / Q8BW41 Protein O-linked-mannose beta-1,4-N-acetylglucosaminyltransferase 2; POMGnT2; Extracellular O-linked N-acetylglucosamine transferase-like; Glycosyltransferase-like domain-containing protein 2; EC 2.4.1.312 from Mus musculus (Mouse) (see 2 papers)
Aligns to 162:395 / 605 (38.7%), covers 97.1% of PF04577, 80.1 bits

• function: O-linked mannose beta-1,4-N- acetylglucosaminyltransferase that transfers UDP-N-acetyl-D- glucosamine to the 4-position of the mannose to generate N-acetyl- D-glucosamine-beta-1,4-O-D-mannosylprotein (By similarity). Involved in the biosynthesis of the phosphorylated O-mannosyl trisaccharide (N-acetylgalactosamine-beta-3-N-acetylglucosamine- beta-4-(phosphate-6-)mannose), a carbohydrate structure present in alpha-dystroglycan (DAG1), which is required for binding laminin G-like domain-containing extracellular proteins with high affinity (PubMed:24256719).
  catalytic activity: 3-O-(alpha-D-mannosyl)-L-threonyl- [protein] + UDP-N-acetyl-alpha-D-glucosamine = 3-O-(N-acetyl-beta- D-glucosaminyl-(1->4)-alpha-D-mannosyl)-L-threonyl-[protein] + H(+) + UDP (RHEA:37663)
  disruption phenotype: Newborn are slightly smaller and die within the first day of birth due to abnormal basal lamina formation and neuronal migration defects. Defects are due to a lack of laminin- binding glycans.

AT3G18180 transferase, transferring glycosyl groups (RefSeq) from Arabidopsis thaliana
Aligns to 186:404 / 470 (46.6%), covers 90.4% of PF04577, 79.8 bits

• Evolution of protein N-glycosylation process in Golgi apparatus which shapes diversity of protein N-glycan structures in plants, animals and fungi
  Wang, Scientific reports 2017
  • “...as a putative xylosyltransferase which was recently characterized as MUCI21, while the genes AT3G18170 and AT3G18180 are expressed highly in a heteroxylan containing mucilaginous tissues, which indicated that the genes in this group are related to mucilage production in terrestrial plants 94 95 . 1,3-fucose transferase...”
• Altered Expression of Genes Implicated in Xylan Biosynthesis Affects Penetration Resistance against Powdery Mildew
  Chowdhury, Frontiers in plant science 2017
  • “...largely of uncharacterised genes and forms a sister clade to the Arabidopsis genes AT3G18170 and AT3G18180 (Figure S3 ). The importance of GT61 family in penetration resistance is strengthened further by enhanced RSI upon TIGS of two additional GT61-family members. The fact that no reciprocal infection...”
• Differential root transcriptomics in a polyploid non-model crop: the importance of respiration during osmotic stress
  Zorrilla-Fontanesi, Scientific reports 2016
  • “...# 2.010 0 (2 10 1 ) # 2.510 0 (6 10 2 ) AT3G18170 AT3G18180 Glycosyltransferase family 61 protein CF158591 (5) GSMUA_Achr 4T08240 _001 * 1.210 1 (4 10 6 ) 4.010 0 (2 10 2 ) # 4.010 0 (1 10 2 ) #...”
• Discovery of diversity in xylan biosynthetic genes by transcriptional profiling of a heteroxylan containing mucilaginous tissue
  Jensen, Frontiers in plant science 2013
  • “...c 12 DPA Stem M01000012733 AT5G61840 IRX10L CAZy GT47 104 508 4919 8557 0 M01000017653 AT3G18180 CAZy GT61 2958 3787 3620 1093 0 M01000032237 AT3G02230 RGP1, UAM CAZy GT75 5063 7559 3561 4548 142 M01000025200 AT3G18170 CAZy GT61 2001 3189 3433 926 0 M01000012668 AT3G18180 CAZy...”
  • “...509 590 1702 2828 0 M01000025204 AT3G18170 CAZy GT61 1694 2058 1702 647 0 M01000017654 AT3G18180 CAZy GT61 1479 1361 1672 304 2 M01000025153 AT2G32750 CAZy GT47 18 180 1200 588 0 M01000026523 AT3G18170 CAZy GT61 6 197 1092 1759 0 M01000007355 AT1G54940 GUX5 CAZy GT8...”
• Glycosyl transferases in family 61 mediate arabinofuranosyl transfer onto xylan in grasses
  Anders, Proceedings of the National Academy of Sciences of the United States of America 2012
  • “...in dicots. Expression levels of the Arabidopsis representatives, At3g18180 and At3g18170, are low and they are not coexpressed with secondary cell wall genes...”
• Identification of genes involved in cell wall biogenesis in grasses by differential gene expression profiling of elongating and non-elongating maize internodes
  Bosch, Journal of experimental botany 2011
  • “...AT5G61840 (IRX10-L) 0E+00 Secondary cell wall-related GT47 [ Os01g0926700 (0E+00)] pGH17 MZ00018424 10.0 5.3 GRMZM2G354610 AT3G18180 9E-79 Glycosyltransferase GH1 MZ00057235 12.7 63.6 GRMZM2G016890 AT5G44640 2E-128 Beta- D -glucosidase [ Os4bglu12 (5E-134)] GH1 MZ00023504 11.5 60.4 GRMZM2G014844 AT5G44640 1E-135 Beta- D -glucosidase [ Os6bglu24 and Os4bglu12 (3E-137)]...”
• A large rearrangement involving genes and low-copy DNA interrupts the microcollinearity between rice and barley at the Rph7 locus
  Brunner, Genetics 2003 (secret)

RCN11_ORYSJ / Q6ZFH6 Beta-1,2-xylosyltransferase RCN11; OsXylT; Protein REDUCED CULM NUMBER 11; EC 2.4.2.- from Oryza sativa subsp. japonica (Rice) (see paper)
Q6ZFH6 glycoprotein 2-beta-D-xylosyltransferase (EC 2.4.2.38) from Oryza sativa (see paper)
BAD09279.1 [N-glycan] β-1,2-xylosyltransferase (RCN11;Xt;Os08g0503800) (EC 2.4.2.38) (see protein)
Aligns to 259:512 / 533 (47.7%), covers 97.1% of PF04577, 78.9 bits

• function: Glycosyltransferase involved in the xylosylation of N- glycans (PubMed:26025522). Possesses beta-1,2-xylosyltransferase activity, transferring xylose from UDP-xylose to the core beta- linked mannose of N-glycans (PubMed:26025522). Beta-1,2-linked xylose residues on N-glycans are critical for seed germination and plant development and growth under conditions of abiotic stress (PubMed:26025522).
  disruption phenotype: Reduced number of tillers and reduced biomass.

AT3G18170 transferase, transferring glycosyl groups (RefSeq) from Arabidopsis thaliana
Aligns to 101:322 / 384 (57.8%), covers 89.5% of PF04577, 78.5 bits

• Evolution of protein N-glycosylation process in Golgi apparatus which shapes diversity of protein N-glycan structures in plants, animals and fungi
  Wang, Scientific reports 2017
  • “...was demonstrated as a putative xylosyltransferase which was recently characterized as MUCI21, while the genes AT3G18170 and AT3G18180 are expressed highly in a heteroxylan containing mucilaginous tissues, which indicated that the genes in this group are related to mucilage production in terrestrial plants 94 95 ....”
• Altered Expression of Genes Implicated in Xylan Biosynthesis Affects Penetration Resistance against Powdery Mildew
  Chowdhury, Frontiers in plant science 2017
  • “...that consists largely of uncharacterised genes and forms a sister clade to the Arabidopsis genes AT3G18170 and AT3G18180 (Figure S3 ). The importance of GT61 family in penetration resistance is strengthened further by enhanced RSI upon TIGS of two additional GT61-family members. The fact that no...”
• Differential root transcriptomics in a polyploid non-model crop: the importance of respiration during osmotic stress
  Zorrilla-Fontanesi, Scientific reports 2016
  • “...) # 2.010 0 (2 10 1 ) # 2.510 0 (6 10 2 ) AT3G18170 AT3G18180 Glycosyltransferase family 61 protein CF158591 (5) GSMUA_Achr 4T08240 _001 * 1.210 1 (4 10 6 ) 4.010 0 (2 10 2 ) # 4.010 0 (1 10 2 )...”
• Discovery of diversity in xylan biosynthetic genes by transcriptional profiling of a heteroxylan containing mucilaginous tissue
  Jensen, Frontiers in plant science 2013
  • “...3620 1093 0 M01000032237 AT3G02230 RGP1, UAM CAZy GT75 5063 7559 3561 4548 142 M01000025200 AT3G18170 CAZy GT61 2001 3189 3433 926 0 M01000012668 AT3G18180 CAZy GT61 153 762 3178 2195 0 M01000021834 AT3G18170 CAZy GT61 153 541 1889 2009 8 M01000033105 AT4G32290 GT14R 509 590...”
  • “...1479 1361 1672 304 2 M01000025153 AT2G32750 CAZy GT47 18 180 1200 588 0 M01000026523 AT3G18170 CAZy GT61 6 197 1092 1759 0 M01000007355 AT1G54940 GUX5 CAZy GT8 350 467 1072 314 0 M01000007434 AT5G05170 CESA3 CAZy GT2 270 377 944 221 1217 M01000021804 AT4G32410 CESA1...”
• Indirect evolution of hybrid lethality due to linkage with selected locus in Mimulus guttatus
  Wright, PLoS biology 2013
  • “...glycosyltransferase metabolic enzyme ( www.phytozome.net ). This protein has greatest homology to A. thaliana gene AT3G18170, which attaches glyosyl groups to N-linked glycan molecules critical for construction of plant cell membranes [31] . The second flanking gene, MGV1A026627M, is located 41 kb from Nec1 and encodes...”
• Glycosyl transferases in family 61 mediate arabinofuranosyl transfer onto xylan in grasses
  Anders, Proceedings of the National Academy of Sciences of the United States of America 2012
  • “...Expression levels of the Arabidopsis representatives, At3g18180 and At3g18170, are low and they are not coexpressed with secondary cell wall genes (Fig. S6). We...”
• Common and unique elements of the ABA-regulated transcriptome of Arabidopsis guard cells
  Wang, BMC genomics 2011
  • “...protein 1.5E-09 5.0 AT5G67370 unknown protein 1.8E-09 4.5 AT2G44660 transferase, transferring glycosyl groups 1.8E-09 3.9 AT3G18170 similar to unknown protein AT3G18180.1 1.9E-09 3.3 AT4G08980 F-box family protein (FBW2) 2.4E-09 3.6 AT1G68470 exostosin family protein 2.4E-09 10.3 AT2G24150 HHP3 heptahelical protein 3; receptor 2.6E-09 10.0 AT5G60790 ATGCN1...”
• A large rearrangement involving genes and low-copy DNA interrupts the microcollinearity between rice and barley at the Rph7 locus
  Brunner, Genetics 2003 (secret)

XAT3_ORYSJ / Q10I20 Alpha-1,3-arabinosyltransferase XAT3; Xylan arabinosyltransferase 3; OsXAT3; EC 2.4.2.- from Oryza sativa subsp. japonica (Rice) (see paper)
AAK50581.1 xylan α-1,3-arabinofuranosyltransferase (OsXAT3; Os03g0567600 or Os03g37010) (EC 2.4.2.-) (see protein)
Aligns to 289:513 / 576 (39.1%), covers 96.2% of PF04577, 77.9 bits

• function: Glycosyltransferase involved in the arabinosylation of xylan, the major hemicellulose (non-cellulosic component) of primary and secondary walls of angiosperms (PubMed:22215597). Possesses alpha-1,3-arabinosyltransferase activity, ttransferring an arabinofuranose residue to the xylan backbone (PubMed:22215597).

LOC105041135 protein O-linked-mannose beta-1,4-N-acetylglucosaminyltransferase 2-like from Elaeis guineensis
Aligns to 175:386 / 462 (45.9%), covers 89.5% of PF04577, 77.3 bits

• Glycosyltransferase Family 61 in Liliopsida (Monocot): The Story of a Gene Family Expansion
  Cenci, Frontiers in plant science 2018
  • “...LOC103696170 LOC103696188, LOC103696198 Partial LOC103696231, LOC103696210 LOC103697726 LOC103696248 NW_008246831.1 LOC103719015 LOC103719019 E. guineensis NC_025995.1 LOC105041134 LOC105041135, LOC105041136 LOC105041137 LOC105041138, LOC105041140, LOC105041139, LOC105041141, LOC105041144, LOC105041142, LOC105041145 LOC105041157 LOC105041146 M. acuminata Chr01 Ma01_g14150 Ma01_g14160, Ma01_g14170, Ma01_g14180 Ma01_g14190 Ma01_g14200 Chr02 Ma02_g16300 Ma02_g16310 Ma02_g16320 Chr02 Ma02_g24690 Ma02_g24680 Chr04 Ma04_g30890 Ma04_g30880...”

CCA61105.1 xylan α-1,3-arabinofuranosyltransferase (TaGT61_1) (EC 2.4.2.-) (see protein)
Aligns to 209:435 / 506 (44.9%), covers 89.5% of PF04577, 77.0 bits

AT4G33600 hypothetical protein (RefSeq) from Arabidopsis thaliana
Aligns to 177:404 / 470 (48.5%), covers 96.7% of PF04577, 76.8 bits

• Identification of ZOUPI Orthologs in Soybean Potentially Involved in Endosperm Breakdown and Embryogenic Development
  Zhang, Frontiers in plant science 2017
  • “...Target Genes The expression of presumed ZOU target genes, including ALE1. At3g06890. At5g03820 , and At4g33600 ( Kondou et al., 2008 ; Yang et al., 2008 ; Xing et al., 2013 ) were detected in the GmZOUs transgenic lines ( Figure 6 ). The ZOU target...”
  • “...GmZOU-2 transgenic lines as detected by qPCR. The expression of ALE1. At3g06890. At5g03820 , and At4g33600 , which are the AtZOU presumed target genes, decreased in the Atzou-4 mutant and showed partial recovery in the GmZOU-1 transgenic lines, but not in the GmZOU-2 transgenic lines. These...”

XAT2_ORYSJ / Q6ZFR0 Alpha-1,3-arabinosyltransferase XAT2; Xylan arabinosyltransferase 2; OsXAT2; EC 2.4.2.- from Oryza sativa subsp. japonica (Rice) (see paper)
BAD15592.1 xylan α-1,3-arabinofuranosyltransferase (OsXAT2; Os02g22480 or Os02g0330200) (EC 2.4.2.-) (see protein)
Aligns to 296:520 / 583 (38.6%), covers 96.2% of PF04577, 76.4 bits

• function: Glycosyltransferase involved in the arabinosylation of xylan, the major hemicellulose (non-cellulosic component) of primary and secondary walls of angiosperms (PubMed:22215597). Possesses alpha-1,3-arabinosyltransferase activity, transferring an arabinofuranose residue to the xylan backbone (PubMed:22215597).

AT2G03370 transferase, transferring glycosyl groups (RefSeq) from Arabidopsis thaliana
Aligns to 159:384 / 452 (50.0%), covers 95.7% of PF04577, 76.3 bits

• A large rearrangement involving genes and low-copy DNA interrupts the microcollinearity between rice and barley at the Rph7 locus
  Brunner, Genetics 2003 (secret)

GRMZM6G474234 glycosyltransferase from Zea mays
Aligns to 285:509 / 572 (39.3%), covers 96.7% of PF04577, 76.2 bits

• Stable Patterns of CENH3 Occupancy Through Maize Lineages Containing Genetically Similar Centromeres
  Gent, Genetics 2015
  • “...80.0 0.000 8 50755590 50755835 245 GRMZM2G100662 13 47 68.1 0.000 9 52423318 52424569 1,251 GRMZM6G474234 39 4 1.9 0.171 9 52961497 52964749 3,252 GRMZM2G061764 40 98 46.1 0.000 9 53764682 53766013 1,331 GRMZM2G143473 35 22 11.8 0.000 9 53828063 53828852 789 GRMZM2G528479 30 9 5.6...”

PP3440 hypothetical protein (NCBI ptt file) from Pseudomonas putida KT2440
Aligns to 153:351 / 372 (53.5%), covers 98.1% of PF04577, 73.3 bits

• Mechanisms of resistance to chloramphenicol in Pseudomonas putida KT2440
  Fernández, Antimicrobial agents and chemotherapy 2012
  • “...PP1514 PP1516 PP2284 PP2310 PP2512 PP2736 PP2738 PP3352 PP3440 PP3656 PP3657 PP3761 PP3781 PP3782 PP3783 PP3809 PP4051 PP4250 PP4252 PP4253 PP4264 PP4265 PP4623...”

CCC14964.1 xylan α-1,3-arabinofuranosyltransferase (TaGT61_2) (EC 2.4.2.-) (see protein)
Aligns to 292:516 / 578 (38.9%), covers 95.2% of PF04577, 72.8 bits

PMGT2_DANRE / Q5NDE5 Protein O-linked-mannose beta-1,4-N-acetylglucosaminyltransferase 2; POMGnT2; Extracellular O-linked N-acetylglucosamine transferase-like; Glycosyltransferase-like domain-containing protein 2; EC 2.4.1.312 from Danio rerio (Zebrafish) (Brachydanio rerio) (see paper)
Aligns to 161:394 / 578 (40.5%), covers 97.1% of PF04577, 72.1 bits

• function: O-linked mannose beta-1,4-N- acetylglucosaminyltransferase that transfers UDP-N-acetyl-D- glucosamine to the 4-position of the mannose to generate N-acetyl- D-glucosamine-beta-1,4-O-D-mannosylprotein. Involved in the biosynthesis of the phosphorylated O-mannosyl trisaccharide (N- acetylgalactosamine-beta-3-N-acetylglucosamine-beta-4-(phosphate- 6-)mannose), a carbohydrate structure present in alpha- dystroglycan (DAG1), which is required for binding laminin G-like domain-containing extracellular proteins with high affinity (By similarity).
  catalytic activity: 3-O-(alpha-D-mannosyl)-L-threonyl- [protein] + UDP-N-acetyl-alpha-D-glucosamine = 3-O-(N-acetyl-beta- D-glucosaminyl-(1->4)-alpha-D-mannosyl)-L-threonyl-[protein] + H(+) + UDP (RHEA:37663)

NP_001012384 protein O-linked-mannose beta-1,4-N-acetylglucosaminyltransferase 2 from Danio rerio
Aligns to 168:401 / 585 (40.0%), covers 97.1% of PF04577, 72.0 bits

• Exome sequencing and functional validation in zebrafish identify GTDC2 mutations as a cause of Walker-Warburg syndrome.
  Manzini, American journal of human genetics 2012
  • GeneRIF: We found that gtdc2 knockdown in zebrafish replicates all WWS features (hydrocephalus, ocular defects, and muscular dystrophy), strongly suggesting that GTDC2 mutations cause WWS.

CNC02270 hypothetical protein (RefSeq) from Cryptococcus neoformans var. neoformans JEC21
Aligns to 363:507 / 561 (25.8%), covers 56.5% of PF04577, 71.6 bits

• The lncRNA RZE1 Controls Cryptococcal Morphological Transition
  Chacko, PLoS genetics 2015
  • “...of CNG02160 Upstream of CNAG_03366 RZE1 , Upstream of Zinc finger transcription factor ZNF2 X318 CNC02270 CNAG_01723 Hypothetical protein X319 CNH01180 CNAG_05456 Hypothetical protein X322 CNF04180 CNAG_06601 Amidohydrolase X331 CNK00830 CNAG_02597 Hypothetical protein X333 CNI00570 CNAG_04500 Hypothetical protein X336 CNH00730 and neighbors CNAG_05405 Hypothetical protein X337...”

Q2UVB3 glycoprotein 2-beta-D-xylosyltransferase (EC 2.4.2.38) from Zea mays (see paper)
CAJ47425.1 β-1,2-xylosyltransferase (Xt1;XylT) (EC 2.4.2.38) (see protein)
Aligns to 238:491 / 512 (49.6%), covers 97.6% of PF04577, 71.1 bits

LOC103696170 protein O-linked-mannose beta-1,4-N-acetylglucosaminyltransferase 2-like from Phoenix dactylifera
Aligns to 189:418 / 484 (47.5%), covers 76.1% of PF04577, 71.1 bits

• Glycosyltransferase Family 61 in Liliopsida (Monocot): The Story of a Gene Family Expansion
  Cenci, Frontiers in plant science 2018
  • “...loci of monocot OG-GT61-A genes. Species/sequence A1 A2 A3 A4 A5 A6 P. dactylifera NW_008246516.1 LOC103696170 LOC103696188, LOC103696198 Partial LOC103696231, LOC103696210 LOC103697726 LOC103696248 NW_008246831.1 LOC103719015 LOC103719019 E. guineensis NC_025995.1 LOC105041134 LOC105041135, LOC105041136 LOC105041137 LOC105041138, LOC105041140, LOC105041139, LOC105041141, LOC105041144, LOC105041142, LOC105041145 LOC105041157 LOC105041146 M. acuminata Chr01 Ma01_g14150...”

Pden_1294 hypothetical protein (NCBI) from Paracoccus denitrificans PD1222
Aligns to 132:326 / 354 (55.1%), covers 99.0% of PF04577, 71.0 bits

• Genome-Wide Discovery of Putative sRNAs in Paracoccus denitrificans Expressed under Nitrous Oxide Emitting Conditions
  Gaimster, Frontiers in microbiology 2016
  • “...175052 165043 120000 Pden_1824 hypothetical protein Intergenic 100 2543197 2543334 137 + 1302 473 129 Pden_1294 hypothetical protein Intergenic 12 87937 88007 70 + 170 138 942 Pden_0373 hypothetical protein Antisense 13 90535 90607 72 + 133 142 Pden_1805 binding-protein-dependent transport system inner membrane protein Intergenic...”

LOC109843905 EGF domain-specific O-linked N-acetylglucosamine transferase-like from Asparagus officinalis
Aligns to 98:322 / 387 (58.1%), covers 96.2% of PF04577, 69.2 bits

• Glycosyltransferase Family 61 in Liliopsida (Monocot): The Story of a Gene Family Expansion
  Cenci, Frontiers in plant science 2018
  • “...studied. As expected, A. officinalis sequences have a basal position in all four clades, with LOC109843905 and LOC109840057 clearly included in clade D1 and D4, respectively, whereas the A. officinalis sequence (LOC109831329 ) is branched on a basal position of the two clades D2 and D3...”

NP_187643 Glycosyltransferase family 61 protein from Arabidopsis thaliana
AT3G10320 transferase, transferring glycosyl groups (RefSeq) from Arabidopsis thaliana
Aligns to 197:431 / 494 (47.6%), covers 96.7% of PF04577, 68.1 bits

• Highly Branched Xylan Made by IRREGULAR XYLEM14 and MUCILAGE-RELATED21 Links Mucilage to Arabidopsis Seeds.
  Voiniciuc, Plant physiology 2015
  • GeneRIF: MUCI21, a member of an uncharacterized clade of the GT61 family, and IRX14 (GT43 protein) are essential for the synthesis of highly branched xylan in seed coat epidermal cells.
• Evolution of protein N-glycosylation process in Golgi apparatus which shapes diversity of protein N-glycan structures in plants, animals and fungi
  Wang, Scientific reports 2017
  • “...( Supplementary Figure S14 ). In this group, although no genes were definitely identified enzymatically, AT3G10320 was demonstrated as a putative xylosyltransferase which was recently characterized as MUCI21, while the genes AT3G18170 and AT3G18180 are expressed highly in a heteroxylan containing mucilaginous tissues, which indicated that...”
• Altered Expression of Genes Implicated in Xylan Biosynthesis Affects Penetration Resistance against Powdery Mildew
  Chowdhury, Frontiers in plant science 2017
  • “...AT3G18170AT3G18180 Arabinofuranosyl transferase 6H 49.787 UP (1.79) UP (1.27) Anders et al., 2012 MLOC_35025 GT61 AT3G10320 Xylosyl transferase, decorates xylan with xylose side chains 1H 17.288 UP (1.86) UP (0.91) Voiniciuc et al., 2015 MLOC_64204 GT75 Not found UDP-Arabinose Mutase ( HvUAM3 ) UP (2.09) UP...”
• Decreased glutathione reductase2 leads to early leaf senescence in Arabidopsis
  Ding, Journal of integrative plant biology 2016
  • “...d after emergence in the igr29 line AGI number Description Fold change a RER b AT3G10320 Glycosyltransferase family 61 protein 2.20 5.811.7 AT5G12030 Heat shock protein 17.6A 1.84 3.220.8 AT5G62480 Glutathione Stransferase tau 9 (GSTU9) 4.25 8.432.0 AT3G26830 Cytochrome P450 71B15 (PAD3) 2.25 6.701.3 AT4G23810 WRKY...”
• Expression of ROS-responsive genes and transcription factors after metabolic formation of H(2)O(2) in chloroplasts
  Balazadeh, Frontiers in plant science 2012
  • “...1.10 0.76 0.47 0.18 3.05 1.71 At3g09410 0.28 0.27 0.22 0.81 0.22 1.66 1.46 0.32 At3g10320 0.36 0.84 2.31 1.49 3.05 2.85 6.78 3.90 At3g10930 0.72 4.25 1.97 3.89 3.08 5.28 7.56 5.90 At3g11840 1.19 1.22 1.67 0.87 0.88 1.81 3.81 2.49 At3g12580 1.37 1.54 2.02...”
• A large rearrangement involving genes and low-copy DNA interrupts the microcollinearity between rice and barley at the Rph7 locus
  Brunner, Genetics 2003 (secret)

LOC103719015 EGF domain-specific O-linked N-acetylglucosamine transferase-like from Phoenix dactylifera
Aligns to 181:409 / 476 (48.1%), covers 90.9% of PF04577, 68.1 bits

• Glycosyltransferase Family 61 in Liliopsida (Monocot): The Story of a Gene Family Expansion
  Cenci, Frontiers in plant science 2018
  • “...A4 A5 A6 P. dactylifera NW_008246516.1 LOC103696170 LOC103696188, LOC103696198 Partial LOC103696231, LOC103696210 LOC103697726 LOC103696248 NW_008246831.1 LOC103719015 LOC103719019 E. guineensis NC_025995.1 LOC105041134 LOC105041135, LOC105041136 LOC105041137 LOC105041138, LOC105041140, LOC105041139, LOC105041141, LOC105041144, LOC105041142, LOC105041145 LOC105041157 LOC105041146 M. acuminata Chr01 Ma01_g14150 Ma01_g14160, Ma01_g14170, Ma01_g14180 Ma01_g14190 Ma01_g14200 Chr02 Ma02_g16300 Ma02_g16310 Ma02_g16320...”

XYXT1_ORYSJ / Q5Z8T8 Beta-1,2-xylosyltransferase XYXT1; Xylan xylosyltransferase 1; EC 2.4.2.- from Oryza sativa subsp. japonica (Rice) (see paper)
Aligns to 180:384 / 465 (44.1%), covers 88.5% of PF04577, 68.0 bits

• function: Glycosyltransferase involved in the xylosylation of xylan, the major hemicellulose (non-cellulosic component) of primary and secondary walls of angiosperms (PubMed:29325159). Possesses beta-1,2-xylosyltransferase activity, transferring xylose from UDP-xylose to the xylan backbone (PubMed:29325159). Catalyzes the addition of 2-O-xylosyl side chains to the xylan backbone (PubMed:29325159).

AT2G41640 transferase, transferring glycosyl groups (RefSeq) from Arabidopsis thaliana
Aligns to 194:426 / 500 (46.6%), covers 61.7% of PF04577, 66.4 bits

• GWAS with Heterogeneous Data: Estimating the Fraction of Phenotypic Variation Mediated by Gene Expression Data
  Sasaki, G3 (Bethesda, Md.) 2018
  • “...0.53 FLC * AT1G65480 0.54 2.64E-11 0.37 FT * AT2G45660 0.47 1.35E-08 0.22 SOC1 * AT2G41640 0.42 7.03E-07 0.20 Glycosyl- transferase AT3G57920 0.39 3.28E-06 0.17 SPL15 AT1G04400 0.38 5.24E-06 0.15 CRY2 * AT5G52310 0.38 5.39E-06 0.14 RD29A AT1G69440 0.38 5.53E-06 0.18 AGO7 AT3G13100 0.38 7.71E-06 0.10...”
• Cell growth and homeostasis are disrupted in arabidopsis rns2-2 mutants missing the main vacuolar RNase activity
  Morriss, Annals of botany 2017
  • “...3, reverse primer 5 ATCGCAAGGAACTCTTTGGT 3); AT2G41640, glycosyl transferase (forward primer 5 TGTGCTTCAAACGTCACCCA 3, reverse primer 5 TGCGAAACGAATCTAGGAGGG...”
  • “...results were obtained for the glycosyltransferase gene AT2G41640. Table1. List of genes differentially expressed in the rns2-2 mutant seedlings with respect...”
• ERF5 and ERF6 play redundant roles as positive regulators of JA/Et-mediated defense against Botrytis cinerea in Arabidopsis
  Moffat, PloS one 2012
  • “...Unknown protein 2.6 0.007 - - At2g02930 Glutathione S -transferase (GST16) 2.8 0.006 - - At2g41640 Glycosyltransferase 2.7 0.007 - - At3g04960 Unknown protein 3.0 0.008 - - At3g16530 Lectin-like protein 6.6 <0.001 - - At3g49620 Dark inducible 11 (DIN11) 3.3 0.002 - - At3g53260 Phenylalanine...”
• Expression of ROS-responsive genes and transcription factors after metabolic formation of H(2)O(2) in chloroplasts
  Balazadeh, Frontiers in plant science 2012
  • “...unknown function At4g18880 * 1.6 6.5 4.0 1.9 4.6 2.4 Heat stress-type transcription factor (HsfA4a/HSF21) At2g41640 1.1 4.0 3.7 2.2 6.0 2.7 Protein of unknown function At1g28190 * 1.1 3.9 3.5 2.4 5.6 2.3 Protein of unknown function At5g57220 2.8 9.1 3.3 1.3 6.9 5.2 Cytochrome...”
  • “...0.11 0.23 0.71 1.09 1.44 1.20 At2g41380 0.19 0.27 2.95 2.64 3.26 4.41 5.92 4.88 At2g41640 0.12 2.02 0.91 1.01 1.17 2.59 2.84 2.49 At2g43820 0.50 0.11 1.38 0.24 0.09 0.68 3.02 3.05 At2g47000 0.15 0.22 0.59 2.57 0.55 4.43 7.60 6.33 At3g02800 0.14 2.31 0.32...”
• Unstable transcripts in Arabidopsis allotetraploids are associated with nonadditive gene expression in response to abiotic and biotic stresses
  Kim, PloS one 2011
  • “...27.68 AT1G72950 disease resistance protein (TIR-NBS class), putative 27.98 AT2G28400 similar to unknown protein 28.02 AT2G41640 similar to unknown protein 28.34 AT1G72430 auxin-responsive protein-related 28.60 AT3G52450 U-box domain-containing protein 28.71 AT1G56510 disease resistance protein (TIR-NBS-LRR class), putative 28.72 AT3G19580 AZF2 (ARABIDOPSIS ZINC-FINGER PROTEIN 2) 28.96 AT1G17380...”
• Transcriptional responses of Arabidopsis thaliana plants to As (V) stress
  Abercrombie, BMC plant biology 2008
  • “...protein (GASA1) at1g75750 -1.70 93.7 dehydrin (RAB18) at5g66400 -1.70 81.1 unknown protein similar to glycosyltransferase at2g41640 -1.54 185.8 patatin-like protein 8 at4g29800 -1.52 198.7 phosphate-responsive protein at5g64260 -1.52 221.0 phosphate-responsive protein at1g35140 -1.58 131.5 similar to LITAF-domain containing protein at5g13190 -1.54 293.4 Transcription factor activity DRE-binding...”
• Transcriptional profiling of pea ABR17 mediated changes in gene expression in Arabidopsis thaliana
  Krishnaswamy, BMC plant biology 2008
  • “...Glucosyl transferase -related 2.18 0.16 4.37E-05 At4g24380 Hydrolase, acting on ester bonds 2.16 0.35 1.68E-03 At2g41640 Similar to unknown protein (Arabidopsis thaliana) 2.15 0.15 7.48E-04 At2g30840 2-oxoglutarate-dependent dioxygenase, putative 2.14 0.16 3.57E-05 At5g35510 Unknown protein 2.09 0.16 2.00E-04 At1g17380 Similar to unknown protein (Arabidopsis thaliana) 2.06...”
• A large rearrangement involving genes and low-copy DNA interrupts the microcollinearity between rice and barley at the Rph7 locus
  Brunner, Genetics 2003 (secret)
• More

LOC109831329 uncharacterized protein LOC109831329 from Asparagus officinalis
Aligns to 165:390 / 423 (53.4%), covers 35.4% of PF04577, 63.1 bits

• Glycosyltransferase Family 61 in Liliopsida (Monocot): The Story of a Gene Family Expansion
  Cenci, Frontiers in plant science 2018
  • “...and LOC109840057 clearly included in clade D1 and D4, respectively, whereas the A. officinalis sequence (LOC109831329 ) is branched on a basal position of the two clades D2 and D3 (Figure 3 ). FIGURE 3 Phylogenetic tree obtained with 55 GT61 sequences from clade D, F,...”

AT3G57380 transferase, transferring glycosyl groups (RefSeq) from Arabidopsis thaliana
Aligns to 196:426 / 504 (45.8%), covers 46.9% of PF04577, 62.3 bits

• The Arabidopsis transcription factor IIB-related protein BRP4 is involved in the regulation of mitotic cell-cycle progression during male gametogenesis
  Qin, Journal of experimental botany 2014
  • “...Liu et al. , 1995 ), and found that a T-DNA segment was inserted between At3g57380 and At3g57370 ( BRP4 ), 1014bp upstream of the start codon of BRP4 ( Fig. 1E ). RT-PCR analysis showed that the expression of BRP4 was highly upregulated in smo3-D...”
  • “...BRP4 locus in smo3-D . The coding regions of both At3g57370 ( BRP4 ) and At3g57380 are indicated as black arrows, and the intermediate genomic sequence is indicated as a black line. T-DNA was inserted in the promoter region of BRP4 , 1014bp upstream of ATG....”
• Early gene expression events in the laminar abscission zone of abscission-promoted citrus leaves after a cycle of water stress/rehydration: involvement of CitbHLH1
  Agustí, Journal of experimental botany 2012
  • “...metabolism C21005A06 Xyloglucan endotransglucosylase/hydrolase AT4G25810 3.35 1.55 C21005E09 UDP-glucose dehydrogenase AT5G15490 3.43 2.69 C21001D09 Glycosyltransferase AT3G57380 1.30 1.40 C21003F02 Pectate lyase AT4G24780 2.77 1.65 C21008F11 Acidic cellulase AT4G02800 3.37 3.20 1.92 Fatty acid biosynthesis and metabolism C21006C05 Acyl-CoA synthetase-like protein AT3G23790 1.75 1.05 C21001F06 1-Acyl-sn-glycerol-3-phosphate acyltransferase...”
• A large rearrangement involving genes and low-copy DNA interrupts the microcollinearity between rice and barley at the Rph7 locus
  Brunner, Genetics 2003 (secret)

LOC103696248 uncharacterized protein LOC103696248 from Phoenix dactylifera
Aligns to 325:510 / 511 (36.4%), covers 81.3% of PF04577, 61.3 bits

• Glycosyltransferase Family 61 in Liliopsida (Monocot): The Story of a Gene Family Expansion
  Cenci, Frontiers in plant science 2018
  • “...A2 A3 A4 A5 A6 P. dactylifera NW_008246516.1 LOC103696170 LOC103696188, LOC103696198 Partial LOC103696231, LOC103696210 LOC103697726 LOC103696248 NW_008246831.1 LOC103719015 LOC103719019 E. guineensis NC_025995.1 LOC105041134 LOC105041135, LOC105041136 LOC105041137 LOC105041138, LOC105041140, LOC105041139, LOC105041141, LOC105041144, LOC105041142, LOC105041145 LOC105041157 LOC105041146 M. acuminata Chr01 Ma01_g14150 Ma01_g14160, Ma01_g14170, Ma01_g14180 Ma01_g14190 Ma01_g14200 Chr02 Ma02_g16300...”

LOC109840057 EGF domain-specific O-linked N-acetylglucosamine transferase-like from Asparagus officinalis
Aligns to 236:458 / 524 (42.6%), covers 97.6% of PF04577, 58.8 bits

• Glycosyltransferase Family 61 in Liliopsida (Monocot): The Story of a Gene Family Expansion
  Cenci, Frontiers in plant science 2018
  • “...expected, A. officinalis sequences have a basal position in all four clades, with LOC109843905 and LOC109840057 clearly included in clade D1 and D4, respectively, whereas the A. officinalis sequence (LOC109831329 ) is branched on a basal position of the two clades D2 and D3 (Figure 3...”

GRMZM2G074896 glycosyltransferase from Zea mays
Aligns to 281:512 / 551 (42.1%), covers 62.7% of PF04577, 52.1 bits

• Identification and validation of genomic regions influencing kernel zinc and iron in maize
  Hindu, TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik 2018
  • “...10.7 DHP2 CE and TZ GRMZM2G116586 UTP-glucose-1-phosphate uridylyltransferase S5_68423957 5 68,423,957 6.45E04 2.79E03 1.38 7.9 GRMZM2G074896 Glycosyltransferase protein S5_71718466 5 71,718,466 7.35E04 4.49E06 1.81 13.1 GRMZM2G144282 Translation initiation factor eIF3 subunit S5_100070727 5 100,070,727 6.40E04 2.27E06 1.60 13.3 GRMZM2G079653 Ice binding, Homoiothermy, S7_173181688 7 173,181,688 5.44E04...”

GRMZM2G105221 glycosyltransferase from Zea mays
Aligns to 223:455 / 529 (44.0%), covers 43.5% of PF04577, 45.5 bits

• Comparative RNA-Seq Analysis Reveals That Regulatory Network of Maize Root Development Controls the Expression of Genes in Response to N Stress
  He, PloS one 2016
  • “...pyrophosphate synthase (GRMZM2G058404), splicing factor U2af subunit isoform (GRMZM2G031827), isocitrate lyase (GRMZM2G056369), beta-glucanase (GRMZM2G473711), glycosyltransferase (GRMZM2G105221), and aldose 1-epimerase (GRMZM2G125233). In contrast, rtcs showed larger dynamic changes in gene expression under N-deficiency stress, and 804 co-modulated DEGs were detected ( S10 Table ). More N-deficiency-induced genes...”

Or search for genetic data about PF04577 in the Fitness Browser