Family Search for PF04577 (Glyco_transf_61)
April 2024: See Interactive Tools for Functional Annotation of Bacterial Genomes for advice on using these tools.
Running HMMer for PF04577
PF04577 hits 67 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.
PBN151_4312 glycosyltransferase family 61 protein from Paenibacillus sp. NAIST15-1
Aligns to 130:302 / 361 (47.9%), covers 100.0% of PF04577, 92.6 bits
A1G_01610 hypothetical protein from Rickettsia rickettsii str. 'Sheila Smith'
Aligns to 1:168 / 188 (89.4%), covers 89.0% of PF04577, 80.4 bits
- Limited transcriptional responses of Rickettsia rickettsii exposed to environmental stimuli
Ellison, PloS one 2009 - “...c (Fold Change) RrIowa0897 d 8.54 8.3 RrIowa1169 d 6.03 6.66 A1G_02980 (RrIowa0627) 5.76 5.26 A1G_01610 (RrIowa0341) 5.70 5.55 A1G_00030 (RrIowa0006) 4.46 3.4 RrIowa1039 d 3.63 2.9 A1G_06435 (RrIowa1378) 3.58 3.22 RrIowa0142 d 3.57 3.22 A1G_03075 (RrIowa0648) 3.36 3.03 A1G_03390 (RrIowa0718) 3.34 3.22 A1G_04585 (RrIowa0965) 3.17...”
- “...RrIowa1039 c 9.18 A1G_00030 (RrIowa0006) 8.33 A1G_02195 (RrIowa0461) 7.37 A1G_07015 (RrIowa1497) 7.21 A1G_02820 (RrIowa0592) 7.04 A1G_01610 (RrIowa0341) 6.52 A1G_03075 (RrIowa0648) 6.21 A1G_00065 (RrIowa0015) 6.03 A1G_05945 (RrIowa1276) 6.00 A1G_01945 (RrIowa0410) 5.92 RrIowa0897 c 5.75 A1G_06420 (RrIowa1375) 5.75 RrIowa1169 c 5.64 A1G_05940 (RrIowa1275) 5.46 A1G_00285 (RrIowa0063) 4.73 A1G_05960...”
EOGT_DROME / Q9VQB7 EGF domain-specific O-linked N-acetylglucosamine transferase; Extracellular O-linked N-acetylglucosamine transferase; EC 2.4.1.255 from Drosophila melanogaster (Fruit fly) (see paper)
Q9VQB7 protein O-GlcNAc transferase (EC 2.4.1.255) from Drosophila melanogaster (see paper)
AAF51259.1 [protein] EGF20 O-β-N-acetylglucosaminyltransferase (Eogt;EOGT;CG9867) (EC 2.4.1.255) (see protein)
NP_608678 EGF-domain O-GlcNAc transferase, isoform A from Drosophila melanogaster
Aligns to 233:429 / 520 (37.9%), covers 88.2% of PF04577, 70.6 bits
- function: Catalyzes the transfer of a single N-acetylglucosamine from UDP-GlcNAc to a serine or threonine residue in extracellular proteins resulting in their modification with a beta-linked N-acetylglucosamine (O-GlcNAc). Specifically glycosylates the Thr residue located between the fifth and sixth conserved cysteines of folded EGF-like domains. Involved in epithelial cell adhesion/interaction with the extracellular matrix by mediating glycosylation of proteins in the secretory pathway, such as Dumpy (Dp).
catalytic activity: L-seryl-[protein] + UDP-N-acetyl-alpha-D-glucosamine = 3-O-(N- acetyl-beta-D-glucosaminyl)-L-seryl-[protein] + H(+) + UDP (RHEA:48904)
catalytic activity: L-threonyl-[protein] + UDP-N-acetyl-alpha-D-glucosamine = 3-O- (N-acetyl-beta-D-glucosaminyl)-L-threonyl-[protein] + H(+) + UDP (RHEA:48908)
cofactor: a divalent metal cation
disruption phenotype: Defects in apical extracellular matrix. Embryos show defects in the formation of the innermost layer of the apical extracellular matrix and its attachment to the epidermis. Most larvae die during second-instar or second/third-instar interface, but some survive until early third-instar. Surviving larvae display cuticle defect and irregular tracheal morphology. Ultrastructural analysis of larval epidermis reveals disruption of the deposition zone of the endocuticle, leading to separation of the epidermis from the chitin layers. - EOGT and O-GlcNAc on secreted and membrane proteins.
Varshney, Biochemical Society transactions 2017 - GeneRIF: Studies provide evidence that EOGT plays important roles in drosophila, especially in its development.[review]
- The EGF repeat-specific O-GlcNAc-transferase Eogt interacts with notch signaling and pyrimidine metabolism pathways in Drosophila.
Müller, PloS one 2013 - GeneRIF: Data suggest that Eogt knock-down in the wing leads to metabolic and signaling perturbations that increase cytosolic uracil levels, thereby causing wing blister formation.
XP_001989043 EGF domain-specific O-linked N-acetylglucosamine transferase from Drosophila grimshawi
Aligns to 233:431 / 520 (38.3%), covers 87.5% of PF04577, 69.5 bits
CC_0632 hypothetical protein from Caulobacter crescentus CB15
Aligns to 118:284 / 350 (47.7%), covers 100.0% of PF04577, 69.5 bits
AFUA_4G09390 DUF563 domain protein from Aspergillus fumigatus Af293
Aligns to 209:414 / 488 (42.2%), covers 69.9% of PF04577, 66.6 bits
- Investigation of Aspergillus fumigatus biofilm formation by various "omics" approaches
Muszkieta, Frontiers in microbiology 2013 - “...short chain dehydrogenase/reductase family 2.89 1.53 16.14 4.01 AFUA_1G00930 Hypothetical protein 2.95 1.56 15.40 3.94 AFUA_4G09390 Conserved hypothetical protein 3.38 1.76 15.15 3.92 AFUA_3G03640 Siderochrome-iron transporter (MirB), putative 5.17 2.37 13.62 3.77 AFUA_6G12170 FKBP-type peptidyl-prolyl isomerase, putative 3.61 1.85 11.97 3.58 AFUA_7G00250 Tubulin beta-2 subunit 5.13...”
CC0631, CC_0631 hypothetical protein from Caulobacter crescentus CB15
Aligns to 135:310 / 394 (44.7%), covers 100.0% of PF04577, 65.5 bits
HMPREF1204_03307 glycosyltransferase 61 family protein from Bacteroides fragilis HMW 615
Aligns to 126:315 / 371 (51.2%), covers 99.3% of PF04577, 63.1 bits
- Novel large-scale chromosomal transfer in Bacteroides fragilis contributes to its pan-genome and rapid environmental adaptation
Husain, Microbial genomics 2017 - “...outer membrane associated proteins. Fig. 6. PSF exchange mediated by tetQ2 435 and tetQ2 482. HMPREF1204_03307, is a gene from the PSF operon of B. fragilis HMW615 (within tetQ2 435 ). BF638R_1544, BF638R_1548, BF638R_1552, and BF638R_1556 are genes within the PSF operon of B. fragilis 638R....”
- “...HMW615 genome. a: Lane 1: MW Standard, Lanes 26: Template B. fragilis HMW615. Primers for HMPREF1204_03307, BF638R_1544, BF638R_1548, BF638R_1552, and BF638R_1556, respectively. Lanes 711: Template BF 638R. Primers for HMPREF1204_03307, BF638R_1544, BF638R_1548, BF638R_1552, and BF638R_1556, respectively. Lanes 1216: Template BF638R ::tetQ2 435 . Primers for HMPREF1204_03307,...”
POMGNT2 / Q8NAT1 protein O-linked-mannose β-1,4-N-acetylglucosaminyltransferase 2 (EC 2.4.1.312) from Homo sapiens (see 2 papers)
PMGT2_HUMAN / Q8NAT1 Protein O-linked-mannose beta-1,4-N-acetylglucosaminyltransferase 2; POMGnT2; Extracellular O-linked N-acetylglucosamine transferase-like; Glycosyltransferase-like domain-containing protein 2; EC 2.4.1.312 from Homo sapiens (Human) (see 3 papers)
Q8NAT1 protein O-mannose beta-1,4-N-acetylglucosaminyltransferase (EC 2.4.1.312) from Homo sapiens (see 2 papers)
XP_005265572 protein O-linked-mannose beta-1,4-N-acetylglucosaminyltransferase 2 isoform X1 from Homo sapiens
Aligns to 139:362 / 580 (38.6%), covers 74.3% of PF04577, 59.4 bits
- function: O-linked mannose beta-1,4-N-acetylglucosaminyltransferase that transfers UDP-N-acetyl-D-glucosamine to the 4-position of the mannose to generate N-acetyl-D-glucosamine-beta-1,4-O-D- mannosylprotein. Involved in the biosynthesis of the phosphorylated O- mannosyl trisaccharide (N-acetylgalactosamine-beta-3-N- acetylglucosamine-beta-4-(phosphate-6-)mannose), a carbohydrate structure present in alpha-dystroglycan (DAG1), which is required for binding laminin G-like domain-containing extracellular proteins with high affinity.
catalytic activity: 3-O-(alpha-D-mannosyl)-L-threonyl-[protein] + UDP-N-acetyl- alpha-D-glucosamine = 3-O-(N-acetyl-beta-D-glucosaminyl-(1->4)-alpha- D-mannosyl)-L-threonyl-[protein] + H(+) + UDP (RHEA:37663) - The structure of POMGNT2 provides new insights into the mechanism to determine the functional O-mannosylation site on α-dystroglycan.
Imae, Genes to cells : devoted to molecular & cellular mechanisms 2021 - GeneRIF: The structure of POMGNT2 provides new insights into the mechanism to determine the functional O-mannosylation site on alpha-dystroglycan.
- Protein O-Linked Mannose β-1,4-N-Acetylglucosaminyl-transferase 2 (POMGNT2) Is a Gatekeeper Enzyme for Functional Glycosylation of α-Dystroglycan.
Halmo, The Journal of biological chemistry 2017 - GeneRIF: POMGNT2 when two of the conserved amino acids are replaced. These findings begin to define the selectivity of POMGNT2 and suggest that this enzyme functions as a gatekeeper enzyme to prevent the vast majority of O-mannosylated sites on proteins from becoming modified with glycan structures functional for binding laminin globular domain-containing proteins
- GTDC2 modifies O-mannosylated α-dystroglycan in the endoplasmic reticulum to generate N-acetyl glucosamine epitopes reactive with CTD110.6 antibody.
Ogawa, Biochemical and biophysical research communications 2013 (PubMed)- GeneRIF: GTDC2 generates CTD110.6 antibody-reactive N-acetylglucosamine epitopes on the O-mannosylated alpha-dystroglycan.
- Exome sequencing and functional validation in zebrafish identify GTDC2 mutations as a cause of Walker-Warburg syndrome.
Manzini, American journal of human genetics 2012 - GeneRIF: Using WES in consanguineous WWS-affected families, we found multiple deleterious mutations in GTDC2 (also known as AGO61). .
- High degree of conservation of the enzymes synthesizing the laminin-binding glycoepitope of α-dystroglycan
Bigotti, Open biology 2021 - “...a ER 9 747 Q9Y6A1 POMT2 a ER 14 750 Q9UKY4 POMGnT2 ER 3 580 Q8NAT1 B3GALNT2 ER 1 500 Q8NCR0 POMK ER 8 350 Q9H5K3 FKTN CGC/MGC 9 461 O75072 POMGnT1 a CGC/MGC 1 660 Q8WZA1 FKRP CGC/MGC 19 495 Q9H9S5 RXYLT1 Golgi 12 443...”
- Crystal structures of β-1,4-N-acetylglucosaminyltransferase 2: structural basis for inherited muscular dystrophies.
Yang, Acta crystallographica. Section D, Structural biology 2021 - New phenotype caused by POMGNT2 mutations.
Cassone, BMJ case reports 2021 - Signal peptide peptidase-like 2c impairs vesicular transport and cleaves SNARE proteins
Papadopoulou, EMBO reports 2019 (secret) - Recent advancements in understanding mammalian O-mannosylation
Sheikh, Glycobiology 2017 - “...B3GALNT2 POMK (SGK196) FKTN (FCMD) Q9Y6A1 Q9UKY4 Q8WZA1 Q8NAT1 Q3V5L5 Q8NCR0 Q9H5K3 O75072 FKRP RXYLT1 (TMEM5) B4GAT1 (B3GNT1) LARGE1 (LARGE) LARGE2 (GYLTL1B)...”
- Protein O-Linked Mannose β-1,4-N-Acetylglucosaminyl-transferase 2 (POMGNT2) Is a Gatekeeper Enzyme for Functional Glycosylation of α-Dystroglycan
Halmo, The Journal of biological chemistry 2017 - “...and POMGNT2 (amino acid residues 25-580; UniProt Q8NAT1) were expressed as soluble, secreted fusion proteins by transient transfection of HEK293 suspension...”
AT4G33600 hypothetical protein from Arabidopsis thaliana
Aligns to 175:369 / 470 (41.5%), covers 99.3% of PF04577, 59.3 bits
- Identification of ZOUPI Orthologs in Soybean Potentially Involved in Endosperm Breakdown and Embryogenic Development
Zhang, Frontiers in plant science 2017 - “...Target Genes The expression of presumed ZOU target genes, including ALE1. At3g06890. At5g03820 , and At4g33600 ( Kondou et al., 2008 ; Yang et al., 2008 ; Xing et al., 2013 ) were detected in the GmZOUs transgenic lines ( Figure 6 ). The ZOU target...”
- “...GmZOU-2 transgenic lines as detected by qPCR. The expression of ALE1. At3g06890. At5g03820 , and At4g33600 , which are the AtZOU presumed target genes, decreased in the Atzou-4 mutant and showed partial recovery in the GmZOU-1 transgenic lines, but not in the GmZOU-2 transgenic lines. These...”
G1SQ30 Protein O-linked-mannose beta-1,4-N-acetylglucosaminyltransferase 2 from Oryctolagus cuniculus
Aligns to 164:362 / 580 (34.3%), covers 76.5% of PF04577, 59.1 bits
- Corneal myofibroblasts and fibrosis.
Wilson, Experimental eye research 2020 - “...1.2E-01 G1T8L2 P05997 COL5A2 Uncharacterized protein Collagen alpha-2(V) chain 96 3 4 0.80 0.116 6.8E-02 G1SQ30 POMGNT2 Fibronectin type-III domain-containing protein 1 3 0.75 0.145 5.2E-02 G1U2Q7 C0L8A1 Collagen alpha-1(VIII) chain 1 4 0.74 0.083 1.1E-02 G1T8J0 P02461 C0L3A1 Uncharacterized protein Collagen alpha-1(III) chain 92 3...”
6xi2A / Q8NAT1 Apo form of pomgnt2 (see paper)
Aligns to 88:315 / 528 (43.2%), covers 71.3% of PF04577, 59.1 bits
PMGT2_MOUSE / Q8BW41 Protein O-linked-mannose beta-1,4-N-acetylglucosaminyltransferase 2; POMGnT2; Extracellular O-linked N-acetylglucosamine transferase-like; Glycosyltransferase-like domain-containing protein 2; EC 2.4.1.312 from Mus musculus (Mouse) (see 2 papers)
NP_705768 protein O-linked-mannose beta-1,4-N-acetylglucosaminyltransferase 2 precursor from Mus musculus
Aligns to 137:362 / 580 (39.0%), covers 69.1% of PF04577, 58.3 bits
Q5NDF0 Protein O-linked-mannose beta-1,4-N-acetylglucosaminyltransferase 2 from Rattus norvegicus
Aligns to 137:362 / 580 (39.0%), covers 69.1% of PF04577, 58.3 bits
LOC109846408 uncharacterized protein LOC109846408 from Asparagus officinalis
Aligns to 288:475 / 571 (32.9%), covers 69.1% of PF04577, 57.4 bits
LOC103696188 alpha-1,3-arabinosyltransferase XAT3-like from Phoenix dactylifera
Aligns to 174:365 / 459 (41.8%), covers 76.5% of PF04577, 57.1 bits
- Glycosyltransferase Family 61 in Liliopsida (Monocot): The Story of a Gene Family Expansion
Cenci, Frontiers in plant science 2018 - “...of monocot OG-GT61-A genes. Species/sequence A1 A2 A3 A4 A5 A6 P. dactylifera NW_008246516.1 LOC103696170 LOC103696188, LOC103696198 Partial LOC103696231, LOC103696210 LOC103697726 LOC103696248 NW_008246831.1 LOC103719015 LOC103719019 E. guineensis NC_025995.1 LOC105041134 LOC105041135, LOC105041136 LOC105041137 LOC105041138, LOC105041140, LOC105041139, LOC105041141, LOC105041144, LOC105041142, LOC105041145 LOC105041157 LOC105041146 M. acuminata Chr01 Ma01_g14150 Ma01_g14160,...”
W5PKW4 EGF domain-specific O-linked N-acetylglucosamine transferase from Ovis aries
Aligns to 248:445 / 529 (37.4%), covers 75.0% of PF04577, 57.0 bits
- The olfactory secretome varies according to season in female sheep and goat
Cann, BMC genomics 2019 - “...N-acetylglucosaminyl transferase). The encoding gene is present in sheep and goat genome at accession numbers W5PKW4 and XP_017893891.1, respectively. The porcine, ovine and caprine EOGT protein sequences share 95% of homology suggesting a common role in OBP O- GlcNAcylation. Is the olfactory secretome a phenotype of...”
A0JND3 EGF domain-specific O-linked N-acetylglucosamine transferase from Bos taurus
Aligns to 246:443 / 527 (37.6%), covers 75.0% of PF04577, 57.0 bits
EOGT_MOUSE / Q8BYW9 EGF domain-specific O-linked N-acetylglucosamine transferase; Extracellular O-linked N-acetylglucosamine transferase; EC 2.4.1.255 from Mus musculus (Mouse) (see 2 papers)
Q8BYW9 protein O-GlcNAc transferase (EC 2.4.1.255) from Mus musculus (see paper)
Aligns to 246:443 / 527 (37.6%), covers 75.0% of PF04577, 56.7 bits
- function: Catalyzes the transfer of a single N-acetylglucosamine from UDP-GlcNAc to a serine or threonine residue in extracellular proteins resulting in their modification with a beta-linked N-acetylglucosamine (O-GlcNAc). Specifically glycosylates the Thr residue located between the fifth and sixth conserved cysteines of folded EGF-like domains.
catalytic activity: L-seryl-[protein] + UDP-N-acetyl-alpha-D-glucosamine = 3-O-(N- acetyl-beta-D-glucosaminyl)-L-seryl-[protein] + H(+) + UDP (RHEA:48904)
catalytic activity: L-threonyl-[protein] + UDP-N-acetyl-alpha-D-glucosamine = 3-O- (N-acetyl-beta-D-glucosaminyl)-L-threonyl-[protein] + H(+) + UDP (RHEA:48908)
Q5NDF2 Protein O-linked-mannose beta-1,4-N-acetylglucosaminyltransferase 2 from Bos taurus
Aligns to 139:362 / 580 (38.6%), covers 75.0% of PF04577, 56.7 bits
EOGT_HUMAN / Q5NDL2 EGF domain-specific O-linked N-acetylglucosamine transferase; Extracellular O-linked N-acetylglucosamine transferase; EC 2.4.1.255 from Homo sapiens (Human) (see 2 papers)
Q5NDL2 protein O-GlcNAc transferase (EC 2.4.1.255) from Homo sapiens (see paper)
Aligns to 246:443 / 527 (37.6%), covers 74.3% of PF04577, 56.5 bits
- function: Catalyzes the transfer of a single N-acetylglucosamine from UDP-GlcNAc to a serine or threonine residue in extracellular proteins resulting in their modification with a beta-linked N-acetylglucosamine (O-GlcNAc). Specifically glycosylates the Thr residue located between the fifth and sixth conserved cysteines of folded EGF-like domains.
catalytic activity: L-seryl-[protein] + UDP-N-acetyl-alpha-D-glucosamine = 3-O-(N- acetyl-beta-D-glucosaminyl)-L-seryl-[protein] + H(+) + UDP (RHEA:48904)
catalytic activity: L-threonyl-[protein] + UDP-N-acetyl-alpha-D-glucosamine = 3-O- (N-acetyl-beta-D-glucosaminyl)-L-threonyl-[protein] + H(+) + UDP (RHEA:48908) - A novel nanobody as therapeutics target for EGFR-positive colorectal cancer therapy: exploring the effects of the nanobody on SW480 cells using proteomics approach
Lamtha, Proteome science 2022 - “...0.01 1.51E 16 O43156 TELO2-interacting protein 1 homolog 0 0.837 8.66E 01 0.01 1.51E 16 Q5NDL2 EGF domain-specific O-linked N-acetylglucosamine transferase 0 0.01 1.78E- 16 0.01 1.51E 16 According to Table 1 , in comparison between R9VH36 and control, 5 proteins were over-expressed and 10 proteins...”
- Comparative proteomic analysis of osteogenic differentiated human adipose tissue and bone marrow-derived stromal cells.
Dadras, Journal of cellular and molecular medicine 2020 - “...Heat shockrelated 70kD protein 2 16.20 14.38 16 Q9NS00 GlycoproteinNacetylgalactosamine 3betagalactosyltransferase 1 15.32 16.14 17 Q5NDL2 EGF domainspecific Olinked Nacetylglucosamine transferase 13.66 14.70 18 P11166 Solute carrier family 2, facilitated glucose transporter member 1 12.64 14.34 19 Q8N5C1 Calcium homeostasis modulator protein 5 14.47 15.53 20...”
- Critical observations that shaped our understanding of the function(s) of intracellular glycosylation (O-GlcNAc).
Zachara, FEBS letters 2018 - “...(EGF)-repeat containing cell surface proteins. Extracellular O-GlcNAc (eO-GlcNAc) is catalyzed by an ER-resident enzyme (UniProtKB Q5NDL2) that is unrelated to the O-GlcNAc transferase (OGT, the enzyme that catalyzes the addition of intracellular O-GlcNAc (UniProtKB O15294)) [ 20 , 21 ]. Secondly , the detection of O-GlcNAc...”
- Investigation of glycan evolution based on a comprehensive analysis of glycosyltransferases using phylogenetic profiling
Tomono, Biophysics and physicobiology 2015 - “...(UniProt accession: Q8IYK4; CAZy GT25), and EGF domain-specific O -linked N -acetylglucosamine transferase (UniProt accession: Q5NDL2; CAZy GT61). The remaining one GT [Protein O- glucosyltransferase 1 (UniProt accession: Q8NBL1; CAZy GT90)] contained an extreme C-terminal KTEL sequence identified as other ER lumen-resident motif [ 45 ]....”
- ENZYMAP: exploiting protein annotation for modeling and predicting EC number changes in UniProt/Swiss-Prot
Silveira, PloS one 2014 - “...of EC number. Case studies In the common source 2.4.-.-, our technique predicted that entry Q5NDL2 should be annotated as 2.4.1.-. It was considered as an error because the Swiss-Prot annotation was 2.4.-.-. However, in release 2012_07 from July 2012 (released after our analysis), this entry...”
- “...release 2011_03 (March 2011), indicating that our technique anticipated the third EC level for entry Q5NDL2 16 months before it occurred in Swiss-Prot. DETECT did not return a result for this entry. In this study we included multifunctional enzymes (which are those associated with more than...”
NP_775925 EGF domain-specific O-linked N-acetylglucosamine transferase isoform b precursor from Homo sapiens
Aligns to 115:359 / 443 (55.3%), covers 87.5% of PF04577, 55.7 bits
- SHCBP1 interacting with EOGT enhances O-GlcNAcylation of NOTCH1 and promotes the development of pancreatic cancer.
Yang, Genomics 2021 (PubMed)- GeneRIF: SHCBP1 interacting with EOGT enhances O-GlcNAcylation of NOTCH1 and promotes the development of pancreatic cancer.
- Bioinformatics and Functional Analyses Implicate Potential Roles for EOGT and L-fringe in Pancreatic Cancers.
Barua, Molecules (Basel, Switzerland) 2021 - GeneRIF: Bioinformatics and Functional Analyses Implicate Potential Roles for EOGT and L-fringe in Pancreatic Cancers.
- EOGT Correlated With Immune Infiltration: A Candidate Prognostic Biomarker for Hepatocellular Carcinoma.
Shu, Frontiers in immunology 2021 - GeneRIF: EOGT Correlated With Immune Infiltration: A Candidate Prognostic Biomarker for Hepatocellular Carcinoma.
- The Glycosyltransferase EOGT Regulates Adropin Expression in Decidualizing Human Endometrium.
Muter, Endocrinology 2018 (PubMed)- GeneRIF: Analysis of midluteal endometrial biopsies revealed an inverse correlation between endometrial EOGT and ENHO expression and body mass index. obesity impairs the EOGT-adropin axis in decidual cells, which in turn points toward a mechanistic link between metabolic disorders and adverse pregnancy outcome.
- O-GlcNAc on NOTCH1 EGF repeats regulates ligand-induced Notch signaling and vascular development in mammals.
Sawaguchi, eLife 2017 - GeneRIF: Eogt resulted in defective retinal angiogenesis, with a mild phenotype similar to that caused by reduced Notch signaling in retina. Combined deficiency of different Notch1 mutant alleles exacerbated the abnormalities in Eogt(-/-) retina, and Notch target gene expression was decreased in Eogt(-/-)endothelial cells.
- EOGT and O-GlcNAc on secreted and membrane proteins.
Varshney, Biochemical Society transactions 2017 - GeneRIF: Studies provide evidence that mutations in EOGT lead to autosomal recessive Adams-Oliver Syndrome. [review]
- Autosomal recessive Adams-Oliver syndrome caused by homozygous mutation in EOGT, encoding an EGF domain-specific O-GlcNAc transferase.
Cohen, European journal of human genetics : EJHG 2014 - GeneRIF: c.1074delA mutation segregates with Adams-Oliver syndrome in the Bedouin family.
- Mutations in EOGT confirm the genetic heterogeneity of autosomal-recessive Adams-Oliver syndrome.
Shaheen, American journal of human genetics 2013 - GeneRIF: Mutations in EOGT confirm the genetic heterogeneity of autosomal-recessive Adams-Oliver syndrome.
GRMZM2G098793 glycosyltransferase from Zea mays
Aligns to 168:360 / 455 (42.4%), covers 72.8% of PF04577, 55.7 bits
- SNP-based mixed model association of growth- and yield-related traits in popcorn
Mafra, PloS one 2019 - “...the initial stage of maize seed filling [ 45 ], was identified for 100GW. Gene GRMZM2G098793 ( S2 Table ), encoding the superfamily of glycosyltransferase enzymes that are responsible for glycosylation, a fundamental mechanism for determining the chemical complexity and diversity of natural plant products [...”
- “...of the apical meristem of buds in A . thaliana plants [ 62 ]. Gene GRMZM2G098793, encoding a member of the glycosyltransferase enzyme superfamily, was also identified as related to PE in ENV2. In wheat endosperm starch, the amount of arabinoxylan, which is one of the...”
- Genetic architecture of maize chlorotic mottle virus and maize lethal necrosis through GWAS, linkage analysis and genomic prediction in tropical maize germplasm
Sitonik, TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik 2019 - “...0.48 C /T GRMZM2G177934 Copper ion binding S5_58728012 5 58728012 1.41E05 0.06 0.03 A /G GRMZM2G098793 Glycosyltransferase S6_28146715 6 28146715 5.79E05 0.06 0.24 G /A GRMZM2G313448 Uncharacterized protein S7_167346730 7 167346730 2.03E05 0.06 0.02 A /G GRMZM2G158130 Uncharacterized protein S8_14796196 8 14796196 4.46E05 0.06 0.03 A...”
LOC105041138 beta-1,2-xylosyltransferase XYXT1 from Elaeis guineensis
Aligns to 280:471 / 565 (34.0%), covers 100.0% of PF04577, 54.8 bits
- Glycosyltransferase Family 61 in Liliopsida (Monocot): The Story of a Gene Family Expansion
Cenci, Frontiers in plant science 2018 - “...Partial LOC103696231, LOC103696210 LOC103697726 LOC103696248 NW_008246831.1 LOC103719015 LOC103719019 E. guineensis NC_025995.1 LOC105041134 LOC105041135, LOC105041136 LOC105041137 LOC105041138, LOC105041140, LOC105041139, LOC105041141, LOC105041144, LOC105041142, LOC105041145 LOC105041157 LOC105041146 M. acuminata Chr01 Ma01_g14150 Ma01_g14160, Ma01_g14170, Ma01_g14180 Ma01_g14190 Ma01_g14200 Chr02 Ma02_g16300 Ma02_g16310 Ma02_g16320 Chr02 Ma02_g24690 Ma02_g24680 Chr04 Ma04_g30890 Ma04_g30880 Ma04_g30870 Chr06 Ma06_g11080...”
CGSSpSV35_0508 glycosyltransferase 61 family protein from Streptococcus pneumoniae SV35
Aligns to 117:295 / 410 (43.7%), covers 97.8% of PF04577, 54.8 bits
- In vivo capsular switch in Streptococcus pneumoniae--analysis by whole genome sequencing
Hu, PloS one 2012 - “...capsular locus putative glycosyltransferase - wchV CGSSpSV35_0507 type 23 capsular locus putative glycosyltransferase - wchW CGSSpSV35_0508 type 23 capsular locus capsule biosynthesis repeating unit flippase - wzx CGSSpSV35_0509 type 23 capsular locus putative glycerol phosphotransferase - wchX CGSSpSV35_0510 type 23 capsular locus putative glycerol-2-phosphate dehydrogenase -...”
Q5QPZ6 EGF domain-specific O-linked N-acetylglucosamine transferase from Medicago truncatula
Aligns to 215:437 / 541 (41.2%), covers 88.2% of PF04577, 54.8 bits
- Transcriptomic and metabolite analyses of Cabernet Sauvignon grape berry development.
Deluc, BMC genomics 2007 - “...metabolism 11 16.06 1608932_at CB982469 TC63201 Q59J80 Glucosyltransferase Carbohydrate metabolism 11 15.38 1620347_at CA814065 TC66065 Q5QPZ6 Glycosyltransferase Carbohydrate metabolism 10 15.36 1622282_at CD712313 TC54393 Q7XAE2 Fructokinase Carbohydrate metabolism 2 13.54 1616642_at BQ800221 TC64250 Q9FEP9 Glycerol-3-phosphate acyltransferase Carbohydrate metabolism 16 11.07 1616255_at CF516475 TC57339 O82616 Fructokinase Carbohydrate...”
M8CXR2 Putative glycosyltransferase AGO61 from Aegilops tauschii
Aligns to 213:407 / 505 (38.6%), covers 75.7% of PF04577, 54.6 bits
Pden_1294 hypothetical protein from Paracoccus denitrificans PD1222
Aligns to 38:296 / 354 (73.2%), covers 88.2% of PF04577, 54.3 bits
AT2G41640 transferase, transferring glycosyl groups from Arabidopsis thaliana
Aligns to 196:394 / 500 (39.8%), covers 62.5% of PF04577, 54.2 bits
- NAC transcription factors ATAF1 and ANAC055 affect the heat stress response in Arabidopsis
Alshareef, Scientific reports 2022 - “...revealed five genes that might be priming-associated direct targets of ATAF1: AT2G31260 ( ATG9 ), AT2G41640 ( GT61 ), AT3G44990 ( XTH31 ), AT4G27720 and AT3G23540 . Based on co-expression analyses applied to the aforementioned RNA-seq profiles, we identified ANAC055 to be transcriptionally co-regulated with ATAF1...”
- “...three, or two, time points after heat priming. Five genes, i.e., AT2G31260 ( ATG9 ), AT2G41640 ( GT61 ), AT3G44990 ( XTH31 ), AT4G27720 and AT3G23540 were commonly regulated at two of the three timepoints, suggesting they might be priming-associated direct targets of ATAF1 (Fig. 5...”
- Characterization and Interaction Analysis of the Secondary Cell Wall Synthesis-Related Transcription Factor PmMYB7 in Pinus massoniana Lamb
Chen, International journal of molecular sciences 2022 - “...A. thaliana . Among them, the MYBR1 protein interacted with the CCoAOMT1 protein and the AT2G41640 protein, which are homologous proteins of CCoAOMT2 and XYXT1, respectively ( Figure 6 B). The interaction with other pathway proteins (MYBR1 with CCoAOMT1) will be interesting associations for studying the...”
- “...involved in stress responses are shown in blue. In the Cytoscape-based network, CCoAOMT1 protein and AT2G41640 protein in yellow represent homologous proteins of CCoAOMT2 and XYXT1, respectively. Figure 7 Validation of the interaction proteins. ( A ) Point-to-point validation of the interaction of pGBKT7-PmMYB7 + pGADT7-PmCCoAOMT2....”
- NAC Transcription Factors ATAF1 and ANAC055 Negatively Regulate Thermomemory in Arabidopsis
Alshareef, 2021 - Association Mapping of Seed Quality Traits Under Varying Conditions of Nitrogen Application in Brassica juncea L. Czern & Coss
Akhatar, Frontiers in genetics 2020 - “...A06_17974981, 5007, 5009,5010 15241927 A06 17974981-5010 3.3 15.04 0.35 0.12 0.00 10 79 N100, NP At2g41640 (9.24) A06_27490668, 71, 93 186499036 A06 27490668-0693 4.03 23.21 0.83 0.25 8.72 10 6 N0, NP PSP1 (3.71) A09_30208138 30692244 A09 30208138 3.08 15.94 -1.05 0.11 6.28 10 6 N0,...”
- “...of 6.84 kb from the closest of the associated SNPs: A06_17974981, A06_17975007, A06_17975009, and A06_17975010. At2g41640 , encoding glycosyltransferase family 61 protein, was predicted at a distance of 9.24 kb from SNPs A06_27490668, A06_27490671, and A06_27490693. We also detected PSP1 ( PHOSPHOSERINE PHOSPHATASE 1) on the...”
- Cauliflower mosaic virus transactivator protein (TAV) can suppress nonsense-mediated decay by targeting VARICOSE, a scaffold protein of the decapping complex
Lukhovitskaya, Scientific reports 2019 - “...contrast, although mRNAs carrying AU-rich instability elements (ARE) within their 3 UTRs (At2g4000, At1g72450 and At2g41640) 63 remained elevated in the absence of the UPF1 protein, their levels were not affected or reduced in TAV-transgenic plants (Fig. 3d ). Thus, NMD-sensitive transcripts that are stabilized in...”
- “...) and ( d ) ARE target transcripts containing AU-rich instability elements (At2g4000, At1g72450 and At2g41640) 63 in WT, CM6 TAV transgenic line ( TAVox ) and upf1-5 mutant Arabidopsis plants, normalized to EXPLA1 (AT3G45970) and SAND (At2G28390). Values are expressed in arbitrary units and represent...”
- Comparative transcriptome and metabolome analyses provide new insights into the molecular mechanisms underlying taproot thickening in Panax notoginseng
Li, BMC plant biology 2019 - “...Unigene0070830 PI-PLC X-box domain-containing protein DDB_G0293730 AT4G38690 68.3 32.5 15.9 10.4 Unigene0036376 DUF563 domain-containing protein AT2G41640 97.6 45.9 14.2 13.8 *Unigene0041208 CDP-diacylglycerol-glycerol-3-phosphate3-phosphatidyltransferase AT3G48180 182.8 82.5 31.1 15.0 Unigene0022367 EXORDIUM-like 5 AT2G17230 156.7 70.4 14.6 28.3 Unigene0008870 GDSL-like Lipase/Acylhydrolase superfamily protein AT3G26430 871.2 395.8 98.1 122.2 Secondary...”
- GWAS with Heterogeneous Data: Estimating the Fraction of Phenotypic Variation Mediated by Gene Expression Data
Sasaki, G3 (Bethesda, Md.) 2018 - “...0.53 FLC * AT1G65480 0.54 2.64E-11 0.37 FT * AT2G45660 0.47 1.35E-08 0.22 SOC1 * AT2G41640 0.42 7.03E-07 0.20 Glycosyl- transferase AT3G57920 0.39 3.28E-06 0.17 SPL15 AT1G04400 0.38 5.24E-06 0.15 CRY2 * AT5G52310 0.38 5.39E-06 0.14 RD29A AT1G69440 0.38 5.53E-06 0.18 AGO7 AT3G13100 0.38 7.71E-06 0.10...”
- Cell growth and homeostasis are disrupted in arabidopsis rns2-2 mutants missing the main vacuolar RNase activity
Morriss, Annals of botany 2017 - “...3, reverse primer 5 ATCGCAAGGAACTCTTTGGT 3); AT2G41640, glycosyl transferase (forward primer 5 TGTGCTTCAAACGTCACCCA 3, reverse primer 5 TGCGAAACGAATCTAGGAGGG...”
- “...similar results were obtained for the glycosyltransferase gene AT2G41640. Table 1. List of genes differentially expressed in the rns2-2 mutant seedlings with...”
- More
LOC105041135 alpha-1,3-arabinosyltransferase XAT3 from Elaeis guineensis
Aligns to 177:368 / 462 (41.6%), covers 70.6% of PF04577, 54.0 bits
- Glycosyltransferase Family 61 in Liliopsida (Monocot): The Story of a Gene Family Expansion
Cenci, Frontiers in plant science 2018 - “...LOC103696170 LOC103696188, LOC103696198 Partial LOC103696231, LOC103696210 LOC103697726 LOC103696248 NW_008246831.1 LOC103719015 LOC103719019 E. guineensis NC_025995.1 LOC105041134 LOC105041135, LOC105041136 LOC105041137 LOC105041138, LOC105041140, LOC105041139, LOC105041141, LOC105041144, LOC105041142, LOC105041145 LOC105041157 LOC105041146 M. acuminata Chr01 Ma01_g14150 Ma01_g14160, Ma01_g14170, Ma01_g14180 Ma01_g14190 Ma01_g14200 Chr02 Ma02_g16300 Ma02_g16310 Ma02_g16320 Chr02 Ma02_g24690 Ma02_g24680 Chr04 Ma04_g30890 Ma04_g30880...”
LOC105041134 alpha-1,3-arabinosyltransferase XAT3 from Elaeis guineensis
Aligns to 191:386 / 484 (40.5%), covers 93.4% of PF04577, 53.9 bits
- Glycosyltransferase Family 61 in Liliopsida (Monocot): The Story of a Gene Family Expansion
Cenci, Frontiers in plant science 2018 - “...NW_008246516.1 LOC103696170 LOC103696188, LOC103696198 Partial LOC103696231, LOC103696210 LOC103697726 LOC103696248 NW_008246831.1 LOC103719015 LOC103719019 E. guineensis NC_025995.1 LOC105041134 LOC105041135, LOC105041136 LOC105041137 LOC105041138, LOC105041140, LOC105041139, LOC105041141, LOC105041144, LOC105041142, LOC105041145 LOC105041157 LOC105041146 M. acuminata Chr01 Ma01_g14150 Ma01_g14160, Ma01_g14170, Ma01_g14180 Ma01_g14190 Ma01_g14200 Chr02 Ma02_g16300 Ma02_g16310 Ma02_g16320 Chr02 Ma02_g24690 Ma02_g24680 Chr04 Ma04_g30890...”
XAX1_ORYSJ / Q6Z7I3 Beta-1,2-xylosyltransferease XAX1; Protein XYLOSYL ARABINOSYL SUBSTITUTION OF XYLAN 1; EC 2.4.2.- from Oryza sativa subsp. japonica (Rice) (see paper)
LOC4329203 uncharacterized protein LOC4329203 from Oryza sativa Japonica Group
Aligns to 282:473 / 566 (33.9%), covers 100.0% of PF04577, 53.7 bits
- function: Glycosyltransferase involved in the xylosylation of xylan, the major hemicellulose (non-cellulosic component) of primary and secondary walls of angiosperms (PubMed:23027943). Possesses beta-1,2- xylosyltransferase activity, transferring xylose from UDP-xylose to the xylan backbone (PubMed:23027943).
disruption phenotype: Dwarf phenotype, decreased levels of xylose, ferulic acid and coumaric acid in leaves, and increased saccharification efficiency. - Quantitative iTRAQ-based proteomic analysis of rice grains to assess high night temperature stress
Zhang, Proteomics 2017 - “...0.664 2.029 0.327 Functional unknown protein Q53M16 LOC_Os11g13690 Putative uncharacterized protein 2.272 0.524 4.337 Q6Z7I3 LOC4329203 Os02g0329800 protein 1.788 0.604 2.96 Q851I5 LOC107278586 Putative uncharacterized protein 1.852 0.648 2.859 Q69MT6 OSJNBb0034B12.21 Putative uncharacterized protein 2.948 1.158 2.546 Q9LWS6 LOC4339919 Os06g0115100 protein 2.349 0.997 2.356 Q0JQP1 Os01g0149200...”
- Quantitative iTRAQ-based proteomic analysis of rice grains to assess high night temperature stress
Zhang, Proteomics 2017 - “...mitochondrial 0.664 2.029 0.327 Functional unknown protein Q53M16 LOC_Os11g13690 Putative uncharacterized protein 2.272 0.524 4.337 Q6Z7I3 LOC4329203 Os02g0329800 protein 1.788 0.604 2.96 Q851I5 LOC107278586 Putative uncharacterized protein 1.852 0.648 2.859 Q69MT6 OSJNBb0034B12.21 Putative uncharacterized protein 2.948 1.158 2.546 Q9LWS6 LOC4339919 Os06g0115100 protein 2.349 0.997 2.356 Q0JQP1...”
- “...of unknown functions were upregulated almost 1.5fold in the HTL, whereas downregulated 1.5fold (including Q53M16, Q6Z7I3, Q851I5, and Q0JQP1) or not altered (including Q69MT6 and Q9LWS6) in the HSL. 3.6 Western blotting validation To monitor the expression pattern of the proteins identified by iTRAQ technology, six...”
XAT3_ORYSJ / Q10I20 Alpha-1,3-arabinosyltransferase XAT3; Xylan arabinosyltransferase 3; OsXAT3; EC 2.4.2.- from Oryza sativa subsp. japonica (Rice) (see paper)
AAK50581.1 xylan α-1,3-arabinofuranosyltransferase (OsXAT3; Os03g0567600 or Os03g37010) (EC 2.4.2.-) (see protein)
Aligns to 291:482 / 576 (33.3%), covers 72.1% of PF04577, 53.4 bits
- function: Glycosyltransferase involved in the arabinosylation of xylan, the major hemicellulose (non-cellulosic component) of primary and secondary walls of angiosperms (PubMed:22215597). Possesses alpha-1,3- arabinosyltransferase activity, transferring an arabinofuranose residue to the xylan backbone (PubMed:22215597).
CCA61105.1 xylan α-1,3-arabinofuranosyltransferase (TaGT61_1) (EC 2.4.2.-) (see protein)
Aligns to 210:404 / 506 (38.5%), covers 69.9% of PF04577, 52.6 bits
AT2G03360 transferase, transferring glycosyl groups from Arabidopsis thaliana
Aligns to 160:351 / 451 (42.6%), covers 81.6% of PF04577, 52.5 bits
- Association Mapping of Seed Quality Traits Under Varying Conditions of Nitrogen Application in Brassica juncea L. Czern & Coss
Akhatar, Frontiers in genetics 2020 - “...A04 A4 AT4G30950 FAD6 A01, A08 A1, A8 AT1G31070 GlcNAc1pUT1 A05, A08, A09 A8, A9 AT2G03360 Glycosyltransferase family 61 protein A06, A09 AT3G47340 GLUTAMINE-DEPENDENT ASPARAGINE SYNTHETASE A02, A06 A6 AT3G54010 PASTICCINO-1 A04, A07 A4 AT5G62680 GTR2 A02, A03, A06, A09 A1, A2, A6, A9 GSL AT1G19640...”
- Re-analysis of RNA-seq transcriptome data reveals new aspects of gene activity in Arabidopsis root hairs
Li, Frontiers in plant science 2015 - “...5.34615 5.8301 AT5G42785 Unknown protein 80.0565 1.42305 5.81396 AT2G20030 RING/U-box superfamily protein 8.41905 0.150287 5.80787 AT2G03360 Glycosyltransferase family 61 protein 6.24031 0.112152 5.79809 AT5G12050 Unknown protein 184.136 3.34175 5.78402 AT4G22217 Arabidopsis defensin-like protein 349.124 6.59131 5.72703 AT4G21200 ATGA2OX8, GA2OX8, gibberellin 2-oxidase 8 11.7754 0.22266 5.72479 AT4G08450...”
LOC109843905 EGF domain-specific O-linked N-acetylglucosamine transferase-like from Asparagus officinalis
Aligns to 100:292 / 387 (49.9%), covers 73.5% of PF04577, 52.5 bits
Q5QPY8 Glycosyltransferase from Triticum aestivum
Aligns to 238:431 / 525 (37.0%), covers 66.9% of PF04577, 52.3 bits
LOC103696231 beta-1,2-xylosyltransferase XYXT1-like from Phoenix dactylifera
Aligns to 276:467 / 561 (34.2%), covers 100.0% of PF04577, 52.3 bits
- Glycosyltransferase Family 61 in Liliopsida (Monocot): The Story of a Gene Family Expansion
Cenci, Frontiers in plant science 2018 - “...genes. Species/sequence A1 A2 A3 A4 A5 A6 P. dactylifera NW_008246516.1 LOC103696170 LOC103696188, LOC103696198 Partial LOC103696231, LOC103696210 LOC103697726 LOC103696248 NW_008246831.1 LOC103719015 LOC103719019 E. guineensis NC_025995.1 LOC105041134 LOC105041135, LOC105041136 LOC105041137 LOC105041138, LOC105041140, LOC105041139, LOC105041141, LOC105041144, LOC105041142, LOC105041145 LOC105041157 LOC105041146 M. acuminata Chr01 Ma01_g14150 Ma01_g14160, Ma01_g14170, Ma01_g14180 Ma01_g14190...”
AT2G03370 transferase, transferring glycosyl groups from Arabidopsis thaliana
Aligns to 160:352 / 452 (42.7%), covers 79.4% of PF04577, 52.2 bits
MUC21_ARATH / Q9SS43 Xylan glycosyltransferase MUCI21; Protein MUCILAGE-MODIFIED 5; Protein MUCILAGE-RELATED 21; Putative xylan xylosyltransgerase MUCI21; EC 2.4.-.- from Arabidopsis thaliana (Mouse-ear cress) (see 3 papers)
NP_187643 Glycosyltransferase family 61 protein from Arabidopsis thaliana
AT3G10320 transferase, transferring glycosyl groups from Arabidopsis thaliana
Aligns to 155:401 / 494 (50.0%), covers 79.4% of PF04577, 52.0 bits
- function: Glycosyletransferase required for the proper composition and structural properties of released seed coat mucilage (PubMed:11706181, PubMed:26482889, PubMed:26979331). Required for the production of highly branched xylan polymers in seed coat mucilage (PubMed:26482889). Facilitates the addition of xylose residues directly to the xylan backbone (PubMed:26482889, PubMed:26979331). Xylan with xylose side chains seems to be necessary for pectin attachment to the seed surface (PubMed:26482889, PubMed:26979331). Essential for xylan synthesis in seed coat epidermal (SCE) cells (PubMed:26482889).
disruption phenotype: Reduced amount and altered composition of seed coat mucilage. - Highly Branched Xylan Made by IRREGULAR XYLEM14 and MUCILAGE-RELATED21 Links Mucilage to Arabidopsis Seeds.
Voiniciuc, Plant physiology 2015 - GeneRIF: MUCI21, a member of an uncharacterized clade of the GT61 family, and IRX14 (GT43 protein) are essential for the synthesis of highly branched xylan in seed coat epidermal cells.
- Arabidopsis thaliana Accessions from the Chernobyl Exclusion Zone Show Decreased Sensitivity to Additional Acute Irradiation
Podlutskii, Plants (Basel, Switzerland) 2022 - “...( AT5G49420, ATMYB2, WRKY75 ), stress response ( PYD4, AT1G74010 ), mucilage biosynthetic process ( AT3G10320 ), and defence response ( CAD8, PMEI10, SBT3.3, XTH25, KTI1, PR1, ACA12 ). Seedlings of the accessions Bab-0 and VS-0 had similar transcriptional profiles after acute -irradiation of seeds (...”
- A microProtein repressor complex in the shoot meristem controls the transition to flowering
Rodrigues, Plant physiology 2021 - “...myrosinase-binding protein 2 0 58 21.6 1.94E-37 AT2G07732 Ribulose bisphosphate carboxylase 0 60 4.1 3.61E-26 AT3G10320 Glycosyltransferase family 61 protein 15 77 19.7 1.45E-11 AT3G24982 ATRLP40, RLP40, receptor-like protein 40 31 100 6.9 1.77E-26 FC, fold change in mRNA-seq data set; FDR, false discovery rate. Dissection...”
- Evolution of protein N-glycosylation process in Golgi apparatus which shapes diversity of protein N-glycan structures in plants, animals and fungi
Wang, Scientific reports 2017 - “...( Supplementary Figure S14 ). In this group, although no genes were definitely identified enzymatically, AT3G10320 was demonstrated as a putative xylosyltransferase which was recently characterized as MUCI21, while the genes AT3G18170 and AT3G18180 are expressed highly in a heteroxylan containing mucilaginous tissues, which indicated that...”
- Altered Expression of Genes Implicated in Xylan Biosynthesis Affects Penetration Resistance against Powdery Mildew
Chowdhury, Frontiers in plant science 2017 - “...AT3G18170AT3G18180 Arabinofuranosyl transferase 6H 49.787 UP (1.79) UP (1.27) Anders et al., 2012 MLOC_35025 GT61 AT3G10320 Xylosyl transferase, decorates xylan with xylose side chains 1H 17.288 UP (1.86) UP (0.91) Voiniciuc et al., 2015 MLOC_64204 GT75 Not found UDP-Arabinose Mutase ( HvUAM3 ) UP (2.09) UP...”
- Decreased glutathione reductase2 leads to early leaf senescence in Arabidopsis
Ding, Journal of integrative plant biology 2016 - “...d after emergence in the igr29 line AGI number Description Fold change a RER b AT3G10320 Glycosyltransferase family 61 protein 2.20 5.811.7 AT5G12030 Heat shock protein 17.6A 1.84 3.220.8 AT5G62480 Glutathione Stransferase tau 9 (GSTU9) 4.25 8.432.0 AT3G26830 Cytochrome P450 71B15 (PAD3) 2.25 6.701.3 AT4G23810 WRKY...”
- Expression of ROS-responsive genes and transcription factors after metabolic formation of H(2)O(2) in chloroplasts
Balazadeh, Frontiers in plant science 2012 - “...1.10 0.76 0.47 0.18 3.05 1.71 At3g09410 0.28 0.27 0.22 0.81 0.22 1.66 1.46 0.32 At3g10320 0.36 0.84 2.31 1.49 3.05 2.85 6.78 3.90 At3g10930 0.72 4.25 1.97 3.89 3.08 5.28 7.56 5.90 At3g11840 1.19 1.22 1.67 0.87 0.88 1.81 3.81 2.49 At3g12580 1.37 1.54 2.02...”
- A large rearrangement involving genes and low-copy DNA interrupts the microcollinearity between rice and barley at the Rph7 locus
Brunner, Genetics 2003 - “...2 (atg2g03360, at2g03370, at2g41640) and chromosome 3 (at3g10320, at3g57380, at3g18170, at3g18180; Figure 5B). at3g18170 and at3g18180 as well as atg2g03360 and...”
LOC103719015 alpha-1,3-arabinosyltransferase XAT3-like from Phoenix dactylifera
Aligns to 182:378 / 476 (41.4%), covers 88.2% of PF04577, 52.0 bits
- Glycosyltransferase Family 61 in Liliopsida (Monocot): The Story of a Gene Family Expansion
Cenci, Frontiers in plant science 2018 - “...A4 A5 A6 P. dactylifera NW_008246516.1 LOC103696170 LOC103696188, LOC103696198 Partial LOC103696231, LOC103696210 LOC103697726 LOC103696248 NW_008246831.1 LOC103719015 LOC103719019 E. guineensis NC_025995.1 LOC105041134 LOC105041135, LOC105041136 LOC105041137 LOC105041138, LOC105041140, LOC105041139, LOC105041141, LOC105041144, LOC105041142, LOC105041145 LOC105041157 LOC105041146 M. acuminata Chr01 Ma01_g14150 Ma01_g14160, Ma01_g14170, Ma01_g14180 Ma01_g14190 Ma01_g14200 Chr02 Ma02_g16300 Ma02_g16310 Ma02_g16320...”
LOC103696170 alpha-1,3-arabinosyltransferase XAT3-like from Phoenix dactylifera
Aligns to 189:386 / 484 (40.9%), covers 70.6% of PF04577, 51.5 bits
- Glycosyltransferase Family 61 in Liliopsida (Monocot): The Story of a Gene Family Expansion
Cenci, Frontiers in plant science 2018 - “...loci of monocot OG-GT61-A genes. Species/sequence A1 A2 A3 A4 A5 A6 P. dactylifera NW_008246516.1 LOC103696170 LOC103696188, LOC103696198 Partial LOC103696231, LOC103696210 LOC103697726 LOC103696248 NW_008246831.1 LOC103719015 LOC103719019 E. guineensis NC_025995.1 LOC105041134 LOC105041135, LOC105041136 LOC105041137 LOC105041138, LOC105041140, LOC105041139, LOC105041141, LOC105041144, LOC105041142, LOC105041145 LOC105041157 LOC105041146 M. acuminata Chr01 Ma01_g14150...”
XAT2_ORYSJ / Q6ZFR0 Alpha-1,3-arabinosyltransferase XAT2; Xylan arabinosyltransferase 2; OsXAT2; EC 2.4.2.- from Oryza sativa subsp. japonica (Rice) (see paper)
BAD15592.1 xylan α-1,3-arabinofuranosyltransferase (OsXAT2; Os02g22480 or Os02g0330200) (EC 2.4.2.-) (see protein)
LOC4329205 uncharacterized protein LOC4329205 from Oryza sativa Japonica Group
Aligns to 298:489 / 583 (32.9%), covers 98.5% of PF04577, 51.4 bits
- function: Glycosyltransferase involved in the arabinosylation of xylan, the major hemicellulose (non-cellulosic component) of primary and secondary walls of angiosperms (PubMed:22215597). Possesses alpha-1,3- arabinosyltransferase activity, transferring an arabinofuranose residue to the xylan backbone (PubMed:22215597).
- Mutagenesis of UDP-xylose epimerase and xylan arabinosyl-transferase decreases arabinose content and improves saccharification of rice straw
Chen, Plant biotechnology journal 2021 - “...friendly way of using rice straw efficiently. Accession number LOC4342364 (OsUXE1), LOC4337011 (OsUXE2), LOC4344584 (OsUXE3), LOC4329205 (OsXAT2), LOC4333275 (OsXAT3). Conflict of interest No conflict of interests to declare. Author contributions C. C. and AM. W. contributed to project design. C. C., XH. Z. and XC. W....”
PP3440 hypothetical protein from Pseudomonas putida KT2440
Aligns to 122:321 / 372 (53.8%), covers 93.4% of PF04577, 51.2 bits
XYXT1_ORYSJ / Q5Z8T8 Beta-1,2-xylosyltransferase XYXT1; Xylan xylosyltransferase 1; EC 2.4.2.- from Oryza sativa subsp. japonica (Rice) (see paper)
Q5Z8T8 glycoprotein 2-beta-D-xylosyltransferase (EC 2.4.2.38) from Oryza sativa Japonica Group (see paper)
Aligns to 182:372 / 465 (41.1%), covers 58.8% of PF04577, 50.9 bits
- function: Glycosyltransferase involved in the xylosylation of xylan, the major hemicellulose (non-cellulosic component) of primary and secondary walls of angiosperms (PubMed:29325159). Possesses beta-1,2- xylosyltransferase activity, transferring xylose from UDP-xylose to the xylan backbone (PubMed:29325159). Catalyzes the addition of 2-O-xylosyl side chains to the xylan backbone (PubMed:29325159).
LOC109831329 uncharacterized protein LOC109831329 from Asparagus officinalis
Aligns to 166:366 / 423 (47.5%), covers 59.6% of PF04577, 50.8 bits
NP_001012384 protein O-linked-mannose beta-1,4-N-acetylglucosaminyltransferase 2 from Danio rerio
Aligns to 250:368 / 585 (20.3%), covers 73.5% of PF04577, 50.4 bits
PMGT2_DANRE / Q5NDE5 Protein O-linked-mannose beta-1,4-N-acetylglucosaminyltransferase 2; POMGnT2; Extracellular O-linked N-acetylglucosamine transferase-like; Glycosyltransferase-like domain-containing protein 2; EC 2.4.1.312 from Danio rerio (Zebrafish) (Brachydanio rerio) (see paper)
Aligns to 243:361 / 578 (20.6%), covers 73.5% of PF04577, 50.4 bits
- function: O-linked mannose beta-1,4-N-acetylglucosaminyltransferase that transfers UDP-N-acetyl-D-glucosamine to the 4-position of the mannose to generate N-acetyl-D-glucosamine-beta-1,4-O-D- mannosylprotein. Involved in the biosynthesis of the phosphorylated O- mannosyl trisaccharide (N-acetylgalactosamine-beta-3-N- acetylglucosamine-beta-4-(phosphate-6-)mannose), a carbohydrate structure present in alpha-dystroglycan (DAG1), which is required for binding laminin G-like domain-containing extracellular proteins with high affinity (By similarity).
catalytic activity: 3-O-(alpha-D-mannosyl)-L-threonyl-[protein] + UDP-N-acetyl- alpha-D-glucosamine = 3-O-(N-acetyl-beta-D-glucosaminyl-(1->4)-alpha- D-mannosyl)-L-threonyl-[protein] + H(+) + UDP (RHEA:37663)
Q5QPY7 Glycosyltransferase from Sorghum bicolor
Aligns to 221:412 / 513 (37.4%), covers 100.0% of PF04577, 50.2 bits
CCC14964.1 xylan α-1,3-arabinofuranosyltransferase (TaGT61_2) (EC 2.4.2.-) (see protein)
Aligns to 294:485 / 578 (33.2%), covers 75.7% of PF04577, 50.2 bits
AT3G18170 transferase, transferring glycosyl groups from Arabidopsis thaliana
Aligns to 103:292 / 384 (49.5%), covers 76.5% of PF04577, 49.8 bits
- Broad-range metalloprotease profiling in plants uncovers immunity provided by defence-related metalloenzyme
Morimoto, The New phytologist 2022 - “...on a protein gel and excised the bands to perform an ingel digest. Metalloprotease PREP1 (At3g18170) was predominantly identified from band 1, and metalloproteases MPA1 (At1g63770) and APM1 (At4g33090) were top hits for bands 2 and 3 (Fig. S2 ; Dataset S1 ). Bands 4 and...”
- Evolution of protein N-glycosylation process in Golgi apparatus which shapes diversity of protein N-glycan structures in plants, animals and fungi
Wang, Scientific reports 2017 - “...was demonstrated as a putative xylosyltransferase which was recently characterized as MUCI21, while the genes AT3G18170 and AT3G18180 are expressed highly in a heteroxylan containing mucilaginous tissues, which indicated that the genes in this group are related to mucilage production in terrestrial plants 94 95 ....”
- Altered Expression of Genes Implicated in Xylan Biosynthesis Affects Penetration Resistance against Powdery Mildew
Chowdhury, Frontiers in plant science 2017 - “...that consists largely of uncharacterised genes and forms a sister clade to the Arabidopsis genes AT3G18170 and AT3G18180 (Figure S3 ). The importance of GT61 family in penetration resistance is strengthened further by enhanced RSI upon TIGS of two additional GT61-family members. The fact that no...”
- Differential root transcriptomics in a polyploid non-model crop: the importance of respiration during osmotic stress
Zorrilla-Fontanesi, Scientific reports 2016 (no snippet) - Discovery of diversity in xylan biosynthetic genes by transcriptional profiling of a heteroxylan containing mucilaginous tissue
Jensen, Frontiers in plant science 2013 - “...3620 1093 0 M01000032237 AT3G02230 RGP1, UAM CAZy GT75 5063 7559 3561 4548 142 M01000025200 AT3G18170 CAZy GT61 2001 3189 3433 926 0 M01000012668 AT3G18180 CAZy GT61 153 762 3178 2195 0 M01000021834 AT3G18170 CAZy GT61 153 541 1889 2009 8 M01000033105 AT4G32290 GT14R 509 590...”
- “...1479 1361 1672 304 2 M01000025153 AT2G32750 CAZy GT47 18 180 1200 588 0 M01000026523 AT3G18170 CAZy GT61 6 197 1092 1759 0 M01000007355 AT1G54940 GUX5 CAZy GT8 350 467 1072 314 0 M01000007434 AT5G05170 CESA3 CAZy GT2 270 377 944 221 1217 M01000021804 AT4G32410 CESA1...”
- Indirect evolution of hybrid lethality due to linkage with selected locus in Mimulus guttatus
Wright, PLoS biology 2013 - “...glycosyltransferase metabolic enzyme ( www.phytozome.net ). This protein has greatest homology to A. thaliana gene AT3G18170, which attaches glyosyl groups to N-linked glycan molecules critical for construction of plant cell membranes [31] . The second flanking gene, MGV1A026627M, is located 41 kb from Nec1 and encodes...”
- Glycosyl transferases in family 61 mediate arabinofuranosyl transfer onto xylan in grasses
Anders, Proceedings of the National Academy of Sciences of the United States of America 2012 - “...Expression levels of the Arabidopsis representatives, At3g18180 and At3g18170, are low and they are not coexpressed with secondary cell wall genes (Fig. S6). We...”
- Common and unique elements of the ABA-regulated transcriptome of Arabidopsis guard cells
Wang, BMC genomics 2011 - “...protein 1.5E-09 5.0 AT5G67370 unknown protein 1.8E-09 4.5 AT2G44660 transferase, transferring glycosyl groups 1.8E-09 3.9 AT3G18170 similar to unknown protein AT3G18180.1 1.9E-09 3.3 AT4G08980 F-box family protein (FBW2) 2.4E-09 3.6 AT1G68470 exostosin family protein 2.4E-09 10.3 AT2G24150 HHP3 heptahelical protein 3; receptor 2.6E-09 10.0 AT5G60790 ATGCN1...”
- More
AT3G18180 transferase, transferring glycosyl groups from Arabidopsis thaliana
Aligns to 261:373 / 470 (24.0%), covers 74.3% of PF04577, 48.9 bits
- Evolution of protein N-glycosylation process in Golgi apparatus which shapes diversity of protein N-glycan structures in plants, animals and fungi
Wang, Scientific reports 2017 - “...as a putative xylosyltransferase which was recently characterized as MUCI21, while the genes AT3G18170 and AT3G18180 are expressed highly in a heteroxylan containing mucilaginous tissues, which indicated that the genes in this group are related to mucilage production in terrestrial plants 94 95 . 1,3-fucose transferase...”
- Altered Expression of Genes Implicated in Xylan Biosynthesis Affects Penetration Resistance against Powdery Mildew
Chowdhury, Frontiers in plant science 2017 - “...largely of uncharacterised genes and forms a sister clade to the Arabidopsis genes AT3G18170 and AT3G18180 (Figure S3 ). The importance of GT61 family in penetration resistance is strengthened further by enhanced RSI upon TIGS of two additional GT61-family members. The fact that no reciprocal infection...”
- Differential root transcriptomics in a polyploid non-model crop: the importance of respiration during osmotic stress
Zorrilla-Fontanesi, Scientific reports 2016 (no snippet) - Discovery of diversity in xylan biosynthetic genes by transcriptional profiling of a heteroxylan containing mucilaginous tissue
Jensen, Frontiers in plant science 2013 - “...c 12 DPA Stem M01000012733 AT5G61840 IRX10L CAZy GT47 104 508 4919 8557 0 M01000017653 AT3G18180 CAZy GT61 2958 3787 3620 1093 0 M01000032237 AT3G02230 RGP1, UAM CAZy GT75 5063 7559 3561 4548 142 M01000025200 AT3G18170 CAZy GT61 2001 3189 3433 926 0 M01000012668 AT3G18180 CAZy...”
- “...509 590 1702 2828 0 M01000025204 AT3G18170 CAZy GT61 1694 2058 1702 647 0 M01000017654 AT3G18180 CAZy GT61 1479 1361 1672 304 2 M01000025153 AT2G32750 CAZy GT47 18 180 1200 588 0 M01000026523 AT3G18170 CAZy GT61 6 197 1092 1759 0 M01000007355 AT1G54940 GUX5 CAZy GT8...”
- Glycosyl transferases in family 61 mediate arabinofuranosyl transfer onto xylan in grasses
Anders, Proceedings of the National Academy of Sciences of the United States of America 2012 - “...in dicots. Expression levels of the Arabidopsis representatives, At3g18180 and At3g18170, are low and they are not coexpressed with secondary cell wall genes...”
- Identification of genes involved in cell wall biogenesis in grasses by differential gene expression profiling of elongating and non-elongating maize internodes
Bosch, Journal of experimental botany 2011 - “...AT5G61840 (IRX10-L) 0E+00 Secondary cell wall-related GT47 [ Os01g0926700 (0E+00)] pGH17 MZ00018424 10.0 5.3 GRMZM2G354610 AT3G18180 9E-79 Glycosyltransferase GH1 MZ00057235 12.7 63.6 GRMZM2G016890 AT5G44640 2E-128 Beta- D -glucosidase [ Os4bglu12 (5E-134)] GH1 MZ00023504 11.5 60.4 GRMZM2G014844 AT5G44640 1E-135 Beta- D -glucosidase [ Os6bglu24 and Os4bglu12 (3E-137)]...”
- A large rearrangement involving genes and low-copy DNA interrupts the microcollinearity between rice and barley at the Rph7 locus
Brunner, Genetics 2003 - “...at2g41640) and chromosome 3 (at3g10320, at3g57380, at3g18170, at3g18180; Figure 5B). at3g18170 and at3g18180 as well as atg2g03360 and at2g03370 are arranged...”
- “...shown). Phylogenetic analysis indicated that the at3g18170 and at3g18180 gene products have the highest similarity (53%) to the HvHGA protein sequences of rice...”
LOC103696248 beta-1,2-xylosyltransferase XYXT1-like from Phoenix dactylifera
Aligns to 325:518 / 612 (31.7%), covers 70.6% of PF04577, 48.4 bits
- Glycosyltransferase Family 61 in Liliopsida (Monocot): The Story of a Gene Family Expansion
Cenci, Frontiers in plant science 2018 - “...A2 A3 A4 A5 A6 P. dactylifera NW_008246516.1 LOC103696170 LOC103696188, LOC103696198 Partial LOC103696231, LOC103696210 LOC103697726 LOC103696248 NW_008246831.1 LOC103719015 LOC103719019 E. guineensis NC_025995.1 LOC105041134 LOC105041135, LOC105041136 LOC105041137 LOC105041138, LOC105041140, LOC105041139, LOC105041141, LOC105041144, LOC105041142, LOC105041145 LOC105041157 LOC105041146 M. acuminata Chr01 Ma01_g14150 Ma01_g14160, Ma01_g14170, Ma01_g14180 Ma01_g14190 Ma01_g14200 Chr02 Ma02_g16300...”
AT3G57380 transferase, transferring glycosyl groups from Arabidopsis thaliana
Aligns to 198:396 / 504 (39.5%), covers 64.7% of PF04577, 47.7 bits
- Cell-specific RNA profiling reveals host genes expressed in Arabidopsis cells haustoriated by downy mildew
Asai, Plant physiology 2023 - “...MLA10 113.2 23.6 3.7 40.1 32.5 24.7 AT3G52400 SYP122 565.8 404.7 209.1 127.6 140.3 152.2 AT3G57380 12.5 7.5 0 1.8 1.2 0.8 AT3G61390 PUB36 103.0 48.0 18.4 36.7 37.4 37.0 AT4G08780 17.7 1.5 0 5.8 14.2 11.6 AT4G11910 NYE2, SGR2 12.4 2.9 0 7.8 6.3 4.1...”
- Genome-wide association mapping in Arabidopsis identifies novel genes underlying quantitative disease resistance to Alternaria brassicae
Rajarammohan, Molecular plant pathology 2018 - “...AT2G44240 AT2G44270 AT3G10195 AT3G23280 AT3G25180 AT3G52600 AT3G57380 AT4G02330 AT5G13190 AT5G37500 AT5G37610 P value of most significant SNP* Annotated...”
- The Arabidopsis transcription factor IIB-related protein BRP4 is involved in the regulation of mitotic cell-cycle progression during male gametogenesis
Qin, Journal of experimental botany 2014 - “...Liu et al. , 1995 ), and found that a T-DNA segment was inserted between At3g57380 and At3g57370 ( BRP4 ), 1014bp upstream of the start codon of BRP4 ( Fig. 1E ). RT-PCR analysis showed that the expression of BRP4 was highly upregulated in smo3-D...”
- “...BRP4 locus in smo3-D . The coding regions of both At3g57370 ( BRP4 ) and At3g57380 are indicated as black arrows, and the intermediate genomic sequence is indicated as a black line. T-DNA was inserted in the promoter region of BRP4 , 1014bp upstream of ATG....”
- Early gene expression events in the laminar abscission zone of abscission-promoted citrus leaves after a cycle of water stress/rehydration: involvement of CitbHLH1
Agustí, Journal of experimental botany 2012 - “...metabolism C21005A06 Xyloglucan endotransglucosylase/hydrolase AT4G25810 3.35 1.55 C21005E09 UDP-glucose dehydrogenase AT5G15490 3.43 2.69 C21001D09 Glycosyltransferase AT3G57380 1.30 1.40 C21003F02 Pectate lyase AT4G24780 2.77 1.65 C21008F11 Acidic cellulase AT4G02800 3.37 3.20 1.92 Fatty acid biosynthesis and metabolism C21006C05 Acyl-CoA synthetase-like protein AT3G23790 1.75 1.05 C21001F06 1-Acyl-sn-glycerol-3-phosphate acyltransferase...”
- A large rearrangement involving genes and low-copy DNA interrupts the microcollinearity between rice and barley at the Rph7 locus
Brunner, Genetics 2003 - “...(atg2g03360, at2g03370, at2g41640) and chromosome 3 (at3g10320, at3g57380, at3g18170, at3g18180; Figure 5B). at3g18170 and at3g18180 as well as atg2g03360 and...”
- “...that they originate from recent duplications. The at2g41640 and at3g57380 genes are located in regions of chromosome 2 and 3, which are known to result from a...”
CAI70375.1 β-1,2-xylosyltransferase (PoXYL1) (EC 2.4.2.38) (see protein)
Q599J2 Beta 1,2 xylosyltransferase from Populus canescens
Aligns to 177:417 / 468 (51.5%), covers 58.1% of PF04577, 44.2 bits
- Transcriptomic and metabolite analyses of Cabernet Sauvignon grape berry development.
Deluc, BMC genomics 2007 - “...2.78 1612425_at CF371700 TC56348 Q6EP64 Hydroxyproline-rich glycoprotein Cell Wall Modification 11 2.77 1616826_at CB976610 TC54888 Q599J2 -1,2 Xylosyltransferase Cell Wall Modification 11 2.76 1609138_at CF519079 TC66620 Q16861 Super cysteine rich protein Cell Wall Modification 11 2.74 1617487_at CD720403 TC54500 Q9SFF6 Pectinacetylesterase Cell Wall Modification 2 2.69...”
AAQ73546.1 β-1,2-xylosyltransferase (EC 2.4.2.38) (see protein)
Aligns to 197:460 / 511 (51.7%), covers 58.1% of PF04577, 43.0 bits
RCN11_ORYSJ / Q6ZFH6 Beta-1,2-xylosyltransferase RCN11; OsXylT; Protein REDUCED CULM NUMBER 11; EC 2.4.2.- from Oryza sativa subsp. japonica (Rice) (see paper)
Q6ZFH6 glycoprotein 2-beta-D-xylosyltransferase (EC 2.4.2.38) from Oryza sativa (see paper)
BAD09279.1 [N-glycan] β-1,2-xylosyltransferase (RCN11;Xt;Os08g0503800) (EC 2.4.2.38) (see protein)
Aligns to 234:482 / 533 (46.7%), covers 58.8% of PF04577, 42.6 bits
- function: Glycosyltransferase involved in the xylosylation of N-glycans (PubMed:26025522). Possesses beta-1,2-xylosyltransferase activity, transferring xylose from UDP-xylose to the core beta-linked mannose of N-glycans (PubMed:26025522). Beta-1,2-linked xylose residues on N- glycans are critical for seed germination and plant development and growth under conditions of abiotic stress (PubMed:26025522).
disruption phenotype: Reduced number of tillers and reduced biomass.
LOC109840057 EGF domain-specific O-linked N-acetylglucosamine transferase-like from Asparagus officinalis
Aligns to 238:425 / 524 (35.9%), covers 74.3% of PF04577, 42.4 bits
XYLT / Q9LDH0 glycoprotein 2-β-D-xylosyltransferase (EC 2.4.2.38) from Arabidopsis thaliana (see 5 papers)
XYLT_ARATH / Q9LDH0 Beta-1,2-xylosyltransferase; AtXYLT; EC 2.4.2.38 from Arabidopsis thaliana (Mouse-ear cress) (see 6 papers)
Q9LDH0 glycoprotein 2-beta-D-xylosyltransferase (EC 2.4.2.38) from Arabidopsis thaliana (see 5 papers)
CAB90610.1 core β-1,2-xylosyltransferase (XylT;AtXYLT;At5g55500) (EC 2.4.2.38) (see protein)
NP_568825 beta-1,2-xylosyltransferase from Arabidopsis thaliana
AT5G55500 XYLT (ARABIDOPSIS THALIANA BETA-1,2-XYLOSYLTRANSFERASE); xylosyltransferase from Arabidopsis thaliana
Aligns to 211:483 / 534 (51.1%), covers 58.1% of PF04577, 42.4 bits
- function: Glycosyltransferase involved in the xylosylation of N-glycans (PubMed:10781814, PubMed:12943552, PubMed:15013764, PubMed:15686448). Possesses beta-1,2-xylosyltransferase activity, transferring xylose from UDP-xylose to the core beta-linked mannose of N-glycans (PubMed:10781814, PubMed:12943552, PubMed:15013764, PubMed:15686448). Involved in the biosynthesis of glycoprotein bound N-glycans (PubMed:15686448, PubMed:22024534). Does not require metal ions for its activity (PubMed:15686448).
catalytic activity: N(4)-{beta-D-GlcNAc-(1->2)-alpha-D-Man-(1->3)-[beta-D-GlcNAc- (1->2)-alpha-D-Man-(1->6)]-beta-D-Man-(1->4)-beta-D-GlcNAc-(1->4)- beta-D-GlcNAc}-L-asparaginyl-[protein] + UDP-alpha-D-xylose = H(+) + N(4)-{beta-D-GlcNAc-(1->2)-alpha-D-Man-(1->3)-[beta-D-GlcNAc-(1->2)- alpha-D-Man-(1->6)]-[beta-D-Xyl-(1->2)]-beta-D-Man-(1->4)-beta-D- GlcNAc-(1->4)-beta-D-GlcNAc}-L-asparaginyl-[protein] + UDP (RHEA:10612) - Arabidopsis β1,2-xylosyltransferase: substrate specificity and participation in the plant-specific N-glycosylation pathway.
Kajiura, Journal of bioscience and bioengineering 2012 (PubMed)- GeneRIF: AtXYLT acts on protein-bound N-glycans prior to alpha1,3-fucosyltransferase and mannosidase II.
- An antibody produced in tobacco expressing a hybrid beta-1,4-galactosyltransferase is essentially devoid of plant carbohydrate epitopes.
Bakker, Proceedings of the National Academy of Sciences of the United States of America 2006 - GeneRIF: Data show that expression of a hybrid enzyme of Arabidopsis thaliana xylosyltransferase and human beta-1,4-galactosyltransferase I in tobacco causes a reduction of N-glycans with potentially immunogenic core-bound xylose and fucose residues.
- Arabidopsis thaliana beta1,2-xylosyltransferase: an unusual glycosyltransferase with the potential to act at multiple stages of the plant N-glycosylation pathway.
Bencúr, The Biochemical journal 2005 - GeneRIF: The substrate specificity of XylT permits the enzyme to act at multiple stages of the plant N-glycosylation pathway.
- Omics Profiles of Non-transgenic Scion Grafted on Transgenic RdDM Rootstock
Kodama, Food safety (Tokyo, Japan) 2022 - “...GTE11_ARATH Transcription factor GTE11 Q93ZB7 3.74 STC_RICCO Sugar carrier protein C Q41144 3.15 XYLT_ARATH Beta-1,2-xylosyltransferase Q9LDH0 2.98 * TIF6B_ARATH Protein TIFY 6B Q9LVI4 2.87 EIX2_SOLLC Receptor-like protein EIX2 Q6JN46 2.56 XTH8_ARATH Probable xyloglucan endotransglucosylase/hydrolase protein 8 Q8L9A9 2.30 OPT5_ARATH Oligopeptide transporter 5 Q9SUA4 2.20 Y5566_ARATH Uncharacterized...”
- Pectin Synthesis and Pollen Tube Growth in Arabidopsis Involves Three GAUT1 Golgi-Anchoring Proteins: GAUT5, GAUT6, and GAUT7
Lund, Frontiers in plant science 2020 - “...with the N-terminal sequence (amino acid positions between 1 and 90) of a -1,2-xylosyltransferase (XYLT, At5g55500), a glycosyltransferase involved in N -glycosylation ( Figure 6A ). This N-terminal sequence was previously shown to be sufficient for localization in the medial Golgi cisternae ( Schoberer etal., 2013...”
- N-linked Glycan Micro-heterogeneity in Glycoproteins of Arabidopsis
Zeng, Molecular & cellular proteomics : MCP 2018 - “...(xylt) was used for the -1,2-xylosyltransferase (XylT) mutant (At5g55500). Plants were grown in growth chamber under long day growth conditions (16 h light and...”
- “...Arabidopsis xylt mutant (26) harbors an insertion at the At5g55500 locus which encodes a -1,2-XylT responsible for the addition of a -1,2-Xyl to the maturing...”
- Evolution of protein N-glycosylation process in Golgi apparatus which shapes diversity of protein N-glycan structures in plants, animals and fungi
Wang, Scientific reports 2017 - “...other plants 31 89 90 . Domain PF04577 was identified in Arabidopsis XylT peptide sequence (AT5G55500). Genes containing the domain PF04577 were not identified in fungi. Only 13 genes were present in each animal genome, while in plants, genes are abundant (as many as over 30...”
- “...PF07748 CL0158 n/a CL0103 GnTII A. thaliana AT2G05320 GT16 PF05060 CL0110 plants 1,2-XylT A. thaliana AT5G55500 GT61 PF04577 n/a 1,3-FucT A. thaliana AT3G19280 GT10 PF00852 n/a 1,3-GalT A. thaliana AT1G26810 GT31 PF00337 PF01762 CL0004 CL0110 1,4-FucT A. thaliana AT1G71990 GT10 PF00852 n/a animals 1,4-GalT H. sapiens...”
- Glycosyltransferase complexes in eukaryotes: long-known, prevalent but still unrecognized
Kellokumpu, Cellular and molecular life sciences : CMLS 2016 - “...AT4G38240, CGL1 EC:2.4.1.101 Alpha-1,3-mannosyl-glycoprotein 2-beta -N- acetylglucosaminyltransferase GnTII, AT2G05320 EC:2.4.1.143 Beta-1,2 -N- acetylglucosaminyltransferase II XYLT, AT5G55500 EC:2.4.2.38 Beta-(1,2)-xylosyltransferase ARAD1 Putative arabinosyltransferase ARAD2 Putative arabinosyltransferase XXT3, AT5G07720 EC:2.4.2.39 Xyloglucan xylosyltransferase 3 XXT4 EC:2.4.2.39 Xyloglucan xylosyltransferase 4 MUR3, AT2G20370, KATAMARI1 EC:2.4.1.- Xyloglucan galactosyltransferase XLT2 EC:2.4.1.- Xyloglucan galactosyltransferase Since...”
- Exploring the N-glycosylation pathway in Chlamydomonas reinhardtii unravels novel complex structures
Mathieu-Rivet, Molecular & cellular proteomics : MCP 2013 - “...(40%) (22%) At3g19280 (20%) At1g30000 (28%) At5g55500 (17%) At5g66680 At1g76400 At4g21150 At1g32210 At1g34130 At5g19960 At1g61790 At5g28460 At2g44660 At5g61790...”
- XAX1 from glycosyltransferase family 61 mediates xylosyltransfer to rice xylan
Chiniquy, Proceedings of the National Academy of Sciences of the United States of America 2012 - “...represented by only a single sequence per genome (At5G55500 and Os08g39380 in Arabidopsis and rice, respectively). One member of this clade, At5g55500, has been...”
- Generation of glyco-engineered BY2 cell lines with decreased expression of plant-specific glycoepitopes
Yin, Protein & cell 2011 - “...67.0% similarity to 1,2XylT from A. thaliana (At5g55500) and O. sativa (Os08 g0503800), respectively. NetPlantGene analysis and sequence alignment with other...”
- Functional UDP-xylose transport across the endoplasmic reticulum/Golgi membrane in a Chinese hamster ovary cell mutant defective in UDP-xylose Synthase
Bakker, The Journal of biological chemistry 2009 - “...able to act on xylosides when transferase (AtXylT; AT5G55500) (32) was isolated from the same provided at high concentration but not on the endogenous...”
Q2UVB3 glycoprotein 2-beta-D-xylosyltransferase (EC 2.4.2.38) from Zea mays (see paper)
CAJ47425.1 β-1,2-xylosyltransferase (Xt1;XylT) (EC 2.4.2.38) (see protein)
Aligns to 191:461 / 512 (52.9%), covers 58.8% of PF04577, 41.6 bits
M0YBT1 Glycosyltransferase from Hordeum vulgare subsp. vulgare
Aligns to 227:417 / 518 (36.9%), covers 66.2% of PF04577, 41.2 bits
- Identification of the Genetic Basis of Response to De-Acclimation in Winter Barley
Wójcik-Jagła, International journal of molecular sciences 2021 - “...A0A287MER1 N/A Unknown function protein acyl transferase 4-like [ Aegilops tauschii subsp. tauschii ] HORVU3HR1G109590 M0YBT1 N/A Unknown function protein glycosyltransferase [ Triticum aestivum ] HORVU4HR1G019410 M0ZB44 N/A Unknown function protein alkaline invertase [ Triticum aestivum ] HORVU4HR1G026770 A0A287NMD2 N/A LEA_2 domain-containing protein NDR1/HIN1-like protein 13...”
CAI11448.1 β-1,2-xylosyltransferase (Xt1) (EC 2.4.2.38) (see protein)
Aligns to 225:464 / 515 (46.6%), covers 58.8% of PF04577, 40.8 bits
CNC02270 hypothetical protein from Cryptococcus neoformans var. neoformans JEC21
Aligns to 349:477 / 561 (23.0%), covers 69.9% of PF04577, 38.8 bits
- The lncRNA RZE1 Controls Cryptococcal Morphological Transition
Chacko, PLoS genetics 2015 - “...of CNG02160 Upstream of CNAG_03366 RZE1 , Upstream of Zinc finger transcription factor ZNF2 X318 CNC02270 CNAG_01723 Hypothetical protein X319 CNH01180 CNAG_05456 Hypothetical protein X322 CNF04180 CNAG_06601 Amidohydrolase X331 CNK00830 CNAG_02597 Hypothetical protein X333 CNI00570 CNAG_04500 Hypothetical protein X336 CNH00730 and neighbors CNAG_05405 Hypothetical protein X337...”
CNAG_01723 hypothetical protein from Cryptococcus neoformans var. grubii H99
Aligns to 351:477 / 561 (22.6%), covers 66.9% of PF04577, 38.1 bits
- The lncRNA RZE1 Controls Cryptococcal Morphological Transition
Chacko, PLoS genetics 2015 - “...CNG02160 Upstream of CNAG_03366 RZE1 , Upstream of Zinc finger transcription factor ZNF2 X318 CNC02270 CNAG_01723 Hypothetical protein X319 CNH01180 CNAG_05456 Hypothetical protein X322 CNF04180 CNAG_06601 Amidohydrolase X331 CNK00830 CNAG_02597 Hypothetical protein X333 CNI00570 CNAG_04500 Hypothetical protein X336 CNH00730 and neighbors CNAG_05405 Hypothetical protein X337 CNF02530...”
GRMZM5G869788 uncharacterized protein LOC100194196 from Zea mays
Aligns to 243:449 / 555 (37.3%), covers 58.1% of PF04577, 35.9 bits
- GBS-Based SNP Map Pinpoints the QTL Associated With Sorghum Downy Mildew Resistance in Maize (Zea mays L.)
Jadhav, Frontiers in genetics 2022 - “...and CCHC-type zinc finger domains containing protein 17 GRMZM5G850997 5 183703994 RING/U-box superfamily protein 15 GRMZM5G869788 6 143956525 Glycosyltransferase family 61 protein 16 GRMZM2G424582 6 143982360 Protein kinases; ubiquitin-protein ligases 17 GRMZM2G427337 6 144117824 Glycine-rich protein 18 GRMZM2G332107 6 144413748 Cysteine-rich RLK (Receptor-like protein kinase) 2...”
- “...al., 2012 ). GRMZM2G424582 (Protein kinases; ubiquitin-protein ligases) ( Furlan et al., 2012 ), and GRMZM5G869788 (Glycosyltransferase family 61 protein) ( Chowdhury et al., 2017 ). Collectively, this study identified several putative candidate genes to qDMR3.1 , qDMR5.1 , and qDMR6.1 . However, the available information...”
GRMZM2G074896 uncharacterized protein LOC100281411 from Zea mays
Aligns to 362:481 / 555 (21.6%), covers 54.4% of PF04577, 34.2 bits
- Identification and validation of genomic regions influencing kernel zinc and iron in maize
Hindu, TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik 2018 - “...10.7 DHP2 CE and TZ GRMZM2G116586 UTP-glucose-1-phosphate uridylyltransferase S5_68423957 5 68,423,957 6.45E04 2.79E03 1.38 7.9 GRMZM2G074896 Glycosyltransferase protein S5_71718466 5 71,718,466 7.35E04 4.49E06 1.81 13.1 GRMZM2G144282 Translation initiation factor eIF3 subunit S5_100070727 5 100,070,727 6.40E04 2.27E06 1.60 13.3 GRMZM2G079653 Ice binding, Homoiothermy, S7_173181688 7 173,181,688 5.44E04...”
GRMZM2G451975 uncharacterized protein LOC100217259 from Zea mays
Aligns to 229:432 / 547 (37.3%), covers 56.6% of PF04577, 33.3 bits
Or search for genetic data about PF04577 in the Fitness Browser
by Morgan Price,
Arkin group
Lawrence Berkeley National Laboratory