Family Search for PF05128 (DUF697)
April 2024: See Interactive Tools for Functional Annotation of Bacterial Genomes for advice on using these tools.
PF05128 hits 26 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.
YPO2347 putative membrane protein from Yersinia pestis CO92
YPTB2265 putative membrane protein from Yersinia pseudotuberculosis IP 32953
Aligns to 183:343 / 353 (45.6%), covers 99.4% of PF05128, 200.4 bits
NTHI0051 hypothetical protein from Haemophilus influenzae 86-028NP
Aligns to 180:340 / 354 (45.5%), covers 98.8% of PF05128, 198.1 bits
P43931 UPF0283 membrane protein HI_0043 from Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Aligns to 180:340 / 354 (45.5%), covers 98.8% of PF05128, 196.3 bits
NJ56_RS14750 YcjF family protein from Yersinia ruckeri
Aligns to 183:343 / 352 (45.7%), covers 99.4% of PF05128, 196.1 bits
all3787 hypothetical protein from Nostoc sp. PCC 7120
Aligns to 325:483 / 516 (30.8%), covers 99.4% of PF05128, 194.7 bits
STM1684 putative inner membrane protein from Salmonella typhimurium LT2
Aligns to 182:342 / 353 (45.6%), covers 98.8% of PF05128, 188.1 bits
ECO26_1890 hypothetical protein from Escherichia coli O26:H11 str. 11368
Aligns to 182:342 / 353 (45.6%), covers 98.8% of PF05128, 188.0 bits
ETAE_1862 hypothetical protein from Edwardsiella tarda EIB202
Aligns to 184:344 / 355 (45.4%), covers 100.0% of PF05128, 188.0 bits
Tery_1904 GTP-binding protein, HSR1-related from Trichodesmium erythraeum IMS101
Aligns to 323:481 / 545 (29.2%), covers 99.4% of PF05128, 187.8 bits
APL_0308 hypothetical membrane protein from Actinobacillus pleuropneumoniae L20
Aligns to 174:334 / 348 (46.3%), covers 98.8% of PF05128, 187.7 bits
YcjF / b1322 DUF697 domain-containing inner membrane protein YcjF from Escherichia coli K-12 substr. MG1655 (see 2 papers)
c1794 Hypothetical protein ycjF from Escherichia coli CFT073
b1322 hypothetical protein from Escherichia coli str. K-12 substr. MG1655
Aligns to 182:342 / 353 (45.6%), covers 98.8% of PF05128, 187.4 bits
- Role of metagenomics in prospecting novel endoglucanases, accentuating functional metagenomics approach in second-generation biofuel production: a review
Pabbathi, Biomass conversion and biorefinery 2023 - “...4 C8546 Cellulase Sigma-Aldrich Trichoderma reesei ATCC 26922 10 KU Cellulose 208.11 15,550.88 https://www.sigmaaldrich.com/catalog/product/sigma/c8546?lang=en®ion=IN 5 C1794 Cellulase Sigma-Aldrich Trichoderma sp. 10 KU Cellulose 208.56 15,584.6 https://www.sigmaaldrich.com/catalog/product/sigma/c1794?lang=en®ion=IN 6 PCT1518* Cellulase Himedia Unknown source 100 KU Cellulose 541.77 41,674.5 http://www.himedialabs.com/intl/en/products/Plant-Tissue-Culture/Plant-Culture-Tested-Chemicals-Enzymes/Cellulase-Plant-Culture-Tested-PCT1518 7 C0615 Cellulase ( 5000 units/g solid) Sigma-Aldrich...”
- 18th Congress of the European Hematology Association, Stockholm, Sweden, June 13–16, 2013
, Haematologica 2013 - Sxy induces a CRP-S regulon in Escherichia coli
Sinha, Journal of bacteriology 2009 - “...COLI 5185 TABLE 1--Continued Gene Designation Induction (fold) b1060 b1322 b2592 b2614 b0014 b2699 b0966 b3686 b3687 b3635 b4140 b0631 bssS ycjF clpB grpE dnaK...”
- Differential gene expression for investigation of Escherichia coli biofilm inhibition by plant extract ursolic acid
Ren, Applied and environmental microbiology 2005 - “...b4140 b1594 b1739 b3498 b1194 b1321 b1566 b1760 b0141 b2674 b0631 b1322 b2157 b3292 b3525 b4367 b3399 1.4 1.1 1.4 1.3 1.8 1.4 1.6 1.3 1.5 1.6 1.4 1.5 1.0 1.2...”
- Interfering with different steps of protein synthesis explored by transcriptional profiling of Escherichia coli K-12
Sabina, Journal of bacteriology 2003 - “...rnc yagR thrA hemN ycjI b1762 molR xseB mhpT b1513 b1322 b1976 b2048 b0072 b4103 b0287 b0355 b3767 b1433 b0922 b2567 b0284 b0002 b3867 b1326 b1762 b2115 b0422...”
- “...b2560 b2885 b2579 b2557 b2709 b2578 b4013 b0687 b4194 b0557 b1322 b4192 b1129 b4032 b1628 b1285 b1445 b1045 b4201 b0601 b3301 b4202 b2607 b2553 b0022 85 16 16...”
- Genome-wide expression profiling in Escherichia coli K-12
Richmond, Nucleic acids research 1999 - “...protein b1874 cutC 6.8 3.2 Copper homeostasis protein b1322 ycjF 6.8 19.8 ORF, hypothetical protein Cold-shock protein Response regulator, positive activator of...”
slr1462 unknown protein from Synechocystis sp. PCC 6803
Aligns to 323:481 / 561 (28.3%), covers 99.4% of PF05128, 187.0 bits
- Biochemical elucidation of citrate accumulation in Synechocystis sp. PCC 6803 via kinetic analysis of aconitase
Nishii, Scientific reports 2021 - “...3.9 sll0622 nadA ; quinolinate synthetase K03517 25.0 4.8 slr1411 Unknown protein K09121 25.0 5.2 slr1462 Unknown protein K06883 24.6 6.5 sll8019 Hypothetical protein 24.6 7.9 sll0757 purF ; amidophosphoribosyltransferase K00764 24.3 9.6 BLAST search for ATP-citrate lyase, citryl-CoA synthetase, and citryl-CoA lyase was performed using...”
- Iron deprivation in Synechocystis: inference of pathways, non-coding RNAs, and regulatory elements from comprehensive expression profiling
Hernández-Prieto, G3 (Bethesda, Md.) 2012 - “...1.67 0.43 0.29 1.37 8.6810 7 0.93 slr0488-as1 1.21 1.14 0.38 0.25 0.27 3.1610 4 slr1462 Hypothetical protein 1.27 0.99 0.10 0.09 0.30 4.2310 6 0.93 slr1462-as2 1.36 1.38 0.43 0.08 0.54 7.2610 6 slr1529 Nitrogen assimilation regulatory protein 0.74 1.17 0.07 0.35 0.67 3.2910 6...”
- Identification of two genes, sll0804 and slr1306, as putative components of the CO2-concentrating mechanism in the cyanobacterium Synechocystis sp. strain PCC 6803
Zhang, Journal of bacteriology 2008 - “...encoded by sll0503 (55% similarity and 38% identity) and slr1462 (47% similarity and 27% identity). The slr1306 gene is predicted to encode a protein containing...”
- “...were identified, including hypothetical proteins encoded by slr1462 (47% similarity and 26% identity) and sll0503 (45% similarity and 23% identity). Growth...”
- Four novel genes required for optimal photoautotrophic growth of the cyanobacterium Synechocystis sp. strain PCC 6803 identified by in vitro transposon mutagenesis
Zhang, Journal of bacteriology 2004 - “...a number of other cyanobacterial hypothetical proteins including Slr1462 from Synechocystis and Alr4172 from Nostoc sp. Recently, this gene has been identified...”
B8F381 UPF0283 membrane protein HAPS_0079 from Glaesserella parasuis serovar 5 (strain SH0165)
HAPS_0079 hypothetical membrane protein from Haemophilus parasuis SH0165
Aligns to 172:332 / 348 (46.3%), covers 98.1% of PF05128, 179.0 bits
- HtrA Is Important for Stress Resistance and Virulence in Haemophilus parasuis.
Zhang, Infection and immunity 2016 - “...A (OmpA) C0L8L0 39,348 Periplasmic dipeptide transport protein (DppA) B8F5G1 59,421 Membrane protein HAPS_0079 (0079) B8F381 39,824 The four proteins were tested as potential substrates of HpHtrA. The four genes encoding the target proteins were PCR amplified, expressed, and purified. Since HtrA-like proteins mainly work on...”
- HtrA Is Important for Stress Resistance and Virulence in Haemophilus parasuis
Zhang, Infection and immunity 2016 - “...This study pET28a- ompA pET28a containing WT ompA gene This study pET28a-0079 pET28a containing WT HAPS_0079 gene This study a WT, wild type. TABLE 2 Primers used in the study Primer Primer sequence (53) a Hp htrA -L CATG CCATGG CATTGCCTACTGCTGTAAACGG Hp htrA -R CCG CTCGAG...”
- “...membrane protein A (OmpA) C0L8L0 39,348 Periplasmic dipeptide transport protein (DppA) B8F5G1 59,421 Membrane protein HAPS_0079 (0079) B8F381 39,824 The four proteins were tested as potential substrates of HpHtrA. The four genes encoding the target proteins were PCR amplified, expressed, and purified. Since HtrA-like proteins mainly...”
SMc00466 HYPOTHETICAL TRANSMEMBRANE PROTEIN from Sinorhizobium meliloti 1021
Aligns to 193:353 / 359 (44.8%), covers 96.3% of PF05128, 173.5 bits
alr4172 hypothetical protein from Nostoc sp. PCC 7120
Aligns to 290:455 / 481 (34.5%), covers 98.8% of PF05128, 145.6 bits
slr1306 unknown protein from Synechocystis sp. PCC 6803
Aligns to 298:462 / 485 (34.0%), covers 99.4% of PF05128, 142.7 bits
sll0804 unknown protein from Synechocystis sp. PCC 6803
Aligns to 273:438 / 453 (36.6%), covers 95.7% of PF05128, 122.2 bits
- Identification of two genes, sll0804 and slr1306, as putative components of the CO2-concentrating mechanism in the cyanobacterium Synechocystis sp. strain PCC 6803
Zhang, Journal of bacteriology 2008 - “...Vol. 190, No. 24 Identification of Two Genes, sll0804 and slr1306, as Putative Components of the CO2-Concentrating Mechanism in the Cyanobacterium Synechocystis...”
- “...2008/Accepted 3 October 2008 Insertional transposon mutations in the sll0804 and slr1306 genes were found to lead to a loss of optimal photoautotrophy in the...”
- Four novel genes required for optimal photoautotrophic growth of the cyanobacterium Synechocystis sp. strain PCC 6803 identified by in vitro transposon mutagenesis
Zhang, Journal of bacteriology 2004 - “...Synechocystis sp. strain PCC 6803 genes (sll1495, sll0804, slr1306, and slr1125) which encode hypothetical proteins were determined by transposon mutagenesis to...”
- “...enzyme 4YD9 3ZA12 4BA2 CG4 slr1125 slr1306 sll0804 sll1495 NAe NA NA NA Probable glucosyltransferasef Hypothetical proteinf Hypothetical proteinf Hypothetical...”
alr0904 hypothetical protein from Nostoc sp. PCC 7120
Aligns to 264:433 / 448 (37.9%), covers 99.4% of PF05128, 118.3 bits
sll0503 unknown protein from Synechocystis sp. PCC 6803
Aligns to 279:449 / 474 (36.1%), covers 98.1% of PF05128, 115.6 bits
- Evidence for a major role of antisense RNAs in cyanobacterial gene regulation
Georg, Molecular systems biology 2009 - “...in darkness. On a shift to HL, the expression levels increased for both the mRNA sll0503 and its asRNA as_sll0503. However, if CO 2 was depleted only as_sll0503 went up, thus the resulting asRNA/mRNA ratio shifted to 4 ( Figure 7B ). The amount of as_tktA...”
- “...the asRNA to gene lepA . ( B ) Analysis of the asRNA to gene sll0503. ( C ) Analysis of the asRNA to tktA . Figure 8 A possible role of as_rpl1 in discoordinating gene expression within the L11 r-operon under high light. ( A...”
- Identification of two genes, sll0804 and slr1306, as putative components of the CO2-concentrating mechanism in the cyanobacterium Synechocystis sp. strain PCC 6803
Zhang, Journal of bacteriology 2008 - “...protein were identified, including hypothetical proteins encoded by sll0503 (55% similarity and 38% identity) and slr1462 (47% similarity and 27% identity). The...”
- “...by slr1462 (47% similarity and 26% identity) and sll0503 (45% similarity and 23% identity). Growth of many aquatic photosynthetic microorganisms, such as the...”
- Four novel genes required for optimal photoautotrophic growth of the cyanobacterium Synechocystis sp. strain PCC 6803 identified by in vitro transposon mutagenesis
Zhang, Journal of bacteriology 2004 - “...cyanobacterial proteins including Alr0904 from Nostoc and Sll0503 from Synechocystis. This protein is predicted to be localized to the inner membrane...”
PMM1444 GTPase SAR1 and related small G proteins from Prochlorococcus marinus sp. MED4
Aligns to 220:387 / 413 (40.7%), covers 84.0% of PF05128, 86.9 bits
MM22_MAGGM / V6F2Z8 Magnetosome membrane protein 22 from Magnetospirillum gryphiswaldense (strain DSM 6361 / JCM 21280 / NBRC 15271 / MSR-1) (see paper)
Aligns to 30:174 / 195 (74.4%), covers 87.7% of PF05128, 56.6 bits
DR_2057 hypothetical protein from Deinococcus radiodurans R1
Aligns to 7:161 / 190 (81.6%), covers 52.5% of PF05128, 53.2 bits
ZP_03274017 Uncharacterized protein/domain associated with GTPase-like protein from Arthrospira maxima CS-328
Aligns to 2:139 / 187 (73.8%), covers 64.8% of PF05128, 41.0 bits
LSA1716 Hypothetical protein from Lactobacillus sakei subsp. sakei 23K
Aligns to 61:210 / 211 (71.1%), covers 78.4% of PF05128, 37.3 bits
- Global transcriptome response in Lactobacillus sakei during growth on ribose
McLeod, BMC microbiology 2011 - “...LSA1663 lsa1663 Hypothetical protein -0.8 LSA1678 lsa1678 Hypothetical protein -0.6 LSA1680 lsa1680 Hypothetical protein -0.6 LSA1716 lsa1716 Hypothetical protein -0.5 LSA1822 lsa1822 Hypothetical protein -0.5 LSA1828 lsa1828 Hypothetical integral membrane protein 0.6 0.7 LSA1850 lsa1850 Hypothetical protein -0.6 LSA1876 lsa1876 Hypothetical integral membrane protein -0.6 LSA1877...”
CJE0670 GTP-binding protein from Campylobacter jejuni RM1221
Aligns to 200:345 / 355 (41.1%), covers 77.2% of PF05128, 36.7 bits
jhp0681 putative from Helicobacter pylori J99
Aligns to 239:390 / 404 (37.6%), covers 70.4% of PF05128, 28.6 bits
- A novel method for assessing and measuring homophily in networks through second-order statistics
Apollonio, Scientific reports 2022 - “...of the same protein, but these nodes were simply denoted by a unique label (e.g. jhp0681) in the edge listing file. We merged such nodes in a single node; in the few cases in which they were associated to different functional classes, we merged them associating...”
- Differences in genome content among Helicobacter pylori isolates from patients with gastritis, duodenal ulcer, or gastric cancer reveal novel disease-associated genes
Romo-González, Infection and immunity 2009 - “...N/A, HP0681, JHP0622 N/A, HP0712, JHP0651 N/A, HP0744, JHP0681 N/A, HP0764, JHP0701, JHP0702 acpP, HP0962, N/A N/A, HP0963, JHP0897 N/A, HP0964, JHP0898,...”
Or search for genetic data about PF05128 in the Fitness Browser
by Morgan Price,
Arkin group
Lawrence Berkeley National Laboratory