Family Search for PF05768 (Glrx-like)

April 2024: See Interactive Tools for Functional Annotation of Bacterial Genomes for advice on using these tools.

PF05768 hits 45 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.

asl1664 hypothetical protein from Nostoc sp. PCC 7120
Aligns to 2:83 / 95 (86.3%), covers 98.8% of PF05768, 85.2 bits

• The nitrogen-regulated response regulator NrrA controls cyanophycin synthesis and glycogen catabolism in the cyanobacterium Synechocystis sp. PCC 6803
  Liu, The Journal of biological chemistry 2014
  • “...4.76 alr4249 sigE AATTCTCAGTAGTTAACA -32 4.37 asl1664 asl1664-murE TATCATGTATTCTTTACA -52 4.67 asr0064 asr0064 TGTCAGGAAATTTTGACA -182 4.64 hetR...”

NGFG_00480, NGO_0331 glutaredoxin family protein from Neisseria gonorrhoeae FA 1090
Aligns to 2:76 / 77 (97.4%), covers 100.0% of PF05768, 81.8 bits

• Central Role of Sibling Small RNAs NgncR_162 and NgncR_163 in Main Metabolic Pathways of Neisseria gonorrhoeae
  Steiner, mBio 2023
  • “...(maf) Function unknown NGFG_02049*/ NGFG_02050 0.0037/ 0.0312 1.8075/ 1.6178 3-Hydroxyisobutyrate dehydrogenase Lipid transport and metabolism NGFG_00480 2.45E04 1.795 Thioredoxin Posttranslational modification, protein turnover NGFG_00981 0.01 1.7888 Conjugative transfer pilus assembly protein TraH Function unknown NGFG_02348 4.23E04 1.7851 Hypothetical protein (maf) Function unknown NGFG_00447 0.0118 1.7839 Hypothetical...”
• Iron-regulated small RNA expression as Neisseria gonorrhoeae FA 1090 transitions into stationary phase growth
  Jackson, BMC genomics 2017
  • “...Fe dependent small RNAs FA 1090 5 ORF sRNA Orientation 3 ORF Fe Regulation NrsA NGO_0331 trans a NGO_0332 Induced NrsB NGO_0686 trans NGO_0687 Induced NrsC NGO_1221 trans NGO_1222 Induced NrsD NGO_1651 trans a NGO_1652 Induced NrsE NGO_1713 trans NGO_1714 Induced a RIT present Relative concentration...”

AT4G08280 hypothetical protein from Arabidopsis thaliana
Aligns to 34:122 / 126 (70.6%), covers 98.8% of PF05768, 81.4 bits

• Genome-wide association studies identify loci controlling specialized seed metabolites in Arabidopsis
  Naake, Plant physiology 2024 (no snippet)
• Phytochromes and Their Role in Diurnal Variations of ROS Metabolism and Plant Proteome
  Luklová, International journal of molecular sciences 2022
  • “...mutant genotypes. Nine proteins whose dark-induced accumulation was lost in the mutants included a glutaredoxin (AT4G08280; with a putative role in redox signaling) and beta-amylase BAM3 (AT4G17090; required for the starch breakdown in leaves during the night, [ 43 ]). Proteins of interest in the set...”
• Network mapping of root-microbe interactions in Arabidopsis thaliana
  He, NPJ biofilms and microbiomes 2021
  • “...0 1 7 2 GA2OX5 AT1G12760 AT5G19097 AT5G35525 AT3G30405 AT5G35495 PDE320 AT3G29175 UPL4 Gene AT1G14800 AT4G08280 Altruism QTLs 2 1 2 0 1 0 EGRET RGLG5 AT5G60470 Gene PUM11 In the QTL network for the microbial antagonism network, a closeness hub QTL acts like gene UBP22(AT5G10790)...”
• Transcriptome-wide high-throughput deep m(6)A-seq reveals unique differential m(6)A methylation patterns between three organs in Arabidopsis thaliana
  Wan, Genome biology 2015
  • “...22 33 ] Redox process AT1G50430, AT1G67140, AT1G76150, AT2G27110, AT1G80560, AT2G07687, AT2G07727, AT2G38020, AT3G20560, AT2G48060, AT4G08280, AT4G23420, AT4G39850, AT5G42790, AT5G65750, AT4G01860, AT3G08950, AT3G01380, AT4G36080, AT2G43420, AT4G16310, AT5G21060, AT1G56000, AT4G17150, AT5G08470, AT4G16070, AT4G30993, AT3G20560 [ 18 , 34 36 ] Signal transduction AT1G03060, AT1G43130, AT1G48090, AT1G51690, AT1G58250,...”

NE2328 putative thioredoxin from Nitrosomonas europaea ATCC 19718
Aligns to 9:85 / 85 (90.6%), covers 98.8% of PF05768, 81.0 bits

• Transcriptomic Response of Nitrosomonas europaea Transitioned from Ammonia- to Oxygen-Limited Steady-State Growth
  Sedlacek, mSystems 2020
  • “...TableS2 ; Data Set S1 ). Surprisingly, rubredoxin (NE1426) and a glutaredoxin family protein-encoding gene (NE2328) did not follow this trend and were transcribed at significantly higher levels (2.8- and 1.8-fold, respectively) during O 2 -limited growth ( TableS2 ). Although their role in N. europaea...”

Tery_4152 glutaredoxin 2 from Trichodesmium erythraeum IMS101
Aligns to 2:88 / 91 (95.6%), covers 98.8% of PF05768, 78.3 bits

• The nitrogen-regulated response regulator NrrA controls cyanophycin synthesis and glycogen catabolism in the cyanobacterium Synechocystis sp. PCC 6803
  Liu, The Journal of biological chemistry 2014
  • “...73102 Trichodesmium erythraeum IMS101 Tery_1921 19 Tery_4152 Tery_4152-murE AATGCTCAAAAGTTTACT -144 4.38 Tery_4481 glyS-murD TGTCCTCGTAAATTAATA -392 4.46 a...”

C5XSW5 Glutaredoxin-like protein from Sorghum bicolor
Aligns to 40:128 / 133 (66.9%), covers 98.8% of PF05768, 77.5 bits

• Label-free quantitative proteomics of Sorghum bicolor reveals the proteins strengthening plant defense against insect pest Chilo partellus
  Tamhane, Proteome science 2021
  • “...to Diaminopimelate decarboxylase Diaminopimelate decarboxylase activity, meso-2,6-diaminopimelate + H(+)=L-lysine + CO(2), systemic acquires resistance 31,822 C5XSW5 Glutaredoxin-like protein Photooxidative stress, antioxidant activity 19,098 C5Z949 similar to RING zinc finger domain superfamily protein Ubiquitin specific protease binding, ERAD-associated E3 ubiquitin-protein ligase HRD1-like isoform X1 2715 C5XIX0 similar...”

GRMZM2G113418 glutaredoxin 2 from Zea mays
Aligns to 40:128 / 133 (66.9%), covers 97.5% of PF05768, 75.9 bits

• Genetic resources and breeding of maize for Striga resistance: a review
  Dossa, Frontiers in plant science 2023
  • “...2 Striga damage GRMZM2G162781 2 Striga damage GRMZM2G081285 4 Striga damage GRMZM2G112548 5 Striga damage GRMZM2G113418 5 Striga damage GRMZM2G035073 5 Striga damage GRMZM5G832409 6 Striga damage GRMZM2G162382 7 Striga damage GRMZM2G300965 GRMZM2G300969 10 Striga damage GRMZM5G873586 GRMZM2G356817 10 Striga damage GRMZM2G364748 10 Striga damage GRMZM2G017470...”
• Genome-Wide Association Analysis for Candidate Genes Contributing to Kernel-Related Traits in Maize
  Qu, Frontiers in plant science 2022
  • “...protein 3 M11 Affx-291398282 GRMZM2G122431 Zm00001d041972 145210669 3 KT cellulose synthase-like protein G2 M12 Affx-291407617 GRMZM2G113418 Zm00001d018192 87482064 5 KT glutaredoxin 2 M13 Affx-291375641 GRMZM2G359521 Zm00001d005752 190584813 2 HKW uncharacterized protein M14 Affx-291381677 GRMZM2G354579 Zm00001d044607 27905121 3 HKW uncharacterized protein LOC103651651 - Module indicate the protein-protein...”
  • “...the root node and root length in maize (Wang, 2016 ). Furthermore, the candidate gene GRMZM2G113418 (M13) enhanced drought tolerance and grain yield in field-grown maize and regulated maize inflorescence meristem development via redox control of TGA transcriptional activity (Mamoru et al., 2003 ; Lupini et...”
• Association analysis for resistance to Striga hermonthica in diverse tropical maize inbred lines
  Stanley, Scientific reports 2021
  • “...160459526 GRMZM2G081285 RING-H2 finger protein ATL1R S5_5623740 5623740 GRMZM2G112548 transcription factor JUNGBRUNNEN 1 S5_216138908 216138908 GRMZM2G113418 glutaredoxin 2 S5_70442824 70442824 GRMZM2G035073 putative cytochrome P450 superfamily protein S6_25428338 25428338 GRMZM5G832409 knotted related homeobox 5 (lg4b) S7_10795659 10795659 GRMZM2G162382 Transcription factor bHLH7 S10_25285761 25285761 GRMZM2G300965; GRMZM2G300969 uncharacterized LOC100381459;...”

BA5371 glutaredoxin family protein from Bacillus anthracis str. Ames
Aligns to 2:76 / 81 (92.6%), covers 98.8% of PF05768, 75.1 bits

• Bacillus anthracis thioredoxin systems, characterization and role as electron donors for ribonucleotide reductase
  Gustafsson, The Journal of biological chemistry 2012
  • “...potential NrdH redoxins denoted NrdH (BA4201) and NrdH2 (BA5371), and one hypothetical protein similar to the arsenate reductase family denoted ArsC (BA5229)...”
  • “...protein BA5387 BA2768 BA4758 BA4945 BA5225 BA4201 BA5371 BA5229 Potential active site Potential gene product Predicted extinction coefficient CAVC CPYC CGPC...”

YDR286C Putative protein of unknown function; predicted to have thiol-disulfide oxidoreductase active site from Saccharomyces cerevisiae
Aligns to 22:109 / 114 (77.2%), covers 98.8% of PF05768, 74.9 bits

• Multi-omics Reveal Specific Targets of the RNA-Binding Protein Puf3p and Its Orchestration of Mitochondrial Biogenesis
  Lapointe, Cell systems 2018
  • “...). For example, they include previously uncharacterized genes (e.g., AIM11 , AIM18 , YBR292C , YDR286C , YDR381C-A , YGR021W , and YGR161W-C ), which we can now potentially link to roles in mitochondrial biogenesis given their identity as Puf3p target mRNAs. Thus, the pathways mapped...”
• The roles of thiol oxidoreductases in yeast replicative aging
  Hacioglu, Mechanisms of ageing and development 2010
  • “...disulfide isomerase YCL035C GRX1 CxxC 26 -CPYC- Glutaredoxin YCR083W TRX3 CxxC 54 -CGPC- Mitochondrial thioredoxin YDR286C YDR286C CxxC 30 -CGLC- Thioredoxin YDR513W GRX2 CxxC 60 -CPYC- Glutaredoxin YGR029W ERV1 CxxC, CxxC 29, 129 -CRSC, -CNWC- Mitochondrial biogenesis YGR209C TRX2 CxxC 30 -CGPC- Thioredoxin YIL005W EPS1 CxxC,...”
• Most, but not all, yeast strains in the deletion library contain the [PIN(+)] prion
  Manogaran, Yeast (Chichester, England) 2010
  • “...YLR304C (ACO1) YOR274W (MOD5) YDR283C ( GCN2 ) YGL127C ( SOH1 ) YLR331C (JIP3) YOR379C YDR286C YGL226W YML061C (PIF1) YPL148C (PPT2) YDR287W ( INM2) YGL252C ( RTG2 ) YML121W (GTR1) YPR054W (SMK1) YDR294C ( DPL1 ) YGR007W ( MUQ1 ) YML129C (COX14) YPR060C (ARO7) YDR333C YGR268C...”
• Computationally driven, quantitative experiments discover genes required for mitochondrial biogenesis
  Hess, PLoS genetics 2009
  • “...mitochondrial biogenesis. For example, the four genes ( AIP1 , MPM1 , YDL027C , and YDR286C ) that specifically interact with rvs167 are potentially involved in the actin-based transmission of mitochondria to the daughter cell as Rvs167 is a regulator of actin polymerization [49] . In...”
• Genomic-scale comparison of sequence- and structure-based methods of function prediction: does structure provide additional insight?
  Fetrow, Protein science : a publication of the Protein Society 2001
  • “...YER174C YDR098C YPL059W YOR085W (OST3) YML019W (OST6) YDR286C YNL155W YDR133C YDR199W YOL024W YKL102C YLR245C (cdd1) YLR246W (erf2) YHR002W Active site Thd/FFFc...”
  • “...consensus positives discussed in the text. (Black bar) Sequence (YDR286C) identified by BL00195A and the FFF. We are unable to validate this prediction by using...”

G372_RS0101425 glutaredoxin family protein from Thioalkalivibrio thiocyanoxidans ARh2
Aligns to 3:77 / 79 (94.9%), covers 98.8% of PF05768, 73.9 bits

• Analysis of the Genes Involved in Thiocyanate Oxidation during Growth in Continuous Culture of the Haloalkaliphilic Sulfur-Oxidizing Bacterium Thioalkalivibrio thiocyanoxidans ARh 2^T Using Transcriptomics
  Berben, mSystems 2017
  • “...protein L3 G372_RS0100975 1.52 2.39E-11 30S ribosomal protein S10 G372_RS0101385 1.64 1.11E-5 Nucleoside triphosphate pyrophosphohydrolase G372_RS0101425 1.76 7.96E-7 Glutaredoxin G372_RS0101510 1.75 2.01E-12 30S ribosomal protein S6 G372_RS0101520 1.59 3.63E-12 Hypothetical protein G372_RS0102735 1.73 2.80E-10 Sulfite oxidase G372_RS0102740 1.52 6.26E-12 6,7-Dimethyl-8-ribityllumazine synthase G372_RS0102750 1.70 7.83E-17 30S ribosomal...”

Rv0508 hypothetical protein from Mycobacterium tuberculosis H37Rv
Aligns to 5:84 / 97 (82.5%), covers 98.8% of PF05768, 69.7 bits

• Reengineering redox sensitive GFP to measure mycothiol redox potential of Mycobacterium tuberculosis during infection
  Bhaskar, PLoS pathogens 2014
  • “...identified three putative Mrx1 like proteins in Mtb H37Rv. Out of the three proteins (Rv3053c, Rv0508, and Rv3198A), Rv3198A demonstrate highest similarity with Mrx1 of Msm (72% identity). Based on this, we selected Rv3198A ORF as a putative mycoredoxin-encoding gene and named its product as Mtb...”
• Mycobacterium tuberculosis modulates its cell surface via an oligopeptide permease (Opp) transport system
  Flores-Valdez, FASEB journal : official publication of the Federation of American Societies for Experimental Biology 2009
  • “...1.0 1.1 0.6 1.3 0.6 2.4 1.1 Rv0341 Rv0404 Rv0440 Rv0467 Rv0475 Rv0508 1.1 1.9 0.7 0.3 0.6 1.0 0.8 0.4 1.6 0.9 1.1 0.6 0.6 0.9 1.0 1.1 1.0 0.9 Rv0509 Rv0583c...”

Francci3_0483 glutaredoxin 2 from Frankia sp. CcI3
Aligns to 16:90 / 103 (72.8%), covers 98.8% of PF05768, 69.0 bits

• Transcriptomes of Frankia sp. strain CcI3 in growth transitions
  Bickhart, BMC microbiology 2011
  • “...DNA-binding protein Francci3_1949 1203 acyl transferase region Francci3_0991 691 hypothetical protein Francci3_1985 724 glutaredoxin 2 Francci3_0483 1202 regulatory protein GntR Francci3_3218 690 Rhodanese-like Francci3_2753 721 translation elongation factor Tu Francci3_0580 1179 CRISPR-associated protein Francci3_3346 680 Thiolase Francci3_2502 718 thioredoxin Francci3_4537 1165 hypothetical protein Francci3_1874 678 response...”

PA3033 hypothetical protein from Pseudomonas aeruginosa PAO1
Aligns to 17:91 / 92 (81.5%), covers 97.5% of PF05768, 67.8 bits

• Network analysis for identifying potential anti-virulence targets from whole transcriptome of Pseudomonas aeruginosa and Staphylococcus aureus exposed to certain anti-pathogenic polyherbal formulations
  Ruparel, Drug target insights 2023
  • “...3.45 0.0002 19 PA1211 Hypothetical protein 3.40 0.01 20 PA0818 Hypothetical protein 3.30 0.004 21 PA3033 Hypothetical protein 3.25 0.0005 22 kynB Arylformamidase (kynurenine formamidase) 3.15 0.0001 23 PA5196 Hypothetical protein 3.14 0.005 24 PA5181.1 P34 3.11 0.001 25 nuoI NADH-quinone oxidoreductase subunit I 3.08 2.73E-08...”
• Pseudomonas aeruginosa mexR and mexEF Antibiotic Efflux Pump Variants Exhibit Increased Virulence
  Vaillancourt, Antibiotics (Basel, Switzerland) 2021
  • “...in mexE, mexF, and oprN all exhibited increased swarming relative to a Tn mutant control (PA3033), which has been shown to be a neutral Tn mutation for numerous phenotypes. As above, a mexR Tn mutant showed the same levels of swarming as the Tn mutant control....”
  • “...swarming motility in different mexR and mexEF-oprN transposon mutants vs. a neutral Tn mutant control (PA3033) after 24 h, n = 512 replicates/group. For all panels, * p < 0.05, **** p < 0.0001, one-way ANOVA, followed by a Tukeys multiple comparisons test. Figure 3 MexAB-OprM...”

MSMEG_0951 glutaredoxin 2 from Mycobacterium smegmatis str. MC2 155
Aligns to 1:79 / 80 (98.8%), covers 96.3% of PF05768, 65.4 bits

• Discovery of a novel dehydratase of the fatty acid synthase type II critical for ketomycolic acid biosynthesis and virulence of Mycobacterium tuberculosis
  Lefebvre, Scientific reports 2020
  • “...membrane protein MmpS2, respectively. The distinct genes in M. smegmatis , MSMEG_0946 , MSMEG_0950 and MSMEG_0951 , are annotated as encoding a NAD-dependent epimerase/dehydratase family protein, a hypothetical protein and the glutaredoxin 2, respectively. ( C ) Verification of hadD Mtb gene deletion by PCR analysis....”

Cp1002_0272 glutaredoxin family protein from Corynebacterium pseudotuberculosis 1002
Aligns to 9:83 / 84 (89.3%), covers 98.8% of PF05768, 64.4 bits

• Label-free proteomic analysis to confirm the predicted proteome of Corynebacterium pseudotuberculosis under nitrosative stress mediated by nitric oxide
  Silva, BMC genomics 2014
  • “...12 1.25 1 CYT noxC Shared D9Q680_CORP1 Glutaredoxin-like domain protein 292.69 2 -1.91 0 CYT Cp1002_0272 Core Glycolysis pathways D9Q5B6_CORP1 N-Acetylglucosamine kinase 228.69 6 1.74 0.98 CYT nanK Core D9Q4U9_CORP1 Alcohol dehydrogenase 236.02 17 1.22 1 CYT adhA Shared Iron-sulfur clusters D9Q7L6_CORP1 Ferredoxin 36927.57 7 2.10...”

Q9CWB7 Glutaredoxin-like protein C5orf63 homolog from Mus musculus
Aligns to 31:105 / 115 (65.2%), covers 97.5% of PF05768, 62.6 bits

• Cognitive impairment resulting from treatment with docetaxel, doxorubicin, and cyclophosphamide
  Brown, Brain research 2021
  • “...6.79 A2AER7 Pqbpl protein Nucleus Other 4.49 B1AW58 Calcium/calmodulin-dependent protein kinase ID Nucleus Kinase 2.64 Q9CWB7 Glutaredoxin-like protein C5orf63 homolog Mitochondrion Other 2.46 Q9DBM2 Peroxisomal bifunctional enzyme (PBE) (PBFE) [Includes: Enoyl- CoA hydratase/3,2-trans-enoyl-CoA isomerase (EC 4.2.1.17) (EC 5.3.3.8); 3-hydroxyacyl-CoA dehydrogenase (eC 1.1.1.35)] Peroxisome Enzyme 2.45 Q9JJV5...”

LSDV053 glutaredoxin-like protein from Lumpy skin disease virus NI-2490
Aligns to 4:112 / 126 (86.5%), covers 100.0% of PF05768, 58.5 bits

• Constitutive proteins of lumpy skin disease virion assessed by next-generation proteomics
  Schlosser-Perrin, Journal of virology 2023
  • “...LSDV052 G3L M046L Hypothetical protein 12,955 7 7 3 58 0.8491 2.4701 3.3192 AOE47627.1 YES LSDV053 G4L M048L Glutaredoxin-like protein 14,395 10 11 4 16 3.7513 7.6415 11.3928 AOE47629.1 YES LSDV057 G7L M052L Putative virion core protein 42,031 20 26 3 21 2.3078 4.5918 6.8997 AOE47633.1...”
  • “...I7L C S LSDV048; D VACWR078 G1L C S LSDV050; S VACWR081 G4L C D LSDV053; S VACWR085 G7L C S LSDV057; S VACWR091 L4R C S LSDV063; S VACWR093 J1R C S LSDV065; S VACWR107 D2L C S LSDV080; S VACWR108 D3R C S LSDV081;...”
• Genome of deerpox virus
  Afonso, Journal of virology 2005
  • “...EVM037 YLDV 29L Species and descriptiond LSDV052 LSDV053 LSDV047 LSDV048 LSDV049 LSDV050 LSDV051 LSDV046 LSDV044 LSDV045 LSDV035 LSDV037 LSDV038 LSDV039 LSDV040...”
• Complete genomic sequence and comparative analysis of the tumorigenic poxvirus Yaba monkey tumor virus
  Brunetti, Journal of virology 2003
  • “...SPV050 SPV051 SPV052 64 49 84 M048L M049R M050R 69 44 85 LSDV053 LSDV054 LSDV055 75 49 85 G4L G5R G5.5R 45 43 79 56R 57L 291 580 79 78 SPV053 SPV054 53 53 M051R...”
• The genome of swinepox virus
  Afonso, Journal of virology 2002
  • “...LSDV051 63 52R 48 M047R 55 G2R 44 L L LSDV052 58 51L LSDV053 70 53L 54 M046L 64 M048L 63 G3L 64 G4L 47 43 E LSDV054 63 54R LSDV055 87 55R 54 M049R 84 M050R 52...”
• Genome of lumpy skin disease virus
  Tulman, Journal of virology 2001
  • “...86996-86301 (232) 87220-86996 (75) 89214-87232 (661) LSDV052 LSDV053 LSDV054 LSDV055 LSDV056 LSDV057 LSDV058 LSDV059 LSDV060 LSDV061 LSDV062 LSDV063 LSDV064...”

FPV077 glutaredoxin-like protein from Fowlpox virus
Aligns to 4:114 / 125 (88.8%), covers 100.0% of PF05768, 58.2 bits

• Modulation of Early Host Innate Immune Response by an Avipox Vaccine Virus' Lateral Body Protein
  Giotis, Biomedicines 2020
  • “...involved in morphogenesis, as well as the dual-specificity phosphatase H1 discussed above (FWPV orthologues, FPV103, FPV077 and FPV138, respectively). H1 has an immunomodulatory function by virtue of its ability to target STAT-mediated signalling, required for IFN-mediated induction of ISG expression. Our demonstration that FPV184 and VACV...”
• The genome of canarypox virus
  Tulman, Journal of virology 2004
  • “...(186) FPV073 (174) -- FPV074 (104) FPV075 (199) FPV077 (125) 43 79 30 83 B16R* D5R CNPV105 CNPV106 CNPV107 CNPV108 109528-109833 (102) 109534-108833 (234)...”
• The genome of fowlpox virus
  Afonso, Journal of virology 2000
  • “...thymidine kinase (FPV086), dUTP pyrophosphatase (FPV038), glutaredoxin (FPV077), two deoxycytidine kinases (dCKs; FPV059 and FPV151), and a putative DNase II...”
  • “...110 AF110798 H. sapiens 129 133 29 27 FPV077 FPV078 FPV079 FPV080 78569-78943 (125) 79590-79898 (103) 79596-78922 (225) 81019-79931 (363) 290 119 339 178...”

D6WAN7 acetyl-CoA C-acetyltransferase from Tribolium castaneum
Aligns to 423:497 / 502 (14.9%), covers 98.8% of PF05768, 57.6 bits

• The Differential Expression of Mevalonate Pathway Genes in the Gut of the Bark Beetle Dendroctonus rhizophagus (Curculionidae: Scolytinae) Is Unrelated to the de Novo Synthesis of Terpenoid Pheromones
  Sarabia, International journal of molecular sciences 2019
  • “...jeffreyi AY966010.1 92 Q56CY6 91.5 Leptinotarsa decemlineata KP689334.1 72 A0A0H4IRH6 81.1 Tribolium castaneum XM_969915.4 72 D6WAN7 79.9 HMGS Dendroctonus ponderosae JQ855690.1 95 I1VJ69 96.7 Dendroctonus jeffreyi AF166002.1 94 Q9NDA8 93.7 Dendroctonus armandi KP317812.1 92 A0A0F7LEZ1 94.5 Ips pini AY902193.1 72 Q5EE42 75.9 Leptinotarsa decemlineata KP689335.1 71...”

LHK_01462 thioredoxin from Laribacter hongkongensis HLHK9
Aligns to 4:79 / 82 (92.7%), covers 96.3% of PF05768, 55.5 bits

• Environmental adaptability and stress tolerance of Laribacter hongkongensis: a genome-wide analysis
  Lau, Cell & bioscience 2011
  • “...bonds trxA Thioredoxin 1 ppGpp LHK_01690 CV1584 NMB1366 NGO0652 - Thioredoxin LHK_00591 CV1325 NMB0006 NGO0057 LHK_01462 CV4257 NMB1845 NGO1923 LHK_01491 CV4279 NMB1958 NGO2124 LHK_02476 LHK_02092 trxC Thioredoxin 2 OxyR - CV1106 - - trxB Thioredoxin reductase LHK_1482 CV1895 CV2813 NMB1324 NGO0580 - Peroxiredoxin LHK_02841 CV3708 NMB0946...”

Deide_13741 putative Glutaredoxin from Deinococcus deserti VCD115
Aligns to 8:79 / 92 (78.3%), covers 69.1% of PF05768, 55.3 bits

• Proteomics-based refinement of Deinococcus deserti genome annotation reveals an unwonted use of non-canonical translation initiation codons
  Baudet, Molecular & cellular proteomics : MCP 2010
  • “...start site. Only one peptide is found upstream from hitherto annotated sequences of Deide_05590, Deide_07640, Deide_13741, Deide_16590, Deide_19650, Deide_22950, Deide_2p01230, and Deide_2p01630. Visual inspection of multialignments of these polypeptides and close homologous sequences confirmed that some residues were missing in all of these cases. We thus...”

K9G667 Glutaredoxin-like protein from Penicillium digitatum (strain PHI26 / CECT 20796)
Aligns to 12:101 / 109 (82.6%), covers 96.3% of PF05768, 54.8 bits

• Deciphering Molecular Determinants Underlying Penicillium digitatum's Response to Biological and Chemical Antifungal Agents by Tandem Mass Tag (TMT)-Based High-Resolution LC-MS/MS
  Citores, International journal of molecular sciences 2022
  • “...protein (AC: K9GPG9), upregulated upon -sarcin and BE27 treatments. Moreover, for the Glutaredoxin-like protein (AC: K9G667), a glutathione-dependent oxidoreductase playing a role in redox homeostasis, a significant downregulation was observed following treatments with protein toxins. Collectively, these results point to a differential modulation of redox system...”
  • “...3 4 Oxidative stress response K9GPG9 Glyoxalase family protein 1.6 1.92 1.25 6 3 5 K9G667 Glutaredoxin-like protein 0.55 0.45 0.88 28 4 11 K9G5U5 Catalase 1.16 1.23 1.6 27 15 35 RNA binding K9FAA5 Nuclear mRNA splicing factor-associated protein, putative 0.89 1.7 1.03 3 2...”

Q8V507 Glutaredoxin-2 from Ectromelia virus (strain Moscow)
Aligns to 4:112 / 124 (87.9%), covers 98.8% of PF05768, 53.5 bits

• Identification of core therapeutic targets for Monkeypox virus and repurposing potential of drugs against them: An in silico approach.
  Sahu, Computers in biology and medicine 2023
  • “...P68456 Late transcription elongation factor G2, Protein G2 G2R 98.64 220 3 5.5E-161 OG045 124 Q8V507 Glutaredoxin-2 EVM065 100.00 124 0 4.5E-91 2G2Q_A (97.56, 99) OG046 340 P07611 Myristoylated protein G9, Protein F1 G9R 98.53 340 5 0.0E+00 OG047 250 P0DOT7 Protein L1; Virion membrane protein...”

CPXV091 CPXV091 protein from Cowpox virus
Aligns to 4:112 / 124 (87.9%), covers 98.8% of PF05768, 52.8 bits

• Generation of a complete single-gene knockout bacterial artificial chromosome library of cowpox virus and identification of its essential genes
  Xu, Journal of virology 2014
  • “...CPXV084 CPXV085 CPXV086 CPXV087 CPXV088 CPXV089 CPXV090 CPXV091 CPXV092 CPXV093 CPXV094 CPXV095 CPXV096 CPXV097 CPXV098 CPXV099 CPXV100 CPXV101 CPXV102 CPXV103...”

GLRX2_VACCW / P68460 Glutaredoxin-2 from Vaccinia virus (strain Western Reserve) (VACV) (Vaccinia virus (strain WR)) (see 6 papers)
VACWR081 thioredoxin-like protein from Vaccinia virus
P68461 Glutaredoxin-2 from Vaccinia virus (strain Copenhagen)
Aligns to 4:112 / 124 (87.9%), covers 98.8% of PF05768, 52.1 bits

• function: Glutaredoxin necessary for virion morphogenesis and virus replication. Functions as a thiol-disulfide transfer protein between membrane-associated OPG128/A2.5 and substrates OPG095/L1 or OPG053/F9. The complete pathway for formation of disulfide bonds in intracellular virion membrane proteins sequentially involves oxidation of OPG072/E10, OPG128/A2.5 and OPG088/G4. Exhibit thioltransferase and dehydroascorbate reductase activities in vitro.
  subunit: Homodimer.
• Constitutive proteins of lumpy skin disease virion assessed by next-generation proteomics
  Schlosser-Perrin, Journal of virology 2023
  • “...LSDV046; ND f VACWR076 I7L C S LSDV048; D VACWR078 G1L C S LSDV050; S VACWR081 G4L C D LSDV053; S VACWR085 G7L C S LSDV057; S VACWR091 L4R C S LSDV063; S VACWR093 J1R C S LSDV065; S VACWR107 D2L C S LSDV080; S VACWR108...”
• The genome of Yoka poxvirus
  Zhao, Journal of virology 2011
  • “...56003-56662 57012-56638 72 74 71 67 VACWR078 VACWR079 VACWR080 VACWR081 (G1L) (G3L) (G2R) (G4L) 591 111 220 124 YKV061 440 57015-58334 58 VACWR082 (G5R) 434...”
• ISG15 Is Required for the Dissemination of Vaccinia Virus Extracellular Virions
  Bécares, Microbiology spectrum 2023
  • “...replication 2.33 49.04 P20992 Core protein A15 A15L Morphogenetic complex; formation of virosomes 2.33 44.83 P68461 Glutaredoxin-2 G4L (GLRX2) Virion morphogenesis and viral replication; formation of disulfide bonds in intracellular virion membrane 2 47.85 P21016 Protein F7 F7L 2 47.18 P68619 Protein A36 A36R Intracellular transport...”

Q8P6W3 Glutaredoxin family protein from Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Aligns to 2:73 / 78 (92.3%), covers 97.5% of PF05768, 48.8 bits

• Protein structure refinement using a quantum mechanics-based chemical shielding predictor.
  Bratholm, Chemical science 2017
  • “...0.4 1.3 (0.5) 0.9 9.1 Lamin-B1 (P20700) 0.5 1.6 (0.4) 1.6 1.9 Target protein XcR50 (Q8P6W3) 0.3 0.6 (0.4) 0.8 2.9 OB-fold domain of replication protein A (Q6LYF9) 0.5 1.5 (0.5) 1.7 2.1 TM1442 protein (Q9X1F5) 0.3 1.5 (0.4) 1.8 1.8 Liver fatty acid-binding protein (LFAB)...”
• A community resource of experimental data for NMR / X-ray crystal structure pairs.
  Everett, Protein science : a publication of the Protein Society 2016

DR_0057 conserved hypothetical protein from Deinococcus radiodurans R1
Aligns to 6:78 / 84 (86.9%), covers 70.4% of PF05768, 48.6 bits

• Thiol Reductases in Deinococcus Bacteria and Roles in Stress Tolerance
  de, Antioxidants (Basel, Switzerland) 2022
  • “...analysis of the D. radiodurans genome revealed the presence of several other genes (DR_2085, DR_A0072, DR_0057, DR_B0110, and DR_0948) encoding small proteins harbouring CXXC motifs, such a CPDC, CHLC, and CPGC ( Table 3 ), and predicted to display a Trx-fold ( Figure S4 ). These...”
  • “...for instance, three in D. deserti and six in D. gobiensis . The DR_2085 and DR_0057 types, which have CPDC and CHLC active sites, respectively, are present and well conserved in all species selected ( Figure 2 a; Figure S5a ). For D. radiodurans and D....”
• Conservation and diversity of radiation and oxidative stress resistance mechanisms in Deinococcus species
  Lim, FEMS microbiology reviews 2019
  • “...three small (80 to 100 residues) CXXC motif-containing Grx-like proteins (i.e . DR_2085, DR_A0072 and DR_0057) (de Groot etal. 2009 ; Yuan etal. 2012 ), while GSH, GSH reductase and GSH peroxidase are absent (Slade and Radman 2011 ). Of these three Grx-like proteins, the DR_2085-...”

CNPV104 glutaredoxin-like protein from Canarypox virus
Aligns to 4:114 / 125 (88.8%), covers 100.0% of PF05768, 45.5 bits

• Genomic characterization of two novel pathogenic avipoxviruses isolated from pacific shearwaters (Ardenna spp.)
  Sarker, BMC genomics 2017
  • “...105 105 SWPV1-092 SWPV2-098 CNPV103 CNPV103 N1R/p28-like protein 62.304 98.947 188 190 190 SWPV1-093 SWPV2-099 CNPV104 CNPV104 putative glutaredoxin 2, virion morphogenesis 86.4 99.2 125 125 125 SWPV1-094 SWPV2-100 CNPV105 CNPV105 conserved hypothetical protein 77.35 98.718 234 234 234 SWPV1-095 SWPV2-101 CNPV106 CNPV106 putative elongation factor...”
• The genome of canarypox virus
  Tulman, Journal of virology 2004
  • “...CNPV098 CNPV099 CNPV100 CNPV101 CNPV102 CNPV103 CNPV104 93244-92246 (333) 95922-93541 (794) 96741-96079 (221) 97484-96831 (218) 98751-97543 (403) 99035-99385...”
  • “...in several large CNPV genomic regions (CNPV069 to CNPV084, CNPV104 to CNPV140, CNPV171 to CNPV194, and CNPV238 to CNPV273) which correspond to the large genomic...”

Dhaf_0850 Thioredoxin domain protein from Desulfitobacterium hafniense DCB-2
Aligns to 22:103 / 110 (74.5%), covers 97.5% of PF05768, 34.4 bits

• Genome sequence of Desulfitobacterium hafniense DCB-2, a Gram-positive anaerobe capable of dehalogenation and metal reduction
  Kim, BMC microbiology 2012
  • “...expressed constitutively. Other oxygen responsive genes include those for thioredoxin (Dhaf_1227 and Dhaf_3584), thioredoxin reductase (Dhaf_0850), and rubrerythrin (Dhaf_4567). These results suggest that D. hafniense DCB-2 is equipped with and can operate defensive machinery against oxygen, which includes ROS scavenging, oxygen metabolism, and other oxygen-responsive reductive...”

THIO_METJA / Q57755 Thioredoxin from Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440) (Methanococcus jannaschii) (see paper)
Aligns to 5:85 / 85 (95.3%), covers 75.3% of PF05768, 29.3 bits

• function: Acts to maintain redox homeostasis; functions as a protein disulfide reductase.

cmoI / O34639 N-acetyl-L-cysteine sulfenic acid reductase from Bacillus subtilis (strain 168) (see 5 papers)
CMOI_BACSU / O34639 N-acetyl-S-hydroxy-L-cysteine reductase; N-acetyl-L-cysteine sulfenic acid reductase; EC 1.8.4.- from Bacillus subtilis (strain 168) (see paper)
Aligns to 6:90 / 93 (91.4%), covers 76.5% of PF05768, 29.2 bits

• function: Involved in a cysteine salvage pathway from S-alkylcysteine. Catalyzes the reduction of N-acetyl-S-hydroxy-L-cysteine (N-acetyl-L- cysteine sulfenic acid) to N-acetyl-L-cysteine. This pathway is likely important in the catabolism of alkylated cysteine generated by proteolysis of alkylated glutathione formed in the detoxification of a wide range of electrophiles.
  catalytic activity: AH2 + N-acetyl-S-hydroxy-L-cysteine = A + H2O + N-acetyl-L- cysteine (RHEA:75531)
• In Silico Safety Assessment of Bacillus Isolated from Polish Bee Pollen and Bee Bread as Novel Probiotic Candidates
  Bin, International journal of molecular sciences 2024
  • “...Vegetative catalase P26901 katE Catalase-2 P42234 fnr Anaerobic regulatory protein P46908 ytnI Putative glutaredoxin YtnI O34639 ggt Glutathione hydrolase proenzyme P54422 bsaA Glutathione peroxidase homolog BsaA P52035 mntH Divalent metal cation transporter MntH P96593 mntD Manganese transport system membrane protein O34500 mntC Manganese transport system membrane...”
  • “...O35023 sodA Superoxide dismutase [Mn] P54375 yojM Superoxide dismutase-like protein O31851 ytnI Putative glutaredoxin YtnI O34639 Immunomodulation dltA AlanineD-alanyl carrier protein ligase P39581 dltB Teichoic acid D-alanyltransferase P39580 dltC Alanyl carrier protein P39579 dltD Protein DltD P39578 Additional stress response genes ykoL Stress response protein YKoL...”

WD0758 glutaredoxin family protein from Wolbachia endosymbiont of Drosophila melanogaster
Aligns to 3:83 / 112 (72.3%), covers 70.4% of PF05768, 29.1 bits

• Genomic evolution of the pathogenic Wolbachia strain, wMelPop
  Woolfit, Genome biology and evolution 2013
  • “...at amino acid 36 ( fig. 5 C ). Frameshift Mutation in the Ortholog of WD0758 WD0758 encodes a 112 amino acid glutaredoxin domain (GRX) protein in w Mel. GRX proteins catalyze the reduction of disulfide bonds formed in other proteins and are involved in a...”
  • “...outside of the GRX domain the effect this mutation would have on the function of WD0758 is unclear; no other GRX domain proteins are thought be encoded by w MelPop-CLA. Ten Base Pair Deletion in Ortholog of WD0413 Gene WD0413 encodes a 600 amino acid aspartyl-tRNA...”
• Wolbachia variants induce differential protection to viruses in Drosophila melanogaster: a phenotypic and phylogenomic analysis
  Chrostek, PLoS genetics 2013
  • “...C T 23 S N WD0754 ankyrin repeat-containing protein 728880 T C 48 E G WD0758 glutaredoxin family protein 732864 C G 18 G A WD0766 ankyrin repeat-containing protein 739409 T G 139 L W WD0766 ankyrin repeat-containing protein 739559 T C 189 I T WD0813...”

MTH807 thioredoxin from Methanothermobacter thermautotrophicus str. Delta H
Aligns to 4:84 / 85 (95.3%), covers 80.2% of PF05768, 28.0 bits

• Thioredoxin targets fundamental processes in a methane-producing archaeon, Methanocaldococcus jannaschii
  Susanti, Proceedings of the National Academy of Sciences of the United States of America 2014
  • “...(7, 8), where Trx1 is closely related to MTH807 (identity, 51%; similarity, 67%) and Trx2 corresponds to MTH895 (identity, 37%; similarity, 54%). Purified...”

VF_0890 glutaredoxin 1 from Vibrio fischeri ES114
VF_0890 GrxA family glutaredoxin from Aliivibrio fischeri ES114
Aligns to 2:82 / 87 (93.1%), covers 69.1% of PF05768, 27.8 bits

• Characterizing the host and symbiont proteomes in the association between the Bobtail squid, Euprymna scolopes, and the bacterium, Vibrio fischeri
  Schleicher, PloS one 2011
  • “...- putative lipoprotein 5.22 72 16 59711049 VF_0442 Pgk phosphoglycerate kinase 5.08 1747 17 59711497 VF_0890 grxA glutaredoxin 1 4.88 216 18 59710869 VF_0262 rpoA DNA-directed RNA polymerase alpha 4.84 647 19 59713778 VF_A0595 - cold shock protein 4.78 273 20 59712703 VF_2096 - hypothetical protein...”

lmo2344 similar to B. subtilis YtnI protein from Listeria monocytogenes EGD-e
Aligns to 3:82 / 88 (90.9%), covers 72.8% of PF05768, 27.8 bits

• Listeria monocytogenes GshF contributes to oxidative stress tolerance via regulation of the phosphoenolpyruvate-carbohydrate phosphotransferase system
  Chen, Microbiology spectrum 2023
  • “...Yes/up - - lmo2152 Thioredoxin lmo2191 - - 2.26 Yes/up spxA ArsC family transcriptional regulator lmo2344 - - - - lmo2344 Hypothetical protein lmo2393 2.15 Yes/up - - lmo2393 Hypothetical protein lmo2424 - - 2.18 Yes/up lmo2424 Thioredoxin lmo2426 1.60 Yes/up 1.96 Yes/up lmo2426 Hypothetical protein...”
• Oxidative lesions and post-treatment viability attenuation of listeria monocytogenes triggered by atmospheric non-thermal plasma
  Pan, Journal of applied microbiology 2022
  • “...of virulence genes ( hly ), most oxidation resistance genes (e.g. sigB , perR , lmo2344 , lmo2770 and trxA ) and DNA repair gene ( recA ) were upregulated significantly ( p <0.05). A visible fragmentation in genomic DNA and a decline in the secretion...”
  • “...) prxs F: TTGAGGAAGAAGGCGTAGCA R: GGCATAGTCCACCAGTTTGAAG 150 Encoding peroxides enzymes Dons et al.( 2014 ) lmo2344 F: ACCGACCATGATTATTTGCG R: GATTTCTGTAACAGCTTGGTAGGT 114 Encoding glutaredoxin to regulate cellular redox levels Srinivas and Gopal( 2014 ) lmo2770 F: CTGGTTGCTTATTTATTTAACTGGC R: GCTACTACCGTCTGGAAGGGAT 94 Encoding glutathione synthetase Srinivas and Gopal( 2014...”
• Deletion of glutaredoxin promotes oxidative tolerance and intracellular infection in Listeria monocytogenes
  Sun, Virulence 2019
  • “...oxidative stress. Listeria monocytogenes has been shown to encode a putative glutaredoxin, Grx (encoded by lmo2344 ), while the underlying roles remain unknown. Here we suggest an unexpected role of L. monocytogenes Grx in oxidative tolerance and intracellular infection. The recombinant Grx was able to efficiently...”
  • “...to elucidate the roles of glutaredoxin in the foodborne pathogen L. monocytogenes . L. monocytogenes lmo2344 is annotated as a putative glutaredoxin in the GenBank database. Homologs of the oxidoreductase system related genes have been identied in the sequenced genome of L. monocytogenes EGD-e via in...”
• Pyruvate carboxylase plays a crucial role in carbon metabolism of extra- and intracellularly replicating Listeria monocytogenes
  Schär, Journal of bacteriology 2010
  • “...lmo2322 lmo2335 (fruA) lmo2336 (fruB) lmo2337 lmo2343 lmo2344 lmo2345 lmo2437d lmo2522 lmo2539 (glyA) lmo2590b lmo2684c lmo2685c lmo2708 lmo2714 lmo2742d...”

AF0769 thioredoxin (trx-2) from Archaeoglobus fulgidus DSM 4304
Aligns to 1:87 / 93 (93.5%), covers 69.1% of PF05768, 27.6 bits

• Unexpected similarity in regulation between an archaeal inositol monophosphatase/fructose bisphosphatase and chloroplast fructose bisphosphatase
  Stieglitz, Protein science : a publication of the Protein Society 2003
  • “...fulgidus genome yielded three putative thioredoxins: AF1284, AF2144, and AF0769, with identities and positives of 49% and 66%, 38% and 68%, and 24% 766 Protein...”

VAS14_00891 putative glutaredoxin 1 from Vibrio angustum S14
VAS14_00891 GrxA family glutaredoxin from Photobacterium angustum S14
Aligns to 2:84 / 87 (95.4%), covers 69.1% of PF05768, 27.3 bits

• Proteome analysis of the UVB-resistant marine bacterium Photobacterium angustum S14
  Matallana-Surget, PloS one 2012
  • “...RNA-binding protein Hfq 1.46 1.69 2 3.08 0.00 1 1.54 0.00 1 3.45 0.00 1 VAS14_00891 putative glutaredoxin 1 1.47 1.04 2 1.32 1.08 2 0.94 0.00 1 1.41 1.31 2 VAS14_06208 ATP-dependent protease ATP-binding subunit 1.49 1.14 2 1.26 1.31 5 1.35 1.17 7 1.80...”
  • “...smaller abundance under UVB treatment compared with the dark control. In this study, one glutaredoxin (VAS14_00891, Table 1 ) was more abundant under UVB treatment. Disulfide bonds are required for proper protein folding and enhance protein stability and/or activity. The formation and reduction of disulfide bonds...”

A6NC05 Glutaredoxin-like protein C5orf63 from Homo sapiens
Aligns to 32:65 / 138 (24.6%), covers 34.6% of PF05768, 27.2 bits

• Proteomics Study of Peripheral Blood Mononuclear Cells in Down Syndrome Children
  Lanzillotta, Antioxidants (Basel, Switzerland) 2020
  • “...S27a P62979 HD Calreticulin P27797 HD Parkinson disease protein 7 Q99497 HD Glutaredoxin-like protein C5orf63 A6NC05 HD Over-expressed in HD T-complex protein 1 subunit beta P78371 0.3 Protein S100-A8, A9 P05109; P06702 0.26 Peptidyl-prolyl cis-trans isomerase A P62937 0.4 Unique DS Nitric oxide synthase-interacting protein Q9Y314...”

4tr0A / A8MJH2 Crystal structure of gssg-bound cgrx2 (see paper)
Aligns to 3:83 / 92 (88.0%), covers 74.1% of PF05768, 27.1 bits

• Ligand: oxidized glutathione disulfide (4tr0A)

BAB1_1879 Glutaredoxin:Thioredoxin type domain from Brucella melitensis biovar Abortus 2308
Q2YLN2 Glutaredoxin from Brucella abortus (strain 2308)
Aligns to 3:75 / 88 (83.0%), covers 60.5% of PF05768, 27.1 bits

• Proteomics-based confirmation of protein expression and correction of annotation errors in the Brucella abortus genome
  Lamontagne, BMC genomics 2010
  • “...PrfA BAB2_0459 Pgl BAB1_0544 DegT/DnrJ/EryC1/StrS BAB1_1187 Endoribonuclease BAB1_1874 LysC BAB2_0460 Zwf BAB1_0561 Man-6-P isomerase L-PSP BAB1_1879 GrxC BAB2_0483 ShuT type II BAB1_1188 GDPD BAB1_1887 HemC BAB2_0513 GcvT BAB1_0570 XylA BAB1_1205 ElaB-domain BAB1_1895 FtsK-gamma BAB2_0518 PutA BAB1_0587 Unknown BAB1_1212 BhbA BAB1_1918 LpdA-2 BAB2_0566 AldA BAB1_0588 ATP/GTP-binding BAB1_1213...”
• Comparative analysis of glutaredoxin domains from bacterial opportunistic pathogens
  Leeper, Acta crystallographica. Section F, Structural biology and crystallization communications 2011
  • “...expression and purification GLXRs from Br. melitensis and Ba. henselae (NCBI YP_415222 and YP_033241.1; UniProt Q2YLN2 and Q6G5J5; Pfam ID PF00462; EC 1.20.4.1) were cloned into a pAVA vector (Choi et al. , 2011 ) and expressed from RIL cells grown in 2l of M9 medium...”

VC1146 glutaredoxin 1 from Vibrio cholerae O1 biovar eltor str. N16961
Aligns to 2:83 / 87 (94.3%), covers 69.1% of PF05768, 27.0 bits

• The transcriptional regulator VqmA increases expression of the quorum-sensing activator HapR in Vibrio cholerae
  Liu, Journal of bacteriology 2006
  • “...synthase III Proline dehydrogenase VC0432 VC0604 VC0687 VC1146 VC1589 VC1590 VC2000 VC2087 VC2744 VC2746 VCA0136 VCA0197 VCA0657 VCA0744 VCA0745 VCA0751 VCA1073...”

JHW33_RS04425 GrxA family glutaredoxin from Rahnella aceris
Aligns to 3:84 / 88 (93.2%), covers 67.9% of PF05768, 26.8 bits

• Comparative Genomics Assisted Functional Characterization of Rahnella aceris ZF458 as a Novel Plant Growth Promoting Rhizobacterium
  Xu, Frontiers in microbiology 2022
  • “...TrxC JHW33_RS20360 WP_013574074.1 WP_013574074.1 100 WP_013574074.1 100 WP_013574074.1 100 WP_015695963.1 99 grxA GrxA family glutaredoxin JHW33_RS04425 WP_013575818.1 WP_013575818.1 100 WP_013575818.1 100 WP_013575818.1 100 WP_013575818.1 100 grxB glutaredoxin 2 JHW33_RS02700 WP_013575015.1 WP_013575015.1 100 WP_013575015.1 100 WP_013575015.1 100 WP_015696848.1 95 grxC glutaredoxin 3 JHW33_RS16070 WP_013577603.1 WP_013577603.1 100 WP_013577603.1...”

AV944_10100 thioredoxin from Sphingomonas sp. LK11
Aligns to 24:101 / 107 (72.9%), covers 85.2% of PF05768, 26.7 bits

• Complete genome sequencing and analysis of endophytic Sphingomonas sp. LK11 and its potential in plant growth
  Asaf, 3 Biotech 2018
  • “...65% (Table S3). These unique genes include glutaredoxin-related (locus AV944_14990 and AV944_14990) and thioredoxin-related (locus AV944_10100) genes, which may be responsible for maintaining a cellular redox environment and may control oxidative stress responses in LK11 as previously reported (Zeller and Klug 2006 ). In addition, the...”

P0A1P8 Glutaredoxin 1 from Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Aligns to 3:84 / 87 (94.3%), covers 67.9% of PF05768, 26.6 bits

• N-dodecanoyl-homoserine lactone influences the levels of thiol and proteins related to oxidation-reduction process in Salmonella
  de, PloS one 2018
  • “...Q8ZQX1 fldA Oxidation-reduction ND ND ND ND ND ND 9.103 1.504 9.307 1.054 Glutaredoxin 1 P0A1P8 grxA Oxidation-reduction ND ND 10.883 0.737 ND ND ND ND -0.839 0.547 Glutaredoxin 3 Q7CPH7 grxC Oxidation-reduction ND ND ND ND ND ND ND ND 8.107 1.078 Hydrogenase-3, iron-sulfur subunit...”

Z1076 glutaredoxin1 redox coenzyme for glutathione-dependent ribonucleotide reductase from Escherichia coli O157:H7 EDL933
ECs0929 glutaredoxin1 redox coenzyme for glutathione-dependent ribonucleotide reductase from Escherichia coli O157:H7 str. Sakai
Aligns to 2:83 / 85 (96.5%), covers 67.9% of PF05768, 26.5 bits

• Transcriptomic analysis reveals specific metabolic pathways of enterohemorrhagic Escherichia coli O157:H7 in bovine digestive contents
  Segura, BMC genomics 2018
  • “...NDE NDE Z4804 gntU Gnt-I system low-affinity gluconate transporter NDE 2.35 1.99E-03 NDE NDE NDE Z1076 grxA Glutaredoxin 1 2.97 1.14E-06 5.31 2.61E-19 3.99 2.46E-11 4.51 3.83E-14 4.00 2.26E-11 Z4879 hpR Phosphocarrier protein NDE NDE 2.56 5.73E-04 2.14 7.02E-03 2.32 1.63E-03 Z1389 hyaA Hydrogenase I (small...”
• Transcriptomic analysis of Escherichia coli O157:H7 and K-12 cultures exposed to inorganic and organic acids in stationary phase reveals acidulant- and strain-specific acid tolerance responses
  King, Applied and environmental microbiology 2010
  • “...b1439 ECs4871 ECs3271 ECs2412 ECs4196 ECs4523 ECs3537 ECs0645 ECs0929 ECs3331 b3942 b2392 b1705 b3345 b3648 b2674 b0606 b0849 b2469 ECs4441 ECs4043 ECs2037...”

Or search for genetic data about PF05768 in the Fitness Browser