Family Search for PF05787 (PhoX)

April 2024: See Interactive Tools for Functional Annotation of Bacterial Genomes for advice on using these tools.

PF05787 hits 58 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.

VCA0033 hypothetical protein from Vibrio cholerae O1 biovar eltor str. N16961
Aligns to 55:591 / 624 (86.1%), covers 99.8% of PF05787, 689.9 bits

• Vibrio cholerae phosphatases required for the utilization of nucleotides and extracellular DNA as phosphate sources
  McDonough, Molecular microbiology 2016
  • “...and Camilli ( 2002 ) olj386 McDonough etal . ( 2014 ) qPCR primers phoX VCA0033 qPCR F CGGTGTCACCATTGTTGAAG VCA0033 qPCR R TGATCCGACGATTACGTTCA phoB PhoBqF AGGGCTATCAGGCGGTTGAG PhoBqR TACCACCAGGCAACATCCAG cpdB cpdB qRT F AGATAAAGCCTCCGATCAAAT cpdB qRT R GATCAAATCACCGTTATCGAC ushA ushA qPCR F GTACCAGAATCAGACCTACAAGA ushA qPCR R GGATTATCAAATTCGTGGTTAC...”
• Molecular analysis of VCA1008: a putative phosphoporin of Vibrio cholerae
  Goulart, FEMS microbiology letters 2009 (PubMed)
  • “...expression of vc0719 for the response regulator PhoB, vca0033 for an alkaline phosphatase and vca1008 for an outer membrane protein (OMP). Sequences with high...”
  • “...and discussion Identification of close homologues of vc0719, vca0033 and vca1008 in V. cholerae isolates from distinct serogroups In previous works we showed...”
• Genes induced late in infection increase fitness of Vibrio cholerae after release into the environment
  Schild, Cell host & microbe 2007
  • “...hypothetical protein 3.9 ND 0.6 43.1 11.2 74.4 ND VCA0033 hypothetical protein 1.6 ND 4.2 21.8 13.9 5.2 ND VCA0043 conserved hypothetical protein 6.8 ND 2.1...”
• Identification of the gene for the monomeric alkaline phosphatase of Vibrio cholerae serogroup O1 strain
  Majumdar, Gene 2005 (PubMed)
  • “...found to be located on the hypothetical protein locus VCA0033 of chromosome II. The identity of the gene was confirmed by expressing the cloned VCA0033 locus in...”
  • “...and BLAST analysis 3.2 Cloning of the V. cholerae VCA0033 locus in phoA mutant E. coli strains 3.3 Insertional inactivation of the APase gene in V. cholerae...”

alr4794 hypothetical protein from Nostoc sp. PCC 7120
Aligns to 83:684 / 728 (82.7%), covers 98.4% of PF05787, 661.4 bits

• The Anabaena sp. PCC 7120 Exoproteome: Taking a Peek outside the Box
  Oliveira, Life (Basel, Switzerland) 2015
  • “...Alr4745 Dihydrolipoyl dehydrogenase N 2 , NO 3 , NH 4 + Energy metabolism - Alr4794 Alr4794 protein NO 3 , NH 4 + Conserved hypothetical protein Anabaena Alr4853 Aspartate aminotransferase N 2 Amino acid biosynthesis - Alr4907 Ornithine carbamoyltransferase N 2 , NO 3 ,...”

SMc02634 HYPOTHETICAL TRANSMEMBRANE PROTEIN from Sinorhizobium meliloti 1021
Aligns to 83:628 / 667 (81.9%), covers 99.8% of PF05787, 641.1 bits

• Sinorhizobium meliloti phospholipase C required for lipid remodeling during phosphorus limitation
  Zavaleta-Pastor, Proceedings of the National Academy of Sciences of the United States of America 2010
  • “...smb20094, and smc04448. Also, four genes (smc00620, smc02634, smc01907, and smc00171) encoding putative phosphatases are strongly induced under Pi limitation in...”
  • “...PHO02634 (deficient in smb20094, smc04448, smc00620, or smc02634, respectively) degraded zwitterionic phospholipids similarly to the wild-type and formed DGTS...”
• Genome prediction of PhoB regulated promoters in Sinorhizobium meliloti and twelve proteobacteria
  Yuan, Nucleic acids research 2006
  • “...CTGTCATAAATGTTTCAC 115 0.72 9 SMc02174 Overlap a TTGTGAACGATCTGTCGC 76 0.36 Hypothetical transmembrane protein *1 10 Smc02634 Overlap a,b TTGTCGCAGAGCTGTCAT 77 0.56 phoA3 , putative alkaline phosphatase *2 11 Smc03124 Overlap a,b CTGTCACGAAAGTTTCAC 93 0.44 Putative ABC transporter periplasmic binding *5 12 SMc03243 Overlap a,b CTGTAAAGCCGCTGACAT 64...”
  • “...alkaline phosphatase CTGTCGCCAAACCGTCCG 97 0.37 2 Smc01907 CTGTCATCCAGCTGTTAC 82 0.72 S.meliloti Hypothetical transmembrane protein 3 Smc02634 TTGTCGCAGAGCTGTCAT 77 0.56 S.meliloti Hypothetical protein, phosphatase 4 Atu1263 ATGTCATGCCACTGTCAC 51 0.59 A.tumefaciens Conserved hypothetical protein 5 BMEII0655 CCGTCATTCCTGTGTAAT 53 0.38 B.melitensis phoA , alkaline phosphatase 6 BR1200 CTGTCACACGCCTGCAAT 80...”
• sinI- and expR-dependent quorum sensing in Sinorhizobium meliloti
  Gao, Journal of bacteriology 2005
  • “...SMc02094 SMc02156 SMc02365 SMc02378 SMc02465 SMc02562 SMc02562 SMc02562 SMc02634 SMc02689 SMc02857 SMc02857 SMc02896 SMc02898 SMc03061 52 23 50 16 22 18 49 38...”
  • “...(MocB, IlvE1, KdsB, and the protein corresponding to Smc02634) were significantly affected by the addition of C14-HSL and/or C16:1 HSL (Table 2). These results...”
• Role of the regulatory gene rirA in the transcriptional response of Sinorhizobium meliloti to iron limitation
  Chao, Applied and environmental microbiology 2005
  • “...SMc01319 SMc01326 SMc01469 SMc01842 SMc01847 SMc02392 SMc02634 SMc03004 SMc03005 SMc03007 SMc03008 SMc03009 SMc03012 SMc03013 SMc03017 SMc03021 SMc03022...”
• Proteomic analysis of wild-type Sinorhizobium meliloti responses to N-acyl homoserine lactone quorum-sensing signals and the transition to stationary phase
  Chen, Journal of bacteriology 2003
  • “...SMc02408 SMc02495 SMc02499 SMc02508 SMc02509 SMc02510 SMc02634 SMc02692 SMc02774 SMc02873 SMc02857 SMc02857 SMc02857 SMc03061 SMa0312 SMc03157 SMc03233 SMc03786...”

PA2635 hypothetical protein from Pseudomonas aeruginosa PAO1
Aligns to 84:636 / 672 (82.3%), covers 99.8% of PF05787, 626.7 bits

• Unsupervised Machine Learning Organization of the Functional Dark Proteome of Gram-Negative "Superbugs": Six Protein Clusters Amenable for Distinct Scientific Applications
  Sicilia, ACS omega 2022
  • “...PA4535 0.00198 0.637 0.984 100.00 DUF1780 2 PA3463 0 0.850 0.980 100.00 succinate medium 3 PA2635 0.00108 0.735 0.929 87.05 DUF839 6 PA1624 0.00137 0.612 0.815 93.28 DUF4892 6 PA5545 0.00225 0.751 0.941 91.85 Examples of Uncharacterized Vaccine Antigen Candidates Another potential application of HPs is...”
• Targeting the Pseudomonas aeruginosa Virulence Factor Phospholipase C With Engineered Liposomes
  Wolfmeier, Frontiers in microbiology 2022
  • “...oprI PALES_22111 9 PA2853 Putative aminopeptidase n.a. PALES_21241 58 PA2939 Putative phosphatase n.a. PALES_24701 74 PA2635 Pyrophosphate-specific outer membrane porin OprO oprO PALES_17861 48 PA3290 n.a., not available. Figure 2 Pseudomonas aeruginosa supernatant-induced hemolysis is attenuated by the removal of phospholipase C and supernatants pre-incubated with...”
• Tobramycin reduces key virulence determinants in the proteome of Pseudomonas aeruginosa outer membrane vesicles
  Koeppen, PloS one 2019
  • “...FliC, FliD, LasA, LasB, LipA, PA2939, PasP, PepA, Piv, PlcN Flagellar FliC, FliD Unknown PA1324, PA2635, PA3922, PA4139, PA4140 Subcellular localization annotations were retrieved from Pseudomonas Genome Database ( http://www.pseudomonas.com/localizations/list ). Proteins can be associated with multiple subcellular localizations. Differential abundance of proteins in Tobi OMVs...”
• Genome wide identification and experimental validation of Pseudomonas aeruginosa Tat substrates
  Gimenez, Scientific reports 2018
  • “...SRR S F IR LAAGTVGATVATSML PSSIQA* PA14_22560 PA3222 MN RR SA L AALHGGALLFGLT GVFGKLASA* PA14_30040 PA2635 MSLEKKDAILFGDGDELPSNHSNNPHMNDLIAGLG RR Q 8V L AGGAALGALAFLG VALPASA* PA14_31820 PA2531 MPAL SRR S F VTLTALASSSILLS PRAFA* PA14_33720 PA2394 d MND RR T FLK QAGILAAGL PLLSAAQSLRA* PA14_33740 PA2392 d MTV SRR G...”
  • “...RR SA L AALHGGALLFGLT GVFGKLASA* Permease None predicted Membrane proteins Unknown 31 This work PA14_30040 PA2635 MSLEKKDAILFGDGDELPSNHSNNPHMNDLIAGLG RR Q V L AGGAALGALAFLG VALPASA* Hypothetical protein None predicted Hypothetical, unclassified, unknown Unknown 73.8 This work PA14_34510 PA2328 MCLDDPTH SRR DI LK LAALLSAAGAL PLLSSLQARA* Hypothetical protein None predicted...”
• Reorganization of gene network for degradation of polycyclic aromatic hydrocarbons (PAHs) in Pseudomonas aeruginosa PAO1 under several conditions
  Yan, Journal of applied genetics 2017
  • “...Interestingly, it did not act alone, but with eight other genes (PA0470, PA0863, PA1417, PA2494, PA2635, PA3502, PA4649, and PA4660), i.e., these eight genes changed their membership from the light green cluster to the black one ( Supplementary materials ). Of these eight genes, PA0470 encodes...”
  • “...multidrug efflux transporter MexF, and PA4660 encodes a deoxyribodipyrimidine photolyase, while the functions of PA1417, PA2635, PA3502, and PA4649 are unknown. Therefore, we can not only postulate that PA0247 initiation needs the transporter, receptor, oxidoreductase and photolyase, but also have the clue for the function of...”
• Pseudomonas aeruginosa GroEL Stimulates Production of PTX3 by Activating the NF-κB Pathway and Simultaneously Downregulating MicroRNA-9
  Shin, Infection and immunity 2017
  • “...used as a control (CON). thetical proteins (PA0572 and PA2635). To evaluate their potential to induce expression of PTX3, these proteins (but not PlcN) were...”
  • “...to treat THP-1 cells. We were unable to purify PA2635 due to the formation of inclusion bodies. In these assays, GroEL was identified as the most active...”
• Coexistence and within-host evolution of diversified lineages of hypermutable Pseudomonas aeruginosa in long-term cystic fibrosis infections
  Feliziani, PLoS genetics 2014
  • “...6 2 4 PA0788 5 0 5 PA2077 5 1 4 PA2151 5 2 3 PA2635 5 1 4 PA3728 5 2 3 PA4735 5 3 2 PA4836 5 1 4 a The categories used for functional classification were as described in the The Pseudomonas aeruginosa...”
• New microbicidal functions of tracheal glands: defective anti-infectious response to Pseudomonas aeruginosa in cystic fibrosis
  Bastonero, PloS one 2009
  • “...PA4761 DnaK protein 68 ++ 6 PA3319 PlcN non-hemolytic phospholipase C precursor 77 ++ 7 PA2635 Hypothetical protein PhoX, predicted phosphatase 74 ++ 8 PA0347 GlpQ glycerophosphoryl diester phosphodiesterase, periplasmic 42 ++ 9 PA5369 PstS phosphate ABC transporter, periplasmic phosphate-binding protein, PstS 34 ++ 10 and...”
• More

PA14_30040 putative phosphatase from Pseudomonas aeruginosa UCBPP-PA14
Aligns to 84:636 / 672 (82.3%), covers 99.8% of PF05787, 625.8 bits

• Genome wide identification and experimental validation of Pseudomonas aeruginosa Tat substrates
  Gimenez, Scientific reports 2018
  • “...MISK SRR S F IR LAAGTVGATVATSML PSSIQA* PA14_22560 PA3222 MN RR SA L AALHGGALLFGLT GVFGKLASA* PA14_30040 PA2635 MSLEKKDAILFGDGDELPSNHSNNPHMNDLIAGLG RR Q 8V L AGGAALGALAFLG VALPASA* PA14_31820 PA2531 MPAL SRR S F VTLTALASSSILLS PRAFA* PA14_33720 PA2394 d MND RR T FLK QAGILAAGL PLLSAAQSLRA* PA14_33740 PA2392 d MTV SRR...”
  • “...MN RR SA L AALHGGALLFGLT GVFGKLASA* Permease None predicted Membrane proteins Unknown 31 This work PA14_30040 PA2635 MSLEKKDAILFGDGDELPSNHSNNPHMNDLIAGLG RR Q V L AGGAALGALAFLG VALPASA* Hypothetical protein None predicted Hypothetical, unclassified, unknown Unknown 73.8 This work PA14_34510 PA2328 MCLDDPTH SRR DI LK LAALLSAAGAL PLLSSLQARA* Hypothetical protein None...”

PSF113_5402 PhoX family phosphatase from Pseudomonas ogarae
Aligns to 58:600 / 631 (86.1%), covers 99.6% of PF05787, 617.1 bits

• Genome sequence reveals that Pseudomonas fluorescens F113 possesses a large and diverse array of systems for rhizosphere function and host interaction
  Redondo-Nieto, BMC genomics 2013
  • “...of specific enzymes, such as the homologues of the alkaline phosphatases PhoD (PSF113_0888) and PhoX (PSF113_5402) of P. fluorescens Pf0-1 [ 39 ] and a beta-propeller phytase (PSF113_2886) [ 40 ]. Altogether, these traits could contribute to mobilization of insoluble soil phosphate into bioavailable forms that...”

4a9vA / Q3K5N8 Pseudomonas fluorescens phox (see paper)
Aligns to 4:546 / 581 (93.5%), covers 99.8% of PF05787, 609.0 bits

• Ligands: calcium ion; mu-oxo-diiron (4a9vA)

Q3K5N8 Transcriptional initiation protein Tat from Pseudomonas fluorescens (strain Pf0-1)
Aligns to 58:600 / 633 (85.8%), covers 99.8% of PF05787, 608.5 bits

• In Vitro and in Silico Evidence of Phosphatase Diversity in the Biomineralizing Bacterium Ramlibacter tataouinensis
  Skouri-Panet, Frontiers in microbiology 2017
  • “...P42251 (583) COG3540 [22539]; cd07389 [174468] 2yeqA Rodriguez et al., 2014 PhoX Pseudomonas fluorescens Pf0-1 Q3K5N8 (633) COG3211 [17633] 4alfA Yong et al., 2014 PhoN Salmonella typhimurium Q8KRU6 (250) cd03397 [8233]; smart00014 [109217] 2a96A Makde et al., 2007 AphA Escherichia coli K12 P0AE22 (237) PRK11009 [1237]...”

SCO3790 hypothetical protein from Streptomyces coelicolor A3(2)
Q9F2J1 PhoX family protein from Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Aligns to 105:653 / 692 (79.3%), covers 99.8% of PF05787, 606.7 bits

• Multi-omics Study of Planobispora rosea, Producer of the Thiopeptide Antibiotic GE2270A
  Del, mSystems 2021
  • “...phosphatase phoA SCO2286 Activation C EV45_RS14855 Alkaline phosphatase Activation C EV45_RS34915 TAT-secreted putative phosphatase (DUF839) SCO3790 Activation C EV45_RS33230 RNA degradosome polyphosphate kinase ppk SCO4145 Activation C EV45_RS33235 NUDIX hydrolase SCO4143 Activation C EV45_RS15230 Hypothetical protein SCO4877 Activation C EV45_RS15235 Glycosyltransferase family 2 protein SCO4878 Activation...”
• Comparative proteomic analysis of Streptomyces lividans Wild-Type and ppk mutant strains reveals the importance of storage lipids for antibiotic biosynthesis
  Le, Applied and environmental microbiology 2013
  • “...176 229 56 63 Up Up 4 4 SCO3409 SCO3790 Q9X8I9 Q9F2J1 19/4.8 75/6.2 214 244 59 33 Down Down 3 4 Inositol-5-monophosphate dehydrogenase Polynucleotide...”
  • “...are PhoX, a presumed secreted phosphatase encoded by sco3790 (31, 32), an inorganic pyrophosphatase encoded by sco0118 (33, 34), and the putative...”
• Extracting regulator activity profiles by integration of de novo motifs and expression data: characterizing key regulators of nutrient depletion responses in Streptomyces coelicolor
  Iqbal, Nucleic acids research 2012
  • “...the high affinity phosphate transporter pst operon (SCO4139-42), SCO1393 which encodes for an acetoacetyl-CoA synthetase, SCO3790 a conserved hypothetical protein and SCO1906 a secreted protein. The activity profile has a high correlation to the three regulators PhoP (SCO4230), PhoU (SCO4228), AraC (SCO0466), ( r =0.83, 0.84...”
• Metabolic switches and adaptations deduced from the proteomes of Streptomyces coelicolor wild type and phoP mutant grown in batch culture
  Thomas, Molecular & cellular proteomics : MCP 2012
  • “...(encoded by SCO1565, glpQ1; SCO1968, glpQ2; SCO4151; and SCO3790) and two alkaline phosphatase-like proteins (SCO2068 and SCO2286) were observed only in the...”
• Cross-talk of global nutritional regulators in the control of primary and secondary metabolism in Streptomyces
  Martín, Microbial biotechnology 2011
  • “...; Makarewicz etal ., 2006 ). Other genes encoding putative phosphate scavengers are SCO1906 , SCO3790 and SCO4152 . Both SCO1906 and SCO3790 encode putative secreted phosphatases (other than PhoA and PhoC) and their promoters are bound by PhoP ( RodrguezGarca etal ., 2007 ; SolaLanda...”
  • “...of the alkaline phosphatases phoA and phoD , other two putative phosphatases ( SCO1906 and SCO3790 ), a putative phytase ( Apel etal ., 2007 ; SolaLanda etal ., 2008 ) and two glpQ genes ( SantosBeneit etal ., 2009b ). The DRus are boxed, and...”
• Target genes and structure of the direct repeats in the DNA-binding sequences of the response regulator PhoP in Streptomyces coelicolor
  Sola-Landa, Nucleic acids research 2008
  • “..., secreted alkaline phosphatase CC 1 e Coding 128 103 AA >0.25 Activation e SCO3790-1 SCO3790, putative phosphatase CC 1 Coding 79 N.D. 0D 0.165 Activation SCO4142 pstS , Pst transporter, phosphate-binding component (EE) CC 1 f Coding 114 39 A0 <0.000 Activation f SCO6169-70 SCO6169,...”
  • “...ironsulphur protein), SCO1394 (a possible glycosyl hydrolase), SCO1854 (a possible integral membrane protein), SCO1906 and SCO3790 (putative phosphatases different from phoA , phoC , phoD ), SCO1993 (an unknown protein), SCO2262 (a possible oxidoreductase), SCO2620 (a probable cell division trigger factor), SCO4451 (a probable export protein),...”
• Genome-wide transcriptome analysis reveals that a pleiotropic antibiotic regulator, AfsS, modulates nutritional stress response in Streptomyces coelicolor A3(2)
  Lian, BMC genomics 2008
  • “...(Tat) dependent exported proteins ( SCO1196 , SCO1565 , SCO1633 , SCO1906 , SCO2286 , SCO3790 , SCO6691 and SCO7631 ) identified in an earlier study [ 24 ] also belonged to this category. Several other genes encoding secreted proteins, nucleases and other hypothetical proteins were...”
  • “...SCO2764 Putative lipoprotein. 0.15 SCO2878 Hypothetical protein 0.32 SCO3789 Endonuclease, exonuclease, phosphatase family protein 0.10 SCO3790 Conserved hypothetical protein 0.35 SCO4139 Phosphate ABC transport system ATP-binding protein ( pstB ) 0.32 SCO4140 Phosphate ABC transport system permease protein ( pstA ) 0.36 SCO4141 phosphate ABC transport...”
• Uncovering genes with divergent mRNA-protein dynamics in Streptomyces coelicolor
  Jayapal, PloS one 2008
  • “...SCO4139; PstS, SCO4142; NeuB, SCO4881; RegX3, SCO4230; a phosphate transporter, SCO4228; alkaline phosphatase, SCO2286; SCO1906; SCO3790; SCO5140 and SCO7631) were strongly correlated with PC-1 of both proteins and mRNA. These genes also generally had a high positive value along PC-2, indicating a transient up-regulatory trend. Identification...”
• More
• Comparative proteomic analysis of Streptomyces lividans Wild-Type and ppk mutant strains reveals the importance of storage lipids for antibiotic biosynthesis
  Le, Applied and environmental microbiology 2013
  • “...63 Up Up 4 4 SCO3409 SCO3790 Q9X8I9 Q9F2J1 19/4.8 75/6.2 214 244 59 33 Down Down 3 4 Inositol-5-monophosphate dehydrogenase Polynucleotide phosphorylase/...”

Achr_19350 PhoX family phosphatase from Azotobacter chroococcum NCIMB 8003
Aligns to 74:626 / 662 (83.5%), covers 99.8% of PF05787, 603.8 bits

• Holistic view of biological nitrogen fixation and phosphorus mobilization in Azotobacter chroococcum NCIMB 8003
  Biełło, Frontiers in microbiology 2023
  • “...phosphorus metabolism ( Figure 4 ), a high induction of the PhoX domain-containing protein A0A0C4WPA0 (Achr_19350) was observed. This is an uncharacterized protein (according to KEGG annotation) or a Tat pathway signal protein (according to Uniprot) with unknown location according to PsortB. However, a PhoX domain...”
  • “...are not annotated with this function, such as the previously mentioned PhoX domain-containing proteins A0A0C4WPA0 (Achr_19350) and A0A0C4WQL9 (Achr_36110) and the PhoD domain contain protein A0A0C4WU22 (Achr_24780). The alkaline phosphatase PhoX Achr_19350 (A0A0C4WPA0) was the most abundant in the FP conditions and the exopolyphosphatase Achr_36790 (A0A0C4WTQ1)...”

PFLU5618 hypothetical protein from Pseudomonas fluorescens SBW25
Aligns to 57:599 / 632 (85.9%), covers 99.8% of PF05787, 593.8 bits

• Rapid decline of adaptation of Pseudomonas fluorescens to soil biotic environment
  Gómez, Biology letters 2022
  • “...regulation biological process 0 0 0 0 1 0 0 0 0 0 0 0 PFLU5618 hypothetical protein unknown predicted phosphatase resource utilization 0 0 0 0 0 0 0 1 0 0 0 0 cyaA adenylate cyclase cytoplasmic membrane adenylate cyclase resource utilization 0 0...”

PSPTO0491, PSPTO_0491 Tat (twin-arginine translocation) pathway signal sequence domain protein from Pseudomonas syringae pv. tomato str. DC3000
Aligns to 63:605 / 638 (85.1%), covers 99.8% of PF05787, 589.1 bits

• Proteomic Profiling Reveals Distinct Bacterial Extracellular Vesicle Subpopulations with Possibly Unique Functionality
  McMillan, Applied and environmental microbiology 2023 (secret)
• Identification of a twin-arginine translocation system in Pseudomonas syringae pv. tomato DC3000 and its contribution to pathogenicity and fitness
  Bronstein, Journal of bacteriology 2005
  • “...identified in silico No. PSPTO0249 PSPTO0315 PSPTO0491 PSPTO0738 PSPTO0759 PSPTO0857 PSPTO0985a PSPTO1010 PSPTO1023 PSPTO1164 PSPTO1212 PSPTO1309 PSPTO1340...”

PSE_1012 PhoX family phosphatase from Pseudovibrio sp. FO-BEG1
Aligns to 73:607 / 633 (84.5%), covers 99.8% of PF05787, 572.7 bits

• Phosphate Limitation Triggers the Dissolution of Precipitated Iron by the Marine Bacterium Pseudovibrio sp. FO-BEG1
  Romano, Frontiers in microbiology 2017
  • “...). In the genome of Pseudovibrio sp. FO-BEG1 different APs, including PhoA (PSE_2813) and PhoX (PSE_1012), and phosphonate degrading enzymes are encoded. Consistent with the P i starvation response described in other bacteria, under P i limitation we detect an increase in the APs activity and...”
• Phosphate Limitation Induces Drastic Physiological Changes, Virulence-Related Gene Expression, and Secondary Metabolite Production in Pseudovibrio sp. Strain FO-BEG1
  Romano, Applied and environmental microbiology 2015
  • “...APs were identified in the genome of FOBEG1 (e.g., PSE_1012 and PSE_2813), but none were quantified during the proteomic analysis. APs are enzymes that cleave...”

SPO1860 PhoX family phosphatase from Ruegeria pomeroyi DSS-3
Aligns to 67:596 / 627 (84.5%), covers 99.8% of PF05787, 571.3 bits

• Transcriptional changes underlying elemental stoichiometry shifts in a marine heterotrophic bacterium
  Chan, Frontiers in microbiology 2012
  • “...protein ( phnK ) 10.9 SPO0781 Phosphonate ABC transporter, periplasmic phosphonate-binding ( phnD ) 103.5 SPO1860 Alkaline phosphatase ( phoX ) 7.4 SPO1948 Phosphate ABC transporter, periplasmic binding protein ( pstS ) 47.9 SPO1949 Phosphate ABC transporter, permease protein ( pstC ) 4.7 SPO1951 Phosphate transporter...”
  • “...protein 103.5 SPO1227 Hypothetical protein 3.2 SPO1504 pqqA Coenzyme PQQ biosynthesis protein A 5.1 4.7 SPO1860 Twin-arginine translocation pathway signal sequence domain-containing protein 7.4 SPO1928 Tat pathway signal sequence domain-containing protein 3.5 0.7 SPO1948 pstS Phosphate ABC transporter, periplasmic binding protein 47.9 SPO1949 pstC Phosphate ABC...”

C9Z8S0 Phosphatase from Streptomyces scabiei (strain 87.22)
Aligns to 107:655 / 694 (79.1%), covers 99.8% of PF05787, 570.8 bits

• Comparative secretome analysis of Streptomyces scabiei during growth in the presence or absence of potato suberin
  Komeil, Proteome science 2014
  • “...lactamase 0.010.01 0.030.04 0.050.03 C9Z6S2 SCAB_27611 d Phage tail sheath protein FI nd 0.030.01 0.090.05 C9Z8S0 SCAB_44821 d Phosphatase 0.030.05 0.000.01 nd C9Z994 SCAB_61611 d Protease 0.050.04 0.140.03 0.030.03 C9ZAQ7 SCAB_61831 d Metalloendopeptidase nd nd 0.030.03 C9ZAU3 SCAB_62211 Phosphatase nd 0.110.05 0.170.07 C9ZDW7 SCAB_63921 d Dehydratase...”

NSP_RS05800 PhoX family phosphatase from Nodularia spumigena CCY9414
Aligns to 83:700 / 743 (83.2%), covers 98.8% of PF05787, 567.0 bits

• Acclimation of Nodularia spumigena CCY9414 to inorganic phosphate limitation - Identification of the P-limitation stimulon via RNA-seq
  Santoro, Frontiers in microbiology 2022
  • “...nsp12930 NSP_RS05790 Cation diffusion facilitator family transporter 7.14 0.16 4.97 0.32 2.74 0.23 904 nsp12940 NSP_RS05800 PhoX-like phosphatase 7.02 0.17 5.41 0.14 2.84 0.14 905 nsp18960 NSP_RS08485 Putative PhoX phosphatase, DUF839 domain-containing protein 6.28 0.15 5.69 0.15 1.36 0.17 1304 nsp29340 NSP_RS12935 Metallophosphoesterase 1.82 0.41 0.67...”

CYA_1696 hypothetical protein from Synechococcus sp. JA-3-3Ab
Aligns to 73:639 / 686 (82.7%), covers 99.8% of PF05787, 563.2 bits

• Phosphorus deprivation responses and phosphonate utilization in a thermophilic Synechococcus sp. from microbial mats
  Adams, Journal of bacteriology 2008
  • “...also encode a putative extracellular alkaline phosphatase, PhoX (CYA_1696 and CYB_ 1988), which is most similar to the PhoX of the marine, gammaproteobacterium...”

A1C3J6 alkaline phosphatase (EC 3.1.3.1) from Pasteurella multocida (see paper)
Aligns to 70:603 / 647 (82.5%), covers 99.8% of PF05787, 563.0 bits

Rta_14460 PhoX family phosphatase from Ramlibacter tataouinensis TTB310
F5Y472 Tat pathway signal protein from Ramlibacter tataouinensis (strain ATCC BAA-407 / DSM 14655 / LMG 21543 / TTB310)
Aligns to 60:599 / 643 (84.0%), covers 99.8% of PF05787, 562.4 bits

• In Vitro and in Silico Evidence of Phosphatase Diversity in the Biomineralizing Bacterium Ramlibacter tataouinensis
  Skouri-Panet, Frontiers in microbiology 2017
  • “...TF name Upstream sequence positions p -value PhoD Rta_17200 D 1805367 1806959 148 19 PhoX1 Rta_14460 R 1514607 1512676 109 21 PhoX2 Rta_37610 R 4006412 4004532 74* 200 PhoX3 Rta_37000 R 3936191 3933921 114 188 PhoB [96, 81] 5.3e-05 Fur [18, 1] 2.3e-05 PhoX4 Rta_01350 R...”
• In Vitro and in Silico Evidence of Phosphatase Diversity in the Biomineralizing Bacterium Ramlibacter tataouinensis
  Skouri-Panet, Frontiers in microbiology 2017
  • “...pI PhoD F5XVP7 530 Extracellular L = 31, Tat signal 58.8 (55.5) 7.3 (6.9) PhoX1 F5Y472 643 Cytoplasmic L = 51, Tat signal 69.5 (64.1) 6.3 (6.3) PhoX2 F5Y2Z6 626 Non-cytoplasmic L = 50, Tat signal 67.2 (62.3) 9.3 (9.2) PhoX3 F5Y248 756 Non-cytoplasmic L =...”

F5Y2Z6 Tat pathway signal protein from Ramlibacter tataouinensis (strain ATCC BAA-407 / DSM 14655 / LMG 21543 / TTB310)
Aligns to 56:586 / 626 (84.8%), covers 99.8% of PF05787, 562.3 bits

• In Vitro and in Silico Evidence of Phosphatase Diversity in the Biomineralizing Bacterium Ramlibacter tataouinensis
  Skouri-Panet, Frontiers in microbiology 2017
  • “...(6.9) PhoX1 F5Y472 643 Cytoplasmic L = 51, Tat signal 69.5 (64.1) 6.3 (6.3) PhoX2 F5Y2Z6 626 Non-cytoplasmic L = 50, Tat signal 67.2 (62.3) 9.3 (9.2) PhoX3 F5Y248 756 Non-cytoplasmic L = 67, Tat signal 80.4 (73.7) 5.4 (5.6) PhoX4 F5Y3B1 458 Non-cytoplasmic L =...”

Rta_37610 PhoX family phosphatase from Ramlibacter tataouinensis TTB310
Aligns to 63:593 / 633 (83.9%), covers 99.8% of PF05787, 562.3 bits

• In Vitro and in Silico Evidence of Phosphatase Diversity in the Biomineralizing Bacterium Ramlibacter tataouinensis
  Skouri-Panet, Frontiers in microbiology 2017
  • “...PhoD Rta_17200 D 1805367 1806959 148 19 PhoX1 Rta_14460 R 1514607 1512676 109 21 PhoX2 Rta_37610 R 4006412 4004532 74* 200 PhoX3 Rta_37000 R 3936191 3933921 114 188 PhoB [96, 81] 5.3e-05 Fur [18, 1] 2.3e-05 PhoX4 Rta_01350 R 134200 132824 416 48 FadR [173, 158]...”

EV45_RS34915 PhoX family phosphatase from Planobispora rosea
Aligns to 93:642 / 681 (80.8%), covers 99.8% of PF05787, 560.5 bits

• Multi-omics Study of Planobispora rosea, Producer of the Thiopeptide Antibiotic GE2270A
  Del, mSystems 2021
  • “...SCO2068 Activation C EV45_RS22905 Alkaline phosphatase phoA SCO2286 Activation C EV45_RS14855 Alkaline phosphatase Activation C EV45_RS34915 TAT-secreted putative phosphatase (DUF839) SCO3790 Activation C EV45_RS33230 RNA degradosome polyphosphate kinase ppk SCO4145 Activation C EV45_RS33235 NUDIX hydrolase SCO4143 Activation C EV45_RS15230 Hypothetical protein SCO4877 Activation C EV45_RS15235 Glycosyltransferase...”

CYB_1988 hypothetical protein from Synechococcus sp. JA-2-3B'a(2-13)
Aligns to 73:639 / 682 (83.1%), covers 99.8% of PF05787, 558.7 bits

• Role of polyphosphate in thermophilic Synechococcus sp. from microbial mats
  Gomez-Garcia, Journal of bacteriology 2013
  • “...included periplasmic phosphatases such as PhoX (CYB_1988) and phosphate transporters (CYB_1074-CYB_1077 and CYB_1912-CYB_1915). Because the Synechococcus OS-B=...”
  • “...the construct CYB_0858 CYB_2856 CYB_1493 CYB_0159 CYB_1076 CYB_1988 CYB_1794 CYB_1795 CYB_1796 CYB_1797 CYB_2082 CYB_0017 M, Y, and V are ambiguous bases...”
• Phosphorus deprivation responses and phosphonate utilization in a thermophilic Synechococcus sp. from microbial mats
  Adams, Journal of bacteriology 2008
  • “...regulon transcripts of OS-Ba Size Gene CYB_1198 CYB_0684 CYB_1988 CYB_1077 CYB_1915 CYB_0159 CYB_0160 CYB_1467 CYB_0164 CYB_0165 nt aa 1,349 1,727 2,048 1,076...”
  • “...of gene(s) Locus tag CYB_0858 CYB_2856 CYB_1198 CYB_1988 CYB_0684 CYB_0884 CYB_1427 CYB_2320 CYB_0274 CYB_2765 CYB_1493 CYB_2082 CYB_1077-74 pstS-2, pstC-2,...”

CJM1_0145 PhoX family phosphatase from Campylobacter jejuni subsp. jejuni M1
Aligns to 35:562 / 593 (89.0%), covers 99.8% of PF05787, 548.3 bits

• Campylobacter jejuni transcriptome changes during loss of culturability in water
  Bronowski, PloS one 2017
  • “...active, providing Campylobacter with that vital energy source, inorganic phosphate (Pi). The gene encoding PhoX (CJM1_0145) was significantly upregulated at Time 0 compared to the MHB control. Motility and chemotaxis We observed the upregulation of many flagellar assembly genes across all experimental conditions ( Fig 5...”

MED193_05784 hypothetical protein from Roseobacter sp. MED193
A3X8H3 dTDP-glucose 4,6-dehydratase from Roseobacter sp. MED193
Aligns to 83:627 / 676 (80.6%), covers 99.8% of PF05787, 547.1 bits

• Bacterial catabolism of membrane phospholipids links marine biogeochemical cycles
  Westermann, Science advances 2023
  • “...4.35 5.96 N/D N/D MED193_04067 A3XBN7 PhoR Sensor histidine kinase ++ 4.50 0.04 N/D N/D MED193_05784 A3X8H3 PhoX-type I Extracellular phosphatase ++ 4.25 2.24 -0.45 0.00 MED193_06579 A3X815 GlpQ-1 Extracellular glycerophosphoryl diester phosphodiesterase ++ 4.55 3.37 N/D N/D MED193_07818 A3X9L3 Putative G3P ABC transporter, periplasmic substrate...”
  • “...is active toward PE and PC and contributes toward cleavage in vivo Given that PhoX (MED193_05784) appears to be the sole extracellular phosphatase produced by Phaeobacter , and Phaeobacter does not have genes to encode the extracellular phosphatases PhoA or PhoD (table S3), we sought to...”
• Bacterial catabolism of membrane phospholipids links marine biogeochemical cycles
  Westermann, Science advances 2023
  • “...5.96 N/D N/D MED193_04067 A3XBN7 PhoR Sensor histidine kinase ++ 4.50 0.04 N/D N/D MED193_05784 A3X8H3 PhoX-type I Extracellular phosphatase ++ 4.25 2.24 -0.45 0.00 MED193_06579 A3X815 GlpQ-1 Extracellular glycerophosphoryl diester phosphodiesterase ++ 4.55 3.37 N/D N/D MED193_07818 A3X9L3 Putative G3P ABC transporter, periplasmic substrate binding...”

Cj0145 hypothetical protein Cj0145 from Campylobacter jejuni subsp. jejuni NCTC 11168
Aligns to 35:562 / 593 (89.0%), covers 99.8% of PF05787, 547.0 bits

• Campylobacter jejuni genotypes are associated with post-infection irritable bowel syndrome in humans
  Peters, Communications biology 2021
  • “...that allow C. jejuni to sense environmental signals and aid bacterial invasion 54 . The Cj0145 ( phoA ) gene is located immediately downstream of tlp2 and induced in the presence of iron, likely regulating cytoplasmic iron levels 53 . It also shows homology with Vibrio...”
• Transducer-Like Protein in Campylobacter jejuni With a Role in Mediating Chemotaxis to Iron and Phosphate
  Chandrashekhar, Frontiers in microbiology 2018
  • “...uptake regulator (Fur) protein ( Butcher et al., 2012 ). The study also revealed that cj0145 ( phoX ), a gene located immediately downstream of tlp2, is induced in the presence of iron although the specific mechanism of regulation is still unexplored ( Butcher et al.,...”
  • “...of 135 base pairs (Figure 3A ). Additionally, a previous study indicated that phoX gene (Cj0145), located immediately downstream of tlp2, is induced by iron and was also enriched in the CjFur ChIP-chip assay ( Butcher et al., 2012 ). As the tlp2 mutant is defective...”
• Avian Intestinal Mucus Modulates Campylobacter jejuni Gene Expression in a Host-Specific Manner
  Looft, Frontiers in microbiology 2018
  • “...mucus. Antisense RNA (fold change) Sense gene(s) (fold change) Genome position relative to antisense RNA Cj0145 (4.9) ** trxB (7.2) ** 1 trxA (4.6) trxB (7.2) ** 1 cfbpA (16) * cfbpA (19) * 0 Cj0176c (14.7) * 1 Cj0177 (137) * 2 Cj0178 (73.8) *...”
• Genomic insights from whole genome sequencing of four clonal outbreak Campylobacter jejuni assessed within the global C. jejuni population
  Clark, BMC genomics 2016
  • “...target Primer location Primer name Primer sequence (5-3) Inversion (93kb) cj0143c Cj-F1 ATGCTTGAGGTGCTATACTGACAC Inversion (93kb) cj0145 Cj-R1 CCTTATCCTTAAGCATAGCAGCAC Inversion (93kb) cj0261c Cj-F2 ACCCCAGTTCCACATCCTATATC Inversion (93kb) cj0263 (zupT) Cj-R2 TGGTAAATTGGCAAACTCACAG Inversion (388 kb) cj0261c CjInv5F ACCCCAGTTCCACATCC Inversion (388 kb) cj15621563 CjInv5R AACCCATCGACTTCATTTG Plasmid cpp50 cpp50tetOF1 GAACTTTACTTGCACGGAATGGAG Plasmid...”
• The Campylobacter jejuni RacRS two-component system activates the glutamate synthesis by directly upregulating γ-glutamyltranspeptidase (GGT)
  van, Frontiers in microbiology 2015
  • “...three independent experiments. Gel Mobility Shift Assay The promoter regions upstream of ggt , phoX (Cj0145), and Cj0200c were amplified by PCR using Dreamtaq polymerase (Thermo) and one of the primers sets GGTpromDIG/GGT204, GGTpromDIG/GGT104, GGTpromDIG/GGT69, GGTpromDIG/GGT35, Cj145F/CJ0145RDIG, and Cj200F/Cj200RDIG, respectively, ( Table 2 ) and Cj...”
• It takes two to tango: two TatA paralogues and two redox enzyme-specific chaperones are involved in the localization of twin-arginine translocase substrates in Campylobacter jejuni
  Liu, Microbiology (Reading, England) 2014
  • “...TatATatC systems ( Goosens et al. , 2014 ). In C. jejuni , alkaline phosphatase (Cj0145) and the nitrate reductase NapA subunit were the first proteins shown to be TAT substrates (in strain 81116; van Mourik et al. , 2008 ). In our previous study (...”
  • “...system. Of the TAT substrate proteins in C. jejuni , the alkaline phosphatase encoded by cj0145 (PhoX; van Mourik et al. , 2008 ) is unique in being a hydrolytic enzyme that requires calcium ions but otherwise has no known cofactor. PhoX may be an example...”
• Evaluation of procedures for outer membrane isolation from Campylobacter jejuni
  Hobb, Microbiology (Reading, England) 2009
  • “...sequence. Similarly, aminopeptidase C is also not encoded in the genome sequence. Although alkaline phosphatase (Cj0145), hippurate hydrolase (Cj0985c), succinate dehydrogenase (Cj0437-9) and lactate dehydrogenase (Cj1167) are encoded in the NCTC 11168 genome sequence, these enzymic assays are either not sensitive enough to differentiate subcellular fractions...”
• Identification of Campylobacter jejuni genes contributing to acid adaptation by transcriptional profiling and genome-wide mutagenesis
  Reid, Applied and environmental microbiology 2008
  • “...pstSCA as well as a number of other genes (Cj0145, pstB, and the Cj0727-Cj0733 operon) (91), that were not differentially expressed in response to growth at pH...”

Achr_36110 PhoX family phosphatase from Azotobacter chroococcum NCIMB 8003
Aligns to 68:622 / 649 (85.5%), covers 99.0% of PF05787, 533.7 bits

• Holistic view of biological nitrogen fixation and phosphorus mobilization in Azotobacter chroococcum NCIMB 8003
  Biełło, Frontiers in microbiology 2023
  • “...2006 ; Sebastian and Ammerman, 2009 ; Lidbury et al., 2016 ). Protein encoded by Achr_36110 (A0A0C4WQL9) is another protein annotated as uncharacterized/tat related whose induction is also significant in FP vs. C (FC 8.46), FP vs. BNF and FP vs. PM (FC 9), but it...”
  • “...with this function, such as the previously mentioned PhoX domain-containing proteins A0A0C4WPA0 (Achr_19350) and A0A0C4WQL9 (Achr_36110) and the PhoD domain contain protein A0A0C4WU22 (Achr_24780). The alkaline phosphatase PhoX Achr_19350 (A0A0C4WPA0) was the most abundant in the FP conditions and the exopolyphosphatase Achr_36790 (A0A0C4WTQ1) was the most...”

NOC_RS11470 PhoX family phosphatase from Nitrosococcus oceani ATCC 19707
Aligns to 89:681 / 718 (82.6%), covers 99.8% of PF05787, 529.5 bits

• High Synteny and Sequence Identity between Genomes of Nitrosococcus oceani Strains Isolated from Different Oceanic Gyres Reveals Genome Economization and Autochthonous Clonal Evolution
  Wang, Microorganisms 2020
  • “...NS58 (NONS58_RS00145), C-27 (IB75_RS17280), and AFC27 (NOC27_RS15820). Furthermore, homologs of the contiguous genes NOC_RS11465 and NOC_RS11470, encoding a PhoX family phosphatase CDS), present in all five genomes, are interrupted in the AFC132 genome by a cluster of three genes, HW44_RS10340-RS10350, predicted to encode a hypothetical protein,...”

MDG893_02110 predicted phosphatase from Marinobacter algicola DG893
Aligns to 81:648 / 676 (84.0%), covers 99.8% of PF05787, 511.4 bits

• Loss of Motility as a Non-Lethal Mechanism for Intercolony Inhibition ("Sibling Rivalry") in Marinobacter
  Cruz-López, Microorganisms 2021
  • “...Flagellar secretion chaperone protein FliS MDG893_01080 0.724 EDM46845.1 Extracellular nuclease MDG893_17732 0.721 EDM47042.1 Predicted phosphatase MDG893_02110 0.712 EDM47259.1 Chemotaxis protein histidine kinase MDG893_18974 0.681...”

SYNPCC7002_A0893 phosphatase from Synechococcus sp. PCC 7002
Aligns to 71:575 / 611 (82.7%), covers 97.3% of PF05787, 500.9 bits

• Transcription Profiling of the Model Cyanobacterium Synechococcus sp. Strain PCC 7002 by Next-Gen (SOLiD™) Sequencing of cDNA
  Ludwig, Frontiers in microbiology 2011
  • “..., pstC ) also increased two- to four-fold. Furthermore, transcript levels for a predicted phosphatase (SYNPCC7002_A0893) and alkaline phosphatase (SYNPCC7002_A2352) increased about 10-fold. Transcript levels for all of these genes were nearly constant at lower cell densities. Collectively, the results at higher cell densities resembled microarray...”
  • “...Phosphate import ATP-binding protein SYNPCC7002_A2285 1.49 1.18 1.07 4.21 pstC Phosphate ABC transporter, permease protein SYNPCC7002_A0893 0.60 0.61 1.23 11.20 Predicted phosphatase SYNPCC7002_A2352 1.14 0.55 0.78 10.75 Alkaline phosphatase SYNPCC7002_A1821 0.93 2.03 1.90 5.20 nblA Putative phycobilisome degradation protein The ratio of relative transcript abundance at...”

SO2385 conserved hypothetical protein from Shewanella oneidensis MR-1
Aligns to 79:648 / 685 (83.2%), covers 99.8% of PF05787, 486.1 bits

• Mislocalization of Rieske protein PetA predominantly accounts for the aerobic growth defect of Tat mutants in Shewanella oneidensis
  Luo, PloS one 2013
  • “...flavocytochrome c flavin subunit, putative P SO1429 dmsA dimethyl sulfoxide reductase, molybdopterin-binding subunit, DmsA OM SO2385 phoX monomeric alkaline phosphatase, PhoX E SO3048 iorB isoquinoline 1-oxidoreductase, molybdopterin-binding subunit, IorB P SO3058 flavocytochrome c, flavin subunit P SO3301 flavocytochrome c, flavin subunit IM SO3791 peptidase, M19 family...”
• Utilization of DNA as a sole source of phosphorus, carbon, and energy by Shewanella spp.: ecological and physiological implications for dissimilatory metal reduction
  Pinchuk, Applied and environmental microbiology 2008
  • “...of seven proteins (SO0990, SO1221, SO1560, SO1844, SO2001, SO2385, and SO3565) were related to P or DNA/nucleotide metabolism. Among these, SO1844 is predicted...”
  • “...cells grown on Na2HPO4. The protein encoded by SO2385, originally annotated as a hypothetical protein, shares 42% identity with the recently discovered PhoX...”
• Transcriptome profiling of Shewanella oneidensis gene expression following exposure to acidic and alkaline pH
  Leaphart, Journal of bacteriology 2006
  • “...so1726 so1762 so1813 so1844 so1975 so2001 so2002 so2101 so2385 so2519 so2570 so3432 so3433 so3687 so4195 so4405 so4466 Gene product description 1638 NOTES same...”

VPA0179 hypothetical protein from Vibrio parahaemolyticus RIMD 2210633
Aligns to 73:641 / 678 (83.9%), covers 99.8% of PF05787, 471.9 bits

• The Transcriptional Regulator HlyU Positively Regulates Expression of exsA, Leading to Type III Secretion System 1 Activation in Vibrio parahaemolyticus
  Getz, Journal of bacteriology 2018
  • “...group, we mapped two transposon insertion mutants, Vpa0179 (phoX) and Vp1473 (merR operon) (Fig. S1). Within the high-luminescence group linked to...”

PPUBIRD1_1093 PhoX family phosphatase from Pseudomonas putida BIRD-1
Aligns to 84:653 / 691 (82.5%), covers 99.8% of PF05787, 454.4 bits

• A widely distributed phosphate-insensitive phosphatase presents a route for rapid organophosphorus remineralization in the biosphere
  Lidbury, Proceedings of the National Academy of Sciences of the United States of America 2022
  • “...Locus tag PhoX F. johnsoniae ND * phoX Fj fjoh_2478 P. putida PF05787 phoX BIRD PPUBIRD1_1093 PhoA F. johnsoniae PF00245 phoA1 Fj fjoh_3249 F. johnsoniae PF00245; PF13653 phoA2 Fj fjoh_3187 E. coli (MG1655) PF00245 phoA Ec b0383 PafA F. johnsoniae PF01663 pafA Fj fjoh_0023 C. pinensis...”
• Comparative genomic, proteomic and exoproteomic analyses of three Pseudomonas strains reveals novel insights into the phosphorus scavenging capabilities of soil bacteria
  Lidbury, Environmental microbiology 2016
  • “...ND General secretion pathway protein K tatA ADR58773 PPUBIRD1_1091 3.34 ND Alkaline phosphatase phoX ADR58775 PPUBIRD1_1093 5.14 ND 2',3'cyclicnucleotide 2'phosphodiesterase uxpA ADR58776 PPUBIRD1_1094 3.24 ND General secretion pathway protein G tatG ADR58781 PPUBIRD1_1099 4.60 ND Hypothetical protein, conserved ADR59032 PPUBIRD1_1354 5.10 ND Metallophosphoesterase plcP ADR59065 PPUBIRD1_1390...”

PP1043 UxpB protein from Pseudomonas putida KT2440
Aligns to 84:653 / 691 (82.5%), covers 99.8% of PF05787, 451.2 bits

• UEG Week 2023 Poster Presentations
  , United European gastroenterology journal 2023

Rta_37000 PhoX family phosphatase from Ramlibacter tataouinensis TTB310
F5Y248 Phosphatase from Ramlibacter tataouinensis (strain ATCC BAA-407 / DSM 14655 / LMG 21543 / TTB310)
Aligns to 82:700 / 756 (81.9%), covers 99.8% of PF05787, 443.3 bits

• In Vitro and in Silico Evidence of Phosphatase Diversity in the Biomineralizing Bacterium Ramlibacter tataouinensis
  Skouri-Panet, Frontiers in microbiology 2017
  • “...PhoX1 Rta_14460 R 1514607 1512676 109 21 PhoX2 Rta_37610 R 4006412 4004532 74* 200 PhoX3 Rta_37000 R 3936191 3933921 114 188 PhoB [96, 81] 5.3e-05 Fur [18, 1] 2.3e-05 PhoX4 Rta_01350 R 134200 132824 416 48 FadR [173, 158] 1.7e-05 Cra [149, 132] 5.7e-05 FhlA [125,...”
• In Vitro and in Silico Evidence of Phosphatase Diversity in the Biomineralizing Bacterium Ramlibacter tataouinensis
  Skouri-Panet, Frontiers in microbiology 2017
  • “...(6.3) PhoX2 F5Y2Z6 626 Non-cytoplasmic L = 50, Tat signal 67.2 (62.3) 9.3 (9.2) PhoX3 F5Y248 756 Non-cytoplasmic L = 67, Tat signal 80.4 (73.7) 5.4 (5.6) PhoX4 F5Y3B1 458 Non-cytoplasmic L = 31, Tat signal 48.9 (45.7) 5.3 (4.9) Molecular weight (MW) and isoelectric point...”

ABAYE3309 hypothetical protein from Acinetobacter baumannii AYE
Aligns to 82:686 / 730 (82.9%), covers 99.8% of PF05787, 439.8 bits

• Novel variants of AbaR resistance islands with a common backbone in Acinetobacter baumannii isolates of European clone II
  Seputiene, Antimicrobial agents and chemotherapy 2012
  • “...target gene encodes the putative phosphatase (similar to ABAYE3309) and, therefore, in the present study was designated as the target pho. Sequence analysis...”

MCR_0920 PhoX family phosphatase from Moraxella catarrhalis BBH18
Aligns to 71:666 / 707 (84.3%), covers 99.8% of PF05787, 431.4 bits

• Comparative Genomic Analyses of the Moraxella catarrhalis Serosensitive and Seroresistant Lineages Demonstrate Their Independent Evolution
  Earl, Genome biology and evolution 2016
  • “...MCR_1733 Phosphate ABC transporter permease protein PstC MCR_1734 Phosphate ABC transporter substrate binding; protein PstS MCR_0920 Conserved hypothetical protein MCR_1199 Hypothetical protein MCR_1722 Polyamine ABC transporter ATPase subunit MCR_1724 Polyamine ABC transporter permease protein MCR_1013 Hypothetical protein MCR_1123 Conserved hypothetical protein MCR_0622 Hypothetical protein MCR_0811 Hypothetical...”

ASF14_09200 PhoX family phosphatase from Sphingomonas sp. Leaf257
Aligns to 158:782 / 826 (75.7%), covers 99.8% of PF05787, 428.5 bits

• Dynamic character displacement among a pair of bacterial phyllosphere commensals in situ
  Hemmerle, Nature communications 2022
  • “...under co-colonization conditions compared to mono-association were a Zn-dependent dipeptidase (ASF14_12990, 18-fold), a putative phosphatase (ASF14_09200, 12-fold) and several hypothetical proteins (>7-fold). In addition, a predicted low-affinity phosphate transporter (ASF14_05655, 3.4-fold) and a phosphate ABC transporter substrate-binding protein (ASF14_05925, 2.4-fold) were downregulated upon co-colonization that were...”

A1S_0462 putative phosphatase from Acinetobacter baumannii ATCC 17978
2 alignments in 1:639 / 683 (90.9%), covering up to 61.2% of PF05787, 416.3 bits

• Mucin acts as a nutrient source and a signal for the differential expression of genes coding for cellular processes and virulence factors in Acinetobacter baumannii
  Ohneck, PloS one 2018
  • “...protein A1S_3174 -5.393271807 0.000347121 Bacterioferritin-associated ferredoxin A1S_3339 -2.168086854 0.036495615 Ferrichrome-iron receptor Phosphate acquisition and metabolism A1S_0462 -4.856772439 4.37285E -05 Phosphatase A1S_0463 -21.07140251 3.86471E -14 Alkaline phosphatase A1S_1662 -2.941837975 0.000264374 Histidine phosphatase super family protein A1S_2445 -3.416948938 8.53187E -07 Phosphate import ATP-binding protein PstB A1S_2446 -13.40837622 8.60938E...”
  • “...metabolism ( Table 2 ). It down-regulates the expression of genes coding for phosphatase activity (A1S_0462, A1S_0463, A1S_2677, A1S_2749), as well as the predicted operons A1S_2445-A1S_2448 and A1S_3374-A1S_3376, which code for potential phosphate transport and regulatory functions, respectively. In summary, the RNA-Seq data are consistent with...”
• genetic determinants of intrinsic colistin tolerance in Acinetobacter baumannii
  Hood, Infection and immunity 2013
  • “...Gene Gene A1S_2445 A1S_2444 A1S_3030 A1S_0462 High-affinity phosphate transport protein (PstB) Putative periplasmic protease Phosphate-inducible protein,...”

Tery_3845 protein of unknown function DUF839 from Trichodesmium erythraeum IMS101
Aligns to 80:713 / 786 (80.7%), covers 97.9% of PF05787, 392.8 bits

• Transcriptional and Proteomic Choreography Under Phosphorus Deficiency and Re-supply in the N₂ Fixing Cyanobacterium Trichodesmium erythraeum
  Frischkorn, Frontiers in microbiology 2019
  • “...the gene encoding the phosphonate binding protein, phnD (Tery_4993), and the alkaline phosphatase genes phoX (Tery_3845) and phoA (Tery_3467) ( Su et al., 2007 ; Orchard et al., 2009 ) ( Table 1 ). Here, sphR (Tery_2902) gene expression was significantly higher in the -P treatment...”
• Mechanisms of increased Trichodesmium fitness under iron and phosphorus co-limitation in the present and future ocean
  Walworth, Nature communications 2016
  • “...and PhnM), inorganic phosphate (P i ) binding (SphX) and one protein of unknown function (Tery_3845) containing the P response regulator SphR motif, which is an orthologue to PhoB in E. coli 34 . In contrast, the high-affinity P i uptake subunits of the Pst transporter...”

SCO6052 hypothetical protein from Streptomyces coelicolor A3(2)
2 alignments in 46:454 / 465 (88.0%), covering up to 70.5% of PF05787, 384.7 bits

• The twin-arginine translocation pathway is a major route of protein export in Streptomyces coelicolor
  Widdick, Proceedings of the National Academy of Sciences of the United States of America 2006
  • “...SCO2286 SCO2758 SCO2780 SCO2786 SCO3484 SCO3790 SCO4672 SCO6052 SCO6198 SCO6272* SCO6281* SCO6457 SCO6580 SCO6594 SCO6691 SCO7631 SCO7677 Description Putative...”

LB061 hypothetical protein from Leptospira interrogans serovar lai str. 56601
Aligns to 42:501 / 532 (86.5%), covers 99.8% of PF05787, 381.4 bits

• In silico and microarray-based genomic approaches to identifying potential vaccine candidates against Leptospira interrogans
  Yang, BMC genomics 2006
  • “...- hypothetical protein LB050 344 533.3 - hypothetical protein LB056 443.5 523.8 COG0457R TPR-repeat-containing protein LB061 550.2 769.7 COG3211R hypothetical protein LB191 344.3 410 COG1629P COG4771P putative TonB-dependent outer membrane receptor protein LB199 917.3 925.2 COG1629P putative outermembrane protein LB258 552.5 1,082 COG4870O Cysteine protease LB277...”

SCO1906 secreted protein from Streptomyces coelicolor A3(2)
2 alignments in 61:475 / 490 (84.7%), covering up to 70.7% of PF05787, 373.5 bits

• Extracting regulator activity profiles by integration of de novo motifs and expression data: characterizing key regulators of nutrient depletion responses in Streptomyces coelicolor
  Iqbal, Nucleic acids research 2012
  • “...operon (SCO4139-42), SCO1393 which encodes for an acetoacetyl-CoA synthetase, SCO3790 a conserved hypothetical protein and SCO1906 a secreted protein. The activity profile has a high correlation to the three regulators PhoP (SCO4230), PhoU (SCO4228), AraC (SCO0466), ( r =0.83, 0.84 and 0.67, respectively). It is known...”
• Cross-talk of global nutritional regulators in the control of primary and secondary metabolism in Streptomyces
  Martín, Microbial biotechnology 2011
  • “...., 2006 ; Makarewicz etal ., 2006 ). Other genes encoding putative phosphate scavengers are SCO1906 , SCO3790 and SCO4152 . Both SCO1906 and SCO3790 encode putative secreted phosphatases (other than PhoA and PhoC) and their promoters are bound by PhoP ( RodrguezGarca etal ., 2007...”
  • “...the promoters of the alkaline phosphatases phoA and phoD , other two putative phosphatases ( SCO1906 and SCO3790 ), a putative phytase ( Apel etal ., 2007 ; SolaLanda etal ., 2008 ) and two glpQ genes ( SantosBeneit etal ., 2009b ). The DRus are...”
• Target genes and structure of the direct repeats in the DNA-binding sequences of the response regulator PhoP in Streptomyces coelicolor
  Sola-Landa, Nucleic acids research 2008
  • “...3 conserved DRu SCO0033-4 SCO0034, unknown CCC 1 g Non-coding 127 N.D. 0D 0.034 Activation SCO1906 SCO1906, putative phosphatase CCC 1 Coding 92 N.D. 00 > 0.25 N.D. SCO4261-3 h SCO4261, possible response regulator CCC 1 g Non-coding 43 N.D. aA 0.088 Repression C. Class III:...”
  • “...(a putative ironsulphur protein), SCO1394 (a possible glycosyl hydrolase), SCO1854 (a possible integral membrane protein), SCO1906 and SCO3790 (putative phosphatases different from phoA , phoC , phoD ), SCO1993 (an unknown protein), SCO2262 (a possible oxidoreductase), SCO2620 (a probable cell division trigger factor), SCO4451 (a probable...”
• Genome-wide transcriptome analysis reveals that a pleiotropic antibiotic regulator, AfsS, modulates nutritional stress response in Streptomyces coelicolor A3(2)
  Lian, BMC genomics 2008
  • “...genes encoding twin-arginine translocation (Tat) dependent exported proteins ( SCO1196 , SCO1565 , SCO1633 , SCO1906 , SCO2286 , SCO3790 , SCO6691 and SCO7631 ) identified in an earlier study [ 24 ] also belonged to this category. Several other genes encoding secreted proteins, nucleases and...”
  • “...SCO1565 Putative glycerophosphoryl diester phosphodiesterase 0.46 SCO1633 Tat dependent secreted protein ( tatA ) 0.23 SCO1906 Probable Tat dependent secreted protein 0.40 SCO1968 Glycerophosphoryl diester phosphodiesterase ( glpQ ) 0.52 SCO1969 Putative DNA-methyltransferase 0.20 SCO2068 Putative secreted alkaline phosphatase 0.28 SCO2286 Putative Tat-dependent secreted alkaline phosphatase...”
• Uncovering genes with divergent mRNA-protein dynamics in Streptomyces coelicolor
  Jayapal, PloS one 2008
  • “...(PstB, SCO4139; PstS, SCO4142; NeuB, SCO4881; RegX3, SCO4230; a phosphate transporter, SCO4228; alkaline phosphatase, SCO2286; SCO1906; SCO3790; SCO5140 and SCO7631) were strongly correlated with PC-1 of both proteins and mRNA. These genes also generally had a high positive value along PC-2, indicating a transient up-regulatory trend....”
• The twin-arginine translocation pathway is a major route of protein export in Streptomyces coelicolor
  Widdick, Proceedings of the National Academy of Sciences of the United States of America 2006
  • “...SCO1172 SCO1196 SCO1356* SCO1432 SCO1565 SCO1590 SCO1639 SCO1906 SCO2068 SCO2286 SCO2758 SCO2780 SCO2786 SCO3484 SCO3790 SCO4672 SCO6052 SCO6198 SCO6272*...”

C9YVU0 Putative secreted protein from Streptomyces scabiei (strain 87.22)
SCAB_20641 hypothetical protein from Streptomyces scabiei 87.22
2 alignments in 40:443 / 455 (88.8%), covering up to 70.7% of PF05787, 365.9 bits

• Comparative secretome analysis of Streptomyces scabiei during growth in the presence or absence of potato suberin
  Komeil, Proteome science 2014
  • “...0.110.03 0.060.06 Unknown function C9Z6Q2 SCAB_12841 0.440.12 0.700.25 0.590.17 C9ZBK5 SCAB_15581 d 0.040.04 0.030.02 0.030.03 C9YVU0 SCAB_20641 0.070.04 0.340.09 0.380.11 C9Z0X8 SCAB_40131 0.280.13 0.140.05 0.070.03 C9Z5E6 SCAB_42301 d nd 0.030.06 0.030.06 C9ZGX5 SCAB_49501 0.060.06 nd nd C9YV55 SCAB_52141 d 0.020.03 0.030.03 0.080.09 C9Z1G8 SCAB_72441 0.170.06 0.270.09...”
• Comparative secretome analysis of Streptomyces scabiei during growth in the presence or absence of potato suberin
  Komeil, Proteome science 2014
  • “...0.060.06 Unknown function C9Z6Q2 SCAB_12841 0.440.12 0.700.25 0.590.17 C9ZBK5 SCAB_15581 d 0.040.04 0.030.02 0.030.03 C9YVU0 SCAB_20641 0.070.04 0.340.09 0.380.11 C9Z0X8 SCAB_40131 0.280.13 0.140.05 0.070.03 C9Z5E6 SCAB_42301 d nd 0.030.06 0.030.06 C9ZGX5 SCAB_49501 0.060.06 nd nd C9YV55 SCAB_52141 d 0.020.03 0.030.03 0.080.09 C9Z1G8 SCAB_72441 0.170.06 0.270.09 0.320.10...”

alr0132 hypothetical protein from Nostoc sp. PCC 7120
Aligns to 42:431 / 444 (87.8%), covers 100.0% of PF05787, 348.7 bits

• The Anabaena sp. PCC 7120 Exoproteome: Taking a Peek outside the Box
  Oliveira, Life (Basel, Switzerland) 2015
  • “...3 Purines, pyrimidines, nucleosides, and nucleotides - Alr0069 Ribonuclease PH NH 4 + Transcription - Alr0132 Alr0132 protein NO 3 , NH 4 + Conserved hypothetical protein Anabaena Alr0140 Periplasmic oligopeptide-binding protein of oligopeptide ABC transporter N 2 , NO 3 , NH 4 + Transport...”
• Deep sequencing of HetR-bound DNA reveals novel HetR targets in Anabaena sp. strain PCC7120
  Flaherty, BMC microbiology 2014
  • “...right Fold change expression in hetR 6h HetR binding site 0136127..0136558 431 all0131 Low coverage alr0132 1.1 Yes 0613436..0613919 483 patA (all0521) 8.0 alr0522 d 5.6 Yes 1729122..1729569 447 all1467 1.4 alr1468 Low coverage Yes 1732738..1733693 955 asr1469 c 1.7 alr1470 3.1 Yes 1734763..1735224 461 all1471...”

MAE_30190 hypothetical protein from Microcystis aeruginosa NIES-843
Aligns to 64:673 / 735 (83.0%), covers 97.9% of PF05787, 323.1 bits

• Co-occurring microorganisms regulate the succession of cyanobacterial harmful algal blooms
  Wang, Environmental pollution (Barking, Essex : 1987) 2021
  • “...). Six Micorcystis DEGs were related to P metabolism, including those for alkaline phosphatase (ALP) (MAE_30190), sensor histidine kinase (MAE_02100, MAE_31720, MAE_03210), creatininase (MAE_62630), and phosphate-starvation induced ATPase (MAE_43330). ( Figs. 2b1 and 2b-2 ). Anabaena DEGs did not include any of the microcystin synthesis genes....”

slr8030 hypothetical protein from Synechocystis sp. PCC 6803
Aligns to 62:671 / 732 (83.3%), covers 98.3% of PF05787, 312.9 bits

• Comparison of alternative integration sites in the chromosome and the native plasmids of the cyanobacterium Synechocystis sp. PCC 6803 in respect to expression efficiency and copy number
  Nagy, Microbial cell factories 2021
  • “...four endogenous megaplasmids (pSYSM/ slr5037 - slr5038 ; pSYSX/ slr6037 ; pSYSA/ slr7023 ; pSYSG/ slr8030 ) that have not been previously evaluated for the purpose. Fluorescent analysis of the segregated strains revealed that the expression levels between the megaplasmids and chromosomal constructs were very similar,...”
  • “...the four megaplasmids (pSYSM/ slr5037 - slr5038 ; pSYSX/ slr6037 ; pSYSA/ slr7023 ; pSYSG/ slr8030 ), and two in the small native plasmids (pCC5.2/ slr9002 ; pCB2.4/ ssr9202 ). Five of the new chromosomal target sites were genes of unknown function ( sll0710 , slr0725...”

SYNW1799 conserved hypothetical protein from Synechococcus sp. WH 8102
Aligns to 62:651 / 716 (82.4%), covers 98.3% of PF05787, 299.5 bits

• Proteomic responses of oceanic Synechococcus WH8102 to phosphate and zinc scarcity and cadmium additions
  Cox, Frontiers in microbiology 2013
  • “...SYNW2390 putative alkaline phosphatase/5 nucleotidase, and SNW2391 putative alkaline phosphatase ( phoA ). In addition, SYNW1799 is an alkaline phosphatase ( phoX ) (Kathuria and Martiny, 2011 ). Alkaline phosphatases vary in cellular location and associated metal ions. Two alkaline phosphatases purified from different strains of...”
  • “...but was inhibited by Mn 2+ (Wagner et al., 1995 ). Recent experimentation on PhoX (SYNW1799) overexpressed in E. coli have shown enhanced enzyme activity in the presence of Ca, leading the authors to conclude that bacterial lineages with the presence of phoX in the genome...”

NSP_RS08485 alkaline phosphatase PhoX from Nodularia spumigena CCY9414
Aligns to 52:458 / 471 (86.4%), covers 97.9% of PF05787, 270.0 bits

• Acclimation of Nodularia spumigena CCY9414 to inorganic phosphate limitation - Identification of the P-limitation stimulon via RNA-seq
  Santoro, Frontiers in microbiology 2022
  • “...2.74 0.23 904 nsp12940 NSP_RS05800 PhoX-like phosphatase 7.02 0.17 5.41 0.14 2.84 0.14 905 nsp18960 NSP_RS08485 Putative PhoX phosphatase, DUF839 domain-containing protein 6.28 0.15 5.69 0.15 1.36 0.17 1304 nsp29340 NSP_RS12935 Metallophosphoesterase 1.82 0.41 0.67 0.10 1.16 0.37 1934 nsp29350 NSP_RS12940 Metallophosphoesterase 0.10 0.15 0.00 0.12...”

Rta_01350 alkaline phosphatase PhoX from Ramlibacter tataouinensis TTB310
F5Y3B1 Phosphatase from Ramlibacter tataouinensis (strain ATCC BAA-407 / DSM 14655 / LMG 21543 / TTB310)
2 alignments in 57:444 / 458 (84.7%), covering up to 70.5% of PF05787, 268.6 bits

• In Vitro and in Silico Evidence of Phosphatase Diversity in the Biomineralizing Bacterium Ramlibacter tataouinensis
  Skouri-Panet, Frontiers in microbiology 2017
  • “...Rta_37000 R 3936191 3933921 114 188 PhoB [96, 81] 5.3e-05 Fur [18, 1] 2.3e-05 PhoX4 Rta_01350 R 134200 132824 416 48 FadR [173, 158] 1.7e-05 Cra [149, 132] 5.7e-05 FhlA [125, 112] 6.9e-05 Genes are located on direct (D) or reverse (R) DNA strands; the CDS...”
• In Vitro and in Silico Evidence of Phosphatase Diversity in the Biomineralizing Bacterium Ramlibacter tataouinensis
  Skouri-Panet, Frontiers in microbiology 2017
  • “...(9.2) PhoX3 F5Y248 756 Non-cytoplasmic L = 67, Tat signal 80.4 (73.7) 5.4 (5.6) PhoX4 F5Y3B1 458 Non-cytoplasmic L = 31, Tat signal 48.9 (45.7) 5.3 (4.9) Molecular weight (MW) and isoelectric point (pI) are indicated for both precursor and mature forms of each protein (the...”

phoX / CAA10030.1 alkaline phosphatase from Volvox carteri (see paper)
2 alignments in 142:1159 / 1365 (65.6%), covering up to 73.4% of PF05787, 155.5 bits

C9ZAU3 Putative secreted protein from Streptomyces scabiei (strain 87.22)
SCAB_62211 hypothetical protein from Streptomyces scabiei 87.22
3 alignments in 91:367 / 386 (71.8%), covering up to 29.1% of PF05787, 131.8 bits

• Comparative secretome analysis of Streptomyces scabiei during growth in the presence or absence of potato suberin
  Komeil, Proteome science 2014
  • “...nd C9Z994 SCAB_61611 d Protease 0.050.04 0.140.03 0.030.03 C9ZAQ7 SCAB_61831 d Metalloendopeptidase nd nd 0.030.03 C9ZAU3 SCAB_62211 Phosphatase nd 0.110.05 0.170.07 C9ZDW7 SCAB_63921 d Dehydratase nd 0.040.05 0.070.03 C9ZHB0 SCAB_66321 d F420-dependent NADP reductase nd 0.020.03 0.050.05 C9ZB18 SCAB_77401 Glycosyl hydrolase nd 0.060.03 0.050.04 C9ZCL9 SCAB_78431...”
• Comparative secretome analysis of Streptomyces scabiei during growth in the presence or absence of potato suberin
  Komeil, Proteome science 2014
  • “...C9Z994 SCAB_61611 d Protease 0.050.04 0.140.03 0.030.03 C9ZAQ7 SCAB_61831 d Metalloendopeptidase nd nd 0.030.03 C9ZAU3 SCAB_62211 Phosphatase nd 0.110.05 0.170.07 C9ZDW7 SCAB_63921 d Dehydratase nd 0.040.05 0.070.03 C9ZHB0 SCAB_66321 d F420-dependent NADP reductase nd 0.020.03 0.050.05 C9ZB18 SCAB_77401 Glycosyl hydrolase nd 0.060.03 0.050.04 C9ZCL9 SCAB_78431 Tripeptidylaminopeptidase...”

BCAL1083 putative exported alkaline phosphatase from Burkholderia cenocepacia J2315
Aligns to 160:596 / 654 (66.8%), covers 60.8% of PF05787, 73.7 bits

• Transcriptional responses of Burkholderia cenocepacia to polymyxin B in isogenic strains with diverse polymyxin B resistance phenotypes
  Loutet, BMC genomics 2011
  • “...15.2 20.7 BCAM2453 (Redoxin) 40.5 6.2 Genes differentially regulated in RSF34 4000B compared to RSF34 BCAL1083 (Exported alkaline phosphatase) -16.7 -3.2 BCAL1213 (2-oxoisovalerate dehydrogenase subunit) 29.9 19.7 BCAL1270 (Phosphate transport, periplasmic) -23.5 -17.9 BCAM0537 (Serine peptidase) -28.2 -4.1 BCAM0855 (UDP-glucose dehydrogenase) -5.0 -4.2 BCAM2195 (AMP-binding enzyme)...”
  • “...cluster ( BCAL1270 to BCAL1276 ) predicted to encode a phosphate ABC transport system and BCAL1083 , which encodes a predicted exported alkaline phosphatase. qRT-PCR analysis of representative genes from these clusters ( BCAL1213 , BCAL2195 , BCAL1270 , and BCAL1083 ) confirmed these patterns of...”

AKJ12_RS09730 alkaline phosphatase PhoX from Xanthomonas arboricola pv. juglandis
Aligns to 162:606 / 651 (68.4%), covers 70.5% of PF05787, 66.4 bits

• Proteome Analysis of Walnut Bacterial Blight Disease
  H, International journal of molecular sciences 2020
  • “...(33); two esterases (AKJ12_RS20070 and AKJ12_RS13810); endoglucanase (AKJ12_RS08070); two phospholipases (AKJ12_RS07015 and AKJ12_RS03905); five phosphatases (AKJ12_RS09730, AKJ12_RS09895, AKJ12_RS11635, AKJ12_RS05780, and AKJ12_RS13650); alpha-xylosidase (AKJ12_RS09825); xylose isomerase (AKJ12_RS20500); four hydrolases (AKJ12_RS18195, AKJ12_RS14795, AKJ12_RS12205, and AKJ12_RS12930); four aminopeptidases (AKJ12_RS15095, AKJ12_RS13855, AKJ12_RS05625, and AKJ12_RS04085); and biotin carboxylase (AKJ12_RS08585). In addition,...”

PXO_00684 alkaline phosphatase from Xanthomonas oryzae pv. oryzae PXO99A
Aligns to 140:596 / 630 (72.5%), covers 73.6% of PF05787, 64.8 bits

• Deciphering the Role of Tyrosine Sulfation in Xanthomonas oryzae pv. oryzae Using Shotgun Proteomic Analysis
  Park, The plant pathology journal 2016
  • “...protein * 188576165 PXO_00406 Acetoacetyl-CoA reductase 1.61 I, R R (general function prediction only) 188576411 PXO_00684 Alkaline phosphatase 1.55 S (function unknown) 188577991 PXO_01984 Hypothetical protein * 188578598 PXO_02671 Adhesin-like protein A 3.16 188576643 PXO_00888 Hypothetical protein 2.31 188578763 PXO_03057 Hypothetical protein 2.08 188574531 PXO_03595 Hypothetical...”

A1S_0463 putative alkaline phosphatase from Acinetobacter baumannii ATCC 17978
Aligns to 176:643 / 699 (67.0%), covers 70.5% of PF05787, 64.3 bits

• Light Regulates Acinetobacter baumannii Chromosomal and pAB3 Plasmid Genes at 37°C
  Squire, Journal of bacteriology 2022 (secret)
• Acinetobacter baumannii OxyR Regulates the Transcriptional Response to Hydrogen Peroxide
  Juttukonda, Infection and immunity 2019
  • “...A1S_1487 A1S_3305 A1S_1486 A1S_0922 A1S_0393 A1S_0024 A1S_0463 A1S_2459 A1S_3222 A1S_2293 A1S_1446 A1S_0131 Putative acyl-CoA dehydrogenase Putative acyl-CoA...”
• Mucin acts as a nutrient source and a signal for the differential expression of genes coding for cellular processes and virulence factors in Acinetobacter baumannii
  Ohneck, PloS one 2018
  • “...ferredoxin A1S_3339 -2.168086854 0.036495615 Ferrichrome-iron receptor Phosphate acquisition and metabolism A1S_0462 -4.856772439 4.37285E -05 Phosphatase A1S_0463 -21.07140251 3.86471E -14 Alkaline phosphatase A1S_1662 -2.941837975 0.000264374 Histidine phosphatase super family protein A1S_2445 -3.416948938 8.53187E -07 Phosphate import ATP-binding protein PstB A1S_2446 -13.40837622 8.60938E -21 Phosphate transport system permease...”
  • “...( Table 2 ). It down-regulates the expression of genes coding for phosphatase activity (A1S_0462, A1S_0463, A1S_2677, A1S_2749), as well as the predicted operons A1S_2445-A1S_2448 and A1S_3374-A1S_3376, which code for potential phosphate transport and regulatory functions, respectively. In summary, the RNA-Seq data are consistent with mucin...”

AbA118F_1645 alkaline phosphatase PhoX from Acinetobacter baumannii
Aligns to 200:670 / 726 (64.9%), covers 70.5% of PF05787, 64.2 bits

• Cerebrospinal fluid (CSF) augments metabolism and virulence expression factors in Acinetobacter baumannii
  Martinez, Scientific reports 2021
  • “...-2.14 5.2 E-20 outer membrane porin, putative AbA118F_2367 -2.30 4.0 E-02 Phage tail/DNA circulation protein AbA118F_1645 -2.39 1.2 E-27 Alkaline phosphatase AbA118F_1190 -2.62 4.9 E-02 Lysozyme (N-acetylmuramidase) family AbA118F_1376 -2.93 3.4 E-02 Lysozyme (N-acetylmuramidase) family AbA118F_3137 -3.07 2.8 E-03 hypothetical protein AbA118F_2475 -3.31 2.0 E-08 hypothetical...”
  • “...found those coding for transporters (e.g. Mg2+transporters, AbA118F_2476 and AbA118F_2477) and catabolic proteins (such as AbA118F_1645 Alkaline Phosphatase and AbA118F_0711 Acyl-CoA dehydrogenase) (Table 1 and Supplementary Table S1 ). Gene ontology (GO) analysis was next undertaken to identify molecular functions and biological pathways associated to A...”

XOO2357 alkaline phosphatase from Xanthomonas oryzae pv. oryzae KACC10331
Aligns to 219:664 / 709 (62.9%), covers 70.3% of PF05787, 62.4 bits

• Identification of 17 HrpX-regulated proteins including two novel type III effectors, XOC_3956 and XOC_1550, in Xanthomonas oryzae pv. oryzicola
  Xue, PloS one 2014
  • “...N N XAC2155 (91%) XCV2099 (91%) XCC2020 (86%) Xrp9 hypothetical protein XOC_1951 (100%) PXO_00529 (98%) XOO2357 (99%) XOO2488 (96%) XAC2517 (96%) XCV2699 (92%) XCC2382 (84%) Xrp10 hypothetical protein XOC_0560 100%) PXO_04113 (90%) XOO3892 (91%) XOO4113 (90%) XAC3866 (94%) XCV3985 (94%) XCC3811 (81%) Xrp11 hypothetical protein XOC_3130...”

Or search for genetic data about PF05787 in the Fitness Browser