Family Search for PF06155 (GBBH-like_N)
April 2024: See Interactive Tools for Functional Annotation of Bacterial Genomes for advice on using these tools.
PF06155 hits 44 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.
Sama_0429 predicted FeS cluster maintenance protein from Shewanella amazonensis SB2B
Aligns to 9:91 / 126 (65.9%), covers 98.8% of PF06155, 107.8 bits
- mutant phenotype: PFam PF06155.8 (DUF971). conserved cofitness with mrp/apbC (Sama_2048)
SPWS13_2316 DUF971 domain-containing protein from Shewanella putrefaciens
Aligns to 11:93 / 128 (64.8%), covers 98.8% of PF06155, 106.2 bits
- Comparative Transcriptome Analysis of Shewanella putrefaciens WS13 Biofilms Under Cold Stress
Yan, Frontiers in cellular and infection microbiology 2022 - “...-1.24 Arginase AVV84398.1 urdA -1.38 Cytochrome C AVV82368.1 -1.34 TonB-dependent receptor AVV84082.1 -1.21 Hypothetical protein SPWS13_2316 AVV86163.1 hutH -1.08 Histidine ammonia-lyase AVV82091.1 hisC 2.88 Histidinol-phosphate aminotransferase AVV84271.1 5.68 Aldehyde dehydrogenase AVV82088.1 2.89 Hypothetical protein SPWS13_0228 AVV82089.1 hisH 2.58 Imidazole glycerol phosphate synthase AVV82090.1 hisB 2.52 Imidazoleglycerol-phosphate...”
SO4164 predicted FeS cluster maintenance protein from Shewanella oneidensis MR-1
Aligns to 11:93 / 128 (64.8%), covers 98.8% of PF06155, 105.9 bits
- mutant phenotype: PFam PF06155.8 (DUF971). conserved cofitness with mrp/apbC (SO2618) and perhaps bolA
Pnuc_1898 hypothetical protein from Polynucleobacter sp. QLW-P1DMWA-1
Aligns to 6:90 / 128 (66.4%), covers 98.8% of PF06155, 98.5 bits
- Combined Methylome, Transcriptome and Proteome Analyses Document Rapid Acclimatization of a Bacterium to Environmental Changes
Srivastava, Frontiers in microbiology 2020 - “...dioxygenase 4.42 0.012292 Pnuc_1343 Transglutaminase domain protein 4.23 0.000000 Pnuc_1808 Transcriptional regulator, LuxR 4.04 0.000521 Pnuc_1898 DUF971 domain-containing protein 3.54 0.000096 Pnuc_1418 7-Carboxy-7-deazaguanine synthase 3.52 0.006376 Pnuc_1758 Transglut_core2 domain-containing protein 3.50 0.000508 Pnuc_1342 ATP-dependent RNA helicase RhlE 3.46 0.000013 Pnuc_1230 Pseudouridine synthase (EC 5.4.99.-) 3.36 0.000493...”
- “...2.74 0.011066 Pnuc_1732 Peptidyl-prolyl cistrans isomerase 2.66 0.000207 Pnuc_0657 Uroporphyrinogen-III synthase (EC 4.2.1.75) 2.42 0.000339 Pnuc_1898 DUF971 domain-containing protein 2.36 0.005023 Pnuc_0391 HAD-superfamily hydrolase, subfamily IA 2.31 0.000160 Pnuc_1869 Chaperone SurA 2.29 0.000047 Pnuc_1650 Peptidase S16, lon domain protein 2.22 0.000017 Pnuc_1342 ATP-dependent RNA helicase RhlE...”
Pf1N1B4_1554 predicted FeS cluster maintenance protein from Pseudomonas fluorescens FW300-N1B4
Aligns to 8:90 / 125 (66.4%), covers 100.0% of PF06155, 94.7 bits
- mutant phenotype: PFam PF06155.8 (DUF971). Conserved cofitness with mrp/apbC (Pf1N1B4_731)
BN5_0415 DUF971 domain-containing protein from Pseudomonas oleovorans CECT 5344
Aligns to 7:88 / 123 (66.7%), covers 100.0% of PF06155, 94.6 bits
- Putative small RNAs controlling detoxification of industrial cyanide-containing wastewaters by Pseudomonas pseudoalcaligenes CECT5344
Olaya-Abril, PloS one 2019 - “...polyhydroxyalkanoates ( Fig 5A ). Also, sRNA222 and sRNA312, share as target the hisA gene (BN5_0415) that encodes a putative phosphoribosylformimino-5-amidazole carboxamide ribotide isomerase involved in the synthesis of histidine and inositol monophosphate. The sRNA149, sRNA511 and sRNA683 ( Fig 5B ) were downregulated by the...”
- “...family transcriptional regulator phaD; BN5_0412, polyhydroxyalkanoate synthase, class II; BN5_0413, poly(3-hydroxyalkanoate) depolymerase; BN5_0414, poly(3-hydroxyalkanoate) polymerase; BN5_0415, putative phosphoribosylformimino-5-aminoimidazole carboxamide riboside isomerase; BN5_0416, ATP-dependent protease ATPase subunit HslU; BN5_0417, ATP-dependent protease subunit HslV; BN5_0418, uncharacterized protein. B. BN5_0546, azurin; BN5_0547, uncharacterized protein; BN5_0548, cytokinin riboside 5'-monophosphate phosphoribohydrolase;...”
BPSL0636 conserved hypothetical protein from Burkholderia pseudomallei K96243
Aligns to 14:98 / 137 (62.0%), covers 98.8% of PF06155, 94.5 bits
- The Burkholderia pseudomallei intracellular 'TRANSITome'
Heacock-Kang, Nature communications 2021 - “...protrusion stage of infection (Supplementary Fig. 4b ). Of these 11 genes, four, BPSL0097 , BPSL0636 , BPSL1126 , and BPSL1422 , have not been identified in the literature to our knowledge while seven have had some reference. BpeT and BpeS, regulators of the RND efflux...”
- “...respectively, while other mutants showed moderate defects in this process (Supplementary Table 1 ). The BPSL0636 mutant was the only strain to show a significant defect in invasion with a 75% decrease compared to wild type (Supplementary Table 1 ). Six mutants, BPSL0097 , BPSL1126 ,...”
AO353_12420 predicted FeS cluster maintenance protein from Pseudomonas fluorescens FW300-N2E3
Aligns to 9:91 / 126 (65.9%), covers 100.0% of PF06155, 91.9 bits
- mutant phenotype: PFam PF06155.8 (DUF971). conserved cofitness with yggX (AO353_12045), nfuA (AO353_21625)
3luuA / B7J6R7 Crystal structure of protein with unknown function which belongs to pfam duf971 family (afe_2189) from acidithiobacillus ferrooxidans atcc 23270 at 1.93 a resolution
Aligns to 10:84 / 89 (84.3%), covers 92.9% of PF06155, 91.4 bits
PA5055 hypothetical protein from Pseudomonas aeruginosa PAO1
Aligns to 7:88 / 123 (66.7%), covers 100.0% of PF06155, 87.1 bits
PA2292 hypothetical protein from Pseudomonas aeruginosa PAO1
Aligns to 8:90 / 93 (89.2%), covers 97.6% of PF06155, 77.3 bits
RB11918 hypothetical protein from Pirellula sp. 1
RB11918 DUF971 domain-containing protein from Rhodopirellula baltica SH 1
Aligns to 18:130 / 134 (84.3%), covers 95.3% of PF06155, 77.1 bits
PP0211 conserved hypothetical protein from Pseudomonas putida KT2440
Aligns to 7:88 / 93 (88.2%), covers 95.3% of PF06155, 75.2 bits
AL066_11985 DUF971 domain-containing protein from Pseudomonas nunensis
Aligns to 6:88 / 94 (88.3%), covers 95.3% of PF06155, 74.3 bits
- Transcriptomic profiling of microbe-microbe interactions reveals the specific response of the biocontrol strain P. fluorescens In5 to the phytopathogen Rhizoctonia solani
Hennessy, BMC research notes 2017 - “...regulator 2.9 1.3 AL066_24330 Hypothetical protein 3.0 2.6 AL066_26360 AlpA family transcriptional regulator 3.3 3.5 AL066_11985 Hypothetical protein 4.1 1.6 Values indicate fold change based on mean expression values across biological triplicates compared to the control (bacteria only). Only genes showing at least a twofold change...”
- “...[ 26 ]. Transcripts downregulated by a fold-change greater than two included two hypothetical genes (AL066_11985, AL066_24330) in addition to a putative AlpA transcriptional regulator (AL066_26360) which as mentioned previously, was also downregulated during the R. solani interaction. Interaction with P. aphanidermatum induces an Mbth-like protein...”
XP_001007903 CobQ/CobB/MinD/ParA nucleotide-binding domain protein from Tetrahymena thermophila SB210
Aligns to 401:487 / 508 (17.1%), covers 96.5% of PF06155, 74.1 bits
AT3G27340 hypothetical protein from Arabidopsis thaliana
Aligns to 29:109 / 141 (57.4%), covers 91.8% of PF06155, 73.9 bits
- RALF1-FERONIA complex affects splicing dynamics to modulate stress responses and growth in plants
Wang, Science advances 2020 - “...splicing changes (illustrated by the genes AT4G32060 , AT1G48175 , AT1G54110 , AT5G49230 , and AT3G27340 ) were impaired in the fer-4 mutant (fig. S3G). Next, we focused on potential downstream factors of RALF1-FER. Screening of Arabidopsis complementary DNA (cDNA) libraries with the FER kinase domain...”
- “...a small nuclear RNA-activating complex family protein that encodes a protein similar to human SNAP50. AT3G27340 encodes a Myb domain protein. AT2G25000 encodes the WRKY60 transcription factor. AT1G13460 encodes the protein phosphatase 2A regulatory B subunit family protein. AT5G42030 encodes an ABL interactor-like protein 4. AT1G19025...”
NP_001017717 gamma-butyrobetaine dioxygenase from Danio rerio
Aligns to 54:138 / 325 (26.2%), covers 94.1% of PF06155, 68.2 bits
- Collembase: a repository for springtail genomics and soil quality assessment
Timmermans, BMC genomics 2007 - “...Aspergillus nidulans XP_001397474 1e-19 Haloacid dehalogenase-like hydrolase Neosartorya fischeri XP_001260321 2e-19 Hypothetical protein Danio rerio NP_001017717 8e-06 Fcc01457 (8) Cytochrome c oxidase s.u.II Folsomia candida AAS66294 7e-93 Fcc03109 (3) No Significant Hit - - Fcc00170 (27) Alpha-aminoadipyl-cysteinyl -valine synthetase Lysobacter lactamgenus BAA08846 4e-58 B. Normalized Fcc00179...”
XP_002293925 predicted protein from Thalassiosira pseudonana CCMP1335
Aligns to 352:437 / 439 (19.6%), covers 94.1% of PF06155, 64.5 bits
orf19.4316 potential gamma-butyrobetaine hydroxylase from Candida albicans (see paper)
Aligns to 8:89 / 396 (20.7%), covers 90.6% of PF06155, 62.9 bits
- CharProtDB CGD description: Trimethyllysine dioxygenase, the first enzyme in the carnitine biosynthesis pathway; hyphal-induced expression, regulated by Cyr1p, Ras1p, Efg1p
P80193 γ-butyrobetaine hydroxylase subunit (EC 1.14.11.1) from Pseudomonas sp. (strain AK-1) (see 5 papers)
P80193 gamma-butyrobetaine dioxygenase (EC 1.14.11.1) from Pseudomonas sp. (see 2 papers)
Aligns to 19:101 / 383 (21.7%), covers 89.4% of PF06155, 62.0 bits
Bbox1 / Q9QZU7 γ-butyrobetaine hydroxylase subunit (EC 1.14.11.1) from Rattus norvegicus (see paper)
BODG_RAT / Q9QZU7 Gamma-butyrobetaine dioxygenase; Gamma-butyrobetaine hydroxylase; Gamma-BBH; Gamma-butyrobetaine,2-oxoglutarate dioxygenase; EC 1.14.11.1 from Rattus norvegicus (Rat) (see paper)
Q9QZU7 gamma-butyrobetaine dioxygenase (EC 1.14.11.1) from Rattus norvegicus (see paper)
Aligns to 9:92 / 387 (21.7%), covers 91.8% of PF06155, 61.7 bits
BBOX1 / O75936 γ-butyrobetaine dioxygenase (EC 1.14.11.1) from Homo sapiens (see 4 papers)
BODG_HUMAN / O75936 Gamma-butyrobetaine dioxygenase; Gamma-butyrobetaine hydroxylase; Gamma-BBH; Gamma-butyrobetaine,2-oxoglutarate dioxygenase; EC 1.14.11.1 from Homo sapiens (Human) (see paper)
O75936 gamma-butyrobetaine dioxygenase (EC 1.14.11.1) from Homo sapiens (see 5 papers)
Aligns to 9:92 / 387 (21.7%), covers 90.6% of PF06155, 59.2 bits
3o2gA / O75936 Crystal structure of human gamma-butyrobetaine,2-oxoglutarate dioxygenase 1 (bbox1) (see paper)
Aligns to 10:93 / 386 (21.8%), covers 90.6% of PF06155, 59.2 bits
- Ligands: zinc ion; 3-carboxy-n,n,n-trimethylpropan-1-aminium (3o2gA)
B5Y591 Uncharacterized protein (Fragment) from Phaeodactylum tricornutum (strain CCAP 1055/1)
Aligns to 346:436 / 438 (20.8%), covers 81.2% of PF06155, 56.7 bits
CG10814 uncharacterized protein from Drosophila melanogaster
Aligns to 20:106 / 402 (21.6%), covers 96.5% of PF06155, 55.8 bits
- The Reversible Carnitine Palmitoyltransferase 1 Inhibitor (Teglicar) Ameliorates the Neurodegenerative Phenotype in a Drosophila Huntington's Disease Model by Acting on the Expression of Carnitine-Related Genes
Bertapelle, Molecules (Basel, Switzerland) 2022 - “...play a role in age-related neurodegeneration in Drosophila [ 33 , 36 ]. These include CG10814 gene, the putative orthologue of the human BBD gene [ 18 , 36 ], which catalyses the final step of carnitine biosynthesis, and dHNF4 , which is thought to be...”
- “...dHNF4 gene, the master regulator of -oxidation in the fly [ 37 ]; and the CG10814 gene, a putative orthologue of the human BBD gene, that encodes the enzyme that catalyses the final step of carnitine biosynthesis [ 36 ]. Our data clearly indicated transcriptional deregulation...”
- L-Carnitine in Drosophila: A Review
Carillo, Antioxidants (Basel, Switzerland) 2020 - “...of the Drosophila brain during aging, Laranjeira et al. [ 39 ] suggested that the CG10814 gene was the most likely ortholog for the h - BBH1 gene, sharing with this the lack of a mitochondrial targeting sequence. Interestingly, these authors reported that CG10814 transcription levels...”
- “...functional decline of the brain following the neuronal downregulation of some genes as well as CG10814 , the ortholog for the h-BBH and DmelHNF4 (hepatocyte nuclear factor 4), the receptor that is supposed to work like PPAR- in vertebrates [ 149 ]. This gene can sense...”
- Genes Related to Fatty Acid β-Oxidation Play a Role in the Functional Decline of the Drosophila Brain with Age
Laranjeira, PloS one 2016 - “...process of fatty acid -oxidation in the nervous tissue of female wild-type flies. Downregulation of CG10814, dHNF4 and lipid mobilizing genes bmm and dAkh rescues the functional decline of the brain with age, both at the cellular and behaviour level, while over-expression worsens performance. Our data...”
- “...(CG4027) AGTCCGGCCCCTCCATT CTGATCCTCTTGCCCAGACAA Bmm (CG5295) ATTGAAACACGGGGTCCATA GCCAGAGTAATGGTGGAGGA dAkh (CG1171) AACGAAATGCTGCTCGAGAT GTGTGCGTGCTAGACATCGT dHNF4 (CG9310) CAAAGGATTCTTCAGGAGGAGT GTCCTTGTCCACAACGC CG10814 TTCACAATATCTGGAGGGCAC GAATGCTGTGGTTGATGCG Quantification of food intake Quantification of food intake by female flies was performed as described in protocols previously published, by quantifying the uptake of a blue dye added...”
- Quercetin ameliorates Aβ toxicity in Drosophila AD model by modulating cell cycle-related protein expression
Kong, Oncotarget 2016 - “...Mcm3, PCNA, Mcm2 up FoxO signaling pathway CycB, CG10924, polo, CycB3 up Lysine degradation Su, CG10814 down Hypoxia response via HIF activation dhd up De novo pyrimidine deoxyribonucleotide biosynthesis RnrS up Pentose and glucuronate interconversions UGP, Ugt86Dd down Oxidative stress response dhd up Starch and sucrose...”
- Differential gene expression related to Nora virus infection of Drosophila melanogaster
Cordes, Virus research 2013 - “..., BtbVII , Maltase A4 [Mal-A4] , Mal-B2 , CG1600 , CG7059 , CG10588 , CG10814 , CG11257 , CG13650 , CG15534 , CG31089 , CG31926 , CG31928 , CG32523 , and Npc2e ), and immune system (GO:0002376; 1; 3.7; 3.3; CG7763 ). 3.3. qRT-PCR validation...”
- “...response ( Ryu et al., 2010 ). Also, several genes involved in redox reactions ( CG10814 , CG1600 , and CG11257 ) were up-regulated, possibly during the production or removal of ROS. Although no observable increase in viral titer was derived from knockout of highly characterized...”
- A new in vivo model of pantothenate kinase-associated neurodegeneration reveals a surprising role for transcriptional regulation in pathogenesis
Pandey, Frontiers in cellular neuroscience 2013 - “...in the microarray assay ( sepia and pdh downregualted in tim-fbl flies and esg and CG10814 upregulated in the PKAN model; Figure 6D ). Figure 6 Microarray data point to eye degeneration as a highly altered pathway in tim-fbl flies and validation of microarray expression analysis...”
- “...immediate response to the drop of CoA levels upon inhibition of dPanK expression. For example, CG10814, an enzyme with gamma-butyrobetaine dioxygenase activity involved in the synthesis of carnitine [the main transporter of acetyl-CoA into the mitochondria (McGarry and Brown, 1997 )] was 15-fold upregulated. Many stress...”
- Dynamic, mating-induced gene expression changes in female head and brain tissues of Drosophila melanogaster
Dalton, BMC genomics 2010 - “...Lsp2 16.60 9.39E-08 1 FBgn0002563 Lsp1beta 9.10 3.69E-07 2 FBgn0039685 Obp99b 9.09 1.93E-05 17 FBgn0033830 CG10814 6.59 1.66E-05 16 FBgn0030073 CG10962 5.41 2.73E-05 20 Higher in females 72 hours post-mating Flybase symbol Fold-change FDR FDR rank FBgn0037612 CG8112 2.17 4.10E-04 20 FBgn0052523 CG32523 2.35 7.54E-05 7...”
- “...3.01E-06 2 Lower in females 72 hours post-mating Flybase symbol Fold-change FDR FDR rank FBgn0033830 CG10814 7.87 2.67E-06 1 FBgn0039685 Obp99b 5.65 3.98E-06 3 FBgn0039298 to 4.18 1.01E-05 5 FBgn0031432 Cyp309a1 3.27 9.35E-05 10 FBgn0029158 Las 3.11 8.46E-05 9 The rapidity of the gene expression response...”
CIMG_03536 trimethyllysine dioxygenase from Coccidioides immitis RS
Aligns to 76:158 / 450 (18.4%), covers 81.2% of PF06155, 53.8 bits
STR8_STRTC / A0A384XR80 Dioxygenase str8; Strobilurin A biosynthesis cluster protein r8; EC 1.14.-.- from Strobilurus tenacellus (see 3 papers)
Aligns to 58:129 / 422 (17.1%), covers 76.5% of PF06155, 52.7 bits
- function: Dioxygenase; part of the gene cluster that mediates the biosynthesis of strobilurin A, an antifungal polyketide that contains a key beta-methoxyacrylate toxophore that targets the complex III of the mitochondrial electron transport chain (PubMed:30258052). Strobilurin biosynthesis begins with construction of benzoyl CoA by step-wise elimination of ammonia from phenylalanine by the phenylalanine ammonia- lyase str11, oxygenation by str8 and retro-Claisen reaction to form benzoic acid, which is activated to its CoA thiolester benzoyl CoA by the dedicated CoA ligase str10 (PubMed:30258052). Benzoyl CoA forms the starter unit for the highly reducing polyketide synthase stpks1 that produces the polyketide prestrobilutin A (PubMed:30258052). The FAD- dependent oxygenase str9 then catalyzes the key oxidative rearrangement responsible for the creation of the beta-methoxyacrylate toxophore (PubMed:30258052). Str9 performs epoxidation of the 2,3 olefin of prestrobilutin A, followed by Meinwald rearrangement to furnish the aldehyde intermediate (Probable). Rapid enolization of the aldehyde intermediate would give the beta-methoxyacrylate skeleton and methylations catalyzed by str2 and str3 complete the synthesis and lead to the production of strobilurin A (Probable). The short-chain dehydrogenase stl2 and the dehydrogenase str4 play a role in the shunt pathway leading to the production of bolineol (PubMed:30258052). The cluster encodes no obvious halogenase gene that could be involved in production of strobilurin B, nor any obvious dimethylallyl-transferase that could be involved in the production of strobilurin G (Probable). It is possible that unknown proteins encoded in, or near, the cluster (such as str1 or stl1) may form new classes of halogenases or dimethylally-transferases, or that the responsible genes are located elsewhere on the genome (Probable). Similarly, proteins encoded by str5/str6 hydrolases appear to have no chemical role in the biosynthesis of strobilurin A (Probable). Finally, no obvious self- resistance gene is found within the cluster (Probable).
cofactor: Fe(2+) (Binds 1 Fe(2+) ion per subunit.)
LOC107439896 gamma-butyrobetaine dioxygenase from Parasteatoda tepidariorum
Aligns to 59:146 / 447 (19.7%), covers 94.1% of PF06155, 49.9 bits
XP_006535917 trimethyllysine dioxygenase, mitochondrial isoform X2 from Mus musculus
Aligns to 51:134 / 342 (24.6%), covers 96.5% of PF06155, 47.9 bits
TMLH_MOUSE / Q91ZE0 Trimethyllysine dioxygenase, mitochondrial; Epsilon-trimethyllysine 2-oxoglutarate dioxygenase; TML hydroxylase; TML-alpha-ketoglutarate dioxygenase; TML dioxygenase; TMLD; EC 1.14.11.8 from Mus musculus (Mouse) (see paper)
Q91ZE0 trimethyllysine dioxygenase (EC 1.14.11.8) from Mus musculus (see 2 papers)
Aligns to 51:134 / 421 (20.0%), covers 96.5% of PF06155, 47.6 bits
- function: Converts trimethyllysine (TML) into hydroxytrimethyllysine (HTML).
catalytic activity: 2-oxoglutarate + N(6),N(6),N(6)-trimethyl-L-lysine + O2 = (3S)-3-hydroxy-N(6),N(6),N(6)-trimethyl-L-lysine + CO2 + succinate (RHEA:14181)
cofactor: Fe(2+) (Binds 1 Fe(2+) ion per subunit.)
cofactor: L-ascorbate
subunit: Homodimer. - Hippocampal Proteomic Analysis in Male Mice Following Aggressive Behavior Induced by Long-Term Administration of Perampanel
Yang, ACS omega 2022 - “...1 1.20656536 0.033370933 Q99K95 replication termination factor 2, GN = Rtf2 3 1 1.194115843 0.036390341 Q91ZE0 trimethyllysine dioxygenase, mitochondrial, GN = Tmlhe 2 1 1.190253971 0.030854053 Q8VBT0 thioredoxin-related transmembrane protein 1, GN = Tmx1 23 8 1.187900082 0.029794138 Q61333 tumor necrosis factor alpha-induced protein 2, GN...”
- AAV9-TAZ Gene Replacement Ameliorates Cardiac TMT Proteomic Profiles in a Mouse Model of Barth Syndrome
Suzuki-Hatano, Molecular therapy. Methods & clinical development 2019 - “...following AAV treatment. The first enzyme in the L-carnitine biosynthetic pathway, trimethyllysine dioxygenase (Tmlhe) (UniProt: Q91ZE0 ), also displayed a significantly reduced expression level in BTHS that was improved with gene therapy. Figure5 MS2 Spectra for Representative Proteins Identified by TMT Reporter ions for each are...”
- A new non-canonical pathway of Gα(q) protein regulating mitochondrial dynamics and bioenergetics
Benincá, Cellular signalling 2014 - “...424 43.9 8.44 68.46 3-ketoacyl-CoA thiolase A, peroxisomal OS=Mus musculus GN=Acaa1a PE=2 SV=1 - [THIKA_MOUSE] Q91ZE0 46.08 23 15 421 49.6 8.25 67.29 Trimethyllysine dioxygenase, mitochondrial OS=Mus musculus GN=Tmlhe PE=2 SV=2 - [TMLH_MOUSE] P18872 44.63 22 14 354 40.1 5.53 63.74 Guanine nucleotide-binding protein G(o) subunit...”
Tmlhe / Q91ZW6 ε-N-trimethyllysine hydroxylase subunit (EC 1.14.11.8) from Rattus norvegicus (see paper)
TMLH_RAT / Q91ZW6 Trimethyllysine dioxygenase, mitochondrial; Epsilon-trimethyllysine 2-oxoglutarate dioxygenase; TML hydroxylase; TML-alpha-ketoglutarate dioxygenase; TML dioxygenase; TMLD; EC 1.14.11.8 from Rattus norvegicus (Rat) (see paper)
Q91ZW6 trimethyllysine dioxygenase (EC 1.14.11.8) from Rattus norvegicus (see paper)
Aligns to 51:134 / 421 (20.0%), covers 96.5% of PF06155, 47.2 bits
- function: Converts trimethyllysine (TML) into hydroxytrimethyllysine (HTML) (PubMed:11431483).
catalytic activity: 2-oxoglutarate + N(6),N(6),N(6)-trimethyl-L-lysine + O2 = (3S)-3-hydroxy-N(6),N(6),N(6)-trimethyl-L-lysine + CO2 + succinate (RHEA:14181)
cofactor: Fe(2+) (Binds 1 Fe(2+) ion per subunit.)
cofactor: L-ascorbate
subunit: Homodimer. - Proteomics to Metabolomics: A New Insight into the Pathogenesis of Hypertensive Nephropathy
Eshraghi, Kidney & blood pressure research 2023 - “...subunit 1 1.195 0.033 P81795 Eif2s3 Eukaryotic translation initiation factor 2 subunit 3 1.134 0.038 Q91ZW6 Tmlhe Trimethyllysine dioxygenase, mitochondrial 0.998 0.035 Q920A6 Scpep1 Retinoid-inducible serine carboxypeptidase 0.920 0.040 B0BNC9 Cryzl2 Quinone oxidoreductase-like protein 2 0.892 0.031 PXD012889 (inner cortex) G3V7K3 Cp Ceruloplasmin 7.772 0.010 M0RBF1...”
- Systems Biology and Chemoinformatics-Based Strategies to Explore the Biological Mechanism of Fugui Wenyang Decoction in Treating Vascular Dementia Rats
Yang, Oxidative medicine and cellular longevity 2021 - “...Crooked neck-like protein 1 Up R9PXS3 Transcription elongation factor, mitochondrial Up A0A0G2K1C7 Protein RGD1566386 Up Q91ZW6 Trimethyllysine dioxygenase, mitochondrial Up F1M3H3 Protein Frasl Up P28470 Calcineurin subunit B type 2 Up M0RRJ7 Complement C3 Up Q5U2R9 Protein Scfd2 Up B0BNJ9 RCG44002, isoform CRA a Up Q5HZD9...”
TMLHE / Q9NVH6 trimethyllysine dioxygenase, mitochondrial (EC 1.14.11.8) from Homo sapiens (see 4 papers)
TMLH_HUMAN / Q9NVH6 Trimethyllysine dioxygenase, mitochondrial; Epsilon-trimethyllysine 2-oxoglutarate dioxygenase; Epsilon-trimethyllysine hydroxylase; TML hydroxylase; TML-alpha-ketoglutarate dioxygenase; TML dioxygenase; TMLD; EC 1.14.11.8 from Homo sapiens (Human) (see 7 papers)
Q9NVH6 trimethyllysine dioxygenase (EC 1.14.11.8) from Homo sapiens (see 6 papers)
Aligns to 37:134 / 421 (23.3%), covers 95.3% of PF06155, 45.2 bits
- function: Converts trimethyllysine (TML) into hydroxytrimethyllysine (HTML) (PubMed:11431483, PubMed:23092983).
catalytic activity: 2-oxoglutarate + N(6),N(6),N(6)-trimethyl-L-lysine + O2 = (3S)-3-hydroxy-N(6),N(6),N(6)-trimethyl-L-lysine + CO2 + succinate (RHEA:14181)
cofactor: Fe(2+) (Binds 1 Fe(2+) ion per subunit.)
cofactor: L-ascorbate
subunit: Homodimer. - New Insights into the Neuromyogenic Spectrum of a Gain of Function Mutation in SPTLC1.
Kölbel, Genes 2022 - “...CARS2 Probable cysteine-tRNA ligase, mitochondrial 9 0.54 0.000 Combined oxidative phosphorylation deficiency 27 COXPD27; MIM:616672 Q9NVH6 TMLHE Trimethyllysine dioxygenase, mitochondrial 2 0.54 0.004 Autism, X-linked 6 AUTSX6; MIM:300872 Q9ULJ6 ZMIZ1 Zinc finger MIZ domain-containing protein 1 2 0.51 0.019 Neurodevelopmental disorder with dysmorphic facies and distal...”
- Component Identification of Phenolic Acids in Cell Suspension Cultures of Saussureainvolucrata and Its Mechanism of Anti-Hepatoma Revealed by TMT Quantitative Proteomics
Gao, Foods (Basel, Switzerland) 2021 - “...digestion and absorption 1 4 27 3214 E1B4S8 00310 Lysine degradation 2 36 27 3214 Q9NVH6 Q08426 03320 PPAR signaling pathway 2 36 27 3214 A0A140VKG0 Q08426 05412 Arrhythmogenic right ventricular cardiomyopathy (ARVC) 2 37 27 3214 P17301 E7ESP4 04610 Complement and coagulation cascades 2 40...”
- “...E7ESP4 Integrin alpha-2 P47989 Xanthine dehydrogenase/oxidase O15264 Mitogen-activated protein kinase 13 E1B4S8 Apolipoprotein B (Fragment) Q9NVH6 Trimethyllysine dioxygenase Q08426 Peroxisomal bifunctional enzyme A0A0F7G8J1 Plasminogen Q19UG4 Christmas factor (Fragment) Prot ID: the enriched protein list; description: the function of the protein described in the database. foods-10-02466-t007_Table 7...”
- Effects of thyroid hormone on mitochondria and metabolism of human preimplantation embryos.
Noli, Stem cells (Dayton, Ohio) 2020 - “...Ubiquinolcytochrome c reductase, complex III subunit X, Q9UDW1 Complex 3 subunit TMLHE, Trimethyllysine hydroxylase, epsilon, Q9NVH6 Carnitine biosynthesis and succinate generation COA4, Cytochrome c oxidase assembly factor 4 homolog, Q9NYJ1 Complex 4 assembly factor MRPL37, Mitochondrial ribosomal protein L37, Q9BZE1 Mitoribosome subunit involved in translating mitochondrial...”
- Comparative Proteomic Analysis of Visceral Adipose Tissue in Morbidly Obese and Normal Weight Chinese Women.
Shang, International journal of endocrinology 2019 - “...DCLK1 0.305100359 Down P23297 S100A1 Protein S100-A1 0.307875276 Down P99999 CYCS Cytochrome c 0.315465993 Down Q9NVH6 TMLHE Trimethyllysine dioxygenase, mitochondrial 0.325505242 Down P21589 NT5E 5-nucleotidase 0.334139431 Down P12277 CKB Creatine kinase B-type 0.341811143 Down P07451 CA3 Carbonic anhydrase 3 0.342863108 Down P01766 Ig heavy chain V-III...”
- Inhibition of MAPKs, Myc/Max, NFκB, and hypoxia pathways by Phyllanthus prevents proliferation, metastasis and angiogenesis in human melanoma (MeWo) cancer cell line.
Tang, International journal of medical sciences 2014 - “...Q8WVM8 Sec1 family domain-containing protein 1 -1.44 -1.56 -1.64 -1.54 -1.76 -1.65 -1.75 -1.64 52 Q9NVH6 Trimethyllysine dioxygenase, mitochondrial -1.58 -1.48 -1.58 -1.54 -1.79 -1.68 -1.53 -1.66...”
Q0VC74 Trimethyllysine dioxygenase, mitochondrial from Bos taurus
Aligns to 41:134 / 421 (22.3%), covers 95.3% of PF06155, 44.6 bits
XP_011529484 trimethyllysine dioxygenase, mitochondrial isoform X1 from Homo sapiens
Aligns to 5:83 / 370 (21.4%), covers 78.8% of PF06155, 42.5 bits
- Investigating the active site of human trimethyllysine hydroxylase.
Wang, The Biochemical journal 2019 (PubMed)- GeneRIF: This work demonstrates the importance of the recognition sites that contribute to the enzymatic activity of TMLH: the Fe(II)-binding H242-D244-H389 residues, R391-R398 involved in 2OG binding and several residues (D231, N334 and the aromatic cage comprised of W221, Y217 and Y234) associated with binding of (2S)-N (epsilon)-trimethyllysine.
- Complex recombination with deletion in the F8 and duplication in the TMLHE mediated by int22h copies during early embryogenesis.
Chen, Thrombosis and haemostasis 2017 (PubMed)- GeneRIF: Case Report: complex recombination with deletion in the F8 and duplication in the TMLHE mediated by int22h copies during early embryogenesis in proband's mother.
- A common X-linked inborn error of carnitine biosynthesis may be a risk factor for nondysmorphic autism.
Celestino-Soper, Proceedings of the National Academy of Sciences of the United States of America 2012 - GeneRIF: TMLHE deficiency is common in control males and was not significantly increased in frequency in probands from simplex autism families, however, it was 2.82-fold more frequent in probands from male-male multiplex autism families.
- Analysis of the chromosome X exome in patients with autism spectrum disorders identified novel candidate genes, including TMLHE.
Nava, Translational psychiatry 2012 - GeneRIF: Study found 3 mutations in TMLHE to be associated with autism spectrum disorder, c.229C>T/p.Arg77X, c.730G>C/p.Asp244His, and c.1107G>T/p.Glu369Asp.
- Use of array CGH to detect exonic copy number variants throughout the genome in autism families detects a novel deletion in TMLHE.
Celestino-Soper, Human molecular genetics 2011 - GeneRIF: Use of array CGH to detect exonic copy number variants throughout the genome in autism families detects a novel deletion in TMLHE.
- Functional characterization of the TMLH gene: promoter analysis, in situ hybridization, identification and mapping of alternative splicing variants.
Monfregola, Gene 2007 (PubMed)- GeneRIF: By 5' and 3' RACE, we identified and mapped two alternative 5' TMLH first exons and seven alternative 3'-splice variants.
- Functional analysis of TMLH variants and definition of domains required for catalytic activity and mitochondrial targeting.
Monfregola, Journal of cellular physiology 2005 (PubMed)- GeneRIF: C-terminal region of trimethyllysine hydroxylase, epsilon contains the main determinants for its enzymatic activity including a key H389 residue
CH_124288 gamma-butyrobetaine dioxygenase from Magnaporthe grisea 70-15 (see paper)
Aligns to 182:273 / 573 (16.1%), covers 84.7% of PF06155, 42.2 bits
CG14630 uncharacterized protein from Drosophila melanogaster
Aligns to 27:107 / 406 (20.0%), covers 89.4% of PF06155, 41.0 bits
- L-Carnitine in Drosophila: A Review
Carillo, Antioxidants (Basel, Switzerland) 2020 - “...[ 18 , 68 ]. In the Drosophila genome, there are three paralogous genes ( CG14630, CG5321, CG10184 ) that are considered putative orthologs for the human - BBH1 (-ButyroBetaine Hydroxylase 1) gene. In a recent study that aimed to identify genes contributing to the functional...”
- Daily Regulation of Phototransduction, Circadian Clock, DNA Repair, and Immune Gene Expression by Heme Oxygenase in the Retina of Drosophila
Damulewicz, Genes 2018 - “..., Cyp6a14 , CG10512, Cyp9h1 , CG11236, CG18170, CG3397, CG14688, Prx2540-2 , CG7724, Cyp4p2 , CG14630, Sodh-2 , Fmo-2 , GILT3 Cellular Macromolecule Metabolic Process (GO:0044260) 17 5.03 E-02 CG13085, Su(var)2-10 , CG43143, Lkr , mus308 , fng , qrk58E-1 , MED23 , S6k , Sse...”
- “...Jhe , CG6415, CG14688, Gnmt , Prx2540-2 , CG7724, Sk1 , ade3 , Cyp4p2 , CG14630, Sodh-2 , Fmo-2 , Lsd-1 , GILT3 Defense Response to Other Organism (GO:0098542) 14 2.28 E-01 AttD , Drsl6 , CecA1 , Su(var)2-10 , CecC , AttA , Thor ,...”
- Role of fat body lipogenesis in protection against the effects of caloric overload in Drosophila
Musselman, The Journal of biological chemistry 2013 - “...CG9527 CG17544 CG9547 CG9709 CG9707 CG8778 CG5044 CG14630 Obese cg-GAL4; UAS-king-tubbyi larvae had significantly lower hemolymph glucose levels (Fig. 6K),...”
- “...cg5840, cg6870, cg7280, cg8193, cg9512, cg9547, cg10962, cg14630, cg14946, cg17544, cg31169, cg33099, cyp6a8, cyp6a9, cyp6a18, cyp6a21, cyp6d4, cyp6d5, cyp6v1,...”
- The genomic response to courtship song stimulation in female Drosophila melanogaster
Immonen, Proceedings. Biological sciences 2012 - “...trn qkr58E-3 Att-A Gld X11Lbeta skf CG10635 Thd1 CG10889 CG14630 mthl8 CG7861 Cys Oseg1 CG10962 Pink1 Cyp6a14 CG31708 mbl CG11093 GstE9 CG5966 Nkd Atg5 CG4678...”
- From first base: the sequence of the tip of the X chromosome of Drosophila melanogaster, a comparison of two sequencing strategies
Benos, Genome research 2001 - “...GH24974 LD08339 CG3690 CG11639 CG11638 CG3021 CG3658 CG14630 CG3019 CG14629 CG3655 CG14628 CG11392 CG11378 CG11384 CG11379 CG14627 CG14626 CG11380 CG14625...”
PF3D7_1128500 uncharacterized protein from Plasmodium falciparum 3D7
Aligns to 576:693 / 718 (16.4%), covers 74.1% of PF06155, 39.7 bits
- Identification of vital and dispensable sulfur utilization factors in the Plasmodium apicoplast
Haussig, PloS one 2014 - “...non-mito 0.0141 PBANKA_083490 PF3D7_0934100 XPD/ERCC2, DNA excision-repair helicase, putative / no SP non-mito 0.0106 PBANKA_091970 PF3D7_1128500 conserved protein, unknown function / non-mito 0.1301 PBANKA_101520 PF3D7_1429500 diphthamide synthesis protein, putative / no SP non-mito 0.2517 PBANKA_102890 PF3D7_1413800 diphthamide synthesis protein, putative / no SP possibly 0.0176 PBANKA_103410...”
M8BTT2 Protein mrp-like protein from Aegilops tauschii
Aligns to 329:427 / 446 (22.2%), covers 74.1% of PF06155, 37.0 bits
- iTRAQ and virus-induced gene silencing revealed three proteins involved in cold response in bread wheat.
Zhang, Scientific reports 2017 - “...at the mRNA and protein levels Seven of the downregulated proteins [i.e., protein mrp-like protein (M8BTT2), histidyl-tRNA synthetase (M7YSY0), non-specific lipid-transfer protein (M7YJJ9), peroxidase 12(M8C3D9), VER2 (O80370), cytochrome b6-f complex iron-sulfur subunit, chloroplastic-like (I1GTJ6), putative lipoxygenase 4 (M8BYV1)] and thirteen of the upregulated proteins [i.e., Late...”
PBANKA_091970 Fe-S cluster assembly protein, putative from Plasmodium berghei ANKA
Aligns to 538:626 / 651 (13.7%), covers 75.3% of PF06155, 35.7 bits
6npbB / A0A4V8H042 X-ray crystal structure of tmpa, 2-trimethylaminoethylphosphonate hydroxylase, with fe and 2og (see paper)
Aligns to 7:92 / 378 (22.8%), covers 94.1% of PF06155, 33.8 bits
- Ligand: fe (ii) ion (6npbB)
tmpA / A0A4V8H042 (2-trimethylamino)ethylphosphonate dioxygenase (EC 1.14.11.72) from Leisingera caerulea (see paper)
TMPA_LEICA / A0A4V8H042 [2-(trimethylamino)ethyl]phosphonate dioxygenase; TMAEP hydroxylase; EC 1.14.11.72 from Leisingera caerulea (Phaeobacter caeruleus) (see paper)
A0A4V8H042 [2-(trimethylamino)ethyl]phosphonate dioxygenase (EC 1.14.11.72) from Leisingera caerulea (see paper)
Aligns to 5:90 / 377 (22.8%), covers 94.1% of PF06155, 33.8 bits
- function: Involved in the degradation of the naturally occurring organophosphonate 2-(trimethylammonio)ethylphosphonate (TMAEP) (PubMed:30789718). Catalyzes the hydroxylation of TMAEP to (R)-1- hydroxy-2-(trimethylammonio)ethylphosphonate (OH-TMAEP) (PubMed:30789718). Is highly specific for its N-trimethylated substrate (PubMed:30789718). Cannot use gamma-butyrobetaine as substrate (PubMed:30789718).
catalytic activity: 2-oxoglutarate + [2-(trimethylamino)ethyl]phosphonate + O2 = [(1R)-1-hydroxy-2-(trimethylamino)ethyl]phosphonate + CO2 + succinate (RHEA:11380)
cofactor: Fe(2+) (Binds 1 Fe(2+) ion per subunit.)
cofactor: L-ascorbate
subunit: Homodimer.
HF101_ARATH / Q6STH5 Fe-S cluster assembly factor HCF101, chloroplastic; Protein HIGH CHLOROPHYLL FLUORESCENCE 101 from Arabidopsis thaliana (Mouse-ear cress) (see 3 papers)
HCF101, NP_189086 ATP binding protein from Arabidopsis thaliana
AT3G24430 HCF101 (HIGH-CHLOROPHYLL-FLUORESCENCE 101); ATP binding from Arabidopsis thaliana
Aligns to 431:516 / 532 (16.2%), covers 69.4% of PF06155, 31.7 bits
- function: Required for photosystem I (PSI) biosynthesis and assembly. May serve as a chloroplast scaffold protein that specifically assembles iron-sulfur (4Fe-4S) clusters and transfers them to the chloroplast PSI and ferredoxin-thioredoxin (FTR) complexes. Can assemble a 4Fe-4S cluster and transfer it to apoproteins in yeast cells. Probably not required for assembly or stability of plastidic 2Fe-2S clusters.
cofactor: [4Fe-4S] cluster (Binds 1 [4Fe-4S] cluster.)
disruption phenotype: Seedling lethality when homozygous due to impaired photosystem I (PSI). - Loss of CpFTSY Reduces Photosynthetic Performance and Affects Insertion of PsaC of PSI in Diatoms
Nymark, Plant & cell physiology 2023 - “...FeS clusters in the chloroplast was increased in the diatom cpftsy mutants( Table 2 ). HCF101 is universally conserved and essential for the assembly of the [4Fe4S]-containing PSI in plants ( Lezhneva etal. 2004 ), whereas the SufE- and BolA-domain protein detected in our analyses is...”
- “...24529448 Lezhneva L. , Amann K. and Meurer J. ( 2004 ) The universally conserved HCF101 protein is involved in assembly of [4Fe-4S]-cluster-containing complexes in Arabidopsis thaliana chloroplasts . Plant J. 37 : 174 185 . 14690502 Li Z.R. , Wakao S. , Fischer B.B. and...”
- Biogenic Volatile Organic Compounds and Protein Expressions of Chamaecyparis formosensis and Chamaecyparis obtusa var. formosana Leaves under Different Light Intensities and Temperatures
Chen, Plants (Basel, Switzerland) 2022 - “...mol m 2 s 1 ). In contrast, the expression of Fe-S cluster assembly factor HCF101 (HCF101, spot O162) decreased with increasing light intensity ( Figure 5 and Table S3 ). Among these proteins, Lhcb6 was one of the light-harvesting chlorophyll a/b-binding (LHC) proteins, which not...”
- “...suffered by C. obtusa var. formosana saplings at high light intensities. On the other hand, HCF101, an indispensable member participating in PSI, decreased its expression at high light intensities. HCF101 is responsible for assembling iron-sulfur (4Fe-4S) clusters and transferring them to PSI and ferredoxin-thioredoxin reductase (FTR)...”
- iTRAQ Proteomic Analysis of Wheat (Triticum aestivum L.) Genotypes Differing in Waterlogging Tolerance
Yang, Frontiers in plant science 2022 - “...Redox TRIAE_CS42_4BL_TGACv1_321826_AA1065960.1 1.18 Heat shock protein 101 Stress response TRIAE_CS42_3AL_TGACv1_195570_AA0651350.1 0.33 Fe-S cluster assembly factor HCF101 Chloroplast TRIAE_CS42_3AL_TGACv1_195570_AA0651350.2 0.33 Fe-S cluster assembly factor HCF101 Chloroplast TRIAE_CS42_3AL_TGACv1_195570_AA0651350.3 0.33 Fe-S cluster assembly factor HCF101 Chloroplast TRIAE_CS42_3DL_TGACv1_250912_AA0874940.1 0.33 Fe-S cluster assembly factor HCF101 Chloroplast TRIAE_CS42_3DL_TGACv1_250912_AA0874940.2 0.33 Fe-S cluster assembly...”
- The Cluster Transfer Function of AtNEET Supports the Ferredoxin-Thioredoxin Network of Plant Cells
Zandalinas, Antioxidants (Basel, Switzerland) 2022 - “...Cyt, cytosol; DRE2, Homolog of Yeast DRE2; e, electron; GRXS14, Glutaredoxin S14; GRXS16, Glutaredoxin S16; HCF101, High-Chlorophyll-Fluorescence 101; Holo, holo-protein; MET18, Homolog of Yeast MET18; NAR1, Homolog of Yeast NAR1; NBP35, Nucleotide Binding Protein 35; NFS2, Nifs-Like Cysteine Desulfurase 2; n.s., not significant; SufA1, Sulfur A1;...”
- Commonalities and specialties in photosynthetic functions of PROTON GRADIENT REGULATION5 variants in Arabidopsis
Penzler, Plant physiology 2022 - “...Q9LU01 Y3IP1 Ycf3-interacting protein 1 0.665 1.27 E 02 Q6STH5 HCHF101 Fe-S cluster assembly factor HCF101 1.504 1.80 E 02 PSII biogenesis Q9SRY4 LPA1 Protein LOW PSII ACCUMULATION 1 0.322 3.53 E 03 Q9LR64 PSB27 PSII repair protein PSB27-H1 0.460 3.53 E 03 Q9ZVL6 TLP18.3 Thylakoid...”
- Comparative Transcriptome Profiling Analysis Reveals the Adaptive Molecular Mechanism of Yellow-Green Leaf in Rosa beggeriana 'Aurea'
Gan, Frontiers in plant science 2022 - “...have decreased expression in yl than WT ( Figures 5DI ). Other transcripts HCF136 and HCF101, which are required for the translation of three PSII subunit genes PsbH , PsbT , and PsbB . The cytb6f complex genes, petM and petJ , have no differential expression....”
- The iron-sulfur scaffold protein HCF101 unveils the complexity of organellar evolution in SAR, Haptista and Cryptista
Pyrih, BMC ecology and evolution 2021 - “...and Evolution 2730-7182 BioMed Central London 7980591 1777 10.1186/s12862-021-01777-x Research Article The iron-sulfur scaffold protein HCF101 unveils the complexity of organellar evolution in SAR, Haptista and Cryptista Pyrih Jan 1 rsk Vojtch 1 Fellows Justin D. 2 Grosche Christopher 3 4 Wloga Dorota 5 Striepen Boris...”
- “...unless otherwise stated in a credit line to the data. Background Nbp35-like proteins (Nbp35, Cfd1, HCF101, Ind1, and AbpC) are P-loop NTPases that serve as components of iron-sulfur cluster (FeS) assembly machineries. In eukaryotes, Ind1 is present in mitochondria, and its function is associated with the...”
- Occurrence, Evolution and Specificities of Iron-Sulfur Proteins and Maturation Factors in Chloroplasts from Algae
Przybyla-Toscano, International journal of molecular sciences 2021 - “...are respectively referred to as SufA-ErpA/SUFA1, YgfZ/IBA57.2, Grx4/GRXS14-16, BolA-YrbA/BOLA1-4, NfuA/NFU1-3 and Mrp/high chlorophyll fluorescence 101 (HCF101). Unlike GRX, SUFA, NFU and HCF101 proteins, the BOLA and IBA57 proteins do not bind any Fe-S clusters themselves. For this reason, BOLA and IBA57 proteins are sometimes referred to...”
- “...36 ] and of A. thaliana NFUs. In Arabidopsis, with the exception of the essential HCF101 protein [ 37 ], the other proteins characterized so far, including NFU1-3, are dispensable [ 38 , 39 , 40 ]. While the viability of Arabidopsis mutants has helped to...”
- More
- Commonalities and specialties in photosynthetic functions of PROTON GRADIENT REGULATION5 variants in Arabidopsis
Penzler, Plant physiology 2022 - “...protein 1 0.589 5.35 E 03 Q9LU01 Y3IP1 Ycf3-interacting protein 1 0.665 1.27 E 02 Q6STH5 HCHF101 Fe-S cluster assembly factor HCF101 1.504 1.80 E 02 PSII biogenesis Q9SRY4 LPA1 Protein LOW PSII ACCUMULATION 1 0.322 3.53 E 03 Q9LR64 PSB27 PSII repair protein PSB27-H1 0.460...”
- Drought Stress Induces Morpho-Physiological and Proteome Changes of Pandanus amaryllifolius
Amnan, Plants (Basel, Switzerland) 2022 - “...2,1-aminomutase, chloroplastic Chlorophyll biosynthesis Isomerase 3 Q9LIK0 Plastidial pyruvate kinase 1, chloroplastic Glycolysis Kinase 3 Q6STH5 Fe-S cluster assembly factor HCF101, chloroplastic iron-sulphur cluster assembly 4Fe-4S cluster binding 3 Q0E3C8 Chaperone protein ClpB3, mitochondrial Stress response Chaperone 3 Q94LW3 Homeobox protein knotted-1-like 3 Mucilage biosynthesis DNA...”
- A Sinorhizobium meliloti RpoH-Regulated Gene Is Involved in Iron-Sulfur Protein Metabolism and Effective Plant Symbiosis under Intrinsic Iron Limitation
Sasaki, Journal of bacteriology 2016 - “...Q9Y3D0), and Arabidopsis thaliana HCF101 (532 amino acids; Q6STH5). Red, identical amino acids; blue, amino acids with similar properties. Circles above the...”
- Comparative Analysis of Proteins Regulated during Cadmium Sulfide Quantum Dots Response in Arabidopsis thaliana Wild Type and Tolerant Mutants
Gallo, Nanomaterials (Basel, Switzerland) 2021 - “...have affected either At3g24330 , which encodes an O-glycosyl hydrolase localizing to the endomembrane, or At3g24430 ( HCF101 ), coding for a chloroplast-localizing ATP-binding protein. The Ds element lay within the At3g24400 pseudogene ( AtPERK2 ), which may code for a proline-rich extensin-like receptor kinase. These...”
- “...genes on chromosome 3, potentially At3g24330, encoding an O-glycosyl hydrolase localized in the endomembrane, and At3g24430 (Hcf101) encoding an ATP binding protein localized in the chloroplast. The mutagenic element lay within the At3g24400 pseudogene (AtPERK2), which possibly encodes a proline-rich extensin-like receptor kinase [ 14 ]....”
- Occurrence, Evolution and Specificities of Iron-Sulfur Proteins and Maturation Factors in Chloroplasts from Algae
Przybyla-Toscano, International journal of molecular sciences 2021 - “...NFU2 ) At4g25910 ( NFU3 ) HCF101 Cre01.g045902 Transfer protein, involved in Fe-S cluster trafficking At3g24430 ( HCF101 ) ijms-22-03175-t002_Table 2 Table 2 SUF components in representative microalgae. Sequences were retrieved in 25 species from Phycocosm ( https://phycocosm.jgi.doe.gov/phycocosm/home (accessed on 10 March 2021)) using C. reinhardtii...”
- A Global Proteomic Approach Sheds New Light on Potential Iron-Sulfur Client Proteins of the Chloroplastic Maturation Factor NFU3
Berger, International journal of molecular sciences 2020 - “...HCAR absent n.q. 2x [4Fe4S] 7-hydroxymethyl chlorophyll a (HMCHL) reductase 7-hydroxymethyl chlorophyll a (HMCHL) reductase At3g24430 HCF101 0.47 * n.v. 4Fe4S Fe-S cluster transfer High clorophyll fluorescence 101 At5g04140 GLU1 +0.79 ** +0.83 ** 3Fe4S Nitrate assimilation Glutamate synthase 1 (Fd-GOGAT) At2g41220 GLU2 n.v. n.q. 3Fe4S...”
- Regulation of Iron Homeostasis and Use in Chloroplasts
Kroh, International journal of molecular sciences 2020 - “...Cre12.g504150.t2.1 (3) Cre17.g710800.t2.1 [ 128 ] ssl2667 [ 128 ] High Chlorophyll Fluorescence 101 (HCF101) At3g24430 Cre01.g045902.t1.1 [ 128 ] slr0067 [ 128 ] Monothiol Glutaredoxins (GRXS) (14) AT3G54900 (16) AT2G38270 (14) Cre07.g325743.t1.1 (16) Cre01.g047800.t1.1 [ 128 ] WP_010871706 NEET AT5G51720 Cre01.g050550.t1.2 Heme biosynthesis Ferrochelatase (FC)...”
- High Light Acclimation Induces Chloroplast Precursor Phosphorylation and Reduces Import Efficiency
Eisa, Plants (Basel, Switzerland) 2019 - “...least three times. 4.8. Accession Numbers STY8 (At2g17700), STY17 (At4g35780), STY46 (At4g38470), pOE23 (At1g06680), pHCF101 (At3g24430), pNdhM (At4g37925) and pFNRL1 (At5g66190), pSSU (AAA34116), pLhcb1 (AT1G29930), CysP (AT5G06290), FNR (P10933), LHC (P27490), FBP (At3g54050) Acknowledgments Tamara Bergius is acknowledged for excellent technical assistance. Supplementary Materials The following...”
- Assembly and Transfer of Iron-Sulfur Clusters in the Plastid
Lu, Frontiers in plant science 2018 - “...proteins Lon et al., 2003 ; Nath et al., 2016 , 2017 Carrier protein HCF101 At3g24430 Carrier of 4Fe-4S Seedling lethal (strong alleles); reduced levels of 4Fe-4S proteins Lezhneva et al., 2004 ; Stckel and Oelmuller, 2004 ; Schwenkert et al., 2010 ; Hu et al.,...”
- Reporter Gene-Facilitated Detection of Compounds in Arabidopsis Leaf Extracts that Activate the Karrikin Signaling Pathway
Sun, Frontiers in plant science 2016 - “...DLK2 (At3g24420) and 103 bp downstream of the annotated 3 UTR of the preceding gene (At3g24430). We also included the DLK2 5UTR (31 bp). This sequence was amplified by PCR using Phusion polymerase (New England Biolabs). Oligonucleotides were (5AAAAAAGCAGGCTCAAACGCGATAACCTTTTCA3) and MW446 (5CAAGAAAGCTGGGTGCTTAAGTACAAGAGTTTTG3); regions of homology to...”
- Post-Transcriptional Coordination of the Arabidopsis Iron Deficiency Response is Partially Dependent on the E3 Ligases RING DOMAIN LIGASE1 (RGLG1) and RING DOMAIN LIGASE2 (RGLG2)
Pan, Molecular & cellular proteomics : MCP 2015 - “...EDITING FACTOR20 At1g52230 At5g42070 At5g49940 At1g67810 At3g24430 At1g12110 At2g38940 At3g58810 At5g03570 At3g06450 At1g14400 PSAH2, PHOTOSYSTEM I SUBUNIT H2...”
- More
NCU12046 gamma-butyrobetaine dioxygenase from Neurospora crassa OR74A
Aligns to 201:285 / 755 (11.3%), covers 78.8% of PF06155, 30.1 bits
TGME49_318590 MRP family domain-containing protein from Toxoplasma gondii ME49
Aligns to 545:611 / 644 (10.4%), covers 67.1% of PF06155, 24.3 bits
Or search for genetic data about PF06155 in the Fitness Browser
by Morgan Price,
Arkin group
Lawrence Berkeley National Laboratory