Family Search for PF06417 (DUF1077)

April 2024: See Interactive Tools for Functional Annotation of Bacterial Genomes for advice on using these tools.

PF06417 hits 11 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.

EMC4_HUMAN / Q5J8M3 ER membrane protein complex subunit 4; Cell proliferation-inducing gene 17 protein; Transmembrane protein 85 from Homo sapiens (Human) (see 7 papers)
NP_057538 ER membrane protein complex subunit 4 isoform a from Homo sapiens
Aligns to 56:170 / 183 (62.8%), covers 97.5% of PF06417, 157.4 bits

• function: Part of the endoplasmic reticulum membrane protein complex (EMC) that enables the energy-independent insertion into endoplasmic reticulum membranes of newly synthesized membrane proteins (PubMed:30415835, PubMed:29809151, PubMed:29242231, PubMed:32459176, PubMed:32439656). Preferentially accommodates proteins with transmembrane domains that are weakly hydrophobic or contain destabilizing features such as charged and aromatic residues (PubMed:30415835, PubMed:29809151, PubMed:29242231). Involved in the cotranslational insertion of multi-pass membrane proteins in which stop-transfer membrane-anchor sequences become ER membrane spanning helices (PubMed:30415835, PubMed:29809151). It is also required for the post-translational insertion of tail-anchored/TA proteins in endoplasmic reticulum membranes (PubMed:29809151, PubMed:29242231). By mediating the proper cotranslational insertion of N-terminal transmembrane domains in an N-exo topology, with translocated N- terminus in the lumen of the ER, controls the topology of multi-pass membrane proteins like the G protein-coupled receptors (PubMed:30415835). By regulating the insertion of various proteins in membranes, it is indirectly involved in many cellular processes (Probable).
  subunit: Component of the ER membrane protein complex (EMC).
• Selective EMC subunits act as molecular tethers of intracellular organelles exploited during viral entry.
  Bagchi, Nature communications 2020
  • GeneRIF: ER membrane protein complex subunit 4 (EMC4) and EMC7 support SV40 infection by promoting from the late endosome (LE) to the endoplasmic reticulum (ER) targeting of the virus. They do this by engaging LE-associated Rab7, to stabilize contact between the LE and ER. These EMC subunits also bind to the ER-resident fusion machinery component syntaxin18, which is required for SV40-arrival to the ER.
• Transmembrane protein 85 from both human (TMEM85) and yeast (YGL231c) inhibit hydrogen peroxide mediated cell death in yeast.
  Ring, FEBS letters 2008 (PubMed)
  • GeneRIF: TMEM85 is a complex gene that encodes a novel conserved anti-apoptotic protein.
• Biochemical and cellular analysis of Ogden syndrome reveals downstream Nt-acetylation defects.
  Myklebust, Human molecular genetics 2015
  • “...RER1 (RER1) NatA M SGFLE NI O95807 Transmembrane protein 50A (TM50A) NatA M TAQGG NI Q5J8M3 Transmembrane protein 85 (TMM85) NatA M TKAGS NI Q96AG4 Leucine-rich repeat-containing protein 59 (LRC59) NatA M TKVAE NI NI Q13206 Probable ATP-dependent RNA helicase DDX10 (DDX10) NatA M TMDAL NI...”
• PredictProtein--an open resource for online prediction of protein structural and functional features.
  Yachdav, Nucleic acids research 2014
  • “...(UniProt AC E5A5U3). ( B ) ER membrane protein complex subunit 4 (EMC4, UniProt AC Q5J8M3). The protein sequence is represented by a scale on top of the predicted features. Features presented include proteinprotein binding sites (ISIS2), disulfide bonds (DISULFIND), structural features such as secondary structure...”
  • “...simple example, the human endoplasmatic reticulum (ER) membrane protein complex subunit 4 (EMC4, UniProt AC Q5J8M3; Figure 1BE ). EMC4 is a small alpha-helical transmembrane protein with 183 residues. It is relatively well annotated, localizes to the membrane of the ER and is implicated in apoptosis...”

Q9CZX9 ER membrane protein complex subunit 4 from Mus musculus
D4A0W1 ER membrane protein complex subunit 4 from Rattus norvegicus
Aligns to 56:170 / 183 (62.8%), covers 97.5% of PF06417, 157.4 bits

• Protein kinase A catalytic-α and catalytic-β proteins have nonredundant regulatory functions
  Raghuram, American journal of physiology. Renal physiology 2020 (secret)
• Functional, proteomic and bioinformatic analyses of Nrf2- and Keap1- null skeletal muscle
  Gao, The Journal of physiology 2020
  • “...0.04 1.66 Lars Q8BMJ2 Leucine--tRNA ligase, cytoplasmic 0.04 1.85 Sync Q9EPM5 Syncoilin 0.04 1.81 Emc4 Q9CZX9 ER membrane protein complex subunit 4 0.04 1.36 Mapk3 Q63844 Mitogen-activated protein kinase 3 0.04 1.44 Lmod3 E9QA62 Leiomodin-3 0.04 2.15 Timm8a2 Q4FZG7 Putative mitochondrial import inner membrane translocase subunit...”
• Predicted molecules and signaling pathways for regulating seizures in the hippocampus in lithium-pilocarpine induced acute epileptic rats: A proteomics study
  Wang, Frontiers in cellular neuroscience 2022
  • “...0.00805689 0.006715078 D4A017 Transmembrane protein 87A Tmem87a 1.13 0.101 0.985 0.112 0.883 0.042 0.03823588 0.032409648 D4A0W1 ER membrane protein complex subunit 4 Emc4 1.13 0.05 0.903 0.115 0.911 0.068 0.02995042 0.049835285 D4A1U7 Round spermatid basic protein 1 Rsbn1 1.737 0.104 0.621 0.037 0.627 0.048 0.0000018 0.0000031...”
  • “...1.007 0.085 0.017770309 0.01481953 D3ZGR7 RCG51149 Trir 1.185 0.087 0.886 0.048 0.932 0.092 0.008574615 0.00969835 D4A0W1 ER membrane protein complex subunit 4 Emc4 1.13 0.05 0.903 0.115 0.911 0.068 0.02995042 0.04036656 D4A1U7 Round spermatid basic protein 1 Rsbn1 1.737 0.104 0.621 0.037 0.627 0.048 0.0000018 0.0000030...”
• Neurexin-2 is a potential regulator of inflammatory pain in the spinal dorsal horn of rats.
  Xu, Journal of cellular and molecular medicine 2020
  • “...2 Kng2 663346666.7 228196666.7 2.9069078 .0062072 P06907 Myelin protein P0 Mpz 6503300000 2395866667 2.7143831 .0168115 D4A0W1 ER membrane protein complex subunit 4 Emc4 22143666.67 9857866.667 2.246294 .0389439 D3ZAD6 Neurexin2 Nrxn2 19773000 9587100 2.0624589 .0395407 A0A0G2K3C8 Nidogen2 Nid2 50950000 20579500 2.4757647 .0451098 P62634 Cellular nucleic acidbinding protein...”

XP_001657467 ER membrane protein complex subunit 4 isoform X1 from Aedes aegypti
Aligns to 46:159 / 173 (65.9%), covers 97.5% of PF06417, 153.3 bits

• Dual roles for the ER membrane protein complex in flavivirus infection: viral entry and protein biogenesis
  Barrows, Scientific reports 2019
  • “...EMC3 and EMC4 were readily identified. EMC2 (aaEMC2; XP_001661937), EMC3 (aaEMC3; XP_001652133), and EMC4 (aaEMC4; XP_001657467) are 44%, 65% and 51% identical based on protein sequence comparison to the respective human EMC subunits EMC2 (NP_055488), EMC3 (NP_060917), and EMC4 (NP_057538). These three EMC subunits were selected...”

YQ13_SCHPO / O94520 ER membrane protein complex subunit 4 from Schizosaccharomyces pombe (strain 972 / ATCC 24843) (Fission yeast) (see paper)
Aligns to 62:178 / 193 (60.6%), covers 96.6% of PF06417, 153.3 bits

EMC4_YEAST / P53073 ER membrane protein complex subunit 4 from Saccharomyces cerevisiae (strain ATCC 204508 / S288c) (Baker's yeast) (see 4 papers)
NP_011283 chaperone EMC4 from Saccharomyces cerevisiae S288C
YGL231C Putative protein of unknown function; green fluorescent protein (GFP)-fusion protein localizes to the endoplasmic reticulum from Saccharomyces cerevisiae
Aligns to 60:178 / 190 (62.6%), covers 97.5% of PF06417, 145.5 bits

• function: Part of the endoplasmic reticulum membrane protein complex (EMC) that enables the energy-independent insertion into endoplasmic reticulum membranes of newly synthesized membrane proteins (PubMed:29809151). Preferentially accommodates proteins with transmembrane domains that are weakly hydrophobic or contain destabilizing features such as charged and aromatic residues (PubMed:29809151). Involved in the cotranslational insertion of multi- pass membrane proteins in which stop-transfer membrane-anchor sequences become ER membrane spanning helices (PubMed:29809151). It is also required for the post-translational insertion of tail-anchored/TA proteins in endoplasmic reticulum membranes. By mediating the proper cotranslational insertion of N-terminal transmembrane domains in an N- exo topology, with translocated N-terminus in the lumen of the ER, controls the topology of multi-pass membrane proteins (By similarity).
  subunit: Component of the ER membrane protein complex (EMC), which is composed of EMC1, EMC2, EMC3, EMC4, EMC5 and EMC6.
• Transmembrane protein 85 from both human (TMEM85) and yeast (YGL231c) inhibit hydrogen peroxide mediated cell death in yeast.
  Ring, FEBS letters 2008 (PubMed)
  • GeneRIF: Overexpression of the yeast TMEM85 ortholog YGL231c leads to increased resistance to oxidative stress.
• Structural and mechanistic basis of the EMC-dependent biogenesis of distinct transmembrane clients
  Miller-Vedam, eLife 2020
  • “...Saccharomyces cerevisiae ) yEMC3 Uniprot Uniprot: P36039 Gene ( Saccharomyces cerevisiae ) yEMC4 Uniprot Uniprot: P53073 Gene ( Saccharomyces cerevisiae ) yEMC5 Uniprot Uniprot: P40540 Gene ( Saccharomyces cerevisiae ) yEMC6 Uniprot Uniprot: Q12431 Gene ( Saccharomyces cerevisiae ) yEMC7 Uniprot Uniprot: P39543 Gene ( Saccharomyces...”
• PartCrafter: find, generate and analyze BioParts
  Scher, Synthetic biology (Oxford, England) 2019
  • “...SDD2 Protein with homology to human PDCD5. PDCD5 is involved in programmed cell death. 6 YGL231C EMC4 Member of conserved ER transmembrane complex. 7 YHR179W OYE2 Conserved NADPH oxidoreductase containing FMN. May be involved in sterol metabolism, oxidative stress response and programmed cell death. 8 YKL184W...”
• Widespread Cumulative Influence of Small Effect Size Mutations on Yeast Quantitative Traits
  Hua, Cell systems 2018
  • “...YCR034W, YMR292W, YDR233C, YNL297C, YGL005C, YDR245W, YBR036C, YDR221W, YPL192C, YLL014W, YDR508C, YEL001C, YER005W, YDR137W, YDL099W, YGL231C, YHR108W, YMR238W, YAL053W, YIL027C, YER072W, YML038C, YER120W, YEL027W, YIL030C, YDR492W, YJR131W, YMR010W, YHR181W, YPR063C, YIL124W, YLR350W, YJR088C, YBL011W, YML048W, YNL044W, YDR358W, YOR311C, YDR411C, YMR272C, YNL049C, YMR015C, YDL052C, YJR134C, YKL096W, YNL280C,...”
• Chemogenetic E-MAP in Saccharomyces cerevisiae for Identification of Membrane Transporters Operating Lipid Flip Flop
  Vazquez, PLoS genetics 2016
  • “...follows: Arrow 2: CHO1 interacting with Chr. VII bp 63048 to 202273, encompassing EMC4 (= YGL231C), OST5 , VRG4 , YIP4 , TPN1 , YIP5 and AIM14 (= YGL160W). Arrow 3, PCP1 interacting with Chr. XII bp 41280 to 211933 encompassing YBT1 (= YLL048C), GPI13 ,...”
• De-novo assembly and analysis of the heterozygous triploid genome of the wine spoilage yeast Dekkera bruxellensis AWRI1499
  Curtin, PloS one 2012
  • “...detect around 10% of potential ORFs. Four CEGs (corresponding to S. cerevisae ORFs YGR181w, YOR103c, YGL231c, YGL047w) were detected at low identity or had only partial matches in the scaffold consensus. A further 11 CEGs with AWRI1499 gene model tblastn hits at worse than >1e-20 were...”
• Comprehensive characterization of genes required for protein folding in the endoplasmic reticulum
  Jonikas, Science (New York, N.Y.) 2009
  • “...conserved ( Table S9 ) multi-protein transmembrane complex. The poorly characterized genes YCL045C, YJR088C, YKL207W, YGL231C, KRE27 and YLL014W all clustered together and showed strongly alleviating interactions among themselves ( Fig. 4B ), a signature of factors that cooperate to carry out a single function (...”
• Transmembrane protein 85 from both human (TMEM85) and yeast (YGL231c) inhibit hydrogen peroxide mediated cell death in yeast
  Ring, FEBS letters 2008 (PubMed)
  • “...both human (TMEM85) and yeast (YGL231c) inhibit hydrogen peroxide mediated cell death in yeast FEBS Letters Journal 00145793 582 17 2637 2642 2637-2642 17...”
  • “...oxidative stress. Overexpression of the yeast TMEM85 ortholog (YGL231c) also leads to increased resistance to oxidative stress. Analysis of the existing TMEM85...”
• Meiotic recombination at the ends of chromosomes in Saccharomyces cerevisiae
  Barton, Genetics 2008
  • “...YFR039C YGL262Wh YGL257Ch YGL254W YGL253W YGL251C YGL248W YGL231C YGR288Wh YGR283C YGR266W YHL047Ch YHL046Ch YHL026C VIR (174) VIIL (164) VIIR (183)j VIIIL...”
• End resection initiates genomic instability in the absence of telomerase
  Hackett, Molecular and cellular biology 2003
  • “...to ADE5, 63,020 bp from the telomere, between YGL232w and YGL231c. URA3 was inserted 11 kb to the right of the centromere of chromosome VII, between MUQ1 and...”
• More

AT5G10780 hypothetical protein from Arabidopsis thaliana
Aligns to 51:166 / 187 (62.0%), covers 97.5% of PF06417, 136.3 bits

• TurboID-based proteomic profiling of meiotic chromosome axes in Arabidopsis thaliana
  Feng, Nature plants 2023
  • “...reticulum; Golgi; membrane Key player of retrieval of ER membrane proteins ASY3 Statistical analysis ATC30 AT5G10780 AT5G10780 endoplasmic reticulum; nucleus ER membrane protein complex subunit-like protein ASY3 Statistical analysis ATC31 AT5G53530 VPS26A membrane Homolog of yeast retromer subunit VPS26 ASY3 Statistical analysis ATC32 AT4G25050 ACP4 chloroplast;...”
• Looking for a safe haven: tail-anchored proteins and their membrane insertion pathways
  Mehlhorn, Plant physiology 2021
  • “...TAIR At5g28220 AtEMC2 b Cytosol c EMC3 At4g12590 AtEMC3 ER membrane c PSI-BLAST, TAIR EMC4 At5g10780 AtEMC4 ER membrane c PSI-BLAST, TAIR EMC5 At5g03345 PRCE2 ER membrane c PSI-BLAST, TAIR EMC6 At5g49540 AtEMC6 Plasma membrane c PSI-BLAST, TAIR EMC7 At2g25310 AtEMC7 a ER membrane c PSI-BLAST,...”
• Primers for low-copy nuclear genes in the Melastomataceae
  Reginato, Applications in plant sciences 2016
  • “...factor 1 50 R: YAGCTTTGACCGATCCRAGT UFP F: AAGTGGAGCGGGAAGGAGTA At4g06599 Ubiquitin family protein 53 R: RGGAGMCTCCACTTGGTCCA At5g10780 F: AGYGCCTTGCAGGGTGTTGG At5g10780 Unknown protein 50 R: RAGTAGGCCCAATGTGTTTA SOS4 F: GCAACAAGTCGGCTGTCTTT At5g37850 Pyridoxal kinase 51 R: CGGAGCTTCTTGACAACTTCC ZBADH F: TCCACGAGCTYGGGGGTRCC At5g61510 Zinc-binding alcohol dehydrogenase family 53 R: GGCCGGAAGAATCTGCTCTT waxy F1:...”
  • “...Miconia included in this study. However, sequencing was problematic for some other samples of the At5g10780 marker (also in the Chaenanthera clade, not included in this study), due to a repetitive sequence of ca. 15 Ts. Sequences of the eight amplified loci for the samples of...”

PF3D7_1435400 ER membrane protein complex subunit 4, putative from Plasmodium falciparum 3D7
Aligns to 62:178 / 190 (61.6%), covers 96.6% of PF06417, 113.2 bits

• Protein control of membrane and organelle dynamics: Insights from the divergent eukaryote Toxoplasma gondii
  Ovciarikova, Current opinion in cell biology 2022
  • “...ER PF3D7_1410000 Yes 3.42 EMC3 TGME49_230100 3.02 ER PF3D7_1360200 Yes 2.81 EMC4 TGME49_259000 4.77 ER PF3D7_1435400 Yes 3.3 EMC5 TGME49_293200 2.68 ER PF3D7_0306700 Yes 3.39 EMC6 TGME49_239690 3.57 No data PF3D7_1214400 No 2.76 EMC7 TGME49_243390 1.71 ER PF3D7_1310500 Yes 3.08 EMC8 TGME49_249310 4.1 ER PF3D7_1139900 Yes...”

cgd6_1070 hypothetical protein from Cryptosporidium parvum Iowa II
Aligns to 102:219 / 229 (51.5%), covers 94.1% of PF06417, 111.2 bits

• Dual Transcriptomics To Determine Gamma Interferon-Independent Host Response to Intestinal Cryptosporidium parvum Infection
  Gallego-Lopez, Infection and immunity 2022
  • “...3007 2621 3043 3357 3 cgd2_410 Signal peptide-containing protein-Mucin 3 2099 1659 1984 2654 4 cgd6_1070 Uncharacterized protein 1989 1747 1975 2246 5 cgd4_3410 RNA recognition motif/WW Domain-containing protein 1877 1515 1837 2281 6 cgd3_550 Major Facilitator Superfamily 1875 1612 1687 2327 7 cgd3_500 GDP-fucose transporter...”
• Genetic Diversity of Cryptosporidium hominis in a Bangladeshi Community as Revealed by Whole-Genome Sequencing
  Gilchrist, The Journal of infectious diseases 2018
  • “...into the neighboring DNA, which encoded a gene of unknown function ( C. parvum ID: cgd6_1070). Other highly diverse alleles in the Bangladesh C. hominis genomes include the ortholog of the highly antigenic C. parvum protein Cops-1 [ 13 ] and the genes encoding the insulinase-like...”
• Zoonotic Cryptosporidium Species in Animals Inhabiting Sydney Water Catchments
  Zahedi, PloS one 2016
  • “...5TGCGGTTGTATGACACCATCA 3 5TCTCTGGTGTTTGGCCTGAC 3 511 cgd6_810 Chro. 60105(5 end)BRCT 5AGACACCAAGATGGAAAAGGCA 3 5GGGAAGACCTTTTGATATTGCCC 3 467 gp60 cgd6_1070 Chro. 60137(3 end)conservedhypothetical protein 5AGCAAGACCGCAACTCAAGT 3 5CCCATAGTGCCCAGCTTGAA 3 430 cgd6_1090 Chro. 60141(5 end) hsp40 5TATTTGGAGGTGGGGCCAAG 3 5AAAACGGGTTTAGGGGTGGT 3 367 Each 25 l qPCR reaction contained 0.5 x GoTaq PCR Buffer...”

EHI_063570 hypothetical protein, conserved from Entamoeba histolytica HM-1:IMSS
Aligns to 1:117 / 135 (86.7%), covers 95.8% of PF06417, 86.4 bits

• Use of bacterially expressed dsRNA to downregulate Entamoeba histolytica gene expression
  Solis, PloS one 2009
  • “...986 304 0 1061 ehcs0010K23.b EHI_010570 99,86 697 1 0 20 716 0 1103 ehcs0010L01.b EHI_063570 100 306 0 0 7 312 9E-138 486 ehcs0010L05.b EHI_045540 100 388 0 0 434 47 9E-177 616 ehcs0010L10.b EHI_148060 100 334 0 0 461 794 4E-151 530 ehcs0010L20.b EHI_125630...”

TGME49_259000 hypothetical protein from Toxoplasma gondii ME49
Aligns to 70:218 / 229 (65.1%), covers 94.1% of PF06417, 80.9 bits

• Protein control of membrane and organelle dynamics: Insights from the divergent eukaryote Toxoplasma gondii
  Ovciarikova, Current opinion in cell biology 2022
  • “...EMC2 TGME49_267840 4.08 ER PF3D7_1410000 Yes 3.42 EMC3 TGME49_230100 3.02 ER PF3D7_1360200 Yes 2.81 EMC4 TGME49_259000 4.77 ER PF3D7_1435400 Yes 3.3 EMC5 TGME49_293200 2.68 ER PF3D7_0306700 Yes 3.39 EMC6 TGME49_239690 3.57 No data PF3D7_1214400 No 2.76 EMC7 TGME49_243390 1.71 ER PF3D7_1310500 Yes 3.08 EMC8 TGME49_249310 4.1...”

7ktxD / P53073 Cryo-em structure of saccharomyces cerevisiae er membrane protein complex bound to a fab in ddm detergent (see paper)
Aligns to 5:62 / 74 (78.4%), covers 40.7% of PF06417, 48.6 bits

• Ligand: peptide (7ktxD)

Or search for genetic data about PF06417 in the Fitness Browser