Family Search for PF06500 (FrsA-like)
April 2024: See Interactive Tools for Functional Annotation of Bacterial Genomes for advice on using these tools.
PF06500 hits 55 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.
YPO3224 conserved hypothetical protein from Yersinia pestis CO92
y0964 fermentation/respiration switch protein from Yersinia pestis KIM
Aligns to 1:415 / 415 (100.0%), covers 100.0% of PF06500, 785.3 bits
YafA / b0239 fermentation-respiration switch protein from Escherichia coli K-12 substr. MG1655 (see 4 papers)
FRSA_ECOLI / P04335 Esterase FrsA; Fermentation/respiration switch protein; EC 3.1.1.1 from Escherichia coli (strain K12) (see 2 papers)
P04335 carboxylesterase (EC 3.1.1.1) from Escherichia coli (see paper)
Aligns to 1:414 / 414 (100.0%), covers 100.0% of PF06500, 780.2 bits
- function: Catalyzes the hydrolysis of esters (PubMed:15808744). Displays esterase activity toward pNP-butyrate (PubMed:15808744). May stimulate mixed-acid fermentation by acting as a fermentation/respiration switch that down-regulates respiration and up- regulates fermentation rates (PubMed:15169777).
catalytic activity: a carboxylic ester + H2O = a carboxylate + an alcohol + H(+) (RHEA:21164)
subunit: Forms a 1:1 complex specifically with the unphosphorylated form of the EIIA component of the glucose-specific PTS system (IIAGlc).
disruption phenotype: Deletion of the gene increases cell respiration rate on several sugars including glucose.
ECs0266 hypothetical protein from Escherichia coli O157:H7 str. Sakai
Aligns to 1:414 / 414 (100.0%), covers 100.0% of PF06500, 776.2 bits
VC2276 conserved hypothetical protein from Vibrio cholerae O1 biovar eltor str. N16961
VC_2276 esterase FrsA from Vibrio cholerae O1 biovar El Tor str. N16961
Aligns to 4:414 / 415 (99.0%), covers 99.8% of PF06500, 768.6 bits
Sesv_0065 esterase FrsA from Salmonella enterica subsp. enterica serovar Virchow str. SVQ1
Aligns to 1:414 / 414 (100.0%), covers 100.0% of PF06500, 744.0 bits
- Genome analysis and CRISPR typing of Salmonella enterica serovar Virchow
Bachmann, BMC genomics 2014 - “...20 Forward 1337 GI-pheV (3 boundary) pheV-C/R GAGAGAACTGGAGCCACAGG 20 Reverse SV-0065-F GCAGAAAGCCTGTCAGGAAC 20 Forward 856 Sesv_0065 SV-0065-R CACCGGGTTAAAAGGGATCT 20 Reverse SV-1374-F TTTTACGGTCTGGGAAGCGAC 21 Forward 623 Sesv_1374 SV-1374-R TATGCGGATTAACCGCCTGC 20 Reverse SV-0106-F GGGCCTGCATTTCTTGTCTA 20 Forward 935 Sesv_0106 SV-0106-R GCCCTTTCTGGATAAGACGA 20 Reverse SV-0279-F CGCAGGTACGCGTGTTATTA 20 Forward 814 Sesv_0279...”
STM14_0374 esterase FrsA from Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S
Aligns to 1:414 / 414 (100.0%), covers 100.0% of PF06500, 743.5 bits
FRSA_VIBVU / Q8DF91 Esterase FrsA; EC 3.1.1.1 from Vibrio vulnificus (strain CMCP6) (see 3 papers)
WP_011078432 esterase FrsA from Vibrio vulnificus
Aligns to 4:414 / 415 (99.0%), covers 99.5% of PF06500, 698.5 bits
- function: Catalyzes the hydrolysis of esters (PubMed:30951551). In vitro, prefers short chain alkanoate ester as substrate. Displays highest activity towards p-nitrophenyl acetate (pNPA). Has weaker activity towards p-nitrophenyl butyrate (pNPB) (PubMed:30951551).
catalytic activity: a carboxylic ester + H2O = a carboxylate + an alcohol + H(+) (RHEA:21164)
subunit: Monomer in solution (PubMed:21623357). Homodimer (PubMed:30951551). Forms a 1:1 complex with the unphosphorylated form of the EIIA component of the glucose-specific PTS system (IIAGlc) (PubMed:21623357). - Purification and biochemical characterization of FrsA protein from Vibrio vulnificus as an esterase
Wang, PloS one 2019 - “...VvFrsA gene was exactly same as the amino acid sequence of VvFrsA protein (protein ID: WP_011078432). Therefore recombinant plasmid of pET28a-VvFrsA was successfully constructed. 10.1371/journal.pone.0215084.g001 Fig 1 Construction of expression plasmid and purification of VvFrsA. A . Agarose gel of pET28a-VvFrsA plasmid. M: DNA marker; 1:...”
- FrsA functions as a cofactor-independent decarboxylase to control metabolic flux.
Lee, Nature chemical biology 2011 (PubMed)- GeneRIF: FrsA converts pyruvate to acetaldehyde and carbon dioxide in a cofactor-independent manner and that its pyruvate decarboxylation activity is enhanced by the dephosphorylated form of IIAGlc (d-IIAGlc)
4i4cA / D9IR22 Crystal structure of the protein frsa complexed with unknown ligand (see paper)
Aligns to 1:401 / 402 (99.8%), covers 97.3% of PF06500, 680.0 bits
- Ligand: hexanoic acid (4i4cA)
MAP3757c hypothetical protein from Mycobacterium avium subsp. paratuberculosis str. k10
Aligns to 18:357 / 368 (92.4%), covers 69.6% of PF06500, 70.5 bits
- Disruption of Mycobacterium avium subsp. paratuberculosis-specific genes impairs in vivo fitness
Wang, BMC genomics 2014 - “...0.0111 0.0057 MmpS1 family protein 14 MAP3751 (MAPK_0017) 0.0746 0.0970 transmembrane transport protein, MmpL4_5 14 MAP3757c (MAPK_0011) 0.0923 0.0679 H.P. 14 MAP3759c (MAPK_3761) 0.0836 0.0106 Tranposase 14 MAP3760c (n. a.) 0.0400 0.0065 H.P. 14 MAP3763c (MAPK_3765) 0.0372 0.0267 PapA2_3 14 MAP3764c (MAPK_3766) 0.1181 0.1928 Pks2 15...”
- “...of MAP3750 and MAP3751 , encoding membrane protein MmpS1 and MmpL4. Other depleted genes include MAP3757c , a probable leucyl-tRNA synthetase, MAP3759 a transposase, MAP3760c a predicted methylase and two adjacent genes, MAP3763c , and MAP3764c, predicted to code for proteins involved in polyketide synthesis (PapA3...”
A0V42_RS19260, CEG92_RS19670, CEP84_RS06855, EC390_RS07915, EC391_RS14825, EGM60_RS19585, EGM63_RS09965, EGM64_RS22685, MAP4_RS00065, MAP_RS19250, RE97_RS00065 alpha/beta fold hydrolase from Mycobacterium avium subsp. paratuberculosis K-10
Aligns to 16:354 / 365 (92.9%), covers 69.6% of PF06500, 70.5 bits
- Diagnostic Sequences That Distinguish M. avium Subspecies Strains
Bannantine, Frontiers in veterinary science 2020 - “...RC58_RS00065 Alpha/beta hydrolase MAVSATAGI Yes paratuberculosis E93 RE97_RS00065 Alpha/beta hydrolase MAVSATAGI Yes paratuberculosis India 2008 A0V42_RS19260 Alpha/beta hydrolase MAVSATAGI Yes paratuberculosis FDAARGOS CEP84_RS06855 Alpha/beta hydrolase MAVSATAGI Yes paratuberculosis JII-1961 CEG92_RS19670 Alpha/beta hydrolase MAVSATAGI Yes paratuberculosis MAPK_CN7/15 EC391_RS14825 Alpha/beta hydrolase MAVSATAGI Yes paratuberculosis MAPK_CN9/15 EC390_RS07915 Alpha/beta hydrolase...”
- “...2008 A0V42_RS19260 Alpha/beta hydrolase MAVSATAGI Yes paratuberculosis FDAARGOS CEP84_RS06855 Alpha/beta hydrolase MAVSATAGI Yes paratuberculosis JII-1961 CEG92_RS19670 Alpha/beta hydrolase MAVSATAGI Yes paratuberculosis MAPK_CN7/15 EC391_RS14825 Alpha/beta hydrolase MAVSATAGI Yes paratuberculosis MAPK_CN9/15 EC390_RS07915 Alpha/beta hydrolase MAVSATAGI Yes paratuberculosis MAPK_CN4/13 EGM63_RS09965 Alpha/beta hydrolase MAVSATAGI Yes paratuberculosis MAPK_JB16/15 EGM64_RS22685 Alpha/beta hydrolase...”
- “...RE97_RS00065 Alpha/beta hydrolase MAVSATAGI Yes paratuberculosis India 2008 A0V42_RS19260 Alpha/beta hydrolase MAVSATAGI Yes paratuberculosis FDAARGOS CEP84_RS06855 Alpha/beta hydrolase MAVSATAGI Yes paratuberculosis JII-1961 CEG92_RS19670 Alpha/beta hydrolase MAVSATAGI Yes paratuberculosis MAPK_CN7/15 EC391_RS14825 Alpha/beta hydrolase MAVSATAGI Yes paratuberculosis MAPK_CN9/15 EC390_RS07915 Alpha/beta hydrolase MAVSATAGI Yes paratuberculosis MAPK_CN4/13 EGM63_RS09965 Alpha/beta hydrolase...”
- “...JII-1961 CEG92_RS19670 Alpha/beta hydrolase MAVSATAGI Yes paratuberculosis MAPK_CN7/15 EC391_RS14825 Alpha/beta hydrolase MAVSATAGI Yes paratuberculosis MAPK_CN9/15 EC390_RS07915 Alpha/beta hydrolase MAVSATAGI Yes paratuberculosis MAPK_CN4/13 EGM63_RS09965 Alpha/beta hydrolase MAVSATAGI Yes paratuberculosis MAPK_JB16/15 EGM64_RS22685 Alpha/beta hydrolase MAVSATAGI Yes paratuberculosis MAPK_JJ1/13 EGM60_RS19585 Alpha/beta hydrolase MAVSATAGI Yes paratuberculosis Telford EGA31_RS21685 Alpha/beta hydrolase...”
- “...FDAARGOS CEP84_RS06855 Alpha/beta hydrolase MAVSATAGI Yes paratuberculosis JII-1961 CEG92_RS19670 Alpha/beta hydrolase MAVSATAGI Yes paratuberculosis MAPK_CN7/15 EC391_RS14825 Alpha/beta hydrolase MAVSATAGI Yes paratuberculosis MAPK_CN9/15 EC390_RS07915 Alpha/beta hydrolase MAVSATAGI Yes paratuberculosis MAPK_CN4/13 EGM63_RS09965 Alpha/beta hydrolase MAVSATAGI Yes paratuberculosis MAPK_JB16/15 EGM64_RS22685 Alpha/beta hydrolase MAVSATAGI Yes paratuberculosis MAPK_JJ1/13 EGM60_RS19585 Alpha/beta hydrolase...”
- “...MAPK_CN4/13 EGM63_RS09965 Alpha/beta hydrolase MAVSATAGI Yes paratuberculosis MAPK_JB16/15 EGM64_RS22685 Alpha/beta hydrolase MAVSATAGI Yes paratuberculosis MAPK_JJ1/13 EGM60_RS19585 Alpha/beta hydrolase MAVSATAGI Yes paratuberculosis Telford EGA31_RS21685 Alpha/beta hydrolase MLLRASRYF No hominissuis 104 MAV_RS08635 Hydroxycinnamic acid hydroxylase MTDSPAYK Yes hominissuis TH135 MAH_RS07880 Propionate hydroxylase MPVVIVGAG No hominissuis OCU464 KV38_RS08390 Hydroxycinnamic...”
- “...MAPK_CN7/15 EC391_RS14825 Alpha/beta hydrolase MAVSATAGI Yes paratuberculosis MAPK_CN9/15 EC390_RS07915 Alpha/beta hydrolase MAVSATAGI Yes paratuberculosis MAPK_CN4/13 EGM63_RS09965 Alpha/beta hydrolase MAVSATAGI Yes paratuberculosis MAPK_JB16/15 EGM64_RS22685 Alpha/beta hydrolase MAVSATAGI Yes paratuberculosis MAPK_JJ1/13 EGM60_RS19585 Alpha/beta hydrolase MAVSATAGI Yes paratuberculosis Telford EGA31_RS21685 Alpha/beta hydrolase MLLRASRYF No hominissuis 104 MAV_RS08635 Hydroxycinnamic acid...”
- “...MAPK_CN9/15 EC390_RS07915 Alpha/beta hydrolase MAVSATAGI Yes paratuberculosis MAPK_CN4/13 EGM63_RS09965 Alpha/beta hydrolase MAVSATAGI Yes paratuberculosis MAPK_JB16/15 EGM64_RS22685 Alpha/beta hydrolase MAVSATAGI Yes paratuberculosis MAPK_JJ1/13 EGM60_RS19585 Alpha/beta hydrolase MAVSATAGI Yes paratuberculosis Telford EGA31_RS21685 Alpha/beta hydrolase MLLRASRYF No hominissuis 104 MAV_RS08635 Hydroxycinnamic acid hydroxylase MTDSPAYK Yes hominissuis TH135 MAH_RS07880 Propionate...”
- “...Locus tag Description Amino acids Roary paratuberculosis K-10 MAP_RS19250 Alpha/beta hydrolase MAVSATAGI Yes paratuberculosis MAP4 MAP4_RS00065 Alpha/beta hydrolase MAVSATAGI Yes paratuberculosis E1 RC58_RS00065 Alpha/beta hydrolase MAVSATAGI Yes paratuberculosis E93 RE97_RS00065 Alpha/beta hydrolase MAVSATAGI Yes paratuberculosis India 2008 A0V42_RS19260 Alpha/beta hydrolase MAVSATAGI Yes paratuberculosis FDAARGOS CEP84_RS06855 Alpha/beta...”
- “...gene discrepancy in Roary analysis. Subspecies Strain Locus tag Description Amino acids Roary paratuberculosis K-10 MAP_RS19250 Alpha/beta hydrolase MAVSATAGI Yes paratuberculosis MAP4 MAP4_RS00065 Alpha/beta hydrolase MAVSATAGI Yes paratuberculosis E1 RC58_RS00065 Alpha/beta hydrolase MAVSATAGI Yes paratuberculosis E93 RE97_RS00065 Alpha/beta hydrolase MAVSATAGI Yes paratuberculosis India 2008 A0V42_RS19260 Alpha/beta...”
- “...by PanOCT analysis that is not listed by Roary. That one gene, encoding alpha/beta hydrolase (MAP_RS19250 in K-10), has the same translational start for all of the Map strains except Telford, which starts 95 codons downstream of the other strains ( Supplementary Figure 1 ). This...”
- “...MAP4 MAP4_RS00065 Alpha/beta hydrolase MAVSATAGI Yes paratuberculosis E1 RC58_RS00065 Alpha/beta hydrolase MAVSATAGI Yes paratuberculosis E93 RE97_RS00065 Alpha/beta hydrolase MAVSATAGI Yes paratuberculosis India 2008 A0V42_RS19260 Alpha/beta hydrolase MAVSATAGI Yes paratuberculosis FDAARGOS CEP84_RS06855 Alpha/beta hydrolase MAVSATAGI Yes paratuberculosis JII-1961 CEG92_RS19670 Alpha/beta hydrolase MAVSATAGI Yes paratuberculosis MAPK_CN7/15 EC391_RS14825 Alpha/beta...”
HMPREF1120_02312 uncharacterized protein from Exophiala dermatitidis NIH/UT8656
Aligns to 65:396 / 415 (80.0%), covers 72.0% of PF06500, 57.7 bits
- Phenotypic Characterization and Comparative Genomics of the Melanin-Producing Yeast Exophiala lecanii-corni Reveals a Distinct Stress Tolerance Profile and Reduced Ribosomal Genetic Content
Romsdahl, Journal of fungi (Basel, Switzerland) 2021 - “...dermatitidis genome, E. lecanii-corni possesses a single homolog of scytalone dehydratase Arp1 and alpha/beta hydrolase HMPREF1120_02312, along with two homologs laccase Abr2 and L-ascorbate oxidase. In contrast, we identified two homologs of 1,3,6,8-tetrahydroxynaphthalene reductase Arp2, relative to the single homolog present in E. dermatitidis . We...”
- “...HMPREF1120_07724 Arp2 1,3,6,8-tetrahydroxynaphthalene reductase EXLC_001201T0, EXLC_006778T0 HMPREF1120_05939 Ayg1 Alpha/beta hydrolase EXLC_008577T0 HMPREF1120_00377 Alpha/beta hydrolase EXLC_003727T0 HMPREF1120_02312 Abr2 Laccase EXLC_004610T0, EXLC_010027T0 HMPREF1120_02828, HMPREF1120_05645 Abr1 Ferrooxidoreductase EXLC_006706T0 HMPREF1120_00173, HMPREF1120_01590, HMPREF1120_04510 L-ascorbate oxidase EXLC_003729T0, EXLC_006667T0 HMPREF1120_03706, HMPREF1120_04536 DOPA-melanin biosynthetic pathway MelC2 Tyrosinase EXLC_006713T0, EXLC_009460T0, EXLC_010702T0 HMPREF1120_03345, HMPREF1120_04514, HMPREF1120_05316 MelO...”
- Comparative genomic and transcriptomic analysis of wangiella dermatitidis, a major cause of phaeohyphomycosis and a model black yeast human pathogen
Chen, G3 (Bethesda, Md.) 2014 - “...W. dermatitidis , including the known polyketide synthase (HMPREF1120_03173, WdPks1p) and the alpha/beta hydrolase AYG1 (HMPREF1120_02312, WdYG1), both of which are required for melanin production in W. dermatitidis ( Feng et al. 2001 ; Wheeler et al. 2008 ). A second candidate alpha-beta hydrolase similar to...”
- “...Afu4g14560 An09g05730 (FwnA) Afu7g00160 An11g07310 Ayg1 Afu2g17550(Ayg1) An14g05350 (Ayg1) HMPREF1120_00377 0.39 8.55e02 0.12 5.26e01 Abhydrolase HMPREF1120_02312 0.32 5.16e02 0.67 7.33e07 Arp2 Afu2g17560 (Arp2) An02g00220 HMPREF1120_05939 1.25 9.27e16 0.18 1.97e01 1,3,6,8-Tetrahydroxynaphthalene reductase Arp1 Afu2g17580 (Arp1) An08g09920 HMPREF1120_07724 0.74 3.10e06 1.27 8.13e23 Scytalone dehydratase Abr2 Afu2g17530 (Abr2) An01g13660...”
NCU05821 conidial pigment biosynthesis protein Ayg1 from Neurospora crassa OR74A
Aligns to 79:411 / 430 (77.4%), covers 64.0% of PF06500, 56.0 bits
EGA31_RS21685 alpha/beta fold hydrolase from Mycobacterium avium subsp. paratuberculosis
Aligns to 4:259 / 270 (94.8%), covers 51.4% of PF06500, 55.6 bits
- Diagnostic Sequences That Distinguish M. avium Subspecies Strains
Bannantine, Frontiers in veterinary science 2020 - “...discrepancy is due to different translational start sites in one of the 13 Map orthologs (EGA31_RS21685 in the Telford strain) encoding an alpha/beta hydrolase, which made this gene appear as though it was not present in all Map strains analyzed ( Supplementary Figure 1 ; Table...”
- “...MAPK_JB16/15 EGM64_RS22685 Alpha/beta hydrolase MAVSATAGI Yes paratuberculosis MAPK_JJ1/13 EGM60_RS19585 Alpha/beta hydrolase MAVSATAGI Yes paratuberculosis Telford EGA31_RS21685 Alpha/beta hydrolase MLLRASRYF No hominissuis 104 MAV_RS08635 Hydroxycinnamic acid hydroxylase MTDSPAYK Yes hominissuis TH135 MAH_RS07880 Propionate hydroxylase MPVVIVGAG No hominissuis OCU464 KV38_RS08390 Hydroxycinnamic acid hydroxylase MTDSPAYK Yes hominissuis H87 BS641_RS14715...”
LUC6_FUSSX / A0A6J4B4M6 Hydrolase LUC6; Lucilactaene biosynthesis cluster protein 6; EC 3.7.1.- from Fusarium sp. (see 2 papers)
Aligns to 39:274 / 419 (56.3%), covers 48.3% of PF06500, 49.7 bits
- function: Hydrolase; part of the gene cluster that mediates the biosynthesis of the mycotoxin lucilactaene and the lucilactaene-related compound NG-391 that act as cell cycle inhibitors with potent growth inhibitory activity against malarial parasites, moderate growth inhibitory activity against cancer cells, and no activity against bacteria and fungi (PubMed:32043422, PubMed:35484225). Within the pathway, LUC6 may catalyze the 2-pyrrolidone ring formation to form prelucilactaene C from prelucilactaene B, followed by C-15 hydroxylation by the same enzyme to give prelucilactaene D, epoxydation to yield prelucilactaene E, and finally cyclization to yield prelucilactaene F (Probable). The pathway begins with the hybrid PKS- NRPS synthetase LUC5 which is responsible for the condensation of one acetyl-coenzyme A (CoA) unit with six malonyl-CoA units and the amide linkage of the arising heptaketide and homoserine, subsequently releasing the first intermediate prelucilactaene B. Both the cytochrome P450 monooxygenase LUC2 and the hydrolase LUC6 function in parallel in modification of prelucilactaene B. LUC6 may catalyze the 2-pyrrolidone ring formation to form prelucilactaene C from prelucilactaene B, followed by C-15 hydroxylation by the same enzyme to give prelucilactaene D, which is then converted to prelucilactaene E by epoxidation, and finally to prelucilactaene F by cyclization. Prelucilactane D, prelucilactaene E, and prelucilactaene F can be converted to dihydrolucilactaene, NG391, and lucilactaene, respectively, via C-20 methyl group hydroxylation by the cytochrome P450 monooxygenase LUC2. However, LUC2, unlike FUS8 in fusarin C biosynthesis, is not enough for the full oxidation of the C-20 methyl group into carboxylic acid, which is a prerequisite for the final methylation step. The aldehyde dehydrogenase LUC3 is involved in the biosynthesis by further oxidation of the C-20 alcoholic analog prelucilactaene G into a carboxylic derivative. This unidentified carboxylic derivative may be converted to demethyllucilactaene. As the last step, the methyltransferase LUC1 methylates the hydroxyl group at C-21 of demethyllucilactaene to generate lucilactaene (Probable).
AYG1_ASPFU / Q4WZB3 Heptaketide hydrolyase ayg1; Conidial pigment biosynthesis protein ayg1; EC 3.7.1.- from Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293) (Neosartorya fumigata) (see 12 papers)
AFUA_2G17550, Afu2g17550 conidial pigment biosynthesis protein Ayg1 from Aspergillus fumigatus Af293
Aligns to 71:399 / 406 (81.0%), covers 73.2% of PF06500, 43.7 bits
- function: Heptaketide hydrolyase; part of the gene cluster that mediates the biosynthesis of dihydroxynaphthalene (DHN)-melanin, a bluish-green pigment and a structural component of the conidial wall (PubMed:10515939, PubMed:11350964, PubMed:15310761, PubMed:19156203). The first step of the pathway is the production of the heptaketide naphtopyrone YWA1 by the polyketide synthase alb1 though condensation of acetyl-CoA with malonyl-CoA (PubMed:10515939). The naphtopyrone YWA1 is then converted to the pentaketide 1,3,6,8-tetrahydroxynaphthalene (1,3,6,8-THN) by the heptaketide hydrolyase ayp1 though chain-length shortening (PubMed:10515939, PubMed:11350964). 1,3,6,8-THN is substrate of the hydroxynaphthalene reductase arp2 to yield scytalone (PubMed:10515939, PubMed:11350964, PubMed:15310761). The scytalone dehydratase arp1 then reduces scytalone to 1,3,8-THN (PubMed:10515939). 1,3,8-THN is also substrate of the hydroxynaphthalene reductase arp2 to yield vermelone (PubMed:10515939). Vermelone is further converted by the multicopper oxidase abr1 to 1,8-DHN (PubMed:10515939). Finally the laccase abr2 transforms 1,8-DHN to DHN-melanin (PubMed:10515939). DHN- melanin biosynthesis appears to be initiated in endosomes where early enzymes (abl1, ayg1, arp1 and arp2) localize, with exocytosis leading to melanin deposition on the cell surface where late enzymes (abr1 and abr2) localize (PubMed:26972005). DHN-melanin is an important structural component of the outer cell wall and is required for the presence of conidial surface hydrophobins (PubMed:19703288). DHN- melanin also plays a crucial role in fungal virulence, including a protective role against the host's immune defenses (PubMed:19156203, PubMed:20145078, PubMed:21501368, PubMed:21747802, PubMed:21573171, PubMed:24818666). DHN-melanin protects also conidia against amoeba predation (PubMed:25684622).
subunit: Homodimer.
disruption phenotype: Leads to a yellow-green color of conidia (PubMed:11350964, PubMed:26972005). Impairs the accumulation of 1,3,6,8-tetrahydroxynaphthalene (1,3,6,8-THN) (PubMed:11350964). Results in an altered conidial surface with masked surface rodlet layer, leaky cell wall allowing the deposition of proteins on the cell surface and exposing the otherwise-masked cell wall polysaccharides at the surface (PubMed:24818666). Decreases the protection against the host's immune defenses (PubMed:21501368). Causes enhanced insect mortality compared to the parent strain in a wax moth Galleria mellonella infection model, probably through exacerbated immune response of the wax moth (PubMed:19156203). - Comparative Genomics Reveals a Single Nucleotide Deletion in pksP That Results in White-Spore Phenotype in Natural Variants of Aspergillus fumigatus
Gibbons, Frontiers in fungal biology 2022 - “...Heinekamp etal., 2012 ). This gene cluster contains 6 genes ( Afu2g17530 , Afu2g17540 , Afu2g17550 , Afu2g17560 , Afu2g17580 and Afu2g17600 ). We used the intersect function in bedtools v2.29.2 ( Quinlan and Hall, 2010 ) to identify SNVs and indels for which genotypes were...”
- Aspergillus fumigatus Strain-Specific Conidia Lung Persistence Causes an Allergic Broncho-Pulmonary Aspergillosis-Like Disease Phenotype
Jones, mSphere 2021 - “...Afu1g16590 7 Putative C 2 H 2 transcription factor Afu1g15440 4 Putative alpha(1-3) glucan synthase Afu2g17550 1 Heptaketide hydrolyase ayg1 Afu2g17560 1 1,3,6,8-Tetrahydroxynaphthalene reductase arp2 Afu2g17600 1 Conidial pigment polyketide synthase alb1 TABLE2 Nonsynonymous variants found in W72310 relative to AF293 that are not found in...”
- Molecular Mechanisms of Conidial Germination in Aspergillus spp
Baltussen, Microbiology and molecular biology reviews : MMBR 2020 (secret) - Fast and Reliable PCR Amplification from Aspergillus fumigatus Spore Suspension Without Traditional DNA Extraction
Fraczek, Current protocols in microbiology 2019 - “...622 to 5259 bp (7 amplicons in total) and amplified the A. fumigatus AYG1 gene (Afu2g17550) and its flanking regions using the supernatant from four different spore concentrations (8 10 8 /ml, 1 10 8 /ml, 5 10 7 /ml, and 1 10 7 /ml). Using...”
- The Transcription Factor ZafA Regulates the Homeostatic and Adaptive Response to Zinc Starvation in Aspergillus fumigatus
Vicentefranqueira, Genes 2018 - “...AFUA_2G15010 NZR - 1.5 0.2 1.2 0.1 AFUA_2G15290 DZR - 26.0 3.6 3.2 0.3 Repression AFUA_2G17550 IZR ayg1 2.7 0.4 103.5 10.8 AFUA_3G02270 DZR cat1 18.9 1.8 2.0 0.2 Induction AFUA_3G03640 IZR mirB 3225.8 304.5 10.0 1.2 AFUA_3G14440 NZR - 3.5 0.5 1.3 0.1 AFUA_4G03410 NZR...”
- The Effect of Aspergillus Thermomutatus Chrysovirus 1 on the Biology of Three Aspergillus Species
Ejmal, Viruses 2018 - “...protein 16 Afu2g17600 Conidial pigment polyketide synthase PksP/Alb1; conidial pigment biosynthesis; conidia wall assembly 13 Afu2g17550 Heptaketide hydrolase ayg1; conidial pigment; polyketide shortening; conidia-enriched protein 13 Afu2g17580 Scytalone dehydratase arp1; conidial pigment biosynthesis; conidia formation and sporulation 9 Afu1g09750 Aldehyde reductase (AKR1), putative; conidia-enriched protein 38...”
- Temperature during conidiation affects stress tolerance, pigmentation, and trypacidin accumulation in the conidia of the airborne pathogen Aspergillus fumigatus
Hagiwara, PloS one 2017 - “...2.55 heat shock transcription factor, putative AFUA_7G01720 647.0 56.9 95.9 11.36 1.68 3-hydroxymethyl-3-methylglutaryl-Coenzyme A lyase AFUA_2G17550 208.0 18.5 6.2 11.24 0.34 ayg1 conidial pigment biosynthesis protein Ayg1 AFUA_1G16960 2413.7 215.9 310.3 11.18 1.44 conserved hypothetical protein AFUA_4G08170 979.3 92.1 68.5 10.64 0.74 uga2 succinate-semialdehyde dehydrogenase Uga2,...”
- Regulation of Secondary Metabolism by the Velvet Complex Is Temperature-Responsive in Aspergillus
Lind, G3 (Bethesda, Md.) 2016 - “..., Afu2g05830 Inglis et al. (2013) Cluster 7 1,8-Dihydroxynaphthalene (DHN) melanin Afu2g17530 , Afu2g17540 , Afu2g17550 , Afu2g17560 , Afu2g17580 , Afu2g17600 Tsai et al. (1999) Cluster 8 Fumigaclavine Afu2g17960 , Afu2g17970 , Afu2g17980 , Afu2g17990 , Afu2g18000 , Afu2g18010 , Afu2g18020 , Afu2g18030 , Afu2g18040...”
- More
- The fungal gene cluster for biosynthesis of the antibacterial agent viriditoxin
Urquhart, Fungal biology and biotechnology 2019 - “...molecule YWA1. BLAST with DHN melanin pathway components in A. fumigatus (i.e. GenBank accessions E9QUT3, Q4WZB3 and Q4WZB4) [ 33 , 34 ] required to convert YWA1 into other pigments revealed their absence from the P. variotii genome. Thus, PvpP of P. variotii is required for...”
Noca_0613 protein of unknown function DUF1100, hydrolase family protein from Nocardioides sp. JS614
Aligns to 67:284 / 383 (56.9%), covers 38.2% of PF06500, 43.4 bits
- KEGG: new perspectives on genomes, pathways, diseases and drugs
Kanehisa, Nucleic acids research 2017 - “...KEGG pathway map of nicotinate and nicotinamide metabolism (map00760) for Nocardioides sp. JS614 (nca), where Noca_0613 for EC:3.7.1.19 is marked red. ( B ) Ortholog table for the KEGG module of nicotine degradation pyridine pathway (M00810), where coloring of positional correlation indicates that Noca_0613 for EC:3.7.1.19...”
- “...the nicotine degradation pyridine pathway module (M00810) for Nocardioides sp. JS614 (nca), where the gene Noca_0613 (Figure 1A ) for K19188 with EC:3.7.1.19 is marked red. Figure 3B is the ortholog table for M00810, which indicates by coloring that this gene is adjacent on the chromosome...”
Q93NG6 2,6-dihydroxypseudooxynicotine hydrolase (EC 3.7.1.19) from Paenarthrobacter nicotinovorans (see 3 papers)
DHPON_PAENI / Q93NG6 2,6-dihydropseudooxynicotine hydrolase; EC 3.7.1.19 from Paenarthrobacter nicotinovorans (Arthrobacter nicotinovorans) (see 3 papers)
Q93NG6 2,6-dihydroxypseudooxynicotine hydrolase (EC 3.7.1.19) from Paenarthrobacter nicotinovorans (see paper)
Aligns to 28:245 / 367 (59.4%), covers 48.8% of PF06500, 43.1 bits
An14g05350 uncharacterized protein from Aspergillus niger
Aligns to 70:398 / 406 (81.0%), covers 72.9% of PF06500, 42.1 bits
- Characterization of a novel polyextremotolerant fungus, Exophiala viscosa, with insights into its melanin regulation and ecological niche
Carr, G3 (Bethesda, Md.) 2023 - “...Bit score % ID Pks1 An03g05440 580617 0.0E00 4,077 47.0 463165 0.0E00 4,081 47.0 Ayg1 An14g05350 511449 1.21E-90 852 44.0 494160 1.21E-90 852 43.9 Arp2 An02g00220 676985 5.72E-93 779 56.5 479993, 453709 5.74E-93 779 56.5, 48.7 *Arp2 Afu2g17560 625384 3.28E-48 612 48.4 242806; 441819 3.29E-48, 6.59E-75...”
- Molecular Mechanisms of Conidial Germination in Aspergillus spp
Baltussen, Microbiology and molecular biology reviews : MMBR 2020 (secret) - Efficient marker free CRISPR/Cas9 genome editing for functional analysis of gene families in filamentous fungi
van, Fungal biology and biotechnology 2019 - “...shown the occurrence of differently sized indels in either fwnA (NRRL3_00462, An09g05730) or olvA (NRRL3_01039, An14g05350) in A. niger NRRL3, ranging from 88bp insertions up to 1096bp deletions across 30 individual mutants. In this study, while targeting the brnA gene, we observed even larger deletions that...”
- The role of melanin pathways in extremotolerance and virulence of Fonsecaea revealed by de novo assembly transcriptomics using illumina paired-end sequencing
Li, Studies in mycology 2016 - “...0.032* G647-03914 Afu4g14560 An09g05730 (FwnA) Afu7g00160 An11g07310 Abhydrolase (Ayg1) unigene1384 0.250 0.309 HMPREF1120-00377 G647-01705 Afu2g17550(Ayg1) An14g05350 (Ayg1) unigene1176 0.301 0.244 HMPREF1120-02312 G647-03620 1,3,6,8-Tetrahydroxynaphthalene reductase (Arp2) unigene2337 0.126 0.142 HMPREF1120-05939 G647-10180 Afu2g17560 (Arp2) An02g00220 unigene3830 0.426 0.037* Scytalone dehydratase (Arp1) unigene3787 0.793 0.04* HMPREF1120-07724 G647-03339 Afu2g17580 (Arp1)...”
- Comparative genomic and transcriptomic analysis of wangiella dermatitidis, a major cause of phaeohyphomycosis and a model black yeast human pathogen
Chen, G3 (Bethesda, Md.) 2014 - “...7.13e55 0.53 4.12e05 Polyketide synthase Afu4g00210 (EncA) An04g09530 Afu4g14560 An09g05730 (FwnA) Afu7g00160 An11g07310 Ayg1 Afu2g17550(Ayg1) An14g05350 (Ayg1) HMPREF1120_00377 0.39 8.55e02 0.12 5.26e01 Abhydrolase HMPREF1120_02312 0.32 5.16e02 0.67 7.33e07 Arp2 Afu2g17560 (Arp2) An02g00220 HMPREF1120_05939 1.25 9.27e16 0.18 1.97e01 1,3,6,8-Tetrahydroxynaphthalene reductase Arp1 Afu2g17580 (Arp1) An08g09920 HMPREF1120_07724 0.74 3.10e06...”
- Germination of conidia of Aspergillus niger is accompanied by major changes in RNA profiles
van, Studies in mycology 2013 - “...complex melanin pigments (see Krijgsheld et al. 2012). Transcripts of three genes (An 03g03750, An09g05730, An14g05350) of the melanin synthesis pathway (Jorgenson et al. 2010) were present in dormant conidia but disappeared during germination. Transcripts of five out of seven genes that code for proteins with...”
- Cytosolic streaming in vegetative mycelium and aerial structures of Aspergillus niger
Bleichrodt, Studies in mycology 2013 - “...RB3 and RB4 for mpdA (An02g05830), RB5 and RB6 for ayg1 (also known as olvA; An14g05350), RB7 and RB8 for flavohemoprotein ( flaA ; An14g02460), RB9 and RB10 for adhA (An17g01530), RB11 and RB12 for FAD binding oxidoreductase ( oxiA ; An18g00510), RB13 and RB14 for...”
- “...H4.1 - Aspergillus nidulans An04g00710 2597 Weak similarity to hypothetical protein CAC28773.2 - Neurospora crassa An14g05350 a 2578 Strong similarity to hypothetical yellowish-green 1 ayg1 - Aspergillus fumigatus An11g02720 2568 Similarity to hypothetical protein C50F7.2 - Caenorhabditis elegans An02g14040 2469 Hypothetical protein An18g04220 2456 Strong similarity...”
- The transcriptional repressor TupA in Aspergillus niger is involved in controlling gene expression related to cell wall biosynthesis, development, and nitrogen source availability
Schachtschabel, PloS one 2013 - “...biosynthesis An09g05730 fwnA polyketide synthase required for melanin synthesis A. niger 54 128 0.4 3.94E-04 An14g05350 olvA strong similarity to hypothetical yellowish-green 1 ayg1 - Aspergillus fumigatus 363 85 4.3 3.42E-05 An14g05370 brnA strong similarity to cell surface ferroxidase precursor Fet3 - Saccharomyces cerevisiae 52 34...”
- More
FUS2_GIBM7 / W7N6P0 20-hydroxy-prefusarin hydrolase FUS2; Fusarin biosynthesis protein 2; EC 3.7.1.- from Gibberella moniliformis (strain M3125 / FGSC 7600) (Maize ear and stalk rot fungus) (Fusarium verticillioides) (see 2 papers)
Aligns to 37:278 / 419 (57.8%), covers 49.0% of PF06500, 41.9 bits
- function: 20-hydroxy-prefusarin hydrolase; part of the gene cluster that mediates the biosynthesis of the mycotoxin fusarin C (PubMed:17121404, PubMed:22652150). Within the cluster, FUS1, FUS2, FUS8 and FUS9 are sufficient for fusarin production (By similarity). The roles of the other FUS members are yet undetermined (By similarity). The fusarin C synthetase FUS1 is responsible for the condensation of one acetyl-coenzyme A (CoA) unit with six malonyl-CoA units and the amide linkage of the arising heptaketide and homoserine, subsequently releasing the first intermediate, prefusarin, as an alcohol with an open ring structure (PubMed:17121404). The cytochrome P450 monooxygenase FUS8 participates in multiple oxidation processes at carbon C-20 and is able to use the FUS1 product as substrate, resulting in formation of 20-hydroxy-prefusarin (By similarity). This reaction seems to be essential before the 2-pyrrolidone ring closure can be catalyzed by FUS2, generating 20-hydroxy-fusarin (By similarity). FUS8 is able to further oxidizes carbon C-20 after ring closure, resulting in the formation of carboxy-fusarin C (By similarity). As the last step, FUS9 methylates the hydroxyl group at C-21 to generate fusarin C (By similarity). Fusarin C can then rearrange to epi-fusarin C, the (z)-isomers, and fusarin A and fusarin D (By similarity).
XENA_XENSI / A0A7L9F0X4 Alpha/beta hydrolase xenA; Xenoacremones biosynthesis cluster protein A; EC 3.7.1.- from Xenoacremonium sinensis (Endophyte fungus) (see paper)
Aligns to 15:283 / 425 (63.3%), covers 49.8% of PF06500, 41.7 bits
- function: Alpha/beta hydrolase; part of the gene cluster that mediates the biosynthesis of xenoacremones such as xenoacremone A, a compound that shows inhibitory activity toward the PI3K/AKT signaling pathway and which has the ability to induce apoptosis of A549 lung cancer cells (PubMed:34900544). Within the pathway, cooperation of the hybrid PKS- NRPS xenE and the trans-acting enoyl reductase xenG is responsible for the formation of the reduced tyrosine-nonaketide derivative (PubMed:34900544). The alpha/beta hydrolase xenA then accelerates intramolecular nucleophilic attack to give a pyrrolidone derivative (PubMed:34900544). Subsequently, three enzymes, xenF, xenD, and xenC, coordinately participate in the conversion to xenoacremone B (PubMed:34900544). XenF catalyzes sigmatropic rearrangement to form an A-ring, which leads to an unusual intermediate with a hexane ring, which is required for the formation of the tricarbocyclic product (PubMed:34900544). Epoxidation catalyzed by xenD and the formation of the paracyclophane ether catalyzed by xenC initiate a spontaneous intramolecular Diels-Alder (IMDA) reaction to yield xenoacremone B (PubMed:34900544). Spontaneous hydration of xenoacremone B leads to the formation of xenoacremone A, which undergoes subsequent methylation to afford xenoacremone C (PubMed:34900544).
subunit: Homodimer.
disruption phenotype: Does not affect the production of xenoacremones A and B but leads to the accumulation of 8.
Pc21g16440 uncharacterized protein from Penicillium rubens
Aligns to 75:401 / 409 (80.0%), covers 72.9% of PF06500, 41.0 bits
Fus2 / S0EE80 fusarin oxygenase from Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831) (see 2 papers)
FUS2_GIBF5 / S0EE80 20-hydroxy-prefusarin hydrolase FUS2; Fusarin biosynthesis protein 2; EC 3.7.1.- from Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831) (Bakanae and foot rot disease fungus) (Fusarium fujikuroi) (see 2 papers)
Aligns to 38:274 / 419 (56.6%), covers 48.8% of PF06500, 40.9 bits
- function: 20-hydroxy-prefusarin hydrolase; part of the gene cluster that mediates the biosynthesis of the mycotoxin fusarin C (PubMed:23932525). Within the cluster, FUS1, FUS2, FUS8 and FUS9 are sufficient for fusarin production (PubMed:23932525). The roles of the other FUS members are yet undetermined (PubMed:23932525). The fusarin C synthetase FUS1 is responsible for the condensation of one acetyl- coenzyme A (CoA) unit with six malonyl-CoA units and the amide linkage of the arising heptaketide and homoserine, subsequently releasing the first intermediate, prefusarin, as an alcohol with an open ring structure (PubMed:23932525). The cytochrome P450 monooxygenase FUS8 participates in multiple oxidation processes at carbon C-20 and is able to use the FUS1 product as substrate, resulting in formation of 20- hydroxy-prefusarin (PubMed:23932525). This reaction seems to be essential before the 2-pyrrolidone ring closure can be catalyzed by FUS2, generating 20-hydroxy-fusarin (PubMed:23932525). FUS8 is able to further oxidizes carbon C-20 after ring closure, resulting in the formation of carboxy-fusarin C (PubMed:23932525). As the last step, FUS9 methylates the hydroxyl group at C-21 to generate fusarin C (PubMed:23932525). Fusarin C can then rearrange to epi-fusarin C, the (z)-isomers, and fusarin A and fusarin D (PubMed:23932525).
disruption phenotype: Accumulates 20-hydroxy-prefusarin (PubMed:23932525).
Q54287 OrfZ protein from Streptomyces hygroscopicus
Aligns to 41:274 / 389 (60.2%), covers 48.3% of PF06500, 40.6 bits
SS1G_01382 hypothetical protein from Sclerotinia sclerotiorum 1980 UF-70
Aligns to 78:410 / 412 (80.8%), covers 72.7% of PF06500, 40.4 bits
- ORF Ι of Mycovirus SsNSRV-1 is Associated with Debilitating Symptoms of Sclerotinia sclerotiorum
Gao, Viruses 2020 - “...process, of which gene sscle_03g022890 (SS1G_00993) was related to steroid hormone metabolic process, gene sscle_01g009260 (SS1G_01382) was supposed to encode a pigment biosynthesis protein controlling hydrolase activity, and gene sscle_08g063720 (SS1G_05048) had N-acetyltransferase activity that might control acyl-carrier-protein biosynthetic process. In addition, gene sscle_08g067700 (SS1G_05567) was...”
AO090005000332 No description from Aspergillus oryzae RIB40
Aligns to 71:299 / 425 (53.9%), covers 47.1% of PF06500, 39.7 bits
VDAG_04954 pigment biosynthesis protein Ayg1 from Verticillium dahliae VdLs.17
Aligns to 133:463 / 466 (71.0%), covers 65.2% of PF06500, 37.8 bits
- VdGAL4 Modulates Microsclerotium Formation, Conidial Morphology, and Germination To Promote Virulence in Verticillium dahliae
Wen, Microbiology spectrum 2023 - “...To further investigate melanin, microsclerotium formation, and cell wall biogenesis, six genes, including Vayg1 ( VDAG_04954 ), VT4HR ( VDAG_03665 ), VaflM ( VDAG_00183 ), VdSCD ( VDAG_03393 ), VDH1 ( VDAG_02273 ), and VdLAC ( VDAG_00189 ), were used for RT-qPCR analysis ( 70 )....”
- Two Verticillium dahliae MAPKKKs, VdSsk2 and VdSte11, Have Distinct Roles in Pathogenicity, Microsclerotial Formation, and Stress Adaptation
Yu, mSphere 2019 - “...), VdBrn2 ( VDAG_00183 ), VdLac1 ( VDAG_00189 ), VdCmr1 ( VDAG_00195 ), Vayg1 ( VDAG_04954 ), and VdMsn2 ( VDAG_04227 ). Consistent with a deficiency in melanization during culturing, gene expression data showed that seven genes, including VdPKS1 , VdLac1 , and VdCmr1 , were...”
- Transcription factor VdCmr1 is required for pigment production, protection from UV irradiation, and regulates expression of melanin biosynthetic genes in Verticillium dahliae
Wang, Microbiology (Reading, England) 2018 - “...and tetra-hydroxynaphthalene reductase functions [ 41, 42 ] VDAG_03393 . Scytalone dehydratase [ 43 ] VDAG_04954 /pigmentbiosynthesis protein Ayg1 Vayg1/ [ 11 ] Polyketide chain shortening [ 44 ] VDAG_00190 /conidialyellow pigment biosynthesis PKS VdPKS1; this study/ [ 12 ] Polyketide synthase [ 45 ] VDAG_00194/VDAG_00195...”
- “...levels of additional homologues of melanin biosynthetic-related genes VDAG_00034 (laccase) , VDAG_03665 (scytalone dehydratase) , VDAG_04954 (PKS Vayg1) , VDAG_05181 (THN reductase), were analysed in two VDAG_00195 deletion mutants ( Fig. 3a ). Among these genes, VDAG_00034 (laccase) and VDAG_05181 (THN reductase) were not differentially expressed...”
- VdCYC8, Encoding CYC8 Glucose Repression Mediator Protein, Is Required for Microsclerotia Formation and Full Virulence in Verticillium dahliae
Li, PloS one 2015 - “...strains, the gene loci of VDAG_00189 , VDAG_00190 , VDAG_00184 , VDAG_03665 , VDAG_03393 , VDAG_04954 were selected for quantitative real-time PCR (RT-qPCR) analysis ( Table 2 ) [ 40 ]. The expression patterns of VdCYC8 at different stages of development were also assessed by RT-qPCR...”
- “...59C 144 bp R: CACCCTCTTCGAGGTGCTTGTA VDAG_03393 scytalone dehydratase F: ATCACCTTCGACGACTACCTCG 63C 153 bp R: CATGGCCTCCCAGATCTTGTCT VDAG_04954 pigment biosynthesis protein Ayg1 F: GATGGGCACGAGTATCCGTTTC 60C 80 bp R: GTCTTGTACTCCGCCACAGTCT RNA isolation and cDNA synthesis were performed as mentioned above. RT-qPCR was performed in a LightCycler 480 (Roche, Germany)...”
- RNA-seq analyses of gene expression in the microsclerotia of Verticillium dahliae
Duressa, BMC genomics 2013 - “...Protein name/functional annotation Pigment synthesis VDAG_03665 344.05 Tetrahydroxynaphthalene reductase/melanin biosynthesis VDAG_03393 231.29 Scytalone dehydratase/melanin biosynthesis VDAG_04954 165.00 Pigment biosynthesis protein Ayg1 VDAG_00190 136.66 Conidial yellow pigment biosynthesis polyketide synthase/melanin synthesis VDAG_00189 110.81 Laccase/melanin biosynthesis VDAG_05181 86.98 Tetrahydroxynaphthalene reductase/melanin biosynthesis VDAG_00183 40.79 Versicolorin reductase/Polyketide/melanin or aflatoxin biosynthesis...”
- “..., 344-fold; VDAG_05181 87-fold), scytalone dehydratase ( VDAG_03393 , 231-fold), pigment biosynthesis protein Ayg1 ( VDAG_04954 , 165-fold), conidial yellow pigment biosynthesis PKS ( VDAG_00190 , 137-fold), two laccases ( VDAG_00189 , 111-fold, and VDAG_00034 , 7-fold), versicolorin reductase ( VDAG_00183 , 41-fold), polyketide synthase (...”
PYDG_ACRSP / A0A8F4NUL3 Alpha/beta hydrolase pydG; Pyrrocidines biosynthesis cluster protein G; EC 3.7.1.- from Acremonium sp. (see paper)
Aligns to 40:280 / 426 (56.6%), covers 49.3% of PF06500, 37.6 bits
- function: Alpha/beta hydrolasee; part of the gene cluster that mediates the biosynthesis of pyrrocidines, fungal natural products containing a macrocyclic para-cyclophane connected to a decahydrofluorene ring system that show potent antibiotic activities toward Gram-negative bacteria (PubMed:33834778). Within the pathway, pydG catalyzes the Knoevenagel condensation that affords the 3-pyrrolin-2-one ring, using as substrate the polyketide-tyrosyl acyl thioester product of pydA (PubMed:33834778). The pathway begins with the PKS-NRPS pydA which, with the help of the trans-enoyl reductase pydC, synthesizes the polyketide-tyrosyl acyl thioester product which can be reductively off- loaded by the terminal reductase (R) domain in pydA. The alpha/beta hydrolase pydG is then required to catalyze the subsequent Knoevenagel condensation that affords the 3-pyrrolin-2-one ring, whereas the four proteins pydB, pydE, pydX and pydZ then function synergistically to form the cyclophane. PydB and the membrane-bound pydX and pydZ are lipid-binding proteins that can sequester and mold the pdyG product into the inverse S-shape. Binding of the medium chain reductase pydE to the complex would trigger the cascade oxidative cyclization. PydY is involved in the Diels-Alder cycloaddition that forms the decahydrofluorene core. Additional non-enzymatic hydroxylation yields pyrrocidine A2 which can be further reduced into pyrrocidine B by an endogenous reductase (Probable).
subunit: Homodimer.
POXO_PENOX / A0A1W5T1Y7 Hydrolyase poxO; Oxaleimides biosynthesis cluster protein O; EC 3.7.1.- from Penicillium oxalicum (see paper)
Aligns to 43:272 / 421 (54.6%), covers 46.1% of PF06500, 37.0 bits
- function: Hydrolyase; part of the gene cluster that mediates the biosynthesis of oxaleimides, cytotoxic compounds containing an unusual disubstituted succinimide moiety (PubMed:28365998). The first step of the pathway is provided by the HR-PKS poxF that serves in a new mode of collaborative biosynthesis with the PKS-NRPS poxE, by providing the olefin containing amino acid substrate via the synthesis of an ACP- bound dec-4-enoate (PubMed:28365998). The cytochrome P450 monooxygenase poxM-catalyzed oxidation at the alpha-position creates the enzyme-bound 2-hydroxydec-4-enoyl-ACP thioester, which may be prone to spontaneous hydrolysis to yield 2-hydroxydec-4-enoic acid due to increased electrophilicity of the carbonyl (PubMed:28365998). 2-hydroxydec-4- enoic acid can then be further oxidized by poxM to yield the alpha- ketoacid 2-oxodec-4-enoicacid, which is reductively aminated by the aminotransferase poxL to yield (S,E)-2-aminodec-4-enoic acid (PubMed:28365998). The Hybrid PKS-NRPS synthetase poxE then performs condensation between the octaketide product of its PKS modules and the amino group of (S,E)-2-aminodec-4-enoic acid which is activated and incorporated by the adenylation domain (PubMed:28365998). The resulting aminoacyl product can be cyclized by the Diels-Alderase PoxQ and reductively released by the reductive (R) domain of poxE to yield an aldehyde intermediate (PubMed:28365998) (Probable). The released aldehyde is then substrate for a Knoevenagel condensation by the hydrolyase poxO followed by an oxidation at the 5-position of the pyrrolidone ring (PubMed:28365998). The presence of the olefin from the amino acid building block allows for migration of the substituted allyl group to occur (PubMed:28365998). This allylic transposition reaction takes place in a conjugate addition, semipinacol-like fashion to yield a succinimide intermediate (PubMed:28365998). Iterative two-electron oxidations of the C7 methyl of the succinimide intermediate to the carboxylic acid can be catalyzed by one of two remaining cytochrome P450 monooxygenasess poxC or poxD to yield oxaleimide A (PubMed:28365998). Subsequent oxidation yields the maleimide scaffold oxaleimide I (PubMed:28365998). Both oxaleimide A and oxaleimide I can undergo oxidative modifications in the decalin ring to yield the series of products oxaleimides B to H (PubMed:28365998).
subunit: Homodimer.
disruption phenotype: Impairs the productin of oxaleimides and leads to the accumulation of a trans-decalin containing alcohol intermediate.
POXO_PENO1 / S8ASK9 Hydrolyase poxO; Oxaleimides biosynthesis cluster protein O; EC 3.7.1.- from Penicillium oxalicum (strain 114-2 / CGMCC 5302) (Penicillium decumbens) (see paper)
Aligns to 43:272 / 421 (54.6%), covers 46.1% of PF06500, 36.2 bits
- function: Hydrolyase; part of the gene cluster that mediates the biosynthesis of oxaleimides, cytotoxic compounds containing an unusual disubstituted succinimide moiety (PubMed:28365998). The first step of the pathway is provided by the HR-PKS poxF that serves in a new mode of collaborative biosynthesis with the PKS-NRPS poxE, by providing the olefin containing amino acid substrate via the synthesis of an ACP- bound dec-4-enoate (PubMed:28365998). The cytochrome P450 monooxygenase poxM-catalyzed oxidation at the alpha-position creates the enzyme-bound 2-hydroxydec-4-enoyl-ACP thioester, which may be prone to spontaneous hydrolysis to yield 2-hydroxydec-4-enoic acid due to increased electrophilicity of the carbonyl (PubMed:28365998). 2-hydroxydec-4- enoic acid can then be further oxidized by poxM to yield the alpha- ketoacid 2-oxodec-4-enoicacid, which is reductively aminated by the aminotransferase poxL to yield (S,E)-2-aminodec-4-enoic acid (PubMed:28365998). The Hybrid PKS-NRPS synthetase poxE then performs condensation between the octaketide product of its PKS modules and the amino group of (S,E)-2-aminodec-4-enoic acid which is activated and incorporated by the adenylation domain (PubMed:28365998). The resulting aminoacyl product can be cyclized by the Diels-Alderase PoxQ and reductively released by the reductive (R) domain of poxE to yield an aldehyde intermediate (PubMed:28365998) (Probable). The released aldehyde is then substrate for a Knoevenagel condensation by the hydrolyase poxO followed by an oxidation at the 5-position of the pyrrolidone ring (PubMed:28365998). The presence of the olefin from the amino acid building block allows for migration of the substituted allyl group to occur (PubMed:28365998). This allylic transposition reaction takes place in a conjugate addition, semipinacol-like fashion to yield a succinimide intermediate (PubMed:28365998). Iterative two-electron oxidations of the C7 methyl of the succinimide intermediate to the carboxylic acid can be catalyzed by one of two remaining cytochrome P450 monooxygenasess poxC or poxD to yield oxaleimide A (PubMed:28365998). Subsequent oxidation yields the maleimide scaffold oxaleimide I (PubMed:28365998). Both oxaleimide A and oxaleimide I can undergo oxidative modifications in the decalin ring to yield the series of products oxaleimides B to H (PubMed:28365998).
subunit: Homodimer.
disruption phenotype: Impairs the productin of oxaleimides and leads to the accumulation of a trans-decalin containing alcohol intermediate.
NCU01903 pigment biosynthesis protein Ayg1 from Neurospora crassa OR74A
Aligns to 145:483 / 487 (69.6%), covers 73.2% of PF06500, 36.1 bits
GKAG_PENCI / A0A8F4NU75 Alpha/beta hydrolase gkaG; GKK1032 biosynthesis cluster protein G; EC 3.7.1.- from Penicillium citrinum (see paper)
Aligns to 35:282 / 427 (58.1%), covers 49.0% of PF06500, 33.9 bits
- function: Alpha/beta hydrolase; part of the gene cluster that mediates the biosynthesis of GKK1032, fungal natural products containing a macrocyclic para-cyclophane connected to a decahydrofluorene ring system that show potent antitumor activities (PubMed:33834778). Within the pathway, gkaG catalyzes the Knoevenagel condensation that affords the 3-pyrrolin-2-one ring, using as substrate the polyketide-tyrosyl acyl thioester product of gkaA (PubMed:33834778). The pathway begins with the PKS-NRPS gkaA which, with the help of the trans-enoyl reductase gkaC, synthesizes the polyketide-tyrosyl acyl thioester product which can be reductively off-loaded by the terminal reductase (R) domain in gkaA. The alpha/beta hydrolase gkaG is then required to catalyze the subsequent Knoevenagel condensation that affords the 3- pyrrolin-2-one ring, whereas the three proteins gkaB, gkaX and gkaZ then function synergistically to form the cyclophane (Probable).
subunit: Homodimer.
An13g03240 uncharacterized protein from Aspergillus niger
Aligns to 40:272 / 406 (57.4%), covers 46.9% of PF06500, 32.7 bits
- Bioinformatic mapping of a more precise Aspergillus niger degradome
Dong, Scientific reports 2021 - “...GXSXG Ser, Asp, His Dipeptidyl-peptidase IV An02g11420 S9C Acylaminoacyl-peptidase Aminopeptidase C An04g02850 / An09g02830 / An13g03240 Dipeptidyl-peptidase 5 An12g04700 An16g08150 S10 Carboxypeptidase Y Carboxypeptidase C An05g01870* GESYA An08g08750 * An11g06350* Carboxypeptidase D An02g04690 * An05g02170* An07g08030 * An08g00430* An14g02150* An03g05200* TESTG An16g09010* An17g00760* An06g00310* AESYG S15...”
WP_012548346 alpha/beta fold hydrolase from Dictyoglomus thermophilum H-6-12
Aligns to 5:176 / 256 (67.2%), covers 31.4% of PF06500, 31.8 bits
- EstDZ3: A New Esterolytic Enzyme Exhibiting Remarkable Thermostability
Zarafeta, Frontiers in microbiology 2016 - “...analysis revealed that EstDZ3 is identical to a putative Dictyoglomus thermophilum / hydrolase (Accession no. WP_012548346). Analysis against Uniprot/SwissProt indicated that the closest sequence homolog of EstDZ3, which has been characterized functionally, is an arylesterase from Pseudomonas fluorescens (sequence identity 23%, coverage 78%, Accession no. P22862.4)...”
TRIREDRAFT_36822 uncharacterized protein from Trichoderma reesei QM6a
Aligns to 42:278 / 611 (38.8%), covers 47.1% of PF06500, 31.0 bits
ACRC_ASPA1 / P9WEZ7 Hydrolase acrC; Acurin A biosynthesis cluster protein C; EC 3.7.1.- from Aspergillus aculeatus (strain ATCC 16872 / CBS 172.66 / WB 5094) (see paper)
Aligns to 40:315 / 428 (64.5%), covers 47.1% of PF06500, 30.4 bits
- function: Hydrolase; part of the cluster that mediates the biosynthesis of acurin A, a highly reduced polyketide coupled to a serine via a peptide bond (PubMed:32234543). The activities of the highly reducing polyketide synthase acrA and the nonribosomal peptide synthetase acrB are collectively responsible for the synthesis of the acurin A core structure with a heptaketide backbone produced by acrA covalently fused to a L-serine by acrB (PubMed:32234543). After the formation of the PK- NRP hybrid product, it is detached from acrB by reductive release to set up the formation of the lactam ring by aldol condensation (Probable). The hydrolyase acrC then catalyzes water loss to generate a double bond in the ring (Probable). This double bond is probably reduced, which is followed by three oxidations at C-22 to generate the carboxylic acid moiety, involving probably the FAD-binding monooxygenase acrE and the cytochrome P450 monooxygenases acrD and acrF (Probable). Finally, a last methylation step performed by the O- methyltransferase acrG leads to the production of acurin A (Probable).
disruption phenotype: Abolishes the production of acurin A.
plu4186 No description from Photorhabdus luminescens subsp. laumondii TTO1
Q7MZT8 Photorhabdus luminescens subsp. laumondii TTO1 complete genome segment 15/17 from Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Aligns to 60:281 / 384 (57.8%), covers 48.6% of PF06500, 29.5 bits
- Secondary Metabolites Produced by Heterorhabditis Symbionts and Their Application in Agriculture: What We Know and What to Do Next
Stock, Journal of nematology 2017 (secret) - Genome mining unearths a hybrid nonribosomal peptide synthetase-like-pteridine synthase biosynthetic gene cluster
Park, eLife 2017 - “...of the multipotent stilbenes ( Joyce et al., 2008 ); and the polyketide anthraquinone pigments (Plu4186, 4187, 4188, 4192)( Brachmann et al., 2007 ). Collectively, our proteomic data support thatthe pepteridine genomic locus is regulated by HexA and positively affects pyrone quorum sensing and select secondary...”
- Molecular mechanism of polyketide shortening in anthraquinone biosynthesis of Photorhabdus luminescens
Zhou, Chemical science 2019 - “...is exceptional. Moreover, the local alignment search in the NCBI databank revealed that AntI (Uniprot: Q7MZT8) is predominantly found in Photorhabdus species. Thus, AntI is a promising candidate for polyketide shortening, followed by a unique cyclisation of the third aromatic ring in AQ biosynthesis ( Fig....”
FGSG_13222 hypothetical protein from Fusarium graminearum PH-1
Aligns to 29:277 / 419 (59.4%), covers 48.6% of PF06500, 28.0 bits
- The Fusarium graminearum histone H3 K27 methyltransferase KMT6 regulates development and expression of secondary metabolite gene clusters
Connolly, PLoS genetics 2013 - “...genes in the fusarin C cluster are upregulated (A, FGSG_07797; B, FGSG_07798, fus1/pks10 ; C, FGSG_13222, fus2 ; D, FGSG_13223, fus3 ; E, FGSG_07800, fus4 ; F, FGSG_07801, fus5 ; G, FGSG_07802, fus6 ; H, FGSG_07803, fus7 ; I, FGSG_07804, fus8 cytochrome P450; J, FGSG_07805). B....”
- Genome-wide expression profiling shows transcriptional reprogramming in Fusarium graminearum by Fusarium graminearum virus 1-DK21 infection
Cho, BMC genomics 2012 - “...FGSG_07798 Polyketide synthase 6.350204512 0.001744378 36 h FGSG_07800 Eukaryotic aspartyl protease 6.046050259 0.004179133 36 h FGSG_13222 Dipeptidyl aminopeptidases 5.960147173 0.003763144 36 h FGSG_07804 Cytochrome P450 5.427966104 0.011883416 36 h FGSG_04468 Amino acid transporter permease 4.672200299 0.012719315 120 h FGSG_08055 Amino acid transporter permease 4.288189196 0.013683756 120...”
- “...highly reduced at both 36 h and 120 h, whereas FGSG_03788, FGSG_00023, FGSG_07804, FGSG_07801, and FGSG_13222 were strongly induced regardless of the time point (Figure 3 AC). When the mRNA level of a gene is too low to quantify, or the P-values from the microarray data...”
MSMEG_5341 dipeptidyl aminopeptidase/acylaminoacyl peptidase from Mycobacterium smegmatis str. MC2 155
Aligns to 36:265 / 398 (57.8%), covers 47.8% of PF06500, 28.0 bits
CP_0620 alpha/beta hydrolase from Chlamydia pneumoniae AR39
Aligns to 41:199 / 316 (50.3%), covers 28.3% of PF06500, 27.3 bits
- The Chlamydia trachomatis CT149 protein exhibits esterase activity in vitro and catalyzes cholesteryl ester hydrolysis when expressed in HeLa cells
Peters, Microbes and infection 2012 - “...L2 strain 434/Bu (CTL0404), C. trachomatis A/HAR-13 (CTA_158), C. muridarum Nigg (TC_426), C. pneumoniae AR39 (CP_0620), and C. caviae GPIC (CCA_00614). The identical motifs are not only conserved in chlamydiae, but also the localization of the genes coding for CT149 homologs is syntenic with respect to...”
- “...A/HAR-13 (CTA_158, acc. no. YP_327950.1), C. muridarum Nigg (TC_0426, acc no. AAF39282.1), C. pneumonia AR39 (CP_0620, acc. no. AAF38435.1), and C. caviae GPIC (CCA_00614, acc no. AAP05356.1) in ClustalX2 with default settings. The black arrow marks the predicted cleavage site in all sequences. The GXSXG lipase/esterase...”
XF1745 conserved hypothetical protein from Xylella fastidiosa 9a5c
Aligns to 20:185 / 338 (49.1%), covers 32.6% of PF06500, 26.7 bits
UCSC_ACRSP / A0A411KUP9 Alpha/beta hydrolase ucsC; UCS1025A pyrrolizidinone biosynthesis cluster protein C; EC 3.7.1.- from Acremonium sp. (see paper)
Aligns to 38:298 / 492 (53.0%), covers 49.0% of PF06500, 26.5 bits
- function: Alpha/beta hydrolase; part of the gene cluster that mediates the biosynthesis of UCS1025A, a member of the pyrrolizidinone family that acts as a strong telomerase inhibitor and displays potent antibacterial and antitumor properties (PubMed:29373009). These compounds share a hemiaminal-containing pyrrolizidinone core fused with a gamma-lactone, giving a furopyrrolizidine that is connected to a decalin fragment (PubMed:29373009). The polyketide synthase module (PKS) of the PKS-NRPS ucsA is responsible for the synthesis of the polyketide backbone via the condensation of an acetyl-CoA starter unit with 6 malonyl-CoA units (PubMed:29373009). The downstream nonribosomal peptide synthetase (NRPS) module then amidates the carboxyl end of the polyketide with a 2S,3S-methylproline derived from L-isoleucine by the 2-oxoglutarate-dependent dioxygenase ucsF which converts L-isoleucine to (4S,5S)-4-methylpyrroline-5-carboxylate that is further converted to 2S,3S-methylproline by the pyrroline-5-carboxylate reductase ucsG (PubMed:29373009). Reductive release of the completed aminoacyl polyketide from the assembly line can form the 3-pyrrolin-2-one structure via an intramolecular Knoevenagel reaction (PubMed:29373009). Because ucsA lacks a designated enoylreductase (ER) domain, the required activity is provided the enoyl reductase ucsL (PubMed:29373009). This keto acyclic precursor is the substrate of the Diels-Alderase ucsH, that catalyzes the Diels-Alder cycloaddition (PubMed:29373009). Oxidation of the 3S-methyl group to a carboxylate by the cytochrome P450 monooxygenase ucsK allows an oxa-Michael cyclization that might involve the reductase/dehydrogenase ucsI and which furnishes the furopyrrolizidine (PubMed:29373009). The oxidase ucsJ likely plays a critical role in stereoselective reduction of the C5-C6 double bond to afford the required R-configured carboxylate group (Probable). Further enolization and oxidation at C5 by an unidentified enzyme affords the last intermediate that can undergo oxa-Michael cyclization to yield UCS1025A (Probable).
subunit: Homodimer.
ORFZB_PYRO7 / G4MVZ4 Hydrolase ORFZ; ACE1 cytochalasan biosynthesis cluster protein ORFZ; EC 3.7.1.- from Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958) (Rice blast fungus) (Magnaporthe oryzae) (see 3 papers)
Aligns to 27:351 / 424 (76.7%), covers 47.6% of PF06500, 25.5 bits
- function: Hydrolyase; part of the gene cluster that mediates the biosynthesis of a tyrosine-derived cytochalasan acting as a fungal signal recognized by resistant rice plants and leads to avirulence in Pi33 resistant rice cultivars (PubMed:18433432). The first step in the pathway is catalyzed by the hybrid PKS-NRPS ACE1, assisted by the enoyl reductase RAP1, that are responsible for fusion of the tyrosine precursor and the polyketide backbone (PubMed:29142718). The polyketide synthase module (PKS) of ACE1 is responsible for the synthesis of the polyketide backbone and the downstream nonribosomal peptide synthetase (NRPS) amidates the carboxyl end of the polyketide with the tyrosine precursor (PubMed:29142718). Because ACE1 lacks a designated enoylreductase (ER) domain, the required activity is provided the enoyl reductase RAP1 (PubMed:29142718). Reduction by the hydrolyase ORFZ, followed by dehydration and intra-molecular Diels-Alder cyclization by the Diels-Alderase ORF3 then yield the required isoindolone-fused macrocycle (Probable). A number of oxidative steps catalyzed by the tailoring enzymes identified within the cluster, including cytochrome P450 monooxygenases CYP1 to CYP4, the FAD-linked oxidoreductase OXR2 and the short-chain dehydrogenase/reductase OXR1, are further required to afford the final cytochalasans that confer avirulence and which have still to be identified (Probable). The monooxygenase CYP1 has been shown to be a site-selective C-18 hydroxylase whereas the function of CYP3 is the site-selective epoxidation of the C-6/C-7 olefin that is present in some intermediate compounds (PubMed:31644300). Finally, SYN2 and RAP2 are not required for avirulence in Pi33 resistant rice cultivars (PubMed:18433432).
subunit: Homodimer.
An07g00020 uncharacterized protein from Aspergillus niger
Aligns to 44:306 / 448 (58.7%), covers 49.0% of PF06500, 25.4 bits
- Cytosolic streaming in vegetative mycelium and aerial structures of Aspergillus niger
Bleichrodt, Studies in mycology 2013 - “...S30 - Saccharomyces cerevisiae An02g13750 1062 Strong similarity to glutaminase A gtaA - Aspergillus oryzae An07g00020 1054 Strong similarity to hypothetical protein Z - Streptomyces hygroscopicus An12g02740 1051 Weak similarity to ATP-dependent proteinase Clp from patent WO9743303-A1 - Streptococcus pneumoniae An01g02880 1048 Strong similarity to cytoplasmic...”
TTE1809 Hydrolases of the alpha/beta superfamily from Thermoanaerobacter tengcongensis MB4
Aligns to 1:147 / 258 (57.0%), covers 30.9% of PF06500, 25.1 bits
- Thermostable feruloyl esterase for the bioproduction of ferulic acid from triticale bran
Abokitse, Applied microbiology and biotechnology 2010 (PubMed)- “...A putative / hydrolase fold-encoding gene (locus tag TTE1809) from the genome of Thermoanaerobacter tengcongensis was cloned and expressed in Escherichia coli...”
- “...in the thermophilic T. tengcongensis strain MB4T (locus tag TTE1809; NP_623397; Bao et al. 2002) showing 26% sequence identity was chosen for this study. The T....”
- Carboxylic ester hydrolases from hyperthermophiles
Levisson, Extremophiles : life under extreme conditions 2009 - “...Lysophospholipase 314 GHSFG TTE0552 AAM23828 Predicted hydrolase 279 GVSMG TTE0556 AAM23832 Predicted hydrolase 298 GWSMG TTE1809 AAM25001 Alpha/beta hydrolase 258 GLSMG TTE2321 AAM25462 Alpha/beta hydrolase 414 CHSMG TTE2547 AAM25672 Alpha/beta hydrolase 285 AHSFG Thermococcus kodakaraensis TK0522 BAD84711 Carbohydrate esterase 449 GSSLG Thermotoga maritima TM1022 AAD36099 Esterase...”
CHGG_01246 uncharacterized protein from Chaetomium globosum CBS 148.51
Aligns to 30:278 / 431 (57.8%), covers 36.7% of PF06500, 25.1 bits
CT206 (predicted acyltransferase family) from Chlamydia trachomatis D/UW-3/CX
Aligns to 13:177 / 282 (58.5%), covers 27.3% of PF06500, 25.1 bits
- Chlamydia trachomatis infection induces replication of latent HHV-6
Prusty, PloS one 2013 - “...22412.0638 <32+/ 20 ND NEG 22 CT175 10.633452 25.0302 3125.70194 <32+/ ND ND POS 23 CT206 ND 203.0779 6519.2924 POS Samples with detectable HHV-6 DNA as well as chlamydial (Ctr) DNA in cervical smears were grouped in this table. HHV-6 DNA load in cervical smears and...”
- The Chlamydia trachomatis CT149 protein exhibits esterase activity in vitro and catalyzes cholesteryl ester hydrolysis when expressed in HeLa cells
Peters, Microbes and infection 2012 - “...of the esterase/lipase family (predicted outer membrane protein CT073, Lysophospholipase esterase CT136, and predicted acyltransferase CT206) had either zero or only one GXSXG motif in their protein sequence. In addition we did not find other annotated hydrolases in other bacterial species, including Mycobacterium and E. coli...”
- “...esterases and lipases. From four annotated esterase/lipase proteins in C. trachomatis (CT073, CT136, CT149, and CT206) only the gene product from ct149 contains two GXSXG motifs found in lipases/esterases [ 23 , 24 ]. Also, compared to other bacterial species, we did not find another esterase/lipase...”
GRGF_PENSQ / A0A6F8RQ06 Polyketide transferase grgF; Gregatin A biosynthesis cluster protein F; Hydrolase grgF; EC 2.3.-.- from Penicillium sp. (see paper)
Aligns to 2:171 / 294 (57.8%), covers 37.9% of PF06500, 24.9 bits
- function: Polyketide transferase; part of the gene cluster that mediates the biosynthesis of gregatin A, a fungal polyketide featuring an alkylated furanone core (PubMed:32275405). The PKS grgA synthesizes C11 and C4 polyketide chains in the presence and absence of the trans- enoyl reductase grgB, respectively (PubMed:32275405). The polyketide transferase grgF is then responsible for the fusion of the two carbon chains to produce the furanone skeleton of gregatin A (PubMed:32275405). GrgF first undergoes a conformational change to an open form, and the active site Cys-115 is acylated by the C11 chain. After the elimination of the phosphopantetheinyl chain, the second polyketide chain of four carbons long is delivered adjacent to the enzyme-bound C11 chain. The catalytic histidine, His-269, deprotonates a proton from C-2 of the long chain, and the resultant carbanion attacks the C-1 carbonyl of the crotonyl group to perform Claisen condensation, by which the phosphopantetheinyl chain is released. Eventually, hydrolysis of the thioester linkage probably by a His-269- activated water molecule completes the reaction to afford the grgF final product (PubMed:32275405). Next, the cytochrome P450 monooxygenase grgG accepts the unstable grgF final product as substrate and performs the oxidative cyclization to furnish the gregatin scaffold and leads to the formation of desmethylgregatin A (PubMed:32275405). Finally, the O-methyltransferase grgD methylates the carboxyl group of desmethylgregatin A to provide gregatin A (PubMed:32275405).
subunit: Homodimer.
7z2uA / D7RU28 Wild-type ferulic acid esterase from lactobacillus buchneri in complex with ferulate (see paper)
Aligns to 1:202 / 263 (76.8%), covers 29.7% of PF06500, 24.4 bits
- Ligand: 3-(4-hydroxy-3-methoxyphenyl)-2-propenoic acid (7z2uA)
PA3829 hypothetical protein from Pseudomonas aeruginosa PAO1
Aligns to 1:163 / 307 (53.1%), covers 31.6% of PF06500, 24.2 bits
- Functional Characterization of TetR-like Transcriptional Regulator PA3973 from Pseudomonas aeruginosa
Kotecka, International journal of molecular sciences 2022 - “...07350 PA3551 alginate biosynthesis protein AlgA 1.06 1.05 AP; SF; CWLC 1,229,065 6.17 T+ 05895 PA3829 alpha/beta hydrolase 0.59 0.94 HUU 1,229,065 6.17 P+ 05900 PA3828 LPS export ABC transporter permease LptF 0.98 1.00 MP 2,863,600 5.27 T+ 13525 PA2396 N(5)-hydroxyornithine transformylase PvdF 0.84 1.04 AP;...”
- An atlas of the binding specificities of transcription factors in Pseudomonas aeruginosa directs prediction of novel regulators in virulence
Wang, eLife 2021 - “...By contrast, the promoter fragment of katB , nrdA , rocA1 , nrdA , and PA3829 were used as the negative controls, respectively. Note that the up-shift bands of DNA in gel were observed in the experiments but not in negative controls. The TF motifs for...”
CLAH_PENCR / A0A481WQ01 Polyketide transferase claH; Clavatol biosynthesis cluster protein H; EC 2.3.-.- from Penicillium crustosum (Blue mold fungus) (see 2 papers)
Aligns to 3:165 / 308 (52.9%), covers 32.1% of PF06500, 24.2 bits
- function: Polyketide transferase; part of the cla gene cluster that produces clavatol and ortho-quinone methide (PubMed:30811183). The clavatol biosynthesis cluster cla and the terrestric acid cluster tra are both involved in the production of peniphenones and penilactones (PubMed:30811183). The non-reducing PKS claF is responsible for the formation of clavatol from successive condensations of 3 malonyl-CoA units, presumably with a simple acetyl-CoA starter unit, and 2 methylation steps (PubMed:30811183). The esterase claE probably collaborates with claF by catalyzing the hydrolysis of ACP-bound acyl intermediates to free the ACP from stalled intermediates (By similarity). The clavatol oxidase claD then converts clavatol to hydroxyclavatol (PubMed:30811183). Spontaneous dehydration of hydroxyclavatol leads to the accumulation of the highly active ortho- quinone methide (PubMed:30811183, PubMed:31860310). On the other hand, the PKS-NRPS hybrid traA is involved in the formation of crustosic acid, with the help of traB and traD (PubMed:30811183). The polyketide synthase module (PKS) of traA is responsible for the synthesis of the polyketide backbone via the condensation of an acetyl-CoA starter unit with 3 malonyl-CoA units (PubMed:30811183). The downstream nonribosomal peptide synthetase (NRPS) module then amidates the carboxyl end of the polyketide with L-malic acid (PubMed:30811183). Because traA lacks a designated enoylreductase (ER) domain, the required activity is provided the enoyl reductase traG (By similarity). Crustosic acid undergoes decarboxylation and isomerization to the terrestric acid, catalyzed by the 2-oxoglutarate-dependent dioxygenase traH (PubMed:30811183). Both acids are further converted to the 2 gamma- butyrolactones (R)-5-methyltetronic acid and (S)-5- carboxylmethyltetronic acid, with involvement of the cytochrome P450 monooxygenase claJ (PubMed:30811183). Spontaneous addition of the methide to these gamma-butyrolactones leads to peniphenone D and penilactone D, which undergo again stereospecific attacking by methide to give penilactones A and B (PubMed:30811183, PubMed:31860310). The function of the polyketide transferase claH has not been investigated yet (Probable).
D7RU28 Ferulic acid esterase from Lentilactobacillus buchneri
Aligns to 1:198 / 260 (76.2%), covers 28.0% of PF06500, 23.7 bits
PSOB_ASPFU / Q4WAZ8 Alpha/beta hydrolase psoB; Pseurotin biosynthesis protein B; EC 3.7.1.- from Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293) (Neosartorya fumigata) (see 3 papers)
AFUA_8G00530, Afu8g00530 alpha/beta hydrolase, putative from Aspergillus fumigatus Af293
Aligns to 56:272 / 445 (48.8%), covers 33.8% of PF06500, 23.6 bits
- function: Alpha/beta hydrolase; part of the gene cluster that mediates the biosynthesis of pseurotin A, a competitive inhibitor of chitin synthase and an inducer of nerve-cell proliferation (PubMed:24082142, PubMed:24939566). The PKS-NRPS hybrid synthetase psoA is responsible for the biosynthesis of azaspirene, one of the first intermediates having the 1-oxa-7-azaspiro[4,4]-non-2-ene-4,6-dione core of pseurotin, via condensation of one acetyl-CoA, 4 malonyl-CoA, and a L- phenylalanine molecule (PubMed:24082142, PubMed:24939566). The dual- functional monooxygenase/methyltransferase psoF seems to be involved in the addition of the C3 methyl group onto the pseurotin scaffold (PubMed:24939566). Azaspirene is then converted to synerazol through 4 steps including oxidation of C17 by the cytochrome P450 monooxygenase psoD, O-methylation of the hydroxy group of C8 by the methyltransferase psoC, and the trans-to-cis isomerization of the C13 olefin by the glutathione S-transferase psoE (PubMed:24939566). The fourth step of synerazol production is performed by the dual-functional monooxygenase/methyltransferase psoF which seems to catalyze the epoxidation of the intermediate deepoxy-synerazol (PubMed:24939566). Synerazol can be attacked by a water molecule nonenzymatically at two different positions to yield two diol products, pseurotin A and pseurotin D (PubMed:24939566).
subunit: Homodimer.
disruption phenotype: Results in significant reduction of pseurotin production (PubMed:24082142). - At the metal-metabolite interface in Aspergillus fumigatus: towards untangling the intersecting roles of zinc and gliotoxin
Traynor, Microbiology (Reading, England) 2021 - “...P450 monooxygenase FmaG Unique n/a 6 20 AFUA_8G00510 Alpha/beta hydrolase PsoB Unique n/a 12 28.3 AFUA_8G00530 Amino acid oxidase FmpA 7.85265 0.000558 43 85.5 AFUA_6G03440 Fumipyrrole biosynthesis protein C FmpC 6.3108 0.006005 17 33.3 AFUA_6G03460 PKS-NRPS hybrid synthetase PsoA [ 49 ] 5.52392 0.000525 4 42.8...”
- A possible role for fumagillin in cellular damage during host infection by Aspergillus fumigatus
Guruceaga, Virulence 2018 - “...9.95 4.68 10.36 Cytochrome P450 oxidoreductase OrdA-like Afu8g00510 fmaG 5.87 11.07 5.02 10.92 / hydrolase Afu8g00530 psoB 5.41 8.30 5.29 8.47 Methyltransferase Afu8g00550 psoC 7.09 10.12 6.90 10.70 Cytochrome P450 oxidoreductase Afu8g00560 4.61 ND 4.46 ND Glutathione S-transferase like Afu8g00580 elfB / psoE 5.06 9.48 4.96...”
- Regulation of Secondary Metabolism by the Velvet Complex Is Temperature-Responsive in Aspergillus
Lind, G3 (Bethesda, Md.) 2016 - “..., Afu8g00490 , Afu8g00500 , Afu8g00510 , Afu8g00520 Lin et al. (2013) Cluster 34 Pseurotin Afu8g00530 , Afu8g00540 , Afu8g00550 , Afu8g00560 , Afu8g00570 , Afu8g00580 Wiemann et al. (2013) Cluster 35 Not known Afu8g00590 , Afu8g00595 , Afu8g00600 , Afu8g00610 , Afu8g00620 , Afu8g00630 ,...”
- A modified recombineering protocol for the genetic manipulation of gene clusters in Aspergillus fumigatus
Alcazar-Fuoli, PloS one 2014 - “...the left subtelomeric arm of chromosome 8. Genes in the cluster encode two putative hydrolases (AFUA_8G00530, AFUA_8G00570) a putative methyltransferase (AFUA_8G00550), a putative P450 monooxygenase (AFUA_8G00560) and the hybrid PKS/NRPS psoA (AFUA_8G00540) [47] . It has been demonstrated, via gene replacement analyses that integrity of the...”
- “...of pseurotin A production we constructed A. fumigatus mutants lacking the entire pseurotin gene cluster (AFUA_8G00530 AFUA_8G00580) or other genes within or surrounding the cluster limits. We focused upon AFUA_8G00520, which encodes an integral membrane protein which lies beyond the cluster boundaries but is co-regulated, during...”
- A proteomic approach to investigating gene cluster expression and secondary metabolite functionality in Aspergillus fumigatus
Owens, PloS one 2014 - “...enzymes, that form part of the pseurotin biosynthetic cluster, were detected here; an alpha/beta hydrolase (AFUA_8G00530), a hybrid PKS-NRPS enzyme PesO (AFUA_8G00540), a methyltransferase SirN-like (AFUA_8G00550) and a putative glutathione S-transferase (AFUA_8G00580) [4] . This cluster has demonstrated increased expression at both the transcript and protein...”
- RNA-seq reveals the pan-transcriptomic impact of attenuating the gliotoxin self-protection mechanism in Aspergillus fumigatus
O'Keeffe, BMC genomics 2014 - “...0.002 AFUA_8G00510 fmaG 0.793 0.820 8.101 0.0005 AFUA_8G00520 fma-TC/fmaA 0.528 0.904 8.369 0.022 Pseurotin A AFUA_8G00530 psoB 0.415 0.946 7.450 0.0005 AFUA_8G00540 psoA/NRPS14 0.768 0.776 5.792 0.0005 AFUA_8G00550 psoC 0.292 0.964 7.413 0.0005 AFUA_8G00560 psoD 0.808 0.735 6.778 0.0005 AFUA_8G00570 - 0.271 0.965 8.059 0.064 AFUA_8G00580...”
- “...all of the pseurotin A biosynthetic genes was significantly down-regulated (Table 2 ). Expression of AFUA_8G00530 and A. fumigatus psoA/nrps14 , the PKS-NRPS hybrid [ 28 ], were down-regulated log 2 7.45- and log 2 5.79-fold respectively, while A. fumigatus psoC, psoD and elfB [ 31...”
- The fumagillin gene cluster, an example of hundreds of genes under veA control in Aspergillus fumigatus
Dhingra, PloS one 2013 - “...fumagillin gene cluster from Afu8g00370 Afu8g00520 [ 53 ]; and the pseurotin A cluster from Afu8g00530 Afu8g00570 [ 88 ]. 10.1371/journal.pone.0077147.g003 Figure 3 Expression patterns of the fumagillin (A), fumitremorgin G (B), and fumigaclavine C (C) gene clusters in the veA vs WT and OE veA...”
- Transcriptional and proteomic analysis of the Aspergillus fumigatus ΔprtT protease-deficient mutant
Hagag, PloS one 2012 - “...unknown, cluster 24 contains genes for the biosynthesis of fumitremorgin (AFUA_8G00170- AFUA_8G00250) and pseurotin A (AFUA_8G00530- AFUA_8G00720) [13] , [15] , [34] . Only the genes involved in pseurotin A biosynthesis were upregulated in cluster 24 in the prtT mutant. Pseurotin A is a competitive inhibitor...”
- More
CCA_00614 alpha/beta hydrolase from Chlamydia caviae GPIC
Aligns to 41:219 / 315 (56.8%), covers 29.7% of PF06500, 23.6 bits
- The Chlamydia trachomatis CT149 protein exhibits esterase activity in vitro and catalyzes cholesteryl ester hydrolysis when expressed in HeLa cells
Peters, Microbes and infection 2012 - “...trachomatis A/HAR-13 (CTA_158), C. muridarum Nigg (TC_426), C. pneumoniae AR39 (CP_0620), and C. caviae GPIC (CCA_00614). The identical motifs are not only conserved in chlamydiae, but also the localization of the genes coding for CT149 homologs is syntenic with respect to the monooxygenase CT148 and the...”
- “...(TC_0426, acc no. AAF39282.1), C. pneumonia AR39 (CP_0620, acc. no. AAF38435.1), and C. caviae GPIC (CCA_00614, acc no. AAP05356.1) in ClustalX2 with default settings. The black arrow marks the predicted cleavage site in all sequences. The GXSXG lipase/esterase and the CRAC sequence are marked with solid...”
TC0478 conserved hypothetical protein from Chlamydia muridarum Nigg
Aligns to 3:264 / 272 (96.3%), covers 27.3% of PF06500, 23.1 bits
FUJ3_GIBF5 / S0EBV2 Polyketide transferase FFUJ_12241; Fujikurins biosynthesis cluster protein FFUJ_12241; EC 2.3.-.- from Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831) (Bakanae and foot rot disease fungus) (Fusarium fujikuroi) (see 2 papers)
FFUJ_12241 related to DltD N-terminal domain protein from Fusarium fujikuroi IMI 58289
Aligns to 5:130 / 320 (39.4%), covers 28.3% of PF06500, 23.1 bits
- function: Polyketide transferase; part of the gene cluster that mediates the biosynthesis of fujikurins A-D, secondary metabolites playing a role during rice infection (PubMed:23825955, PubMed:26192387). The polyketide synthase PKS19 acts with the trans- enoyl reductase FFUJ_12240 and the polyketide transferase FFUJ_12241 to produce fujikurins, however, the biosynthesis pathway has not been identified yet (PubMed:23825955, PubMed:26192387).
- Whole-genome sequence and mass spectrometry study of the snow blight fungus Phacidium infestans (Karsten) DSM 5139 growing at freezing temperatures
Zerouki, Molecular genetics and genomics : MGG 2023 - “...identity with various biosynthesis proteins 2729 Phain_OT5_Proseq6434 (294 aa) Polyketide transferase Fujikurins biosynthesis cluster protein FFUJ_12241 68 Phain_OT5_Proseq6439 (269 aa) Short chain dehydrogenase Trichoxide biosynthesis protein virK 48 a Proteins retrieved from the fujikurin synthesis pathway in F. fujikuroi (Studt et al. 2016 ) b Most...”
- Deciphering the cryptic genome: genome-wide analyses of the rice pathogen Fusarium fujikuroi reveal complex regulation of secondary metabolism and novel metabolites
Wiemann, PLoS pathogens 2013 - “...transcription factor gene (FFUJ_12243) enhanced expression of PKS19 (FFUJ_12239), FFUJ_12240, FFUJ_12242, and FFUJ_12243, but not FFUJ_12241 or FFUJ_12244 ( Figure 14C ). Analysis of culture extracts of the double overexpression strain (OE::PKS19/OE::FFUJ_12243) led to identification of four metabolites ( Figure 14 , compounds 1 , 2...”
Or search for genetic data about PF06500 in the Fitness Browser
by Morgan Price,
Arkin group
Lawrence Berkeley National Laboratory