Family Search for PF06980 (DUF1302)

April 2024: See Interactive Tools for Functional Annotation of Bacterial Genomes for advice on using these tools.

PF06980 hits 20 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.

PP_0765 putative adhesin (DUF1302) from Pseudomonas putida KT2440
PP_0765 DUF1302 domain-containing protein from Pseudomonas putida KT2440
PP0765 conserved hypothetical protein from Pseudomonas putida KT2440
Aligns to 10:628 / 628 (98.6%), covers 99.4% of PF06980, 606.4 bits

• mutant phenotype: Similar to PA3923, which binds laminin (PMC6890786) and is involved in biofilm formation (PMC8547006), so this is probably an adhesin.
• Fatty Acid and Alcohol Metabolism in Pseudomonas putida: Functional Analysis Using Random Barcode Transposon Sequencing
  Thompson, Applied and environmental microbiology 2020 (secret)
• The TonB_m-PocAB System Is Required for Maintenance of Membrane Integrity and Polar Position of Flagella in Pseudomonas putida
  Ainsaar, Journal of bacteriology 2019 (secret)
• Differential proteomics and physiology of Pseudomonas putida KT2440 under filament-inducing conditions
  Crabbé, BMC microbiology 2012
  • “...gi|26987279 0.28 Acetyltransferase PP_0545 gi|26987283 0.43* Aldehyde dehydrogenase family protein PP_0763 gi|26987499 0.50 Acyl-CoA synthetase PP_0765 gi|26987501 0.45* Hypothetical protein PP_0765 PP_0951 RpoX gi|26987687 0.34* Sigma 54 modulation protein/ribosomal protein S30EA PP_0999 ArcC gi|26987735 0.23* Carbamate kinase PP_1000 ArgI gi|26987736 0.28* Ornithine carbamoyltransferase PP_1001 ArcA gi|26987737...”
• UEG Week 2023 Poster Presentations
  , United European gastroenterology journal 2023
• Mechanisms of resistance to chloramphenicol in Pseudomonas putida KT2440
  Fernández, Antimicrobial agents and chemotherapy 2012
  • “...PP0504 PP0529 PP0586 PP0588 PP0613 PP0620 PP0741 PP0742 PP0765 PP0766 PP0951 PP1018 PP1514 PP1516 PP2284 PP2310 PP2512 PP2736 PP2738 PP3352 PP3440 PP3656 PP3657...”
• The metabolic response of P. putida KT2442 producing high levels of polyhydroxyalkanoate under single- and multiple-nutrient-limited growth: highlights from a multi-level omics approach
  Poblete-Castro, Microbial cell factories 2012
  • “...kDa 3.4 -1.1 Other functions PP2141 Hypothetical protein -4.0 -3.1 PP1659 Hypothetical protein -4.8 -2.4 PP0765 Hypothetical protein -7.1 -2.8 PP2685 Hypothetical protein 11.1 4.0 PP2686 Transglutaminase-like superfamily 6.6 4.6 PP2687 Conserved hypothetical protein 7.1 2.6 PP2689 Endoribonuclease putative 1.7 2.5 * 0.1 > P -value...”

PA14_19810 hypothetical protein from Pseudomonas aeruginosa UCBPP-PA14
PA3422 hypothetical protein from Pseudomonas aeruginosa PAO1
Aligns to 10:585 / 585 (98.5%), covers 99.6% of PF06980, 599.2 bits

• Genome wide identification and experimental validation of Pseudomonas aeruginosa Tat substrates
  Gimenez, Scientific reports 2018
  • “...PA3713 MTI SRR D FL NGVALTIAAGLT PAEILRA* PA14_18900 PA3493 MDAA TRR SM L RNALLLGLFALVGVG LVALV* PA14_19810 PA3422 MTTTK RR GIFPL HALAAATALG C ATQASA* PA14_20200 PA3392 MSDDTKSPHEETHGLN RR G F LGASALTGAAALVGASALGSAV VGREARA* PA14_21110 PA3319 d MISK SRR S F IR LAAGTVGATVATSML PSSIQA* PA14_22560 PA3222 MN RR SA...”
• Genome wide identification and experimental validation of Pseudomonas aeruginosa Tat substrates
  Gimenez, Scientific reports 2018
  • “...MTI SRR D FL NGVALTIAAGLT PAEILRA* PA14_18900 PA3493 MDAA TRR SM L RNALLLGLFALVGVG LVALV* PA14_19810 PA3422 MTTTK RR GIFPL HALAAATALG C ATQASA* PA14_20200 PA3392 MSDDTKSPHEETHGLN RR G F LGASALTGAAALVGASALGSAV VGREARA* PA14_21110 PA3319 d MISK SRR S F IR LAAGTVGATVATSML PSSIQA* PA14_22560 PA3222 MN RR SA L...”
• Secretome analysis of Vibrio cholerae type VI secretion system reveals a new effector-immunity pair
  Altindis, mBio 2015
  • “...inactive state of T6SS ( 13 ). Of those three proteins, the two encoded by PA3422 and PA1888 do not have any homologs in V.cholerae . However, the third (encoded by PA3836) is predicted to be a zinc binding protein as well. Interestingly, PAAR proteins also...”
• A type VI secretion system of Pseudomonas aeruginosa targets a toxin to bacteria
  Hood, Cell host & microbe 2010
  • “...study Tse2 PA2702 2.0 1.8 9.0 (< 0.001) 6 H1-T6SS Substrate, current study Category 3 PA3422 1.1 1.8 - 4 Hypothetical protein PA1888 1.5 1.7 - 6 Hypothetical protein PA3836 1.0 1.6 - 3 ABC-type transport system (COG2984) a Protein names extracted from the Integrated Microbial...”
• Use of O-antigen gene cluster-specific PCRs for the identification and O-genotyping of Yersinia pseudotuberculosis and Yersinia pestis
  Bogdanovich, Journal of clinical microbiology 2003
  • “...Source (reference) St.1 pa3606 Kuratani-2 208 1779 274 83 51 Pa3422 204 197 DD110 257 151 R708 6088 R80 MW864-2 N916 CN3 93422 O:1a O:1b O:1c O:2a O:2b O:2c...”

PA14_13130 hypothetical protein from Pseudomonas aeruginosa UCBPP-PA14
Aligns to 10:641 / 641 (98.6%), covers 99.8% of PF06980, 594.5 bits

• Deprivation of the Periplasmic Chaperone SurA Reduces Virulence and Restores Antibiotic Susceptibility of Multidrug-Resistant Pseudomonas aeruginosa
  Klein, Frontiers in microbiology 2019
  • “...T3SS ExsB (PA14 42400) <0.01 Others Gbt <0.01 4 * FadL (PA14_60730) <0.01 14 3DWO PA14_13130 0.03 PA14_24360 0.04 PA14_36020 7.28 FusA (PA14_13520) >20.40 4 * OM fractions of PA14 WT and the conditional surA mutant derived from three independent experiments were analyzed by mass spectrometry....”

PA3923 hypothetical protein from Pseudomonas aeruginosa PAO1
MPAO1_05385 DUF1302 domain-containing protein from Pseudomonas aeruginosa
Aligns to 10:641 / 641 (98.6%), covers 99.8% of PF06980, 594.2 bits

• Identification of genes involved in enhanced membrane vesicle formation in Pseudomonas aeruginosa biofilms: surface sensing facilitates vesiculation
  Kanno, Frontiers in microbiology 2023
  • “...aminopeptidase PaAP 2 80.0 AAG07609.1 117 PA4221 Fe (III)-pyochelin receptor FptA 3 63.1 AAG07310.1 120 PA3923 Unknown OMP 4 50.4 AAG06923.1 138 PA3535 Probable serine protease precursor EprS 5 46.9 AAG04347.1 111 PA0958 OM porin OprD 6 44.9 AAG06426.1 100 PA3038 OM porin OpdQ 7 22.0...”
  • “...2010b ), the protein pattern of b-MVs was significantly different ( Figure 2D ). FptA, PA3923, Esp, OprD, OpdQ, and PA4824 were the major protein components of b-MVs ( Table 2 ). However, no significant differences in the OMPs between planktonic and biofilm cells were observed...”
• GAUGE-Annotated Microbial Transcriptomic Data Facilitate Parallel Mining and High-Throughput Reanalysis To Form Data-Driven Hypotheses
  Li, mSystems 2021
  • “...73 GAUGE-annotated P. aeruginosa studies, three times more than previously available. GAPE analysis revealed that PA3923 , a gene of unknown function, was frequently differentially expressed in more than 50% of studies and significantly coregulated with genes involved in biofilm formation. Follow-up wet-bench experiments demonstrate that...”
  • “...(KEGG) ( 12 ) pathway enrichment analysis of the compendium revealed a functional prediction for PA3923 , a P. aeruginosa gene encoding a hypothetical protein. We conducted experiments that supported the prediction that PA3923 is a novel protein involved in P. aeruginosa biofilm formation. The GAUGE-annotated...”
• Pseudomonas aeruginosa uses multiple receptors for adherence to laminin during infection of the respiratory tract and skin wounds
  Paulsson, Scientific reports 2019
  • “...Four new high-affinity laminin receptors were identified in the outer membrane; EstA, OprD, OprG and PA3923. Mutated bacteria devoid of these receptors adhered poorly to immobilized laminin. All bacterial receptors bound to the heparin-binding domains on LG4 and LG5 of the laminin alpha chain as assessed...”
  • “...laminin-receptor on P. aeruginosa 14 , four of those, i.e ., EstA, OprD, OprG and PA3923, were further characterized as laminin-receptors in downstream analysis. The remaining six putative laminin-binding proteins were discarded either since the amino acid sequence indicated other subcellular localization than the outer membrane,...”
• Inhibition of Pseudomonas aeruginosa swarming motility by 1-naphthol and other bicyclic compounds bearing hydroxyl groups
  Oura, Applied and environmental microbiology 2015
  • “...PA1914 PA3369 PA3370 PA3371 PA3488 PA3520 PA3601 PA3919 PA3923 PA3969 PA4063 PA4115 PA4155 PA4220 PA4648 PA4773 PA4774 PA4916 PA5460 PA5481 a Fold change...”
• σ Factor and Anti-σ Factor That Control Swarming Motility and Biofilm Formation in Pseudomonas aeruginosa
  McGuffie, Journal of bacteriology 2015
  • “...PA1494 PA2432 PA2895 PA2896 PA3179 PA3569 PA3570 PA3876 PA3923 PA4495 PA5172 PA5315 PA5435 PA5445 PAO1 sbrR pPSV38 vs. PAO1 pPSV38 ical triplicate or...”
• A temporal examination of the planktonic and biofilm proteome of whole cell Pseudomonas aeruginosa PAO1 using quantitative mass spectrometry
  Park, Molecular & cellular proteomics : MCP 2014
  • “...transporter), PA3236 (a probable glycine betaine-binding protein), PA3923, and PA3922. PA3923 has 77% sequence identity to the adhesion AidA, whereas PA3922...”
  • “...variety of Pseudomonas species. The consistent detection of PA3923 in the biofilm samples might be biologically relevant in light of studies in pathogenic...”
• Comparative systems biology analysis to study the mode of action of the isothiocyanate compound Iberin on Pseudomonas aeruginosa
  Tan, Antimicrobial agents and chemotherapy 2014
  • “...PA3520 PA3554 PA3613 PA3621.1 PA3691 PA3692 PA3724 PA3734 PA3923 PA3974 PA4078 PA4112 PA4141 PA4142 PA4143 PA4144 PA4156 PA4159 PA4160 PA4175 PA4207 PA4209...”
• Food as a source for quorum sensing inhibitors: iberin from horseradish revealed as a quorum sensing inhibitor of Pseudomonas aeruginosa
  Jakobsen, Applied and environmental microbiology 2012
  • “...PA3331 PA3361 PA3477 PA3478 PA3479 PA3520 PA3692 PA3724 PA3923 PA4129 PA4130 PA4131 PA4132 PA4133 PA4134 PA4141 PA4142 PA4175 PA4209 PA4211 PA4217 PA4738 PA4739...”
• More
• An integrated model system to gain mechanistic insights into biofilm-associated antimicrobial resistance in Pseudomonas aeruginosa MPAO1
  Varadarajan, NPJ biofilms and microbiomes 2020
  • “...0.03 MPAO1_02290 TonB-dependent receptor 1.66 0.01 MPAO1_27435 Amino acid ABC transporter substrate-binding protein 3.09 0.03 MPAO1_05385 DUF1302 domain-containing protein 2.80 0.03 MPAO1_17965 acnA * Aconitate hydratase 1.49 0.01 48 MPAO1_24155 pilY1 * Type 4a pilus biogenesis protein PilY1 1.54 0.01 49 MPAO1_05375 Fatty acid--CoA ligase 5.06...”

PFLU0923 hypothetical protein from Pseudomonas fluorescens SBW25
Aligns to 10:619 / 619 (98.5%), covers 99.4% of PF06980, 581.9 bits

• Plasmids manipulate bacterial behaviour through translational regulatory crosstalk
  Thompson, PLoS biology 2023
  • “...of greater than 50% ( Fig 4 ), with these being the upstream regions of PFLU0923 (ATGGA), PFLU3378 (AGGGA), PFLU1516 (AGGGA), PFLU4443 (AGGGA, FleQ), and PFLU4726 (ATGGA) with the highest binding seen with PFLU3378. 10.1371/journal.pbio.3001988.g004 Fig 4 RsmQ binds to the upstream regions of predicted mRNA...”
• Plasmid manipulation of bacterial behaviour through translational regulatory crosstalk
  Thompson, 2022

Psest_1122 putative adhesin (DUF1302) from Pseudomonas stutzeri RCH2
Aligns to 11:601 / 601 (98.3%), covers 99.3% of PF06980, 565.5 bits

• mutant phenotype: Similar to PA3923, which binds laminin (PMC6890786) and is involved in biofilm formation (PMC8547006), so this is probably an adhesin.

B158DRAFT_0994 putative adhesin (DUF1302) from Kangiella aquimarina DSM 16071
Aligns to 15:637 / 637 (97.8%), covers 99.6% of PF06980, 553.7 bits

• mutant phenotype: Similar to PA3923, which binds laminin (PMC6890786) and is involved in biofilm formation (PMC8547006), so this is probably an adhesin.

Kkor_1992 protein of unknown function DUF1302 from Kangiella koreensis DSM 16069
Aligns to 15:637 / 637 (97.8%), covers 99.6% of PF06980, 541.0 bits

• The MetJ regulon in gammaproteobacteria determined by comparative genomics methods
  Augustus, BMC genomics 2011
  • “...of Kangiella , one uncharacterized gene with potential metboxes has some similarity to dipeptide transporters: Kkor_1992 (DUF1302 superfamily). Homologs of this gene occur in other Alt species, but not with metboxes. Vitamin B 12 , or cobalamin, is the necessary co-factor for the methionine synthase MetH,...”

PA3082 glycine betaine transmethylase from Pseudomonas aeruginosa PAO1
Aligns to 15:654 / 654 (97.9%), covers 99.4% of PF06980, 537.2 bits

• Traditional Chinese Medicine Tanreqing Inhibits Quorum Sensing Systems in Pseudomonas aeruginosa
  Yang, Frontiers in microbiology 2020
  • “...arginine N2-succinyltransferase PA0897 aruG 1.2 Subunit II of arginine N2-succinyltransferase PA1818 cadA 1.2 Lysine decarboxylase PA3082 gbt 1.2 Glycine betaine transmethylase PA4731 panD 1.4 1.2 Aspartate 1-decarboxylase precursor Carbon compound catabolism PA0153 pcaH 3.9 Protocatechuate 3,4-dioxygenase, beta subunit PA0154 pcaG 4.1 Protocatechuate 3,4-dioxygenase, alpha subunit PA0226...”
• Identification of two gene clusters and a transcriptional regulator required for Pseudomonas aeruginosa glycine betaine catabolism
  Wargo, Journal of bacteriology 2008
  • “...GB or DMG. Mutants defective in the previously described gbt gene (PA3082) grew on GB with kinetics similar to those of the wild type in both the PAO1 and PA14...”
  • “...mM DMG, or 20 mM sarcosine was used. Mutants defective in PA3082 were grown on the media described above, as well as in the minimal medium described by Serra et...”
• Role of lon, an ATP-dependent protease homolog, in resistance of Pseudomonas aeruginosa to ciprofloxacin
  Brazas, Antimicrobial agents and chemotherapy 2007
  • “...22_C5 53_F11 16_G12 PA0353 PA0836 PA1803 PA1803 PA1803 PA3082 PA3294 PA3617 PA3777 PA3965 PA4163 PA4316 PA4316 PA4422 PA4466 PA4700 PA4700 PA4756 PA4763 PA4961...”
• Glycine betaine transmethylase mutant of Pseudomonas aeruginosa
  Serra, Journal of bacteriology 2002
  • “...gene corresponded to an open reading frame (ORF) named PA3082 in the genome of P. aeruginosa PAO1. The translated product of this ORF displayed similarity to...”
  • “...that the transposon had interrupted the locus named PA3082 (Fig. 2A). Sequence analysis of this locus revealed the two overlapping potential ORFs, one of...”

Sama_1588 putative adhesin (DUF1302) from Shewanella amazonensis SB2B
Aligns to 11:691 / 691 (98.6%), covers 99.3% of PF06980, 529.0 bits

• mutant phenotype: Similar to PA3923, which binds laminin (PMC6890786) and is involved in biofilm formation (PMC8547006), so this is probably an adhesin.

Pfl01_2750 hypothetical protein from Pseudomonas fluorescens Pf0-1
Aligns to 4:548 / 548 (99.5%), covers 98.5% of PF06980, 453.8 bits

• Colonization strategies of Pseudomonas fluorescens Pf0-1: activation of soil-specific genes important for diverse and specific environments
  Varivarn, BMC microbiology 2013
  • “...23 Pfl01_3777 Hypothetical protein COG0596 General function prediction only 19 Pfl01_0609 Hypothetical protein 27 a Pfl01_2750 Hypothetical protein 20 Pfl01_2901 Xylose isomerase-like TIM barrel Antisense c 13 a Pfl01_3287 Putative Rho-binding antiterminator COG4568 Transcription 8 a Pfl01_5547 Ribonuclease PH COG0689 Transcription 7 Pfl01_4448 Pyruvate Kinase COG0469...”

DBX28_14755 DUF1302 domain-containing protein from Pseudomonas aeruginosa
Aligns to 3:548 / 548 (99.6%), covers 99.3% of PF06980, 447.1 bits

• Integrated Comparative Genomic Analysis and Phenotypic Profiling of Pseudomonas aeruginosa Isolates From Crude Oil
  Xu, Frontiers in microbiology 2020
  • “...+ DBX28_14745 3137519 3138481 CDS glycosyl hydrolase + DBX28_14750 3138492 3140894 CDS RND transporter + DBX28_14755 3140903 3142489 CDS DUF1302 domain-containing protein + DBX28_14760 3142573 3143997 CDS DUF1329 domain-containing protein + DBX28AM_2960 3144149 3144388 CDS protein of unknown function 2SD + + DBX28_14765 3144552 3145199 CDS...”

ebA1936 DUF1302 domain-containing protein from Aromatoleum aromaticum EbN1
ebA1936 hypothetical protein from Azoarcus sp. EbN1
Aligns to 18:561 / 561 (97.0%), covers 99.1% of PF06980, 438.4 bits

• Anaerobic catabolism of aromatic compounds: a genetic and genomic view
  Carmona, Microbiology and molecular biology reviews : MMBR 2009
  • “...products of the ebA326 to ebA335, ebA1926 to ebA1936, and ebA5762 to ebA5768 genes were specifically formed during anaerobic growth on p-ethylphenol (379),...”
  • “...the bbs cluster, there are five genes (ebA1926 to ebA1936) organized in an operon-like structure, two of which (ebA1932 and ebA1936) encode proteins that are...”
• Substrate-dependent regulation of anaerobic degradation pathways for toluene and ethylbenzene in a denitrifying bacterium, strain EbN1
  Kühner, Journal of bacteriology 2005
  • “...implicated in ethylbenzene degradation, and the ebA1932 and ebA1936 genes, located 7.2 kb upstream of the bbs operon, are implicated in toluene degradation. In...”
  • “...in the promoter regions of bssD, bbsA, and the ebA1936 gene is located 118, 68, and 450 bp upstream of the respective translational starts. VOL. 187, 2005...”

O87938 DUF1302 domain-containing protein from Thauera aromatica
Aligns to 22:564 / 564 (96.3%), covers 99.4% of PF06980, 430.2 bits

• Substrate-dependent regulation of anaerobic degradation pathways for toluene and ethylbenzene in a denitrifying bacterium, strain EbN1
  Kühner, Journal of bacteriology 2005
  • “...5e-38 0 4e-04 Q8XZN6 Q88100 Q88101 O87937 O87938 Q66176 Putative function Hypothetical protein Rsc1359 Putative transporterd Hypothetical protein, bnr domain...”

ebA335 hypothetical protein from Azoarcus sp. EbN1
ebA335 DUF1302 domain-containing protein from Aromatoleum aromaticum EbN1
Aligns to 16:561 / 561 (97.3%), covers 99.3% of PF06980, 429.8 bits

• The predicted σ(54)-dependent regulator EtpR is essential for expression of genes for anaerobic p-ethylphenol and p-hydroxyacetophenone degradation in "Aromatoleum aromaticum" EbN1
  Büsing, BMC microbiology 2015
  • “...-ethylphenol" gene clusters, i.e., acsA , hped and pchF for the "catabolic" gene cluster and ebA335 , ebA327 and ebA326 for the "efflux" gene cluster (Fig. 3a ). Transcripts of both gene clusters were only detected in wild type and etpR -complemented mutant cells growing with...”
  • “...ebA329_212_F ebA329 TGCGGCCCCTGATG 316 ebA329_537_R ACGATGCCGCTGTGG ebA332_488_F e bA 332 CCGGCGTGGAGGTAG 285 ebA332_772_R GGCGCGGGGTTTT ebA335_1092_F ebA335 GCTGGGGGAGACGAA 253 ebA335_1344_R CGCCGCCTTGTTGT Generation of etpR deletion mutation acsA_BamHI_F acsA AA GGATCC CACGAAATGTCTCCTGAACCCTGC 1300 acsA_SphI_R ACCGG GCATGC GCCCACCAGC ebA327_BamHI_F ebA326/ebA327 GATCA GGATCC ACGTCACCG 2350 ebA326_BamHI_R AA GGATCC TGACCGTCGGAGGACCGGATAGATC Identification...”
• Anaerobic catabolism of aromatic compounds: a genetic and genomic view
  Carmona, Microbiology and molecular biology reviews : MMBR 2009
  • “...additional operon-like structure that contains the ebA326 to ebA335 genes, some of whose products are also upregulated when Azoarcus sp. strain EbN1 cells are...”
  • “...of the translational start of the acsA and ebA335 genes, suggesting the transcriptional control of the corresponding promoters by the ebA324 regulator. The...”
• Anaerobic degradation of p-ethylphenol by "Aromatoleum aromaticum" strain EbN1: pathway, regulation, and involved proteins
  Wöhlbrand, Journal of bacteriology 2008
  • “...85.3 32.5 40.7 pEp and pAc-related proteins EbA329 EbA332 EbA335 2.7 4.2 6.7 2.6 2.1 1.3 15.7 102.1 4.9 32.3 259.7 9.4 Paralogous ethylbenzene gene cluster...”
  • “...and four hypothetical proteins (EbA318, EbA329, EbA332, and EbA335). Analogously, expression analysis of pchF and xccA revealed a specific upregulation as well...”
• Nanomolar Responsiveness of an Anaerobic Degradation Specialist to Alkylphenol Pollutants
  Vagts, Journal of bacteriology 2020 (secret)
• Towards the Response Threshold for p-Hydroxyacetophenone in the Denitrifying Bacterium "Aromatoleum aromaticum" EbN1
  Vagts, Applied and environmental microbiology 2018
  • “...catabolism (i.e., acsA) and potential efflux (i.e., ebA335). ABSTRACT IMPORTANCE Aromatic compounds are widespread microbial growth substrates with natural as...”
  • “...effect on the expression of target genes (e.g., ebA335) (Fig. S4). Thus, the experimental setup afforded cells with adequately energy supplies while at the...”

DelCs14_1756 DUF1302 family protein from Delftia sp. Cs1-4
Aligns to 17:557 / 557 (97.1%), covers 99.3% of PF06980, 410.1 bits

• Nanopods: a new bacterial structure and mechanism for deployment of outer membrane vesicles
  Shetty, PloS one 2011
  • “...coregulated protein (Hcp) DelCs14_2985 TPR repeat-containing protein DelCs14_3801 Conserved hypothetical protein DelCs14_4061 Unknown function (DUF1302) DelCs14_1756 Unknown function (DUF1329) DelCs14_1757 1 Identified in three independent samples. 2 Numbering in Delftia sp. Cs1-4 genome. 3 Nanopod protein A, see text. The forgoing provided strong evidence supporting our...”

AzCIB_4528 DUF1302 family protein from Azoarcus sp. CIB
Aligns to 13:624 / 681 (89.9%), covers 87.1% of PF06980, 151.7 bits

• Transcriptional Regulation of the Peripheral Pathway for the Anaerobic Catabolism of Toluene and m-Xylene in Azoarcus sp. CIB
  Blázquez, Frontiers in microbiology 2018
  • “...white rectangle next to the bbs operon in Azoarcus sp. CIB represents orfB (AzCIB_4527), orfC (AzCIB_4528), orfD (AzCIB_4529) and orfE (AzCIB_4530) genes, that are also present in A. toluclasticus MF63. In the bss-bbs cluster of Azoarcus sp. CIB, the DNA fragment harboring the bssDCABEFG genes and...”

PIN17_RS07705 DUF1302 family protein from Prevotella intermedia 17
Aligns to 13:398 / 435 (88.7%), covers 61.4% of PF06980, 49.9 bits

• Iron Deficiency Modulates Metabolic Landscape of Bacteroidetes Promoting Its Resilience during Inflammation
  Lewis, Microbiology spectrum 2023
  • “...W83 (PG_RS05220 to 235; PG1178 to 81), B. thetaiotaomicron VPI-5482 (BT_0507-9), and P. intermedia 17 (PIN17_RS07705 to 25, PIN17_RS02240 50, PIN17_RS07725 to 30). (E) Cell surface extracellular protein in Bacteroidetes . Comparison of genomic locus P. gingivalis W83 (PG_RS02195, PG0495), B. thetaiotaomicron VPI-5482 (no ortholog found),...”

TOL_3188 DUF1302 family protein from Thalassolituus oleivorans MIL-1
Aligns to 32:425 / 425 (92.7%), covers 65.9% of PF06980, 47.2 bits

• Differential Protein Expression During Growth on Medium Versus Long-Chain Alkanes in the Obligate Marine Hydrocarbon-Degrading Bacterium Thalassolituus oleivorans MIL-1
  Gregson, Frontiers in microbiology 2018
  • “...is a FadL homolog which allows hydrophobic compounds to cross the cell membrane through diffusion. TOL_3188 is a porin which may facilitate passive uptake of long-chain alkanes and may be transported to the outer membrane by the inner-membrane transport protein TOL_3187. The expression of a long-chain...”
  • “...(GO:0006810) and the protein is an integral component of a membrane (GO:0016021). Another uncharacterized protein (TOL_3188; P < 0.0001) is coded by a gene immediately downstream of TOL_3187 and was expressed exclusively when growing on n- C 28 (Figure 4A ). Domain analysis showed that no...”

HMPREF1322_RS06015, PG_1178, PG_RS05220 DUF1302 family protein from Porphyromonas gingivalis W50
PG1178 hypothetical protein from Porphyromonas gingivalis W83
Aligns to 30:425 / 425 (93.2%), covers 62.0% of PF06980, 44.6 bits

• Hemin availability induces coordinated DNA methylation and gene expression changes in Porphyromonas gingivalis
  Costeira, mSystems 2023
  • “...0.27 1.21E-184 TetR/AcrR family transcriptional regulator HMPREF1322_RS06010 7,387.12 8.06 0.28 5.34E-183 Outer membrane lipoprotein-sorting protein HMPREF1322_RS06015 24,454.31 7.46 0.28 2.46E-160 Hypothetical protein HMPREF1322_RS06005 47,425.12 7.36 0.30 1.87E-133 MMPL family transporter HMPREF1322_RS05430 7,754.25 5.44 0.23 7.95E-121 Flavodoxin HMPREF1322_RS06790 15,141.08 6.11 0.30 3.67E-92 Heme-binding protein HmuY HMPREF1322_RS04145 4,231.05...”
• The Oxidative Stress-Induced Hypothetical Protein PG_0686 in Porphyromonas gingivalis W83 Is a Novel Diguanylate Cyclase
  Ximinies, Microbiology spectrum 2023
  • “...PG_1019 DUF4876 domain-containing protein 4.03 9.22E-04 5.50 4.54E-03 PG_1020 TonB-dependent receptor 4.36 8.33E-03 9.20 2.98E-03 PG_1178 Hypothetical protein 4.15 4.06E-03 6.24 1.31E-02 PG_1180 Membrane protein 4.05 4.60E-03 8.03 2.93E-03 PG_1181 TetR/AcrR family transcriptional regulator 4.15 2.73E-03 8.52 3.13E-03 PG_1237 DNA-binding response regulator (CdhR) 4.97 3.54E-02 7.18...”
• Iron Deficiency Modulates Metabolic Landscape of Bacteroidetes Promoting Its Resilience during Inflammation
  Lewis, Microbiology spectrum 2023
  • “...regulator and transport system locus in Bacteroidetes . Comparison of genomic locus P. gingivalis W83 (PG_RS05220 to 235; PG1178 to 81), B. thetaiotaomicron VPI-5482 (BT_0507-9), and P. intermedia 17 (PIN17_RS07705 to 25, PIN17_RS02240 50, PIN17_RS07725 to 30). (E) Cell surface extracellular protein in Bacteroidetes . Comparison...”
• Hemin availability induces coordinated DNA methylation and gene expression changes in Porphyromonas gingivalis
  Costeira, 2022
• Involvement of PG2212 zinc finger protein in the regulation of oxidative stress resistance in Porphyromonas gingivalis W83
  Dou, Journal of bacteriology 2014
  • “...PG_0686 PG_0707 PG_0985 PG_0986 PG_0987 PG_1019 PG_1108 PG_1178 PG_1179 PG_1180 PG_1181 PG_1236 PG_1237 PG_1240 PG_1268 PG_1315 PG_1316 PG_1497 PG_1551 PG_1552...”
  • “...ID PG_0138 PG_1167 PG_0521 PG_0708 PG_0709 PG_0985 PG_1178 PG_1208 PG_1237 PG_1775 PG2212 Regulates Oxidative Stress Resistance (B) Promoter region of PG_2212....”
• Iron Deficiency Modulates Metabolic Landscape of Bacteroidetes Promoting Its Resilience during Inflammation
  Lewis, Microbiology spectrum 2023
  • “...system locus in Bacteroidetes . Comparison of genomic locus P. gingivalis W83 (PG_RS05220 to 235; PG1178 to 81), B. thetaiotaomicron VPI-5482 (BT_0507-9), and P. intermedia 17 (PIN17_RS07705 to 25, PIN17_RS02240 50, PIN17_RS07725 to 30). (E) Cell surface extracellular protein in Bacteroidetes . Comparison of genomic locus...”
  • “...by a gene coding for an outer membrane lipoprotein sorting protein (PG1179) and hypothetical protein (PG1178). An interesting finding was the PG1177 coding for a transposase followed by PG1176 to PG1175 encoding orthologs of BT0508 to BT0509 ( Fig.1D , ii). A mobile element-encoding gene, BT1138,...”
• A putative TetR regulator is involved in nitric oxide stress resistance in Porphyromonas gingivalis
  Boutrin, Molecular oral microbiology 2016
  • “...cDNA samples were subsequently subjected to PCR using primers for PG1181, PG1180, PG1179 , and PG1178 ( Supplementary material ), and gel electrophoresis used for analysis of transcripts. Determination of co-transcription for the PG0214-18 locus RNA extraction and cDNA synthesis were carried out as described in...”
  • “...FLL461 which could be likely due to the large size of the DNA sequence between PG1178 and PG1181 . Sensitivity of P. gingivalis FLL460 and FLL461 isogenic mutants to hydrogen peroxide (H 2 O 2 ) The involvement of the proteins PG1178-81 in P. gingivalis oxidative...”
• Involvement of PG2212 zinc finger protein in the regulation of oxidative stress resistance in Porphyromonas gingivalis W83
  Dou, Journal of bacteriology 2014
  • “...Hypothetical protein PG1108 Hypothetical protein PG1178 Hypothetical protein PG1179 Hypothetical protein PG1180 Tetr family transcriptional regulator...”
  • “...subfamily RNA polymerase sigma factor Hypothetical protein PG1178 Molecular chaperone DnaK LuxR family transcriptional regulator GrpE protein 2.93 19.11 3.13...”
• Nitric oxide stress resistance in Porphyromonas gingivalis is mediated by a putative hydroxylamine reductase
  Boutrin, Journal of bacteriology 2012
  • “...seven-gene transcriptional unit that includes PG1775, PG1176, PG1177, PG1178, PG1179, and PG1180, all of which were upregulated except PG1177 when P. gingivalis...”

Or search for genetic data about PF06980 in the Fitness Browser