Family Search for PF07039 (SGF29_Tudor)
April 2024: See Interactive Tools for Functional Annotation of Bacterial Genomes for advice on using these tools.
PF07039 hits 23 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.
3mevB / Q96ES7 Crystal structure of sgf29 in complex with r2ak4me3 (see paper)
Aligns to 45:175 / 178 (73.6%), covers 99.2% of PF07039, 140.8 bits
SGF29_RAT / P0C606 SAGA-associated factor 29; rSGF29; Coiled-coil domain-containing protein 101; SAGA complex-associated factor 29 from Rattus norvegicus (Rat) (see paper)
Aligns to 158:288 / 293 (44.7%), covers 99.2% of PF07039, 138.6 bits
- function: Chromatin reader component of some histone acetyltransferase (HAT) SAGA-type complexes like the TFTC-HAT, ATAC or STAGA complexes (By similarity). SGF29 specifically recognizes and binds methylated 'Lys-4' of histone H3 (H3K4me), with a preference for trimethylated form (H3K4me3) (By similarity). In the SAGA-type complexes, SGF29 is required to recruit complexes to H3K4me (By similarity). Involved in the response to endoplasmic reticulum (ER) stress by recruiting the SAGA complex to H3K4me, thereby promoting histone H3 acetylation and cell survival (By similarity). Also binds non-histone proteins that are methylated on Lys residues: specifically recognizes and binds CGAS monomethylated on 'Lys-491' (By similarity). May be involved in MYC- mediated oncogenic transformation (PubMed:17334388).
subunit: Interacts with dimethylated and trimethylated 'Lys-4' of histone H3 (H3K4me2 and H3K4me3), with a preference for the trimethylated form (H3K4me3) (By similarity). Component of some SAGA- type complexes. Component of the ADA2A-containing complex (ATAC), composed of KAT14, KAT2A, TADA2L, TADA3L, ZZ3, MBIP, WDR5, YEATS2, CCDC101 and DR1 (By similarity). Interacts with (methylated) CGAS (By similarity). Interacts with TADA3L, GCN5L2, SUPT3H and MYC (PubMed:17334388).
SGF29_MOUSE / Q9DA08 SAGA-associated factor 29; Coiled-coil domain-containing protein 101; SAGA complex-associated factor 29 from Mus musculus (Mouse) (see paper)
Aligns to 158:288 / 293 (44.7%), covers 99.2% of PF07039, 138.6 bits
- function: Chromatin reader component of some histone acetyltransferase (HAT) SAGA-type complexes like the TFTC-HAT, ATAC or STAGA complexes (By similarity). SGF29 specifically recognizes and binds methylated 'Lys-4' of histone H3 (H3K4me), with a preference for trimethylated form (H3K4me3) (By similarity). In the SAGA-type complexes, SGF29 is required to recruit complexes to H3K4me (By similarity). Involved in the response to endoplasmic reticulum (ER) stress by recruiting the SAGA complex to H3K4me, thereby promoting histone H3 acetylation and cell survival (By similarity). Also binds non-histone proteins that are methylated on Lys residues: specifically recognizes and binds CGAS monomethylated on 'Lys-491' (PubMed:35210392).
subunit: Interacts with dimethylated and trimethylated 'Lys-4' of histone H3 (H3K4me2 and H3K4me3), with a preference for the trimethylated form (H3K4me3) (By similarity). Component of some SAGA- type complexes. Component of the ADA2A-containing complex (ATAC), composed of KAT14, KAT2A, TADA2L, TADA3L, ZZ3, MBIP, WDR5, YEATS2, CCDC101 and DR1 (By similarity). Interacts with (methylated) CGAS (PubMed:35210392). Interacts with TADA3L, GCN5L2, SUPT3H and MYC (By similarity). - Comprehensive and Quantitative Analysis of the Changes in Proteomic and Phosphoproteomic Profiles during Stimulation and Repression of Steroidogenesis in MA-10 Leydig Cells
Demmouche, International journal of molecular sciences 2022 - “...AICAR Protein name Protein Gene name Fsk+AICAR DMSO DMSO/Fsk+AICAR q -Value Fsk+AICAR/DMSO SAGA-associated factor 29 Q9DA08 Sgf29 1.61 10 6 1.39 10 9 864.22 3.00 10 -5 Down Coiled-coil domain-containing protein 187 Q8C5V8 Ccdc187 1.61 10 6 1.40 10 7 8.71 3.87 10 -4 Down Ferrochelatase...”
SGF29_HUMAN / Q96ES7 SAGA-associated factor 29; Coiled-coil domain-containing protein 101; SAGA complex-associated factor 29 from Homo sapiens (Human) (see 6 papers)
Aligns to 158:288 / 293 (44.7%), covers 99.2% of PF07039, 138.6 bits
- function: Chromatin reader component of some histone acetyltransferase (HAT) SAGA-type complexes like the TFTC-HAT, ATAC or STAGA complexes (PubMed:19103755, PubMed:20850016, PubMed:26421618, PubMed:21685874, PubMed:26578293). SGF29 specifically recognizes and binds methylated 'Lys-4' of histone H3 (H3K4me), with a preference for trimethylated form (H3K4me3) (PubMed:20850016, PubMed:26421618, PubMed:21685874, PubMed:26578293). In the SAGA-type complexes, SGF29 is required to recruit complexes to H3K4me (PubMed:20850016). Involved in the response to endoplasmic reticulum (ER) stress by recruiting the SAGA complex to H3K4me, thereby promoting histone H3 acetylation and cell survival (PubMed:23894581). Also binds non-histone proteins that are methylated on Lys residues: specifically recognizes and binds CGAS monomethylated on 'Lys-506' (By similarity).
subunit: Interacts with dimethylated and trimethylated 'Lys-4' of histone H3 (H3K4me2 and H3K4me3), with a preference for the trimethylated form (H3K4me3) (PubMed:21685874, PubMed:26578293). Component of some SAGA-type complexes (PubMed:20850016). Component of the ADA2A-containing complex (ATAC), composed of KAT14, KAT2A, TADA2L, TADA3L, ZZ3, MBIP, WDR5, YEATS2, CCDC101 and DR1 (PubMed:19103755). Interacts with (methylated) CGAS (By similarity). Interacts with TADA3L, GCN5L2, SUPT3H and MYC (By similarity). - A genome-wide screen in Saccharomyces cerevisiae reveals pathways affected by arsenic toxicity.
Zhou, Genomics 2009 - “...YCL010C SGF29 SaGa associated Factor 29kDa; Probable 29kKDa Subunit of SAGA histone acetyltransferase complex 0.527 Q96ES7 SAGA-associated factor 29 homolog YNR031C SSK2 Map kinase kinase kinase (MAPKKK) of the high- osmolarity signal transduction pathway 0.552 BAA13204 Mitogen-activated protein kinase kinase kinase 4 YDR028C REG1 Regulatory subunit...”
Q9W2I4 FI01566p from Drosophila melanogaster
Aligns to 143:273 / 289 (45.3%), covers 98.5% of PF07039, 127.8 bits
SGF29_YEAST / P25554 SAGA-associated factor 29; 29 kDa SAGA-associated factor; SAGA histone acetyltransferase complex 29 kDa subunit from Saccharomyces cerevisiae (strain ATCC 204508 / S288c) (Baker's yeast) (see 6 papers)
YCL010C SaGa associated Factor 29kDa; Probable 29kKDa Subunit of SAGA histone acetyltransferase complex from Saccharomyces cerevisiae
NP_009917 Sgf29p from Saccharomyces cerevisiae S288C
Aligns to 127:250 / 259 (47.9%), covers 98.5% of PF07039, 123.7 bits
- function: Chromatin reader component of the transcription regulatory histone acetylation (HAT) complexes SAGA and SLIK (PubMed:10026213, PubMed:15647753, PubMed:21685874, PubMed:24307402). In the SAGA complex, SGF29 specifically recognizes and binds methylated 'Lys-4' of histone H3 (H3K4me), with a preference for trimethylated form (H3K4me3) (PubMed:21685874). SGF29 is also required for heterochromatin boundary formation function (PubMed:24307402). SAGA is involved in RNA polymerase II-dependent transcriptional regulation of approximately 10% of yeast genes At the promoters, SAGA is required for recruitment of the basal transcription machinery (PubMed:10026213). It influences RNA polymerase II transcriptional activity through different activities such as TBP interaction (SPT3, SPT8 and SPT20) and promoter selectivity, interaction with transcription activators (GCN5, ADA2, ADA3 and TRA1), and chromatin modification through histone acetylation (GCN5) and deubiquitination (UBP8) (PubMed:10026213). SAGA acetylates nucleosomal histone H3 to some extent (to form H3K9ac, H3K14ac, H3K18ac and H3K23ac). SAGA interacts with DNA via upstream activating sequences (UASs) (PubMed:10026213). SLIK is proposed to have partly overlapping functions with SAGA (PubMed:15647753). It preferentially acetylates methylated histone H3, at least after activation at the GAL1-10 locus (PubMed:15647753).
subunit: Component of the 1.8 MDa SAGA complex, which consists of at least of TRA1, CHD1, SPT7, TAF5, ADA3, SGF73, SPT20/ADA5, SPT8, TAF12, TAF6, HFI1/ADA1, UBP8, GCN5, ADA2, SPT3, SGF29, TAF10, TAF9, SGF11 and SUS1. TAF5, TAF6, TAF9, TAF19, TAF12 and ADA1 seem to be present in 2 copies. SAGA is built of 5 distinct domains with specialized functions. Domain I (containing TRA1) probably represents the activator interaction surface. Domain II (containing TAF5 and TAF6, and probably TAF9 and TAF10), domain III (containing GCN5, TAF10, SPT7, TAF5 and ADA1, and probably ADA2, ADA3 and TAF12), and domain IV (containing HFI1/ADA1 and TAF6, and probably TAF9) are believed to play primarily an architectural role. Domain III also harbors the HAT activity. Domain V (containing SPT3 and SPT20, and probably SPT8) represents the TBP- interacting module, which may be associated transiently with SAGA. Interacts with dimethylated and trimethylated 'Lys-4' of histone H3 (H3K4me2 and H3K4me3), with a preference for the trimethylated form (H3K4me3). Component of the SLIK complex, which consists of at least TRA1, CHD1, SPT7, TAF5, ADA3, SPT20, RTG2, TAF12, TAF6, HFI1, UBP8, GCN5, ADA2, SPT3, SGF29, TAF10 and TAF9. - Genome-wide identification of resistance genes and transcriptome regulation in yeast to accommodate ammonium toxicity
Fu, BMC genomics 2022 - “...TPS1 0.7275 0.00308 0.3579 0.00003 0.3630 0.00002 YBL007C SLA1 0.5340 0.00002 0.2500 0.00003 0.4729 0.00042 YCL010C SGF29 0.3755 0 0.2031 0.00001 0.2475 0.00011 YCR077C PAT1 0.3581 0.00001 0.3037 0.00001 0.4301 0.00004 YDR245W MNN10 0.5099 0.00003 0.2407 0.0001 0.3961 0.00001 YDR289C RTT103 0.5253 0.0002 0.3517 0 0.2833...”
- HKC: an algorithm to predict protein complexes in protein-protein interaction networks
Wang, Journal of biomedicine & biotechnology 2011 - “...(catalog 510.190.10.20.10 in the complexcat benchmark), and their overlap ratio is 0.93. The two proteins YCL010c and YGL066w that are not recovered by cluster 12 have only one interaction with the cluster and do not exhibit good graph theoretic property. Actually, based on the available information...”
- “...with the SAGA complex (size 16), and their overlap ratio is 0.93. The two proteins YCL010c and YGL066w that are not contained in the predicted cluster are isolated nodes with only one edge connecting with the cluster. (c) An example of a well-matched cluster, involving 7...”
- A genome-wide screen in Saccharomyces cerevisiae reveals pathways affected by arsenic toxicity
Zhou, Genomics 2009 - “...0.5181 Q9NQY0 Bridging integrator 3 YGL012W ERG4 Sterol C-24 (28) reductase 0.5262 Q14739 Lamin-B receptor YCL010C SGF29 SaGa associated Factor 29kDa; Probable 29kKDa Subunit of SAGA histone acetyltransferase complex 0.527 Q96ES7 SAGA-associated factor 29 homolog YNR031C SSK2 Map kinase kinase kinase (MAPKKK) of the high- osmolarity...”
- Comparative functional genomic analysis identifies distinct and overlapping sets of genes required for resistance to monomethylarsonous acid (MMAIII) and arsenite (AsIII) in yeast
Jo, Toxicological sciences : an official journal of the Society of Toxicology 2009 - “...YNL025C YCR081W YLR006C YJL128C YOL081W YCR068W YGR133W YGR057C YCL010C YML041C YNL329C YDL082W 50% IC20 Standard name 75lM 150lM PFD1 SAS4 SAS5 SAS2 CIN2 ARR1...”
- A core-attachment based method to detect protein complexes in PPI networks
Wu, BMC bioinformatics 2009 - “...YNL232W YOL021C YOL142W YOR001W YOR076C exosome (RNase complex) 0.805 13 4 5.00e-24 YBR081C YBR198C YBR253W YCL010C YDR167W YDR176W YDR216W YDR448W YGL112C YGR252W YHR099W YMR236W YPL254W SAGA complex 0.452 11 5 9.90e-23 YBR081C YBR198C YDR167W YDR176W YDR392W YDR448W YEL009C YER148W YGL112C YGR274C YHR099W YMR236W YOL148C YPL254W YPR086W...”
- Genome-wide mapping of the coactivator Ada2p yields insight into the functional roles of SAGA/ADA complex in Candida albicans
Sellam, Molecular biology of the cell 2009 - “...orf19.3035 0 Rtg2 Other Sgf29 Tra1 YGL252C -- -- YCL010C YHR099W orf19.7074 orf19.139 8.8e-58 0 S. cerevisiae protein HAT Gcn5 (Ada4) Ada Ada1 Ada2 Ada3 Spt...”
- Chemogenetic fingerprinting by analysis of cellular growth dynamics
Warringer, BMC chemical biology 2008 - “...assumption). Genes included in the screen were: FLO1, PIM1, TAT1, YBR074w, PHO3, YBR099c, APE3, APM3, YCL010C, YCL047C, CVT17, YCR073W, SRB8, YCR101C, YCR106W, YCR195C, YDL109c, YDL124w, DLD1, YDL175c, UGA4, GDH2, RRI1, SHS1, YDR026c, YDR101c, YDR132c, SWM1, GLO2, SUM1, YDR384c, HAT2, PRB1, CAN1, VTC1, DOT6, FTR1, YGL010w, ATE1,...”
- The Ama1-directed anaphase-promoting complex regulates the Smk1 mitogen-activated protein kinase during meiosis in yeast
McDonald, Genetics 2005 - “...rim11 sac7 slg1 spo1 spo19 spt3 ubc8 vac8 vam7 vps30 ycl010c ydr126w yhl0232c ypt7 Class II (wild type) bub3 dmc1 doa1 fks1 gip1 ids2 isc1 mck1 mei5 mpc54 pcl1...”
- More
- Cloning, purification, crystallization and preliminary crystallographic analysis of the tandem tudor domain of Sgf29 from Saccharomyces cerevisiae.
Li, Acta crystallographica. Section F, Structural biology and crystallization communications 2010 - GeneRIF: tandem tudor domain at the C-terminus of Sgf29 was crystallized using the hanging-drop vapour-diffusion method and the crystals diffracted to 1.92 A resolution
3mp8A / P0AEX9,P25554 Crystal structure of sgf29 tudor domain (see paper)
Aligns to 390:513 / 513 (24.2%), covers 98.5% of PF07039, 123.6 bits
- Ligands: alpha-d-glucopyranose; 4-(hydroxymethyl)benzamidine (3mp8A)
XP_003547704 SAGA-associated factor 29 homolog B isoform X1 from Glycine max
Aligns to 132:266 / 271 (49.8%), covers 100.0% of PF07039, 123.3 bits
XP_003547705 SAGA-associated factor 29 homolog B isoform X3 from Glycine max
Aligns to 130:264 / 269 (50.2%), covers 100.0% of PF07039, 123.3 bits
SGF29_SCHPO / Q9USW9 SAGA-associated factor 29 from Schizosaccharomyces pombe (strain 972 / ATCC 24843) (Fission yeast) (see 4 papers)
NP_596000 SAGA complex subunit Sgf29 from Schizosaccharomyces pombe
SPBC1921.07c SAGA complex subunit Sgf29 (predicted) from Schizosaccharomyces pombe
Aligns to 115:243 / 244 (52.9%), covers 98.5% of PF07039, 121.2 bits
- function: Chromatin reader component of the transcription regulatory histone acetylation (HAT) complex SAGA (PubMed:21642955, PubMed:26401015). Sgf29 specifically recognizes and binds methylated 'Lys-4' of histone H3 (H3K4me), with a preference for trimethylated form (H3K4me3) (PubMed:26401015). In the SAGA complex, sgf29 is required to facilitate crosstalk between gcn5 acetyltransferase activity and H3K4me3 recognition (PubMed:26401015). At the promoters, SAGA is required for recruitment of the basal transcription machinery (PubMed:19056896). It influences RNA polymerase II transcriptional activity through different activities such as TBP interaction and promoter selectivity, interaction with transcription activators, and chromatin modification through histone acetylation and deubiquitination (PubMed:19056896). SAGA acetylates nucleosomal histone H3 to some extent (to form H3K9ac, H3K14ac, H3K18ac and H3K23ac) (PubMed:19056896).
subunit: Component of the SAGA complex. - Nucleosome competition reveals processive acetylation by the SAGA HAT module.
Ringel, Proceedings of the National Academy of Sciences of the United States of America 2015 - GeneRIF: Data indicate that Spt-Ada-Gcn5 acetyltransferase (SAGA) coactivator complex contains a separable subcomplex known as the histone acetyltransferase (HAT) module that contains the HAT, Gcn5, bound to Sgf29.
- A genome-wide screen of genes involved in cadmium tolerance in Schizosaccharomyces pombe
Kennedy, Toxicological sciences : an official journal of the Society of Toxicology 2008 - “...sin3 SPAC29A4.20 ELP3/YPL086C kap1 gcn5 SPBC1921.07c SPBC28F2.10c SPAC1952.05 SGF29/YCL010C NGG1/YDR176W GCN5/YGR252W SPAC6B12.05c IES2/YNL215W SPCC18.06c...”
XP_003633806 SAGA-associated factor 29 homolog A isoform X2 from Vitis vinifera
Aligns to 131:265 / 270 (50.0%), covers 100.0% of PF07039, 117.6 bits
XP_003633807 SAGA-associated factor 29 homolog A isoform X1 from Vitis vinifera
Aligns to 142:276 / 281 (48.0%), covers 100.0% of PF07039, 117.4 bits
SG29A_ARATH / Q8RXY6 SAGA-associated factor 29 homolog A; AtSGF29a; 29 kDa SAGA-associated factor homolog A from Arabidopsis thaliana (Mouse-ear cress) (see paper)
AT3G27460 hypothetical protein from Arabidopsis thaliana
Aligns to 131:265 / 270 (50.0%), covers 100.0% of PF07039, 115.0 bits
- function: Chromatin reader component of the transcription regulatory histone acetylation (HAT) complex SAGA (By similarity). Involved in salt stress tolerance. Enhances the effect of ADA2B in the positive regulation of salt-induced gene expression (PubMed:21193996).
disruption phenotype: Delayed flowering. Increased tolerance to salt stress. - The Histone Acetyltransferase GCN5 and the Associated Coactivators ADA2: From Evolution of the SAGA Complex to the Biological Roles in Plants
Vlachonasios, Plants (Basel, Switzerland) 2021 - “...in flowering (Vlachonasios, under review) ADA3b (AT4G29790) No developmental abnormalities [ 39 ] SGF29 SGF29a (AT3G27460) No developmental abnormalities [ 29 ] SGF29b (AT5G40550) No developmental abnormalities [ 29 ] COREm ADA1 ADA1a (AT2G24530) Not available ADA1b (AT4G31440) Not available SPT3 TAF13 (AT1G026280) Seed development [...”
- Composition of the SAGA complex in plants and its role in controlling gene expression in response to abiotic stresses
Moraga, Frontiers in plant science 2015 - “...Os03g53960 XP_002262737 XP_001784968 XP_002268970 ADA3 ADA3 XP_001782560 ADA3 (At4g29790) Os05g28300 XP_002265763 SGF29 SGF29/STAF36 XP_001755688 SGF29a (At3g27460) Os12g19350 XP_003633806 XP_001785583 SGF29b (At5g40550) XP_003633807 SPT SPT8 ND ND ND ND ND SPT20/ADA5 SPT20/FAM48A XP_001762074 SPT20 (At1g72390) Os01g02860 XP_002272317 SPT7 STAF65/STAF65 XP_001767625 HAF1 (At1g32750) Os06g43790 XP_010656962 XP_001779301 HAF2 (At3g19040)...”
- Spt-Ada-Gcn5-Acetyltransferase (SAGA) Complex in Plants: Genome Wide Identification, Evolutionary Conservation and Functional Determination
Srivastava, PloS one 2015 - “...ND AtCHR5 At2g13370 OsCHD1 OsJ_25446 Embryo development; Seed maturation [ 106 ] Sgf29 STAF36 AtSGF29a At3g27460 OsSGF29 Os12g19350 Flowering initiation, Auxiliary role in salt stress [ 61 ] AtSGF29b At5g40550 - Tra1 TRRAP AtTRA1a At2g17930 OsTRA1 Os07g45064 - AtTRA1b At4g36080 - ND: Not detected. Alignment and...”
- “...human CHD2 ( Table 1 and S2 Table ). Further, we also identified two proteins, At3g27460 and At5g40550 in Arabidopsis encoding SGF29, as reported recently [ 61 ] and one protein in O . sativa (Os12g19350) ( Table 1 and S2 Table ). TRA1 is a...”
- AIP1 is a novel Agenet/Tudor domain protein from Arabidopsis that interacts with regulators of DNA replication, transcription and chromatin remodeling
Brasil, BMC plant biology 2015 - “...microarray experiments available in Genevestigator ( https://genevestigator.com ) [ 40 ]. The genes AT5G07350 and AT3G27460 from Class IV are out of analysis since there are no probes in the available microarray data Interestingly, the Arabidopsis Agenet/Tudor genes were highly expressed in reproductive tissues and evolutionary...”
- Genetic screens for floral mutants in Arabidopsis thaliana: enhancers and suppressors
Dinh, Methods in molecular biology (Clifton, N.J.) 2014 - “...T3D7-F GGTATCGATTGAGCAAATAA T3D7-R ACATGCGTCTGCTTGGAG AT2G47160 CHR3 F24P17 ACTGCACATTGCACGAACA F24P17 GGATGGCAACTTAGGCTGAA AT3G06400 K1G2-F ATGAGCTTTAGGAGTGTGTA K1G2-R AATTTTGTCCCAAAAGAATA AT3G27460 CIW4-F GTTCATTAAACTTGCGTGTGT CIW4-R TACGGTCAGATTGAGTGATTC AT3G50820 T20O10-F AAATGCCAGGGGAATAGA T20O10-R CAAACCATGCAATGATGC AT3G62988 CHR4 CIW5-F GGTTAAAAATTAGGGTTACGA CIW5-R AGATTTACGTGGAAGCAAT AT4G01710 CIW6-F CTCGTAGTGCACTTTCATCA CIW6-R CACATGGTTAGGGAAACAATA AT4G13575 4CER450255F CACAAGACAACACCAAAAAC 4CER450255R AGAAGGAATGGCTTCATCTA AT4G20095 AP22-F ATTATGTTAGGAAAATGAGAT AP22-R GCGTTGTAAGAATTAAGAA...”
SG29B_ARATH / Q500Z7 SAGA-associated factor 29 homolog B; AtSGF29b; 29 kDa SAGA-associated factor homolog B from Arabidopsis thaliana (Mouse-ear cress) (see paper)
AT5G40550 hypothetical protein from Arabidopsis thaliana
Aligns to 134:268 / 273 (49.5%), covers 100.0% of PF07039, 114.5 bits
- function: Chromatin reader component of the transcription regulatory histone acetylation (HAT) complex SAGA.
- The Histone Acetyltransferase GCN5 and the Associated Coactivators ADA2: From Evolution of the SAGA Complex to the Biological Roles in Plants
Vlachonasios, Plants (Basel, Switzerland) 2021 - “...developmental abnormalities [ 39 ] SGF29 SGF29a (AT3G27460) No developmental abnormalities [ 29 ] SGF29b (AT5G40550) No developmental abnormalities [ 29 ] COREm ADA1 ADA1a (AT2G24530) Not available ADA1b (AT4G31440) Not available SPT3 TAF13 (AT1G026280) Seed development [ 40 ] SPT7 HAF1 (AT1G32750, HAC13, TAF1) Light...”
- Spt-Ada-Gcn5-Acetyltransferase (SAGA) Complex in Plants: Genome Wide Identification, Evolutionary Conservation and Functional Determination
Srivastava, PloS one 2015 - “...AtSGF29a At3g27460 OsSGF29 Os12g19350 Flowering initiation, Auxiliary role in salt stress [ 61 ] AtSGF29b At5g40550 - Tra1 TRRAP AtTRA1a At2g17930 OsTRA1 Os07g45064 - AtTRA1b At4g36080 - ND: Not detected. Alignment and phylogenetic analysis Clustal-X version 1.83 software program was used for multiple sequence alignment of...”
- “...( Table 1 and S2 Table ). Further, we also identified two proteins, At3g27460 and At5g40550 in Arabidopsis encoding SGF29, as reported recently [ 61 ] and one protein in O . sativa (Os12g19350) ( Table 1 and S2 Table ). TRA1 is a representative of...”
- Composition of the SAGA complex in plants and its role in controlling gene expression in response to abiotic stresses
Moraga, Frontiers in plant science 2015 - “...ADA3 XP_001782560 ADA3 (At4g29790) Os05g28300 XP_002265763 SGF29 SGF29/STAF36 XP_001755688 SGF29a (At3g27460) Os12g19350 XP_003633806 XP_001785583 SGF29b (At5g40550) XP_003633807 SPT SPT8 ND ND ND ND ND SPT20/ADA5 SPT20/FAM48A XP_001762074 SPT20 (At1g72390) Os01g02860 XP_002272317 SPT7 STAF65/STAF65 XP_001767625 HAF1 (At1g32750) Os06g43790 XP_010656962 XP_001779301 HAF2 (At3g19040) SPT3 SPT3 XP_001759999 TAF13 (At1g02680)...”
XP_001417743 predicted protein from Ostreococcus lucimarinus CCE9901
Aligns to 179:313 / 314 (43.0%), covers 99.2% of PF07039, 113.8 bits
XP_002968194 SAGA-associated factor 29 homolog A isoform X2 from Selaginella moellendorffii
Aligns to 137:271 / 276 (48.9%), covers 99.2% of PF07039, 113.5 bits
DDB_G0272054 DUF1325 family protein from Dictyostelium discoideum AX4
Aligns to 287:410 / 411 (30.2%), covers 98.5% of PF07039, 112.5 bits
- Methylation-directed acetylation of histone H3 regulates developmental sensitivity to histone deacetylase inhibition
Huang, Nucleic acids research 2021 - “...in homology with only one candidate protein of 411 amino acids encoded by the gene DDB_G0272054, which, like Sgf29 from other organisms, is predicted to have a TTD at the C-terminus. In addition, three residues (F359, Y366 and F387) in the TTD required for interaction with...”
- “...it binds H3K4me3 and is associated with the GCN5 HAT complex. The protein coded by DDB_G0272054 is a strong candidate for the Dictyostelium orthologue of Sgf29 as it is the only protein encoded in the genome with a TTD. This TTD interacts in vitro specifically with...”
XP_016878383 SAGA-associated factor 29 isoform X1 from Homo sapiens
Aligns to 158:258 / 258 (39.1%), covers 76.5% of PF07039, 111.7 bits
XP_003576694 SAGA-associated factor 29 homolog A from Brachypodium distachyon
Aligns to 145:279 / 284 (47.5%), covers 100.0% of PF07039, 110.7 bits
PPTG_04971 hypothetical protein from Phytophthora parasitica INRA-310
Aligns to 170:304 / 309 (43.7%), covers 98.5% of PF07039, 102.3 bits
CNAG_06392 SAGA-associated factor 29 from Cryptococcus neoformans var. grubii H99
Aligns to 155:317 / 318 (51.3%), covers 99.2% of PF07039, 99.5 bits
- Genomic Variation across a Clinical Cryptococcus Population Linked to Disease Outcome
Sephton-Clark, mBio 2022 - “...previously identified to modulate virulence phenotypes, and these include the SAGA histone acetylation complex SGF29 (CNAG_06392), the protein S-acyl transferase PFA4 (CNAG_03981), the calcineurin catalytic subunit CNA1 (CNAG_04796), and the mitochondrial cochaperone MRJ1 (CNAG_00938) that are required for virulence in the murine model, as well as...”
- Genomic variation across a clinical Cryptococcus population linked to disease outcome
Sephton-Clark, 2021 - Unintended Side Effects of Transformation Are Very Rare in Cryptococcus neoformans
Friedman, G3 (Bethesda, Md.) 2018 - “...four large deletions. The deletions affect the 5 UTRs of two genes and eliminate SGF29 (CNAG_06392) almost completely (Table S1 in File S1 ). The loss of SFG29 in the KN99 lineage was recently observed by another group, which attributed the relatively high virulence of KN99...”
- HDAC genes play distinct and redundant roles in Cryptococcus neoformans virulence
Brandão, Scientific reports 2018 - “...factor TFIID subunit 5 0.16375121 CNAG_06283 LIV4 Putative myb-like mRNA polymerase I termination factor 0.479281412 CNAG_06392 SGF29 Putative saga histone acetyltransferase complex component 0.489834833 CNAG_06544 Non-histone chromosomal protein 6 0.61516928 CNAG_06597 SPT8 Transcriptional activator SPT8 0.224863088 CNAG_06745 Histone H3 0.576382711 CNAG_06746 Histone H2B 0.606684422 CNAG_06747 Histone...”
- Titan cells formation in Cryptococcus neoformans is finely tuned by environmental conditions and modulated by positive and negative genetic regulators
Hommel, PLoS pathogens 2018 - “...Insertion CNAG_06456 hypothetical Insertion H99S CNAG_07595 hypothetical Deletion/frameshift CNAG_12447 miscRNA Insertion CNAG_12900 miscRNA Insertion H99L CNAG_06392, SGF29 transcription factor (binds H3K4me2/3 and recruits histone deacetylation) Deletion KN99 CNAG_06392, SGF29 transcription factor (binds H3K4me2/3 and recruits histone deacetylation) Deletion H99W CNAG_06765 , LMP1 Hypothetical (involved in mating...”
- Convergent microevolution of Cryptococcus neoformans hypervirulence in the laboratory and the clinic
Arras, Scientific reports 2017 - “...shared by the strains of the Laboratory cluster, we also identified a 734bp deletion in CNAG_06392 on chromosome 13 that arose in this lineage during its divergence from H99O. Reciprocal BLASTp analyses with S. cerevisiae identified the predicted product of this gene to exhibit 47% similarity...”
- “...also revealed the presence of two Tudor domains as in S. cerevisiae Sgf29 28 . CNAG_06392 was therefore named SGF29 . Analysis of the mutant SGF29 allele revealed that while the 734bp deletion in the Laboratory strains maintains the open reading frame encoding the predicted protein,...”
- Cryptococcus neoformans histone acetyltransferase Gcn5 regulates fungal adaptation to the host
O'Meara, Eukaryotic cell 2010 - “...CNAG_05428 CNAG_06597 No homologue CNAG_06861 CNAG_02536 No homologue CNAG_01626 CNAG_06392 CNAG_01972 CNAG_07565 44 34 29 16 18 27 30 19 19 37 16 21 29...”
NP_001326215 SGF29 tudor-like domain-containing protein from Arabidopsis thaliana
Aligns to 131:245 / 251 (45.8%), covers 77.3% of PF07039, 89.4 bits
NP_001330202 SGF29 tudor-like domain-containing protein from Arabidopsis thaliana
Aligns to 134:244 / 301 (36.9%), covers 77.3% of PF07039, 88.2 bits
Or search for genetic data about PF07039 in the Fitness Browser
by Morgan Price,
Arkin group
Lawrence Berkeley National Laboratory