Family Search for PF07338 (YdgH_BhsA-like)

April 2024: See Interactive Tools for Functional Annotation of Bacterial Genomes for advice on using these tools.

PF07338 hits 76 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.

WP_004938291 DUF1471 family protein YdgH from Serratia marcescens
3 alignments in 34:316 / 316 (54.1%), covering up to 100.0% of PF07338, 213.4 bits

• A Genome-Scale Antibiotic Screen in Serratia marcescens Identifies YdgH as a Conserved Modifier of Cephalosporin and Detergent Susceptibility.
  Lazarus, Antimicrobial agents and chemotherapy 2021
  • GeneRIF: A Genome-Scale Antibiotic Screen in Serratia marcescens Identifies YdgH as a Conserved Modifier of Cephalosporin and Detergent Susceptibility.

YPTB2227 putative exported protein from Yersinia pseudotuberculosis IP 32953
YPO2305 putative exported protein from Yersinia pestis CO92
y2136 hypothetical protein from Yersinia pestis KIM
YP_2090 putative exported protein from Yersinia pestis biovar Medievalis str. 91001
3 alignments in 35:317 / 317 (53.9%), covering up to 100.0% of PF07338, 212.5 bits

• Growth of Yersinia pseudotuberculosis in human plasma: impacts on virulence and metabolic gene expression
  Rosso, BMC microbiology 2008
  • “...inducible lipoprotein B precursoR 2.229 (< 0.001) 1.413 (0.032) YPTB2219 YPO2297 hypothetical protein 1.576 (0.031) YPTB2227 YPO2305 putative exported protein 1.37 (0.015) 0.774 (0.042) YPTB2229 YPO2307 conserved hypothetical protein 0.708 (0.026) YPTB2237 (asr) YPO2318 putative acid shock protein 0.654 (0.022) YPTB2269 (pspB) YPO2350 phage shock protein...”
• Growth of Yersinia pseudotuberculosis in human plasma: impacts on virulence and metabolic gene expression
  Rosso, BMC microbiology 2008
  • “...lipoprotein B precursoR 2.229 (< 0.001) 1.413 (0.032) YPTB2219 YPO2297 hypothetical protein 1.576 (0.031) YPTB2227 YPO2305 putative exported protein 1.37 (0.015) 0.774 (0.042) YPTB2229 YPO2307 conserved hypothetical protein 0.708 (0.026) YPTB2237 (asr) YPO2318 putative acid shock protein 0.654 (0.022) YPTB2269 (pspB) YPO2350 phage shock protein B...”
• Genetic loci of major antigenic protein genes of Edwardsiella tarda
  Verjan, Applied and environmental microbiology 2005
  • “...binding protein (MalE) Putative exported protein (YPO2305) D-Methionine Putative periplasmic lipoprotein (YraP) Primer sequencesa (F) 5ATACCCTGTTTCCTCACCAG3 (R)...”
  • “...sequences had identities to Yersinia pestis putative exported protein YPO2305 and the glycosylase YraM (Table 2) (6, 30). The genetic location of the Et 32 gene...”
• Identification of Erwinia amylovora genes induced during infection of immature pear tissue
  Zhao, Journal of bacteriology 2005
  • “...Salmonella enterica 56 57 corB* ytfK* 58 59 YPO2305 tolA 60 tolR Salmonella enterica Salmonella enterica serovar Typhimurium Yersinia pestis Salmonella enterica...”
• Role of the PhoP-PhoQ gene regulatory system in adaptation of Yersinia pestis to environmental stress in the flea digestive tract
  Vadyvaloo, Microbiology (Reading, England) 2015
  • “...Y. pestis KIM6+ genome contained five YhcN protein family genes (y1667, y0666, y0640, y3909 and y2136) that encoded predicted proteins of 86, 87, 53, 92 and 317 amino acids, respectively. In E. coli , four of the 10 YhcN family proteins were shown to influence biofilm...”
• Reannotation of Yersinia pestis Strain 91001 Based on Omics Data
  Mao, The American journal of tropical medicine and hygiene 2016
  • “...transhydrogenase subunit alpha YP_2089, hypothetical protein YP_2090, hypothetical protein YP_2091, amino acid antiporter YP_2092, hypothetical protein YP_2093,...”

YPK_1940 hypothetical protein from Yersinia pseudotuberculosis YPIII
3 alignments in 35:317 / 317 (53.9%), covering up to 100.0% of PF07338, 212.5 bits

• Genome-Scale Mapping Reveals Complex Regulatory Activities of RpoN in Yersinia pseudotuberculosis
  Mahmud, mSystems 2020
  • “...TTGGCACGACTCTTGATT + 11.44 70,54 YPK_1894 E,S,V 37 IGS11 2153679 4.7 5.4 NA CTGGTGCAGATTTTGCAG 9.6 70,24,54 YPK_1940 4, 14 IGS12 2194598 16.6 16.8 13.8 TTGGCACGATAACTGCTT 10.96 38,70,54 YPK_1974 14, 43 IGS12 2194598 16.6 16.8 13.8 AGGGGTTAATATTTGCGT + 9.34 54,70,38 YPK_1975 61, 141 IGS13 2298808 7.2 3.5 5.2...”

SSON_1556 hypothetical protein from Shigella sonnei Ss046
3 alignments in 34:314 / 314 (54.1%), covering up to 100.0% of PF07338, 204.7 bits

• High yield production process for Shigella outer membrane particles
  Berlanda, PloS one 2012
  • “...gi|74312061 Unknown 57 3 putative receptor [S. sonnei Ss046] SSON_1681 gi|74312191 58 2 hypothetical protein SSON_1556 [S. sonnei Ss046] ydgH gi|74312071 59 2 hypothetical protein SSON_3340 [S.sonnei Ss046] yrbC gi|74313729 60 2 putative lipoprotein [Shigella dysenteriae Sd197] ybjP gi|82777619 61 1 hypothetical protein S3269 [S. flexneri...”

YdgH / b1604 DUF1471 domain-containing protein YdgH from Escherichia coli K-12 substr. MG1655
b1604 hypothetical protein from Escherichia coli str. K-12 substr. MG1655
P76177 Protein YdgH from Escherichia coli (strain K12)
3 alignments in 34:314 / 314 (54.1%), covering up to 100.0% of PF07338, 204.5 bits

• Rie1 and Sgn1 form an RNA-binding complex that enforces the meiotic entry cell fate decision
  Gaspary, The Journal of cell biology 2023 (no snippet)
• 18th Congress of the European Hematology Association, Stockholm, Sweden, June 13–16, 2013
  , Haematologica 2013
• Interfering with different steps of protein synthesis explored by transcriptional profiling of Escherichia coli K-12
  Sabina, Journal of bacteriology 2003
  • “...livJ nikE nuoL ycdY gadA gadB b1284 gapA hmpA yjfQ apbA b1604 hdeB ibpB livK uhpB yhaB yiaA b1045 serC yeaG ynfM b3254 mraY sucA udp b1057 b2252 b1973 b2220...”
  • “...b2278 b1035 b3517 b1493 b1284 b1779 b2552 b4191 b0425 b1604 b3509 b3686 b3458 b3668 b3120 b3562 b1045 b0907 b1783 b1596 b3254 b0087 b0726 b3831 b1057 0.02 0.02...”
• Comparative Analysis of Outer Membrane Vesicle Isolation Methods With an Escherichia coli tolA Mutant Reveals a Hypervesiculating Phenotype With Outer-Inner Membrane Vesicle Content
  Reimer, Frontiers in microbiology 2021
  • “...1.2 Increased in tolA P75818 ybjP Uncharacterized lipoprotein YbjP BOTH 0.017 9.5 Increased in tolA P76177 ydgH Protein YdgH tolA <0.00010 INF Increased in tolA P0ADM4 yidQ Uncharacterized protein YidQ tolA 0.0091 INF Increased in tolA P0AF70 yjeI Uncharacterized protein YjeI tolA 0.00013 29 Increased in...”
• The Escherichia coli proteome: past, present, and future prospects
  Han, Microbiology and molecular biology reviews : MMBR 2006
  • “...YdiJ YdiY YdjA YeaD YeaZ P77318 P77804 P76177 P0AC69 P77552 P0ACX3 P0A8A4 P77748 P76206 P0ACY1 P39173 P76256 5.38/59,928.8 5.07/54,689 9.1/31,910.83...”
• Identification of genes induced in vivo during Klebsiella pneumoniae CG43 infection
  Lai, Infection and immunity 2001
  • “...AJ292302 AJ292314 E. coli yjjB (P18389) E. coli ydgH (P76177) E. coli yjjZ (P55914) E. coli yhgI (P46846) E. coli yfjB (P37768) E. coli yfaE (P37910) E....”

SF1625 orf, conserved hypothetical protein from Shigella flexneri 2a str. 301
3 alignments in 34:314 / 314 (54.1%), covering up to 100.0% of PF07338, 204.4 bits

• Virulence and Stress Responses of Shigella flexneri Regulated by PhoP/PhoQ
  Lin, Frontiers in microbiology 2017
  • “...ttggc TAAACG g Phosphoglycerol transferase I uspF Chromosome c GcTTTA ggtct GGTTTA t Stress-induced protein SF1625 Chromosome a GGaTTA aaatt GGTTTA a Hypothetical protein sbcD Chromosome a GaTTTA tgaca GaTTTA t Exonuclease SbcD icsA pCP301 t GGTTgA ggctt TGTTTA a Hypothetical protein yffB Chromosome t GaTTTA...”

c1996 Protein ydgH precursor from Escherichia coli CFT073
3 alignments in 34:314 / 314 (54.1%), covering up to 100.0% of PF07338, 203.4 bits

• Methodological differences between studies confound one-size-fits-all approaches to managing surface waterways for food and water safety
  Weller, Applied and environmental microbiology 2024 (no snippet)

STM14_1785 DUF1471 family protein YdgH from Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S
STM1478 putative periplasmic protein from Salmonella typhimurium LT2
3 alignments in 34:314 / 314 (54.1%), covering up to 100.0% of PF07338, 197.0 bits

• Diverse secreted effectors are required for Salmonella persistence in a mouse infection model
  Kidwai, PloS one 2013
  • “...STM14_2265 pagK1 ATTCCAATGCAAGGTGCAACCAGC STM14_3167 pagK2 CAAAGTGCAATGAGAGTACTTGGC STM14_1501 pagC ACGCGCATTGTGGGTACAAGGGTA STM14_1497 pagD CGTATTGTTGTGGGAAGTCTCGTT STM14_0421 sssA GCTGGTATCATGATTCGCATGCTG STM14_1785 sssB GAAGTTTTTGTTCTTATGCTTGGT Each mutant strain was mixed in equal proportions with a wild-type reference strain and co-infected by IP injection into female 56 week old 129SvJ mice at 10 4...”
• The target spectrum of SdsR small RNA in Salmonella
  Fröhlich, Nucleic acids research 2016
  • “...STM0487.S 2,22 heat shock protein 90 (45 to +60 in htpG)::gfp FC yes no ydgH STM1478 2,18 putative periplasmic protein (58 to +60 in ydgH)::gfp WB yes no crp STM3466 2,16 cAMP-regulatory protein (172 to +30 in crp)::gfp FC yes no ( 16 , 17 )...”
• Structural and functional characterization of DUF1471 domains of Salmonella proteins SrfN, YdgH/SssB, and YahO
  Eletsky, PloS one 2014
  • “...secretion [2] , though the host factors with which it interacts are not known. SssB (STM1478, also known as YdgH) is another Salmonella DUF1471 paralogue implicated in pathogenesis. Like SrfN, it appears to be secreted into macrophages by a mechanism independent of Type III secretion, and...”
• Discovery of novel secreted virulence factors from Salmonella enterica serovar Typhimurium by proteomic analysis of culture supernatants
  Niemann, Infection and immunity 2011
  • “...STM0359, STM1026 (GtgA), STM1055 (GtgE), STM1087 (PipA), STM1478 (YdgH), STM1599 (PdgL), STM1809, STM2139, STM2585, STM3762 (CigR), and STM4082 (YiiQ)....”
• Comparative proteomic analysis of Salmonella enterica serovar Typhimurium ppGpp-deficient mutant to identify a novel virulence protein required for intracellular survival in macrophages
  Haneda, BMC microbiology 2010
  • “...037 STM0209 htrA 0.6 0.032 0.60 0.35 040 STM2638 rseB 0.3 0.011 0.88 0.35 040-2 STM1478 ydgH 0.3 0.011 0.17 0.06 c 041 STM1375 ynhG 0.3 0.011 EC 056 STM1746 oppA 0.6 0.001 0.15 0.05 c 058 STM1746 oppA 0.5 0.006 0.15 0.05 c 059 STM1849...”

A6T8N5 YdgH/BhsA/McbA-like domain-containing protein from Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
3 alignments in 34:316 / 316 (53.8%), covering up to 100.0% of PF07338, 195.2 bits

• Mutation of kvrA Causes OmpK35 and OmpK36 Porin Downregulation and Reduced Meropenem-Vaborbactam Susceptibility in KPC-Producing Klebsiella pneumoniae
  Dulyayangkul, Antimicrobial agents and chemotherapy 2020 (secret)
• Identification of Outer Membrane and Exoproteins of Carbapenem-Resistant Multilocus Sequence Type 258 Klebsiella pneumoniae
  Brinkworth, PloS one 2015
  • “...2iwv OmpG 97.1 15 W8V807 YfaZ2 180 3qra Ail 99.6 21 2k0I OmpA 99.5 18 A6T8N5 YdgH 316 2jna YdgH 100 27 4evu YdgH 100 85 A6T9R8 YncE 353 3vh0 YncE, DNA binding protein 100 80 3u4y Unknown dtox_1751 100 13 A6TCL1 YfiB 127 2i26 Rv0899...”

t1398 putative exported protein from Salmonella enterica subsp. enterica serovar Typhi Ty2
3 alignments in 34:314 / 314 (54.1%), covering up to 100.0% of PF07338, 193.5 bits

• Genetic diversity and risk factors for the transmission of antimicrobial resistance across human, animals and environmental compartments in East Africa: a review
  Katale, Antimicrobial resistance and infection control 2020
  • “...November 2011, MRSA cattle PCR, Multiplex PCR, PFGE SCC mec type V (21/23; 91.3%) t7753, t1398, t2112, t3992, t127 Uganda [ 78 ] July to August 2013 MRSA human PCR, WGS SCC mec A ST612 t690 Tanzania [ 66 ] Between December 2014 and September 2015...”

PMI1199 hypothetical protein from Proteus mirabilis HI4320
3 alignments in 35:317 / 317 (53.6%), covering up to 100.0% of PF07338, 188.5 bits

• Outer membrane antigens of the uropathogen Proteus mirabilis recognized by the humoral response during experimental murine urinary tract infection
  Nielubowicz, Infection and immunity 2008
  • “...TonBdependent receptor PMI2043* PMI2341 Putative toxin Pta S E (S) PMI1199 PMI1810* PMI2349 Putative exported protein FadL TolC S (E) E (S) E (S) E, S (E, S) E,...”

STM3362 putative periplasmic protein from Salmonella typhimurium LT2
Aligns to 35:88 / 88 (61.4%), covers 100.0% of PF07338, 81.9 bits

• Stress response, amino acid biosynthesis and pathogenesis genes expressed in Salmonella enterica colonizing tomato shoot and root surfaces
  Han, Heliyon 2020
  • “...STM3236 pirin domain protein 2.1 0.002 1.4 0.003 yhcN STM3361 Putative outer membrane protein 0.004 STM3362 STM3362 Putative periplasmic protein 0.004 yjbE STM4222.S Exopolysaccharide production protein YjbE 3.0 0.003 5.9 0.003 yhhW STM3544 quercetin 2,3-dioxygenase 3.5 0.009 STM0910 STM0910 terminase, large subunit - 2.0 0.003 STM1485...”

YhcN / b3238 DUF1471 domain-containing stress-induced protein YhcN from Escherichia coli K-12 substr. MG1655 (see 5 papers)
P64614 Uncharacterized protein YhcN from Escherichia coli (strain K12)
b3238 orf, hypothetical protein from Escherichia coli str. K-12 substr. MG1655
Aligns to 34:87 / 87 (62.1%), covers 98.2% of PF07338, 81.1 bits

• Optimized Signal Peptide for Secretory Expression of Human Recombinant Somatropin in E. coli
  Ahmadi, Advanced pharmaceutical bulletin 2023
  • “...Escherichia coli (strain K12) Q47702 MKKIICLVITLLMTLPVYA UPF0379 protein yhcN yhcN 22 Escherichia coli (strain K12) P64614 MKIKTTVAALSVLSVLSFGAFA Uncharacterized protein yncJ yncJ 22 Escherichia coli (strain K12) P64459 MFTKALSVVLLTCALFSGQLMA UPF0482 protein ynfB ynfB 28 Escherichia coli (strain K12) P76170 MKITLSKRIGLLAILLPCALALSTTVHA Zinc resistance-associated protein zraP 26 Escherichia coli...”
• Stress response of Escherichia coli to essential oil components - insights on low-molecular-weight proteins from MALDI-TOF
  Božik, Scientific reports 2018
  • “...protein spectrum were observed. Guaiacol induced the most distinct protein profile: UPF0434 protein (m/z 6960.26, P64614, YcaR) and 23S rRNA methylase leader peptide (Erythromycin resistance leader peptide, m/z 3802.46, P10739, ermC) were detected only in the guaiacol-treated sample at very high levels. The former protein is...”
• Whole-Transcriptome Analysis of Verocytotoxigenic Escherichia coli O157:H7 (Sakai) Suggests Plant-Species-Specific Metabolic Responses on Exposure to Spinach and Lettuce Extracts
  Crozier, Frontiers in microbiology 2016
  • “...accounted for high levels of differential expression: e.g., in spinach leaf lysates two hypothetical genes (b3238, b1722) were ranked as #2 and 3 for level of induction, at 50-fold. Probes corresponding to Z5022 and ECs4474 were induced 270- to 300-fold in spinach root exudates, but repressed...”
• Global transcriptomic responses of Escherichia coli K-12 to volatile organic compounds
  Yung, Scientific reports 2016
  • “...1.70 1.99 1.43 UPF0304 family protein; K09161 hypothetical protein Oxidative stress b dms nmp t b3238 yhcN 1.92 1.11 1.39 1.39 1.6 2.25 1.26 1.69 Cadmium and peroxide resistance protein Oxidative stress b chp cp dma dms nmp nms t b3495 uspA* 1.79 1.63 1.49 1.29...”
• Transcriptomic analysis of carboxylic acid challenge in Escherichia coli: beyond membrane damage
  Royce, PloS one 2014
  • “...b1493 gadB 0.000 0.015 25.3 AR2 decarboxylase b3509 hdeB 0.000 0.004 21.1 AR1 chaperone protein b3238 yhcN 0.002 0.064 15.2 Acid response b3510 hdeA 0.000 0.000 13.7 AR1 chaperone protein b4439 micF 0.003 0.078 11.9 Antisense RNA regulator of OmpF porin b3512 gadE 0.004 0.115 10.1...”
• Transcriptomic analysis of Escherichia coli O157:H7 and K-12 cultures exposed to inorganic and organic acids in stationary phase reveals acidulant- and strain-specific acid tolerance responses
  King, Applied and environmental microbiology 2010
  • “...b3585 b3755 b3179 b0380 b0631 b1445 b1848 b2141 b3238 b3346 b3536 b4537 Translation, ribosomal structure and biogenesis Poorly characterized or not present in...”
• The BaeSR two-component regulatory system mediates resistance to condensed tannins in Escherichia coli
  Zoetendal, Applied and environmental microbiology 2008
  • “...marB marR 2.6 2.6 21.5 27.4 b0005 b2390 b0618 b3687 b3686 b3238 b2675 yaaX ypeC citC ibpA ibpB yhcN nrdE 4.9 2.8 34.6 6.9 9.5 3.1 26.8 26.6 20.5 14.7 10.4 48.0...”
• Global gene expression profiling of asymptomatic bacteriuria Escherichia coli during biofilm growth in human urine
  Hancock, Infection and immunity 2007
  • “...mdtL yhcN yqgA rydB sgaB c2436 c2424 b2583 c3859 b3710 b3238 b2966 b4430 b4194 19.8 19.6 19.0 18.9 18.3 17.3 17.2 17.1 16.5 1,196 1,408 1,863 3,664 1,862 5,790...”
  • “...yhcN ibpB bfd b3782 b3556 b3687 b4414 b2153 b0802 b1112 b3238 b3686 b3337 6,476 6,387 6,120 6,025 5,942 5,817 5,804 5,790 5,787 5,582 1.8 15.9 8.7 1.0 1.2 8.2...”
• Global gene expression profiling of the asymptomatic bacteriuria Escherichia coli strain 83972 in the human urinary tract
  Roos, Infection and immunity 2006
  • “...c3973 c1382 b1445 b0620 c2901 b3241 b1335 Z1954 b1430 b3238 b0849 b0151 fepE ydhC evgA nlpI Z4919 c0674 b1660 b2369 b3163 Z4919 a Function or product...”
• Genome-wide localization of mobile elements: experimental, statistical and biological considerations
  Martinez-Vaz, BMC genomics 2005
  • “...yi52_8, ccmH 10. glcC, b2981, yi52_9, b2983, pitB 11. yhcD, yhcE, yi52_10, b3219, b3221, sspB, b3238 12. yhiS, yi52_11 , yhiF, tnaA We confirmed the presence of an IS5 element in the flhDC / yecG intergenic region by PCR. A 2720 bp PCR product was obtained...”
• More

P0E69_02540 peroxide/acid stress response protein YhcN from Chimaeribacter arupi
Aligns to 33:86 / 86 (62.8%), covers 100.0% of PF07338, 81.0 bits

• Chimaeribacter arupi a new member of the Yersineacea family has the characteristics of a human pathogen
  Riediger, Frontiers in cellular and infection microbiology 2023
  • “...P0E69_02430 bmsA 512351..512659 biofilm peroxide resistance protein BsmA P0E69_02500 msrA 524986..525621 peptide-methionine (S)-S-oxide reductase MsrA P0E69_02540 yhcN 535610..535870 peroxide/acid stress response protein YhcN P0E69_02545 yhcN 536006..536269 peroxide/acid stress response protein YhcN P0E69_03070 trx-GI 660012..660452 heat resistance system thioredoxin Trx-GI P0E69_05270 bcp 1133791..1134261 thioredoxin-dependent thiol peroxidase P0E69_06695...”

ECs4111 hypothetical protein from Escherichia coli O157:H7 str. Sakai
Aligns to 51:104 / 104 (51.9%), covers 98.2% of PF07338, 80.5 bits

• Transcriptomic analysis of Escherichia coli O157:H7 and K-12 cultures exposed to inorganic and organic acids in stationary phase reveals acidulant- and strain-specific acid tolerance responses
  King, Applied and environmental microbiology 2010
  • “...ECs4461 ECs4697 ECs4058 ECs0430 ECs0669 ECs2049 ECs2558 ECs3033 ECs4111 ECs4197 ECs4416 ECs5464 b3292 b3585 b3755 b3179 b0380 b0631 b1445 b1848 b2141 b3238...”

P0E69_02545 peroxide/acid stress response protein YhcN from Chimaeribacter arupi
Aligns to 34:87 / 87 (62.1%), covers 100.0% of PF07338, 80.4 bits

• Chimaeribacter arupi a new member of the Yersineacea family has the characteristics of a human pathogen
  Riediger, Frontiers in cellular and infection microbiology 2023
  • “...P0E69_02500 msrA 524986..525621 peptide-methionine (S)-S-oxide reductase MsrA P0E69_02540 yhcN 535610..535870 peroxide/acid stress response protein YhcN P0E69_02545 yhcN 536006..536269 peroxide/acid stress response protein YhcN P0E69_03070 trx-GI 660012..660452 heat resistance system thioredoxin Trx-GI P0E69_05270 bcp 1133791..1134261 thioredoxin-dependent thiol peroxidase P0E69_06695 1506872..1507075 thioredoxin reductase P0E69_09415 2087216..2087419 thioredoxin reductase P0E69_09865...”

SENTW_3490 peroxide/acid stress response protein YhcN from Salmonella enterica subsp. enterica serovar Weltevreden str.
STM3361 putative outer membrane protein from Salmonella typhimurium LT2
t3276 conserved hypothetical protein from Salmonella enterica subsp. enterica serovar Typhi Ty2
Aligns to 34:87 / 87 (62.1%), covers 98.2% of PF07338, 80.3 bits

• Transcriptional profile of Salmonella enterica subsp. enterica serovar Weltevreden during alfalfa sprout colonization
  Brankatschk, Microbial biotechnology 2014
  • “...7.03 Protein TdcF yiaL SENTW_3768 7.86 Protein YiaL ytfK SENTW_4510 8.24 Uncharacterized protein YtfK yhcN3 SENTW_3490 5.82 Protein YdgH ygaU SENTW_2883 5.51 Uncharacterized protein YgaU yggE SENTW_3181 6.70 Uncharacterized protein YggE yfeK SENTW_2617 5.38 Uncharacterized protein YfeK yjfN SENTW_4481 6.70 UPF0379 protein YjfN Genes more transcribed...”
• Stress response, amino acid biosynthesis and pathogenesis genes expressed in Salmonella enterica colonizing tomato shoot and root surfaces
  Han, Heliyon 2020
  • “...protein 1.5 0.002 1.7 0.003 yhaK STM3236 pirin domain protein 2.1 0.002 1.4 0.003 yhcN STM3361 Putative outer membrane protein 0.004 STM3362 STM3362 Putative periplasmic protein 0.004 yjbE STM4222.S Exopolysaccharide production protein YjbE 3.0 0.003 5.9 0.003 yhhW STM3544 quercetin 2,3-dioxygenase 3.5 0.009 STM0910 STM0910 terminase,...”
• Mapping and regulation of genes within Salmonella pathogenicity island 12 that contribute to in vivo fitness of Salmonella enterica Serovar Typhimurium
  Tomljenovic-Berube, Infection and immunity 2013
  • “...STM1519.S marA 2.61 9.14E19 STM3882 STM0162 STM1518 STM3829 STM3512 STM3361 STM1520 rbsA marB dgoK gntT yhcN marR 2.59 2.53 2.46 2.42 2.40 2.36 2.35 7.30E47...”
• In silico identification and experimental validation of PmrAB targets in Salmonella typhimurium by regulatory motif detection
  Marchal, Genome biology 2004
  • “...slsA STM3761 ; putative inner membrane protein 0.765418 CTTTATGTTATTTAAAT nd / 1110 Other distributions yhcN STM3361 ; Ortholog of E. coli orf , hypothetical protein (AAC76270.1); Blast hit to putative outer membrane protein 0.764452 ATTAGTGTATACTTAAT m + 1111 All nine genomes? yceP STM1161 ; Ortholog of...”
• A whole-genome screen identifies Salmonella enterica serovar Typhi genes involved in fluoroquinolone susceptibility
  Turner, The Journal of antimicrobial chemotherapy 2020
  • “...membrane protein 2.04 2.61 10 58 t2964 putative membrane protein; conserved 1.86 3.43 10 35 t3276 putative outer membrane protein; conserved 1.75 4.27 10 12 mrcA penicillin-binding protein 1A 1.60 5.3 10 49 plsC 1-acyl-glycerol-3-phosphate acyltransferase 1.57 1.03 10 8 t3147 putative exported protein 1.50 3.08...”

y0666 hypothetical protein from Yersinia pestis KIM
YPTB0458 putative exported protein from Yersinia pseudotuberculosis IP 32953
Aligns to 34:87 / 87 (62.1%), covers 100.0% of PF07338, 77.7 bits

• Dissecting psa Locus Regulation in Yersinia pestis
  Li, Journal of bacteriology 2021 (secret)
• The Diverse Roles of the Global Transcriptional Regulator PhoP in the Lifecycle of Yersinia pestis
  Fukuto, Pathogens (Basel, Switzerland) 2020
  • “...flea blockage [ 34 ]. Another example is that of the YhcN family genes ( y0666 and y1667 in KIM), which normally display induced expression and promote bacterial aggregation at low pH conditions in vitro [ 64 ]. These genes are highly expressed in fleas blocked...”
  • “...PhoP. PhoP binding motifs have been identified by bioinformatic analysis in the promoter regions of y0666 and y3555/aspB [ 68 ], predicting that these genes are directly regulated by PhoP. Known PhoP-repressed genes psaABC and psaEF , which are involved in production of the pH 6...”
• Role of the PhoP-PhoQ gene regulatory system in adaptation of Yersinia pestis to environmental stress in the flea digestive tract
  Vadyvaloo, Microbiology (Reading, England) 2015
  • “...as per the manufacturer's instructions. Samples were amplified using oligonucleotide primers for crr (y1485), y1667, y0666, y3909, y3519, y2882 ( psaA ), y1918 and the IQ SYBR Green Supermix (Bio-Rad) via a two-step protocol on a Bio-Rad CFX384 real-time system. Oligonucleotide sequences are tabulated in Table...”
  • “...1.0 YPO1087 * HigB2 toxin 2.3 1.2 1.0 1.1 YhcN family (DUF1471) multiple stress resistance y0666 yhcN Multiple stress resistance protein 9.3 (1.5) 1.3 1.1 y1667 Multiple stress resistance protein 12.4 (1.9) 1.0 1.2 * Gene not annotated in Y. pestis KIM (YPO number indicates Y....”
• IscR is essential for yersinia pseudotuberculosis type III secretion and virulence
  Miller, PLoS pathogens 2014
  • “...biosynthetic protein pdxJ 2.2 Hypothetical Proteins(9) YPTB0391 putative exported protein 2.1 YPTB0449 hypothetical protein 3.3 YPTB0458 putative exported protein 2.2 YPTB1093 hypothetical protein 3.6 YPTB1571 hypothetical protein 2.1 YPTB2255 putative exported protein 2.3 YPTB2277 hypothetical protein 2.6 YPTB2496 hypothetical protein 2.8 YPTB3109 hypothetical protein 4.1 a...”

DSJ_21690 peroxide/acid stress response protein YhcN from Pantoea stewartii subsp. stewartii DC283
Aligns to 34:87 / 87 (62.1%), covers 100.0% of PF07338, 77.7 bits

• The Transcription Factor Lrp of Pantoea stewartii subsp. stewartii Controls Capsule Production, Motility, and Virulence Important for in planta Growth
  Bartholomew, Frontiers in microbiology 2021
  • “...seven transcription factors (NsrR, IscR, Nac, Lrp, DSJ_00125, DSJ_03645, and DSJ_18135) and one hypothetical protein (DSJ_21690) were constructed to further evaluate the role of the encoded gene products during in vitro and in planta growth. Assays for capsule production and motility indicate that Lrp plays a...”
  • “...described ( Kernell Burke et al., 2015 ). The genes lrp , DSJ_00125 (00125), and DSJ_21690 (21690) underwent a deletion strategy from methods described by Stice et al. (2020) that was modified as described below. Overlap extension PCR products with attB sites for the upstream and...”
• Discovery of Pantoea stewartii ssp. stewartii genes important for survival in corn xylem through a Tn-Seq analysis
  Duong, Molecular plant pathology 2018 (secret)

4evuB / Q8ZPL1 Crystal structure of c-terminal domain of putative periplasmic protein ydgh from s. Enterica (see paper)
Aligns to 13:68 / 68 (82.4%), covers 100.0% of PF07338, 77.6 bits

• Ligand: sulfate ion (4evuB)

CPT31_08740 multiple stress resistance protein BhsA from Enterobacter hormaechei
Aligns to 33:85 / 85 (62.4%), covers 98.2% of PF07338, 75.1 bits

• The evolution of antibiotic resistance in an incurable and ultimately fatal infection: A retrospective case study
  Woods, Evolution, medicine, and public health 2023
  • “...of the divergently transcribed gene [ 40 ]. In this case, the divergently transcribed gene CPT31_08740 has homology to the multiple stress resistance protein BhsA. The meropenem-resistant isolates from the end of the infectious process also had higher levels of resistance against cefepime, yet they never...”

STY1254 putative secreted protein from Salmonella enterica subsp. enterica serovar Typhi str. CT18
Aligns to 33:85 / 85 (62.4%), covers 98.2% of PF07338, 74.7 bits

• Better together-Salmonella biofilm-associated antibiotic resistance
  Aleksandrowicz, Gut microbes 2023
  • “...by H 2 0 2 and HOCl. 125 It is also referred to as the STY1254 gene, which is one of the most highly upregulated genes in S . Typhi biofilms. 63 Zhang et al. indicated that the bhsA gene in E. coli increases the stickiness...”
• Transcriptomic study of Salmonella enterica subspecies enterica serovar Typhi biofilm
  Chin, BMC genomics 2017
  • “...in the track represent the log 2 -fold change of each gene, e.g. up-regulated genes STY1254 (1,207,090...1207347), and yheA (4,231,386...4231580), and down-regulated genes rmf (1,066,679...1066846) and STY1156 (1,116,294...1116461) Table 2 Selected differentially up-regulated genes and their functions in S. Typhi biofilm cells Gene Gene function log...”
  • “...bacteria membrane matrix The gene that was most highly up-regulated in the biofilm cells was STY1254 , a multiple stress resistance protein, bhsA . It plays a role in the membrane structure of S. Typhi [ 16 ]. According to a study by Zhang et al....”

SL1344_1151, STM14_1388 multiple stress resistance protein BhsA from Salmonella enterica subsp. enterica serovar Typhimurium str. SL1344
NP_460184 putative outer membrane protein from Salmonella enterica subsp. enterica serovar Typhimurium str. LT2
STM1214 putative outer membrane protein from Salmonella typhimurium LT2
Aligns to 33:85 / 85 (62.4%), covers 98.2% of PF07338, 74.7 bits

• Integrative DNA methylome and transcriptome analysis reveals DNA adenine methylation is involved in Salmonella enterica Typhimurium response to oxidative stress
  Zhang, Microbiology spectrum 2023
  • “...symporter STM14_0180 aroP 0.84 0.017 Aromatic amino acid transporter STM14_1053 0.90 0.014 Hypothetical protein STM14_1053 STM14_1388 ycfR 0.68 0.05 Putative outer membrane protein STM14_2212 manX 0.82 0.024 Mannose-specific enzyme IIAB STM14_2213 manY 0.83 0.022 Mannose-specific enzyme IIC STM14_2492 0.93 0.0021 Hypothetical protein STM14_2492 STM14_2773 0.79 0.033...”
• Tigecycline challenge triggers sRNA production in Salmonella enterica serovar Typhimurium
  Yu, BMC microbiology 2012
  • “...in the cDNA library, e.g. dinF and a gene encoding a putative outer membrane protein (SL1344_1151). The dinF gene is a member of the SOS response family and encodes an efflux pump which belongs to the multidrug and toxic compound extrusion (MATE) family [ 31 ],...”
• Roles of YcfR in Biofilm Formation in Salmonella Typhimurium ATCC 14028.
  Kim, Molecular plant-microbe interactions : MPMI 2019 (PubMed)
  • GeneRIF: YcfR is an essential constituent of Salmonella outer membrane architecture and its absence may cause multifaceted structural changes, thereby compromising bacterial envelope integrity
• Stress response, amino acid biosynthesis and pathogenesis genes expressed in Salmonella enterica colonizing tomato shoot and root surfaces
  Han, Heliyon 2020
  • “...SIGNALING [M] Cell wall/membrane/envelope biogenesis yhdV STM3392 outer membrane lipoprotein 1.7 0.002 3.7 0.003 ycfR STM1214 Reduces the permeability of the outer membrane to copper. Seems to be involved in the regulation of biofilm formation. May decrease biofilm formation by repressing cell-cell interaction and cell surface...”
• Mapping and regulation of genes within Salmonella pathogenicity island 12 that contribute to in vivo fitness of Salmonella enterica Serovar Typhimurium
  Tomljenovic-Berube, Infection and immunity 2013
  • “...3.53 1.63E22 1.83E15 2.07E20 4.71E43 3.41E23 1.05E16 2.49E12 STM1214 STM3828 STM0701 STM0152 ycfR dgoA speF aceE 3.18 3.17 3.12 3.06 3.53E09 2.88E39 2.87E76...”
• Effects of indole on drug resistance and virulence of Salmonella enterica serovar Typhimurium revealed by genome-wide analyses
  Nikaido, Gut pathogens 2012
  • “...ybiJ Putative periplasmic protein 3.2 11 STM1156 yceA Putative enzyme related to sulfurtransferases 4.3 8.0 STM1214 ycfR Putative outer membrane protein 4.6 37 STM1251 Putative molecular chaperone (small heat shock protein) 11 9.2 STM1355 ydiP Putative transcription regulator, AraC family 11 7.5 STM1472 Putative periplasmic protein...”
• Transcriptomic responses of Salmonella enterica serovars Enteritidis and Typhimurium to chlorine-based oxidative stress
  Wang, Applied and environmental microbiology 2010
  • “...regulatory protein STM0823 ybiJ Putative periplasmic protein STM1214 ycfR Putative outer membrane protein STM2430 cysK O-Acetylserine sulfhydrolase A STM2338...”

S1196 hypothetical protein from Shigella flexneri 2a str. 2457T
Aligns to 18:70 / 70 (75.7%), covers 98.2% of PF07338, 74.6 bits

• Addendum
  , Open forum infectious diseases 2019

ComC / b1112 DUF1471 domain-containing multiple stress resistance outer membrane protein BhsA from Escherichia coli K-12 substr. MG1655 (see 10 papers)
BHSA_ECOLI / P0AB40 Multiple stress resistance protein BhsA; Copper-induced outer membrane component from Escherichia coli (strain K12) (see 2 papers)
bhsA multiple stress resistance protein bhsA from Escherichia coli K12 (see 4 papers)
NP_309517 multiple stress resistance protein BhsA from Escherichia coli O157:H7 str. Sakai
NP_415630 DUF1471 domain-containing multiple stress resistance outer membrane protein BhsA from Escherichia coli str. K-12 substr. MG1655
b1112 hypothetical protein from Escherichia coli str. K-12 substr. MG1655
ECs1490 hypothetical protein from Escherichia coli O157:H7 str. Sakai
B21_RS05900, DR76_RS20000, ETEC_1177 multiple stress resistance protein BhsA from Escherichia coli ETEC H10407
Aligns to 33:85 / 85 (62.4%), covers 98.2% of PF07338, 73.9 bits

• function: Reduces the permeability of the outer membrane to copper. Seems to be involved in the regulation of biofilm formation. May decrease biofilm formation by repressing cell-cell interaction and cell surface interaction.
  disruption phenotype: Disruption of this gene increases copper sensitivity, induces stress response genes in biofilms, increases aggregation and cell surface hydrophobicity, and decreases indole synthesis.
• Functional analysis of ycfR and ycfQ in Escherichia coli O157:H7 linked to outbreaks of illness associated with fresh produce.
  Deng, Applied and environmental microbiology 2011
  • GeneRIF: These findings suggest that gene regulation via ycfQ and ycfR may be a mechanism by which Escherichia coli O157:H7 strain Sakai could survive in the postharvest processing environment.
• The copper-inducible ComR (YcfQ) repressor regulates expression of ComC (YcfR), which affects copper permeability of the outer membrane of Escherichia coli.
  Mermod, Biometals : an international journal on the role of metal ions in biology, biochemistry, and medicine 2012 (PubMed)
  • GeneRIF: ComC is an outer membrane protein which lowers the permeability of the outer membrane to copper, and its expression is controlled by ComR, a novel, TetR-like copper-responsive repressor.
• Serotype-dependent adhesion of Shiga toxin-producing Escherichia coli to bovine milk fat globule membrane proteins
  Bagel, Frontiers in microbiology 2022
  • “...13.00 (0.0002) 8.63 (0.0000) PMK5 Multiple stress resistance protein BhsA (Copper-induced outer membrane component) A0A070FQT8 (P0AB40) Cell outer membrane [GO:0009279]; response to copper ion [GO:0046688] 3.27 (0.0949) 3.01 (0.0451) 1.09 (0.7891) PMK5 Vitamin B12 transporter BtuB (Cobalamin receptor) (Outer membrane cobalamin translocator) A0A0E1LF30 (A8A774) Cell outer...”
• Top-Down LESA Mass Spectrometry Protein Analysis of Gram-Positive and Gram-Negative Bacteria
  Kocurek, Journal of the American Society for Mass Spectrometry 2017
  • “...24 h, 37 C Storage: 15 days, 4 C 1088.8935 +6 6527.32 -1.1 BhsA a P0AB40 35 -signal peptide 1094.2255 +8 8745.75 -0.6 YnaE P76073 62 1212.1269 +6 7266.72 -0.4 CspC P0A9Y6 37 Incubation: 24 h, 37 C Storage: 2 days, room temperature -Met 1356.6814 +3...”
• A systems approach discovers the role and characteristics of seven LysR type transcription factors in Escherichia coli
  Rodionova, Scientific reports 2022
  • “...b1889 motB Motility protein B 409.8 5.2 b4154 frdA Fumarate reductase flavoprotein subunit 2376.0 5.2 b1112 bhsA DUF1471 domain-containing multiple stress resistance outer membrane protein BhsA 3.5 5.2 b0621 dcuC Anaerobic C4-dicarboxylate transporter DcuC 120.9 5.1 b1878 flhE Flagellar protein 27.4 5.1 b2020 hisD Histidinal/histidinol dehydrogenase...”
• Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure
  LaVoie, BMC genomics 2018
  • “...Name Product Description Hg t10 Hg t30 Hg t60 PMA t10 PMA t30 PMA t60 b1112 bhsA Biofilm, cell surface and signaling defects, YhcN family 1949 563 94 46 21 n.s. b4458 oxyS OxyS sRNA activates genes that detoxify oxidative damage 1524 1292 150 10 6...”
  • “...n.s. b1531 marA Transcriptional activator for multiple antibiotic resistance; 15 9 n.s. 46 31 n.s. b1112 bhsA Biofilm, cell surface and signaling defects, YhcN family 1949 563 94 46 21 n.s. b1532 marB marRAB multiple antibiotic resistance operon 16 8 n.s. 45 27 n.s. b4663 azuC...”
• Transcriptomic analysis of carboxylic acid challenge in Escherichia coli: beyond membrane damage
  Royce, PloS one 2014
  • “...0.002 0.003 3.5 Biofilm formation- rapid acid treatment b3516 gadX 0.001 0.014 3.5 AR2 TR b1112 bhsA 0.002 0.003 3.3 Influencing biofilm through hydrophobicity and SR b2012 yeeD 0.010 0.106 3.0 Uncharacterized b1164 ycgZ 0.006 0.107 2.9 Cold shock stimulon b4554 (c4419) yibT 0.001 0.056 2.8...”
• Global gene expression profiling of asymptomatic bacteriuria Escherichia coli during biofilm growth in human urine
  Hancock, Infection and immunity 2007
  • “...ycfR yhcN ibpB bfd b3782 b3556 b3687 b4414 b2153 b0802 b1112 b3238 b3686 b3337 6,476 6,387 6,120 6,025 5,942 5,817 5,804 5,790 5,787 5,582 1.8 15.9 8.7 1.0 1.2...”
• luxS-dependent gene regulation in Escherichia coli K-12 revealed by genomic expression profiling
  Wang, Journal of bacteriology 2005
  • “...b1022 b1437 b4186 b2406 b3939 b3945 b0648 b1680 b0823 b1112 b4288 b4310 b3103 b0621 b1407 b0076 b2723 b3683 b3028 b2968 b0579 b3220 b0260 b3046 b2919 b3906...”
• Gene expression in Escherichia coli biofilms
  Ren, Applied microbiology and biotechnology 2004 (PubMed)
  • “...of unknown function (ybaJ, ychM, yefM, ygfA, b1060, b1112, b2377, b3022, b1373, b1601, and b0836). The DNA microarray results were corroborated with RNA dot...”
  • “...3 trpE b1264 Unknown genes ybaJ b0461 b2377 b2377 b1112 b1112 b3022 b3022 2 4 Heat shock protein Regulation of superoxide response regulon, global regulator...”
• Prominent roles of the NorR and Fur regulators in the Escherichia coli transcriptional response to reactive nitrogen species
  Mukhopadhyay, Proceedings of the National Academy of Sciences of the United States of America 2004
  • “...b1684 b0127 b4367 b2875 b3106 b4357 b2579 b0484 b3744 b4381 b3774 b0802 b2715 b1200 b1241 b1112 173 338 70 38 2 3 11 2 17 18 1 1 6 5 2 1 15 2 6 7 9 1 1 1 1 2 4...”
• Evolutionary comparisons suggest many novel cAMP response protein binding sites in Escherichia coli
  Brown, Proceedings of the National Academy of Sciences of the United States of America 2004
  • “...(b1779) ydeA (b1528) hpt (b0125); ged (b0124) yefQ (b1111); ycfR (b1112) proP (b4111) ygiG (b3073); aer (b3072) -- -- 3.33 9.14 -- -- -- -- 5.87 -- 4.47 6.70...”
• More
• Pre-Harvest Survival and Post-Harvest Chlorine Tolerance of Enterohemorrhagic Escherichia coli on Lettuce
  Tyagi, Toxins 2019
  • “...3.7 3.9 ECs1417 csgD Transcriptional regulator CsgD 4.5 3.3 ECs1438 bssS biofilm regulator 3.4 4.2 ECs1490 bhsA multiple stress resistance protein (YcfR) 3.5 4.2 ECs1926 zntB Zinc transport protein ZntB 1.8 1.8 ECs2062 ybfL type IV secretion protein Rhs 3.9 3.0 ECs2155 nleG6-2 T3SS secreted effector...”
• Gene expression induced in Escherichia coli O157:H7 upon exposure to model apple juice
  Bergholz, Applied and environmental microbiology 2009
  • “...ECs1318 ECs1342 ECs1350 ECs1397 ECs1438 ECs1441 ECs1488 ECs1490 ECs1576 ECs1588 ECs1593 ECs1612 ECs1654 ECs1655 ECs1691 ECs1760 ECs1763 ECs1771 ECs1775 ECs1823...”
• Cross-Kingdom Comparative Transcriptomics Reveals Conserved Genetic Modules in Response to Cadmium Stress
  Chen, mSystems 2021
  • “...B21_RS13600, and B21_RS07750), stress response (B21_RS19915), sugar import (B21_RS20540, B21_RS20565, and B21_RS21625), cell wall remodeling (B21_RS05900), and energy production and conversion (B21_RS21615) ( Fig.2A ). In S. cerevisiae AH109, 11 selected DEGs (YLR303W, YIR017C, YKL001C, YLL061W, YDR502C, YLR180W, YPL274W, YLL060C, YGR055W, YFR030W, and YPR167C) encoded proteins...”
• Virulence and transcriptome profile of multidrug-resistant Escherichia coli from chicken
  Hussain, Scientific reports 2017
  • “...0.01 DR76_RS05090 HdeB Acid-resistance protein HdeB 5.17 0.01 DR76_RS05080 HdeD Acid-resistance protein HdeD 5.81 0.01 DR76_RS20000 BhsA Multiple stress resistance protein BhsA 1.30 0.01 DR76_RS04045 IbpB Heat shock chaperone IbpB 2.80 0.01 DR76_RS04040 IbpA Heat shock protein IbpA 1.91 0.01 DR76_RS14975 Hsp31 Heat shock protein Hsp31...”
• The molecular basis for control of ETEC enterotoxin expression in response to environment and host
  Haycocks, PLoS pathogens 2015
  • “...1263558 T T TGA CGGCTA TCAC G ETEC_1166 ptsG 1274886 TGTGA TCTGGA TCACA ETEC_1176 / ETEC_1177 ycfQ / bhsA 1301786 GA TGA TCCGCA TCACA ( ETEC_1206 )/ ETEC_1207 ETEC-specific/ETEC-specific 1348166 AT TGA ACAGGA TCACA (ETEC_1259)/ETEC_1260 (rluE)/icd 1376374 G GTGA GCTGGC TCACA ETEC_1292 / ETEC_1293 ycgB /...”

SENTW_4481 DUF1471 family protease activator YjfN from Salmonella enterica subsp. enterica serovar Weltevreden str.
Aligns to 35:91 / 91 (62.6%), covers 98.2% of PF07338, 73.3 bits

• Transcriptional profile of Salmonella enterica subsp. enterica serovar Weltevreden during alfalfa sprout colonization
  Brankatschk, Microbial biotechnology 2014
  • “...protein YgaU yggE SENTW_3181 6.70 Uncharacterized protein YggE yfeK SENTW_2617 5.38 Uncharacterized protein YfeK yjfN SENTW_4481 6.70 UPF0379 protein YjfN Genes more transcribed in presence of sprouts According to Kyoto Encyclopedia of Genes and Genomes (KEGG) categorization, genes significantly more transcribed in presence of sprouts include...”

KP1_2104 hypothetical protein from Klebsiella pneumoniae NTUH-K2044
Aligns to 33:85 / 85 (62.4%), covers 98.2% of PF07338, 72.9 bits

• A Dual Barcoding Approach to Bacterial Strain Nomenclature: Genomic Taxonomy of Klebsiella pneumoniae Strains
  Hennart, Molecular biology and evolution 2022
  • “...2014 ). Here, we updated the scgMLSTv1 scheme, with the following improvements. First, two loci (KP1_2104 and aceB =KP1_0253) were removed because they were absent or truncated in multiple strains, based on 751 high-quality assemblies available in the BIGSdb-Pasteur Klebsiella database on October 16, 2017 (project...”

YPTB2554 putative exported protein from Yersinia pseudotuberculosis IP 32953
YPO2521 putative exported protein from Yersinia pestis CO92
y1667 hypothetical protein from Yersinia pestis KIM
Aligns to 34:86 / 86 (61.6%), covers 100.0% of PF07338, 72.5 bits

• Growth of Yersinia pseudotuberculosis in human plasma: impacts on virulence and metabolic gene expression
  Rosso, BMC microbiology 2008
  • “...(0.001) YPTB2540 or3654 conserved hypothetical protein 2.145 (0.008) YPTB2552 YPO2515 hypothetical 1.46 (0.023) 1.396 (0.042) YPTB2554 YPO2521 putative exported protein 0.648 (0.044) YPTB2562 YPO2530 conserved hypothetical protein 0.527 (0.026) YPTB2623 (flk) YPO2760 putative flagellar assembly regulatory protein. flk 0.549 (0.008) YPTB2699 YPO2976 conserved hypothetical protein 4.448...”
• Growth of Yersinia pseudotuberculosis in human plasma: impacts on virulence and metabolic gene expression
  Rosso, BMC microbiology 2008
  • “...YPTB2540 or3654 conserved hypothetical protein 2.145 (0.008) YPTB2552 YPO2515 hypothetical 1.46 (0.023) 1.396 (0.042) YPTB2554 YPO2521 putative exported protein 0.648 (0.044) YPTB2562 YPO2530 conserved hypothetical protein 0.527 (0.026) YPTB2623 (flk) YPO2760 putative flagellar assembly regulatory protein. flk 0.549 (0.008) YPTB2699 YPO2976 conserved hypothetical protein 4.448 (<...”
• The Diverse Roles of the Global Transcriptional Regulator PhoP in the Lifecycle of Yersinia pestis
  Fukuto, Pathogens (Basel, Switzerland) 2020
  • “...[ 34 ]. Another example is that of the YhcN family genes ( y0666 and y1667 in KIM), which normally display induced expression and promote bacterial aggregation at low pH conditions in vitro [ 64 ]. These genes are highly expressed in fleas blocked from a...”
• Role of the PhoP-PhoQ gene regulatory system in adaptation of Yersinia pestis to environmental stress in the flea digestive tract
  Vadyvaloo, Microbiology (Reading, England) 2015
  • “...Technologies) as per the manufacturer's instructions. Samples were amplified using oligonucleotide primers for crr (y1485), y1667, y0666, y3909, y3519, y2882 ( psaA ), y1918 and the IQ SYBR Green Supermix (Bio-Rad) via a two-step protocol on a Bio-Rad CFX384 real-time system. Oligonucleotide sequences are tabulated in...”
  • “...family (DUF1471) multiple stress resistance y0666 yhcN Multiple stress resistance protein 9.3 (1.5) 1.3 1.1 y1667 Multiple stress resistance protein 12.4 (1.9) 1.0 1.2 * Gene not annotated in Y. pestis KIM (YPO number indicates Y. pestis CO92 homologue). Elevated transcription of four putative toxinantitoxin (TA)...”

SEN_RS21580 DUF1471 family protease activator YjfN from Salmonella enterica subsp. enterica serovar Enteritidis str.
Aligns to 35:91 / 91 (62.6%), covers 98.2% of PF07338, 72.1 bits

• Salmonella Enteritidis Isolate Harboring Multiple Efflux Pumps and Pathogenicity Factors, Shows Absence of O Antigen Polymerase Gene
  Jones-Dias, Frontiers in microbiology 2016
  • “...Island 4 Asn2902Asp 158 4402123 C T SEN_RS21190 (sugar:sodium symporter) Ala350Val 77 4476625 T C SEN_RS21580 (hypothetical protein) Lys76Glu 170 4555382 C T SEN_RS21985 (DNA polymerase III subunit chi) Asp10Asn 110 Furthermore, the RGI strict algorithm, which detects previously unknown variants of known antimicrobial resistance genes,...”

YPO0130 putative exported protein from Yersinia pestis CO92
YPTB3770 putative exported protein from Yersinia pseudotuberculosis IP 32953
Aligns to 36:89 / 89 (60.7%), covers 100.0% of PF07338, 71.4 bits

• Comparative Global Gene Expression Profiles of Wild-Type Yersinia pestis CO92 and Its Braun Lipoprotein Mutant at Flea and Human Body Temperatures
  Galindo, Comparative and functional genomics 2010
  • “...dismutase precursor (Cu-Zn) sodC Resistance to reactive oxygen species 18.2 Unknown functions various genes (y3398, YPO0130, 0198, 1087, 1560, 1996, 2153, 2854, and 3699) * Functions were obtained from the CMR online database ( http://cmr.jcvi.org ) and from the literature. FC = fold-change, which was calculated...”
• Growth of Yersinia pseudotuberculosis in human plasma: impacts on virulence and metabolic gene expression
  Rosso, BMC microbiology 2008
  • “...0.379 (< 0.001) YPTB3769 (feoC) YPO0131 ferrous iron transport protein C 1.899 (< 0.001) YPTB3770 YPO0130 putative exported protein 0.43 (< 0.001) YPTB3781 YPO3935 putative membrane protein 0.717 (0.036) YPTB3789 or2712 putative invasin 0.614 (0.01) YPTB3811 (uspB) YPO3969 universal stress protein B 0.665 (0.04) YPTB3834 (pelY)...”
• Growth of Yersinia pseudotuberculosis in human plasma: impacts on virulence and metabolic gene expression
  Rosso, BMC microbiology 2008
  • “...protein 0.379 (< 0.001) YPTB3769 (feoC) YPO0131 ferrous iron transport protein C 1.899 (< 0.001) YPTB3770 YPO0130 putative exported protein 0.43 (< 0.001) YPTB3781 YPO3935 putative membrane protein 0.717 (0.036) YPTB3789 or2712 putative invasin 0.614 (0.01) YPTB3811 (uspB) YPO3969 universal stress protein B 0.665 (0.04) YPTB3834...”

y3909 hypothetical protein from Yersinia pestis KIM
Aligns to 39:92 / 92 (58.7%), covers 100.0% of PF07338, 71.3 bits

• Role of the PhoP-PhoQ gene regulatory system in adaptation of Yersinia pestis to environmental stress in the flea digestive tract
  Vadyvaloo, Microbiology (Reading, England) 2015
  • “...per the manufacturer's instructions. Samples were amplified using oligonucleotide primers for crr (y1485), y1667, y0666, y3909, y3519, y2882 ( psaA ), y1918 and the IQ SYBR Green Supermix (Bio-Rad) via a two-step protocol on a Bio-Rad CFX384 real-time system. Oligonucleotide sequences are tabulated in Table S1....”
  • “...). The Y. pestis KIM6+ genome contained five YhcN protein family genes (y1667, y0666, y0640, y3909 and y2136) that encoded predicted proteins of 86, 87, 53, 92 and 317 amino acids, respectively. In E. coli , four of the 10 YhcN family proteins were shown to...”

ETEC_4545 DUF1471 family protein YjfY from Escherichia coli ETEC H10407
Aligns to 35:91 / 91 (62.6%), covers 98.2% of PF07338, 70.7 bits

• The molecular basis for control of ETEC enterotoxin expression in response to environment and host
  Haycocks, PLoS pathogens 2015
  • “...GTGA TCTATT TCACA ETEC_4486 / ETEC_4487 aspA / fxsA 4930149 TGTGA TGAACT TCA A A ETEC_4545 / ETEC_4546 yjfY / rpsF 4940903 TGTGA TCACTA TC G CA ETEC_4557 / ETEC_4558 ETEC-specific/ ytfA 4993073 TGTGA CTGGTA TC T C G ( ETEC_4604 ) ( valS ) 5002854...”

YjfY / b4199 DUF1471 domain-containing protein YjfY from Escherichia coli K-12 substr. MG1655 (see paper)
Z5808 orf, hypothetical protein from Escherichia coli O157:H7 EDL933
b4199 hypothetical protein from Escherichia coli str. K-12 substr. MG1655
ECs5175 hypothetical protein from Escherichia coli O157:H7 str. Sakai
Aligns to 35:91 / 91 (62.6%), covers 98.2% of PF07338, 70.5 bits

• Comparison of strand-specific transcriptomes of enterohemorrhagic Escherichia coli O157:H7 EDL933 (EHEC) under eleven different environmental conditions including radish sprouts and cattle feces
  Landstorfer, BMC genomics 2014
  • “...(47) 0.4 (17) 1.0 (7) 6.2 (0) 0.9 (16) 1.7 (25) 5.8 (430) 0.3 (2) Z5808 yjfY , biofilm formation [ 47 49 ] radish 1 (13) 2.7 (50) 1.5 (6) 0.4 (15) 3.0 (99) 1.8 (12) 2.1 (19) 0.3 (7) 1.8 (27) 7.5 (1365) 4.5...”
  • “...LB medium (D1), minimal medium (D2), and on radish sprouts (D3). E1-E3: regulated hypothetical gene Z5808 (see Table 2 ), in LB medium (E1), minimal medium (E2), and on radish sprouts (E3). The color map values range from 0.1 to 3 10 5 , the exact...”
• Global gene expression profiling of asymptomatic bacteriuria Escherichia coli during biofilm growth in human urine
  Hancock, Infection and immunity 2007
  • “...c3865 fxsA b0824 b1532 b4198 Z0555 b4212 b3556 b4199 c3865 b4140 Homolog of Salmonella cold shock protein Cold shock-like protein Heat shock protein Multiple...”
• Combined, functional genomic-biochemical approach to intermediary metabolism: interaction of acivicin, a glutamine amidotransferase inhibitor, with Escherichia coli K-12
  Smulski, Journal of bacteriology 2001
  • “...b3928 b3937 b3995 b4030 b4126 b4127 b4135 b4178 b4189 b4199 b4206 b4234 b4255 b4311 b4325 b4326 b2300 b2302 b2303 b2442 b2529 b2530 b2597 b2664 b2665 b2856...”
  • “...b3875 b3923 b3928 b3937 b3995 b4030 b4126 b4127 b4135 b4178 b4189 b4199 b4206 b4234 b4255 b4311 b4325 b4326 3.2 3.6 2.8 2.2 2.1 2.7 23.6 3.2 4.7 2.6 2.1 2.1 2.0...”
• Influence of Glucose Availability and CRP Acetylation on the Genome-Wide Transcriptional Response of Escherichia coli: Assessment by an Optimized Factorial Microarray Analysis
  Guebel, Frontiers in microbiology 2018
  • “...a set of four genes that codify periplasmic proteins with dodecin-like structure (ECs5165, ECs0884, ECs5164, ECs5175; FDR = 2.1 10 2 ) and another set of five genes which codify enzymes involved in L-arginine degradation ( astA [arginine N-succinyltransferase], astB [N-succinylarginine dihydrolase], astC [bifunctional enzyme succinylornithine...”

YbiM / b0806 DUF1471 domain-containing protein McbA from Escherichia coli K-12 substr. MG1655 (see 2 papers)
MCBA_ECOLI / P0AAX6 Uncharacterized protein McbA; MqsR-controlled colanic acid and biofilm protein A from Escherichia coli (strain K12) (see paper)
mcbA / ECOCYC|G6415-MONOMER MqsR-controlled colanic acid and biofilm protein A from Escherichia coli K12 (see paper)
NP_415327 DUF1471 domain-containing protein McbA from Escherichia coli str. K-12 substr. MG1655
b0806 orf, hypothetical protein from Escherichia coli str. K-12 substr. MG1655
Aligns to 34:86 / 86 (61.6%), covers 100.0% of PF07338, 69.6 bits

• function: Affects biofilm formation and mucoidy.
• The C-terminal part of microcin B is crucial for DNA gyrase inhibition and antibiotic uptake by sensitive cells.
  Shkundina, Journal of bacteriology 2014
  • GeneRIF: The C-terminal part of McbA is crucial for DNA gyrase inhibition and antibiotic uptake.
• Proton motive force dissipation precludes interaction of microcin J25 with RNA polymerase, but enhances reactive oxygen species overproduction.
  Dupuy, Biochimica et biophysica acta 2009 (PubMed)
  • GeneRIF: Data show that the deleterious reactive oxygen species would be produced as a consequence of the minor fraction of MccJ25 that interacts with the bacterial plasma membrane from the periplasmic side.
• Escherichia coli transcription factor YncC (McbR) regulates colanic acid and biofilm formation by repressing expression of periplasmic protein YbiM (McbA).
  Zhang, The ISME journal 2008 (PubMed)
  • GeneRIF: YncC inhibits colanic acid overproduction and thereby inhibits mucoidy by repressing expression of periplasmic protein YbiM
• 5-azacytidine induces transcriptome changes in Escherichia coli via DNA methylation-dependent and DNA methylation-independent mechanisms
  Militello, BMC microbiology 2016
  • “...A; homodimeric; selenate, azaserine, chromate resistance; alkali-inducible, sulfate starvation-inducible protein SSI5; cysteine desulfhydrase 1.58 2.86E-03 b0806 mcbA Stimulates colanic acid mucoidy, YhcN family, periplasmic; suppresses biofilm formation; repressed by McbR 1.71 5.11E-04 b2425 cysP Thiosulfate-binding protein, periplasmic 1.84 1.90E-04 b0506 allR Repressor for all (allantoin) and...”
• YcfR (BhsA) influences Escherichia coli biofilm formation through stress response and surface hydrophobicity
  Zhang, Journal of bacteriology 2007
  • “...function ybiM ybaA yceK yjbJ yjdN ygaM ymgE b0806 b0456 b1050 b4045 b4107 b2672 b1195 Hypothetical protein Hypothetical protein Hypothetical protein Highly...”
• Combined, functional genomic-biochemical approach to intermediary metabolism: interaction of acivicin, a glutamine amidotransferase inhibitor, with Escherichia coli K-12
  Smulski, Journal of bacteriology 2001
  • “...b0607 b0643 b0662 b0707 b0753 b0786 b0789 b0790 b0800 b0806 b0836 b0865 b0897 b0964 b0966 b1003 b1045 b1050 b1060 b1103 b1104 b1105 b1107 b1108 b1111 b1112...”

AAF13_RS31850 DUF1471 family periplasmic protein McbA from Escherichia coli O104:H4 str. C227-11
Aligns to 34:86 / 86 (61.6%), covers 100.0% of PF07338, 69.5 bits

• Broad time-dependent transcriptional activity of metabolic genes of E. coli O104:H4 strain C227/11Φcu in a soil microenvironment at low temperature
  Detert, Environmental microbiology reports 2023
  • “...domaincontaining protein n.d.e 5.36 AAF13_RS19105 DUF1328 domaincontaining protein 2.20 5.39 AAF13_RS19690 Nacetylmannosamine6phosphate 2epimerase 3.03 5.32 AAF13_RS31850 DUF1471 domaincontaining protein n.d.e 6.20 actP Cation/acetate symporter ActP 6.73 2.17 araD Lribulose5phosphate 4epimerase 8.45 2.78 dppF Dipeptide ABC transporter ATP binding subunit DppF 7.12 2.03 gabP GABA permease 7.39...”

YjfN / b4188 protease activator YjfN from Escherichia coli K-12 substr. MG1655 (see 5 papers)
b4188 orf, hypothetical protein from Escherichia coli str. K-12 substr. MG1655
Aligns to 35:91 / 91 (62.6%), covers 98.2% of PF07338, 68.9 bits

• Global RNA half-life analysis in Escherichia coli reveals positional patterns of transcript degradation
  Selinger, Genome research 2003
  • “...Most Labile mRNAs B# Name HL 0 2.5 5 10 20 b4188 b3605 b3914 b0990 b3913 b0553 b2398 b3494 b3556 b3685 b0726 b1205 b3362 b0162 b1060 b2080 b2377 b3361 b4132...”
• DNA microarray analyses of the long-term adaptive response of Escherichia coli to acetate and propionate
  Polen, Applied and environmental microbiology 2003
  • “...aspA 1 Aspartate ammonia lyase (aspartase) 0.37* 0.45* 1.38 b4188 yjfN 1 ORF, hypothetical protein 0.39* 0.50 0.67 b4189 yjfO 1 ORF, hypothetical protein 0.28*...”

ECs5164 hypothetical protein from Escherichia coli O157:H7 str. Sakai
Aligns to 39:95 / 95 (60.0%), covers 98.2% of PF07338, 68.7 bits

• Influence of Glucose Availability and CRP Acetylation on the Genome-Wide Transcriptional Response of Escherichia coli: Assessment by an Optimized Factorial Microarray Analysis
  Guebel, Frontiers in microbiology 2018
  • “...classes a set of four genes that codify periplasmic proteins with dodecin-like structure (ECs5165, ECs0884, ECs5164, ECs5175; FDR = 2.1 10 2 ) and another set of five genes which codify enzymes involved in L-arginine degradation ( astA [arginine N-succinyltransferase], astB [N-succinylarginine dihydrolase], astC [bifunctional enzyme...”
• Global transcriptional response of Escherichia coli O157:H7 to growth transitions in glucose minimal medium
  Bergholz, BMC microbiology 2007
  • “...rpmJ -2.03 1 ECs5067 O157 2.21 2 ECs4165 prlA -2.53 1 ECs5153 purA -2.06 1 ECs5164 yjfN 4.54 2 ECs5240 yjgR 2.24 2 ECs5192 cysQ 2.01 2 ECs5259 O157 -2.09 1 ECs5231 argI -3.29 1 ECs5354 rob 2.15 2 ECs5235 valS -2.58 1 ECs5360 yjjY 2.03...”

Z5795 orf, hypothetical protein from Escherichia coli O157:H7 EDL933
Aligns to 44:100 / 100 (57.0%), covers 98.2% of PF07338, 68.5 bits

• Disruption of rcsB by a duplicated sequence in a curli-producing Escherichia coli O157:H7 results in differential gene expression in relation to biofilm formation, stress responses and metabolism
  Sharma, BMC microbiology 2017
  • “...6.7E-09 yjdA Z5711 Putative DNA replication function +2.23 6.4E-06 yjcJ Z5712 Unknown +2.79 9.4E-05 yjfN Z5795 Unknown 2.58 8.0E-04 a Gene group/gene designations were selected from RAST Server [ 44 ] b Gene ID and known or predicted functions are based on the annotated sequence of...”

ECs0884 hypothetical protein from Escherichia coli O157:H7 str. Sakai
Z1027 orf, hypothetical protein from Escherichia coli O157:H7 EDL933
Aligns to 82:134 / 134 (39.6%), covers 100.0% of PF07338, 68.1 bits

• Influence of Glucose Availability and CRP Acetylation on the Genome-Wide Transcriptional Response of Escherichia coli: Assessment by an Optimized Factorial Microarray Analysis
  Guebel, Frontiers in microbiology 2018
  • “...significant classes a set of four genes that codify periplasmic proteins with dodecin-like structure (ECs5165, ECs0884, ECs5164, ECs5175; FDR = 2.1 10 2 ) and another set of five genes which codify enzymes involved in L-arginine degradation ( astA [arginine N-succinyltransferase], astB [N-succinylarginine dihydrolase], astC [bifunctional...”
• Comparison of strand-specific transcriptomes of enterohemorrhagic Escherichia coli O157:H7 EDL933 (EHEC) under eleven different environmental conditions including radish sprouts and cattle feces
  Landstorfer, BMC genomics 2014
  • “...(2) 1.5 (45) 2.5 (25) 0.9 (3) 1.7 (35) 1.7 (31) 6.6 (945) 3.3 (28) Z1027 ybiM , biofilm formation [ 44 ] radish 1 (17) 0.3 (8) 5.6 (0) 3.1 (1) 0.3 (12) 0.0 (4) 5.6 (0) 5.6 (0) 2.3 (2) 7.5 (1751) 5.6 (0)...”
  • “...LB medium (B1), minimal medium (B2), and on radish sprouts (B3). C1-C3: regulated hypothetical gene Z1027 (see Table 2 ), in LB medium (C1), minimal medium (C2), and on radish sprouts (C3). D1-D3: regulated hypothetical gene Z4396 (Table 2 ), in LB medium (D1), minimal medium...”
• Transcriptional responses of Escherichia coli K-12 and O157:H7 associated with lettuce leaves
  Fink, Applied and environmental microbiology 2012
  • “...expression Symbol Description Day 1 Day 3 Biofilm Z1027 Z1697 ybiM yceP (bssS) Hypothetical protein Hypothetical protein 31.30 7.90 68.30 7.90 Cell envelope...”

P0E69_02430 biofilm peroxide resistance protein BsmA from Chimaeribacter arupi
Aligns to 47:102 / 102 (54.9%), covers 100.0% of PF07338, 67.1 bits

• Chimaeribacter arupi a new member of the Yersineacea family has the characteristics of a human pathogen
  Riediger, Frontiers in cellular and infection microbiology 2023
  • “...thioredoxin reductases. In addition, we found two copies encoding the biofilm peroxide resistance protein BsmA (P0E69_02430 & P0E69_12140). This protein plays a role to resist acid and peroxide stress in biofilms and promotes microcolony formation, which precedes biofilm formation, by inhibiting flagellar motility ( Weber etal.,...”
  • “...P0E69_00230 sodA 48539..49162 superoxide dismutase [Mn 2+ ] P0E69_00440 ohrB 95354..95779 organic hydroperoxide resistance protein P0E69_02430 bmsA 512351..512659 biofilm peroxide resistance protein BsmA P0E69_02500 msrA 524986..525621 peptide-methionine (S)-S-oxide reductase MsrA P0E69_02540 yhcN 535610..535870 peroxide/acid stress response protein YhcN P0E69_02545 yhcN 536006..536269 peroxide/acid stress response protein YhcN...”

KPK_4095 hypothetical protein from Klebsiella pneumoniae 342
Aligns to 33:90 / 90 (64.4%), covers 100.0% of PF07338, 66.1 bits

• Structural and functional characterization of DUF1471 domains of Salmonella proteins SrfN, YdgH/SssB, and YahO
  Eletsky, PloS one 2014
  • “...hormaechei , HMPREF9086_0329, ZP_08496071 (65%); Eae, Enterobacter aerogenes EAE_13230, YP_004592839 (70%); Kpn, Klebsiella pneumonia , KPK_4095, YP_002239898 (68%); Pan, Pantoea sp., Pat9b_3745, YP_004117591 (61%). Notes: Other Salmonella, Klebsiella, and Enterobacter species and strains contain identical or nearly identical sequences to the representatives shown here. However, some...”

STY0860 putative exported protein from Salmonella enterica subsp. enterica serovar Typhi str. CT18
STM0823 putative periplasmic protein from Salmonella typhimurium LT2
Aligns to 34:86 / 86 (61.6%), covers 100.0% of PF07338, 65.2 bits

• Identification of in vivo-induced bacterial protein antigens during human infection with Salmonella enterica serovar Typhi
  Harris, Infection and immunity 2006
  • “...TcfB, and two antigens of unknown function encoded by STY0860 and STY3683. PagC is a virulence factor known to be upregulated in vivo in S. enterica serovar...”
  • “...of unknown function a pHCM1.176 pHMC1.257 pHCM2.0028 STY0860 STY1648 STY2156 STY2195 STY2761 STY3683 STY3684 TrhW--plasmid transfer protein, fimbrial regulation...”
• Effects of indole on drug resistance and virulence of Salmonella enterica serovar Typhimurium revealed by genome-wide analyses
  Nikaido, Gut pathogens 2012
  • “...Enterochelin synthetase, component D (phoshpantetheinyltransferase) 6.1 7.5 STM0707 kdpF Putative outer membrane protein 8.6 18 STM0823 ybiJ Putative periplasmic protein 3.2 11 STM1156 yceA Putative enzyme related to sulfurtransferases 4.3 8.0 STM1214 ycfR Putative outer membrane protein 4.6 37 STM1251 Putative molecular chaperone (small heat shock...”
• Transcriptomic responses of Salmonella enterica serovars Enteritidis and Typhimurium to chlorine-based oxidative stress
  Wang, Applied and environmental microbiology 2010
  • “...STM2544 yfhP Putative iron-sulfur cluster regulatory protein STM0823 ybiJ Putative periplasmic protein STM1214 ycfR Putative outer membrane protein STM2430 cysK...”

EAE_13230 DUF1471 domain-containing protein from Klebsiella aerogenes KCTC 2190
Aligns to 33:90 / 90 (64.4%), covers 100.0% of PF07338, 64.5 bits

• Structural and functional characterization of DUF1471 domains of Salmonella proteins SrfN, YdgH/SssB, and YahO
  Eletsky, PloS one 2014
  • “...rodentium , ROD_12311, YP_003364817 (80%); Eho, Enterobacter hormaechei , HMPREF9086_0329, ZP_08496071 (65%); Eae, Enterobacter aerogenes EAE_13230, YP_004592839 (70%); Kpn, Klebsiella pneumonia , KPK_4095, YP_002239898 (68%); Pan, Pantoea sp., Pat9b_3745, YP_004117591 (61%). Notes: Other Salmonella, Klebsiella, and Enterobacter species and strains contain identical or nearly identical sequences...”

KPN_00497 hypothetical protein from Klebsiella pneumoniae subsp. pneumoniae MGH 78578
A6T5S6 YdgH/BhsA/McbA-like domain-containing protein from Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Aligns to 33:90 / 90 (64.4%), covers 100.0% of PF07338, 64.3 bits

• Liquid Extraction Surface Analysis Mass Spectrometry of ESKAPE Pathogens
  Havlikova, Journal of the American Society for Mass Spectrometry 2021
  • “...pneumoniae KP257 resulted in identification of six proteins, two of which (DNA-binding protein HU- and KPN_00497) were identified in the previous analysis of the in vitro 3D skin models. 21 All six proteins were observed in both biological replicates. The same protein mutation R K at...”
• Direct identification of bacterial and human proteins from infected wounds in living 3D skin models
  Havlikova, Scientific reports 2020
  • “...3,034.6413 0.0066 -Hemolysin Q6G7S2 fMet, G10S substitution 88 48 K. pneumoniae KP257 7,698.9926 7,698.9638 3.7382 KPN_00497 A6T5S6 -Signal peptide (119), R49K substitution 19 48 9,471.1664 9,471.1468 2.0673 DNA-binding protein HU- A6TGQ7 30 48 P. aeruginosa PS1054 5,731.9826 5,731.9816 0.1814 PA0039 Q9I793 -Signal peptide (121) 13 48...”
  • “...KP257, two proteins were identified. Firstly, an uncharacterized protein predicted on the basis of gene KPN_00497 was identified. The protein was detected with a cleaved signal peptide (119) and a RK substitution at position 49. Secondly, DNA-binding protein HU-, which is involved in stabilization of DNA...”
• Direct identification of bacterial and human proteins from infected wounds in living 3D skin models
  Havlikova, Scientific reports 2020
  • “...0.0066 -Hemolysin Q6G7S2 fMet, G10S substitution 88 48 K. pneumoniae KP257 7,698.9926 7,698.9638 3.7382 KPN_00497 A6T5S6 -Signal peptide (119), R49K substitution 19 48 9,471.1664 9,471.1468 2.0673 DNA-binding protein HU- A6TGQ7 30 48 P. aeruginosa PS1054 5,731.9826 5,731.9816 0.1814 PA0039 Q9I793 -Signal peptide (121) 13 48 8,557.5098...”

ECs0880 hypothetical protein from Escherichia coli O157:H7 str. Sakai
Z1023 orf, hypothetical protein from Escherichia coli O157:H7 EDL933
Aligns to 34:86 / 86 (61.6%), covers 100.0% of PF07338, 64.1 bits

• Transcriptomic analysis of Escherichia coli O157:H7 and K-12 cultures exposed to inorganic and organic acids in stationary phase reveals acidulant- and strain-specific acid tolerance responses
  King, Applied and environmental microbiology 2010
  • “...ECs3081 b2190 ECs2359 ECs3396 ECs0128 ECs3328 ECs0503 ECs0880 ECs0927 ECs2042 b0802 b0847 b1438 b2530 b0124 b2466 b0449 ECs0512 ECs5566 ECs2316 ECs0252...”
• Comparison of strand-specific transcriptomes of enterohemorrhagic Escherichia coli O157:H7 EDL933 (EHEC) under eleven different environmental conditions including radish sprouts and cattle feces
  Landstorfer, BMC genomics 2014
  • “...(0) 4.6 (3) 0.0 (0) 0.0 (0) 0.0 (0) 3.3 (1) 5.7 (4) 0.0 (0) Z1023 ybiJ , biofilm formation [ 42 , 43 ] radish 1 (17) 0.2 (8) 0.2 (3) 2.6 (2) 1.5 (45) 2.5 (25) 0.9 (3) 1.7 (35) 1.7 (31) 6.6 (945)...”
  • “...found on the forward strand of this region. B1-B3: example for a regulated hypothetical gene, Z1023 (see Table 2 ), in LB medium (B1), minimal medium (B2), and on radish sprouts (B3). C1-C3: regulated hypothetical gene Z1027 (see Table 2 ), in LB medium (C1), minimal...”

YbiJ / b0802 DUF1471 domain-containing protein YbiJ from Escherichia coli K-12 substr. MG1655 (see 5 papers)
b0802 hypothetical protein from Escherichia coli str. K-12 substr. MG1655
P0AAX3 Uncharacterized protein YbiJ from Escherichia coli (strain K12)
ETEC_0869 DUF1471 family protein YbiJ from Escherichia coli ETEC H10407
Aligns to 34:86 / 86 (61.6%), covers 100.0% of PF07338, 63.9 bits

• Transcriptomic analysis of Escherichia coli O157:H7 and K-12 cultures exposed to inorganic and organic acids in stationary phase reveals acidulant- and strain-specific acid tolerance responses
  King, Applied and environmental microbiology 2010
  • “...ECs2359 ECs3396 ECs0128 ECs3328 ECs0503 ECs0880 ECs0927 ECs2042 b0802 b0847 b1438 b2530 b0124 b2466 b0449 ECs0512 ECs5566 ECs2316 ECs0252 b0459 b4458 b1610...”
• Global gene expression profiling of asymptomatic bacteriuria Escherichia coli during biofilm growth in human urine
  Hancock, Infection and immunity 2007
  • “...ybiJ ycfR yhcN ibpB bfd b3782 b3556 b3687 b4414 b2153 b0802 b1112 b3238 b3686 b3337 6,476 6,387 6,120 6,025 5,942 5,817 5,804 5,790 5,787 5,582 1.8 15.9 8.7 1.0...”
• Prominent roles of the NorR and Fur regulators in the Escherichia coli transcriptional response to reactive nitrogen species
  Mukhopadhyay, Proceedings of the National Academy of Sciences of the United States of America 2004
  • “...b2717 b0795 b1684 b0127 b4367 b2875 b3106 b4357 b2579 b0484 b3744 b4381 b3774 b0802 b2715 b1200 b1241 b1112 173 338 70 38 2 3 11 2 17 18 1 1 6 5 2 1 15 2 6 7...”
• Biodistribution of ⁸⁹Zr-DFO-labeled avian pathogenic Escherichia coli outer membrane vesicles by PET imaging in chickens
  Li, Poultry science 2023
  • “...8 P0AEQ3 GLNH Function unknown Periplasm 9 P09394 GLPQ Energy production and conversion Periplasm 10 P0AAX3 YBIJ Function unknown Periplasm 11 P0AES9 HDEA Function unknown Periplasm 12 P02925 RBSB Carbohydrate transport and metabolism Periplasm 13 P0A862 TPX Posttranslational modification, protein turnover, chaperones Periplasm 14 P64534 RCNB...”
• The molecular basis for control of ETEC enterotoxin expression in response to environment and host
  Haycocks, PLoS pathogens 2015
  • “...C GT T A CCCTTG TC G CA ETEC_0680 rihA 941002 TGTGA TGAGTA TCAC G ETEC_0869 ybiJ 958866 TGTGT ACGAAA TCACA ETEC_0886/ETEC_0887 ybiS/ybiT 1128472 n.d. ( ETEC_1030 ) ( yccS ) 1205350 A GTGA TGTAGA TCACA ETEC_1101 ycgZ TG A GA TCGAGCA CACA 1263558 T T...”

Ent638_3824 protein of unknown function DUF1471 from Enterobacter sp. 638
Aligns to 36:89 / 89 (60.7%), covers 100.0% of PF07338, 62.9 bits

• Entericidin is required for a probiotic treatment (Enterobacter sp. strain C6-6) to protect trout from cold-water disease challenge
  Schubiger, Applied and environmental microbiology 2015
  • “...three hypothetical proteins (Ent638_0594, Ent638_3274, and Ent638_3824), an lpp repeatcontaining protein, and an entericidin B membrane lipoprotein. The...”

KP1_0467 hypothetical protein from Klebsiella pneumoniae NTUH-K2044
Aligns to 35:91 / 91 (62.6%), covers 98.2% of PF07338, 62.6 bits

• Reduced virulence in tigecycline-resistant Klebsiella pneumoniae caused by overexpression of ompR and down-regulation of ompK35
  Park, Journal of biomedical science 2023
  • “...200-IR) Locus_tag Product Fold change RPKM Fold change RPKM 109 109-IR 200 200-IR Up-regulated genes KP1_0467 DUF1471 domain-containing protein 100.860 8.556 958.148 36.543 13.677 625.192 KP1_0570 NAD(P)-dependent alcohol dehydrogenase 222.995 42.385 5534.362 185.672 29.898 4663.129 KP1_1491 MBL fold metallo-hydrolase 244.571 14.271 2441.961 131.245 17.950 2404.509 KP1_1492...”

SBG_0068 DUF1471 family virulence protein SrfN from Salmonella bongori NCTC 12419
Aligns to 35:92 / 96 (60.4%), covers 100.0% of PF07338, 61.4 bits

• Structural and functional characterization of DUF1471 domains of Salmonella proteins SrfN, YdgH/SssB, and YahO
  Eletsky, PloS one 2014
  • “...Salmonella enterica Typhimurium, STM0082 (SrfN), NP_459087 and many other Salmonella strains; Sbo, Salmonella bongori , SBG_0068, YP_004728986 (93%); Cro, Citrobacter rodentium , ROD_12311, YP_003364817 (80%); Eho, Enterobacter hormaechei , HMPREF9086_0329, ZP_08496071 (65%); Eae, Enterobacter aerogenes EAE_13230, YP_004592839 (70%); Kpn, Klebsiella pneumonia , KPK_4095, YP_002239898 (68%); Pan,...”

Q8GHK9 DUF1471 domain-containing protein from Serratia marcescens
Aligns to 38:91 / 94 (57.4%), covers 100.0% of PF07338, 61.0 bits

• Vanillic acid from Actinidia deliciosa impedes virulence in Serratia marcescens by affecting S-layer, flagellin and fatty acid biosynthesis proteins
  Sethupathy, Scientific reports 2017
  • “...0.001 3094 90 2 H9XP47 2,3- butanediol dehydrogenase (budC) SM11 2.84 0.000 140 70 2 Q8GHK9 Multiple stress resistant protein (bhSA) SM13 2.70 0.001 694 78 1 A0A0N2A3T4 Putative oxidoreductase SM14 2.59 0.001 6159 94 19 A0A0N7JPV5 Flagellin SM15 2.57 0.010 297 77 2 A0A0P0QGJ0 Long...”

STY0398 probable secreted protein from Salmonella enterica subsp. enterica serovar Typhi str. CT18
STM0366 putative periplasmic protein from Salmonella typhimurium LT2
SENTW_0348, STM14_0428 DUF1471 family periplasmic protein YahO from Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S
Aligns to 37:89 / 91 (58.2%), covers 100.0% of PF07338, 60.7 bits

• Transcriptomic study of Salmonella enterica subspecies enterica serovar Typhi biofilm
  Chin, BMC genomics 2017
  • “...5.00E-05 0.001837 yiiU FtsZ stabilizer 2.10309 5.00E-05 0.001837 cspB Cold shock protein 2.18312 5.00E-05 0.001837 STY0398 Propionate catabolism operon regulatory protein 2.29804 5.00E-05 0.001837 STY0788 Hypothetical protein 2.35255 5.00E-05 0.001837 osmE Osmotically inducible lipoprotein E 2.36034 5.00E-05 0.001837 tatE Sec-independent protein translocase protein TatE 2.41698 5.00E-05...”
• Structural and functional characterization of DUF1471 domains of Salmonella proteins SrfN, YdgH/SssB, and YahO
  Eletsky, PloS one 2014
  • “...and even lower similarity to other DUF1471 sequences apart from SssB. The Salmonella protein YahO (STM0366) from DUF1471 has not been characterized prior to the work presented here. YahO occurs in Salmonella, Escherichia , and numerous other genera from the Enterobacteriaceae. The yahO gene was identified...”
  • “...the PSI Materials Repository ( http://psimr.asu.edu/ ). The sequence of YahO from Salmonella Typhimurium LT2 (STM0366) is identical to SC0077. The plasmids were transformed separately into E. coli BL21(DE3) pMgK cells and cultured in MJ9 medium [30] containing 2 g/L [ U - 13 C]-glucose and...”
• Global transcriptional analysis of dehydrated Salmonella enterica serovar Typhimurium
  Gruzdev, Applied and environmental microbiology 2012
  • “...aceK (STM4185) phoH (STM1126) minE (STM1816) yahO (STM0366) ybeL (STM0653) tke1 (STM_sRNA) STM1731 Putative acetyl coenzyme A synthetase 2-Methylcitrate...”
• Intraspecies variation in the emergence of hyperinfectious bacterial strains in nature
  Heithoff, PLoS pathogens 2012
  • “...[95] . STM1602 sifB 1.47 0.56 0.68 SPI-2 effector; translocated to macrophage cytoplasm [146] . STM0366 yahO 1.22 0.43 1.13 Modification of cell envelope [147] . STM0614 ybdQ 1.46 0.37 0.09 Universal stress protein [144] . PhoB/PhoR STM4287 phnO 0.16 1.43 0.96 Regulator of phosphocarbonate breakdown...”
• Quantitative mass spectrometry catalogues Salmonella pathogenicity island-2 effectors and identifies their cognate host binding partners
  Auweter, The Journal of biological chemistry 2011
  • “...STM2817 STM2444 STM2287 STM2780 STM1263 STM0781 STM3053 STM1119 STM1891 STM4561 STM1033 STM0366 STM1088 STM2892 11 5 4 9 9 14 26 6 4 10 13 14 3 12 2 3 9 8...”
• Quantitative proteomic analysis of the Salmonella-lettuce interaction
  Zhang, Microbial biotechnology 2014
  • “...1.7E-02 1 Putative type II restriction enzyme methylase subunit D0ZU54 5.5 2.2E-03 1 Hypothetical protein STM14_0428 D0ZM36 yahO 5.7 1.9E-02 2 Hypothetical protein STM14_0454 D0ZM62 psiF 3.9 7.5E-04 4 Putative cytoplasmic protein D0ZVJ6 14.0 1.0E-04 2 Hypothetical protein STM14_1588 D0ZW41 spy 5.4 2.8E-02 3 Putative cytoplasmic...”
• Transcriptional profile of Salmonella enterica subsp. enterica serovar Weltevreden during alfalfa sprout colonization
  Brankatschk, Microbial biotechnology 2014
  • “...protein SENTW_0384 3.95 Hypothetical protein sopD SENTW_0915 13.24 Homologous to secreted protein SopD (T3SS) yahO SENTW_0348 4.40 Protein of unknown function yebV SENTW_1340 15.38 Uncharacterized protein yiaK SENTW_3767 9.61 Putative protein yciF SENTW_1469 11.99 Unknown function ygaT (csiD) SENTW_2877 19.85 Hypothetical protein tctA SENTW_2876 10.62 Unknown...”

BHU62_12635 YdgH/BhsA/McbA-like domain containing protein from Serratia marcescens
Aligns to 38:91 / 94 (57.4%), covers 100.0% of PF07338, 60.3 bits

• Microbial Reduction of Fumonisin B1 by the New Isolate Serratia marcescens 329-2
  Keawmanee, Toxins 2021
  • “...Stringent starvation protein A sspA 3.09 A0A6M5HTX8 Uncharacterized protein HMI62_14785 3.08 A0A1Q4NZT3 DUF1471 domain-containing protein BHU62_12635 3.03 A0A086FJA0 50S ribosomal protein L9 rplI 3.02 toxins-13-00638-t004_Table 4 Table 4 Identification of the downregulated proteins (<0.50-fold change) in FB1-treated S. marcescens 329-2 compared with the control group. Entry...”

NP_459087 putative secreted protein from Salmonella enterica subsp. enterica serovar Typhimurium str. LT2
STM0082 putative secreted protein from Salmonella typhimurium LT2
SEN0084 probable secreted protein from Salmonella enterica subsp. enterica serovar Enteritidis str. P125109
SL1344_0083 DUF1471 family virulence protein SrfN from Salmonella enterica subsp. enterica serovar Typhimurium str. SL1344
Aligns to 35:92 / 96 (60.4%), covers 98.2% of PF07338, 59.5 bits

• Structural and functional characterization of DUF1471 domains of Salmonella proteins SrfN, YdgH/SssB, and YahO
  Eletsky, PloS one 2014
  • “...to SrfN, excluding the signal sequence, are as follows: Sty, Salmonella enterica Typhimurium, STM0082 (SrfN), NP_459087 and many other Salmonella strains; Sbo, Salmonella bongori , SBG_0068, YP_004728986 (93%); Cro, Citrobacter rodentium , ROD_12311, YP_003364817 (80%); Eho, Enterobacter hormaechei , HMPREF9086_0329, ZP_08496071 (65%); Eae, Enterobacter aerogenes EAE_13230,...”
• Salmonella Establishment in Agricultural Soil and Colonization of Crop Plants Depend on Soil Type and Plant Species
  Jechalke, Frontiers in microbiology 2019
  • “...expression of genes associated with infection and host-pathogen interaction was increased ( feoB , STM1808, STM0082), as well as genes associated with biofilm formation ( yaiC, luxS ). Interestingly, sulA , which is associated with filamentation and downregulation of SPI-1 as well as celC , encoding...”
  • “...growth of Salmonella during systemic infection of mice ( Karlinsey et al., 2012 ) and STM0082, also referred to as gene srfN , which was reported for S. enterica to be important for intra-host fitness even though, the exact function of this gene is not known...”
• The RNA Complement of Outer Membrane Vesicles From Salmonella enterica Serovar Typhimurium Under Distinct Culture Conditions
  Malabirade, Frontiers in microbiology 2018
  • “...the stable presence of transcripts of T3SS-independent effectors such as ydgH (or sssB ) and STM0082 (or srfN ) ( Eletsky et al., 2014 ). No enrichment of T3SS-independent effectors was observed in OMVs isolated from SPI-2ind conditions even though their intracellular expression is increased in...”
• InvS Coordinates Expression of PrgH and FimZ and Is Required for Invasion of Epithelial Cells by Salmonella enterica serovar Typhimurium
  Wang, Journal of bacteriology 2017
  • “...derived from the 3= untranslated region (UTR) of srfN (STM0082) (8). A Northern blot analysis confirmed the size of InvS and that it is cotranscribed with srfN...”
  • “...that InvS sRNA is encoded in the 3= UTR of STM0082. For this, we tested whether the overexpression of these regulators would rescue the invasion defect of the...”
• Temporal Regulation of a Salmonella Typhimurium Virulence Factor by the Transcriptional Regulator YdcR
  Liu, Molecular & cellular proteomics : MCP 2017
  • “...volcano plot the only protein near YdcR is SrfN (STM0082), indicating its marked repression in the ydcR strain. Furthermore, like YdcR, SrfN was not detected in...”
  • “...strain at 18 hpi Gene Protein description ydcR STM0082 nupC cysN STM2234 pipB yfgC frdB Putative GntR family regulatory protein Putative secreted protein NUP...”
• The Impact of 18 Ancestral and Horizontally-Acquired Regulatory Proteins upon the Transcriptome and sRNA Landscape of Salmonella enterica serovar Typhimurium
  Colgan, PLoS genetics 2016
  • “...< > 0.89 - c STnc3090 oadG STM0057 < > < 0.87 - STnc470 (InvS) STM0082 STM0081 > < < 0.85 - STnc3020 prgJ prgH as to prgI 0.84 Yes STnc3180 ybdO dsbG < > < 0.83 - PinT STM4310 STM4312 > > < 0.82 -...”
• Global analysis of Salmonella alternative sigma factor E on protein translation
  Li, Journal of proteome research 2015
  • “...were verified by Western blot analysis of the relative protein levels of CspA and SrfN (STM0082) in the three growth conditions studied ( Figure 2A,C ). By using chromosomal HA-tagged fusion proteins, we found that CspA expression was significantly higher in the rpoE strain compared to...”
• Structural and functional characterization of DUF1471 domains of Salmonella proteins SrfN, YdgH/SssB, and YahO
  Eletsky, PloS one 2014
  • “...and similarity to SrfN, excluding the signal sequence, are as follows: Sty, Salmonella enterica Typhimurium, STM0082 (SrfN), NP_459087 and many other Salmonella strains; Sbo, Salmonella bongori , SBG_0068, YP_004728986 (93%); Cro, Citrobacter rodentium , ROD_12311, YP_003364817 (80%); Eho, Enterobacter hormaechei , HMPREF9086_0329, ZP_08496071 (65%); Eae, Enterobacter...”
  • “...some Pantoea species do not contain homologues that fall within this DUF1471 subfamily. The SrfN (STM0082 in S . Typhimurium LT2) protein is one of a few DUF1471 paralogues for which limited experimental data has provided some clues to the function. SrfN has close homologues in...”
• Mixed-isotope labeling with LC-IMS-MS for characterization of protein-protein interactions by chemical cross-linking
  Merkley, Journal of the American Society for Mass Spectrometry 2013
  • “...for providing the plasmid construct for expressing SrfN/ STM0082 and the mixture of unlabeled and 13C,15N-labeled SO_2176, Dr. Sam Payne and Dr. Gordon Slysz...”
• More
• Genetic diversity and evolution of Salmonella enterica serovar Enteritidis strains with different phage types
  Zheng, Journal of clinical microbiology 2014
  • “...to KF449715 for the intergenic sequence (IGS) between SEN0084 and SEN0085, KF449716 to KF449813 for SEN0629, KF449814 to KF449911 for SEN0999-SEN1000, KF449912...”
• A global data-driven census of Salmonella small proteins and their potential functions in bacterial virulence
  Venturini, microLife 2020
  • “...a divergent role between the two organisms. Two peaks were detected for the hypothetical protein SL1344_0083 (one in the low molecular weight fractions and one partially overlapping that of RNAP), suggesting that only a fraction of the SL1344_0083 proteins in a cell are engaged in stable...”

SC0077 putative secreted protein from Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67
Aligns to 35:92 / 96 (60.4%), covers 98.2% of PF07338, 59.5 bits

• Structural and functional characterization of DUF1471 domains of Salmonella proteins SrfN, YdgH/SssB, and YahO
  Eletsky, PloS one 2014
  • “...which has described previously [29] . Briefly, the coding sequences of the STM0082 (SrfN) and SC0077 (YahO) genes of Salmonella enterica serovars Typhimurium LT2 and Choleraesuis, respectively, were cloned into vector pET21_NESG coding for a C-terminal affinity tag (LEHHHHHH) to yield the plasmids StR109-21.1 and StR106-21.1....”
  • “...( http://psimr.asu.edu/ ). The sequence of YahO from Salmonella Typhimurium LT2 (STM0366) is identical to SC0077. The plasmids were transformed separately into E. coli BL21(DE3) pMgK cells and cultured in MJ9 medium [30] containing 2 g/L [ U - 13 C]-glucose and 1 g/L [ U...”

EAM_RS11745 DUF1471 domain-containing protein from Erwinia amylovora ATCC 49946
Aligns to 35:91 / 91 (62.6%), covers 100.0% of PF07338, 58.7 bits

• A complete twelve-gene deletion null mutant reveals that cyclic di-GMP is a global regulator of phase-transition and host colonization in Erwinia amylovora
  Kharadi, PLoS pathogens 2022
  • “...symporter CDS dicarboxylate/amino acid:cation symporter -10.81381354 5.2721E-119 EAM_RS19445 hypothetical protein CDS hypothetical protein -7.950021219 9.05238E-26 EAM_RS11745 DUF1471 domain-containing protein CDS DUF1471 domain-containing protein -5.590416774 3.0468E-177 EAM_RS16620 hmsP CDS biofilm formation regulator HmsP -5.50909201 4.6447E-238 EAM_RS05505 amino acid ABC transporter substrate-binding protein CDS amino acid ABC transporter...”

YjfO / b4189 DUF1471 domain-containing putative lipoprotein BsmA from Escherichia coli K-12 substr. MG1655 (see 4 papers)
BSMA_ECOLI / P39297 Lipoprotein BsmA; Biofilm stress and motility protein from Escherichia coli (strain K12) (see paper)
b4189 orf, hypothetical protein from Escherichia coli str. K-12 substr. MG1655
NP_418610 DUF1471 domain-containing putative lipoprotein BsmA from Escherichia coli str. K-12 substr. MG1655
Aligns to 53:108 / 109 (51.4%), covers 100.0% of PF07338, 58.3 bits

• function: Involved in protection of biofilms against oxidative stress.
  disruption phenotype: Mutant exhibits reduced microcolony formation and greatly enhanced flagellar motility. Biofilms from the mutant strain are less able to resist acid and peroxide stresses.
• A previously uncharacterized gene, yjfO (bsmA), influences Escherichia coli biofilm formation and stress response
  Weber, Microbiology (Reading, England) 2010
  • “...the present study, we observed the uncharacterized gene yjfO (b4189) to be upregulated. This same gene has been found to be upregulated in at least two previous...”
• Genome-wide analysis of lipoprotein expression in Escherichia coli MG1655
  Brokx, Journal of bacteriology 2004
  • “...b2809 b2813 b2833 b2865 b2963 b3150 b3163 b3267 b3369 b3661 b4149 b4189 b4288 1,177.4 P 2,142.5 P 75 P 45.55 P 48.6 P 107.7 P 136.6 P 126.4 P 172.1 P 587.4...”
• DNA microarray analyses of the long-term adaptive response of Escherichia coli to acetate and propionate
  Polen, Applied and environmental microbiology 2003
  • “...b4188 yjfN 1 ORF, hypothetical protein 0.39* 0.50 0.67 b4189 yjfO 1 ORF, hypothetical protein 0.28* 0.40* 0.88 b4239 b4240 treC treB 1 1 Trehalase-6-phosphate...”
• Combined, functional genomic-biochemical approach to intermediary metabolism: interaction of acivicin, a glutamine amidotransferase inhibitor, with Escherichia coli K-12
  Smulski, Journal of bacteriology 2001
  • “...b3923 b3928 b3937 b3995 b4030 b4126 b4127 b4135 b4178 b4189 b4199 b4206 b4234 b4255 b4311 b4325 b4326 b2300 b2302 b2303 b2442 b2529 b2530 b2597 b2664 b2665...”
  • “...b3861 b3875 b3923 b3928 b3937 b3995 b4030 b4126 b4127 b4135 b4178 b4189 b4199 b4206 b4234 b4255 b4311 b4325 b4326 3.2 3.6 2.8 2.2 2.1 2.7 23.6 3.2 4.7 2.6 2.1...”
• A previously uncharacterized gene, yjfO (bsmA), influences Escherichia coli biofilm formation and stress response.
  Weber, Microbiology (Reading, England) 2010
  • GeneRIF: yjfO mutants are altered in biofilm structure and cell motility, and in their ability as biofilms to respond to pH and oxidative stresses.

ROD_12311 hypothetical protein from Citrobacter rodentium ICC168
Aligns to 51:108 / 112 (51.8%), covers 98.2% of PF07338, 58.2 bits

• Structural and functional characterization of DUF1471 domains of Salmonella proteins SrfN, YdgH/SssB, and YahO
  Eletsky, PloS one 2014
  • “...many other Salmonella strains; Sbo, Salmonella bongori , SBG_0068, YP_004728986 (93%); Cro, Citrobacter rodentium , ROD_12311, YP_003364817 (80%); Eho, Enterobacter hormaechei , HMPREF9086_0329, ZP_08496071 (65%); Eae, Enterobacter aerogenes EAE_13230, YP_004592839 (70%); Kpn, Klebsiella pneumonia , KPK_4095, YP_002239898 (68%); Pan, Pantoea sp., Pat9b_3745, YP_004117591 (61%). Notes: Other...”

SEN4145 hypothetical protein from Salmonella enterica subsp. enterica serovar Enteritidis str. P125109
Aligns to 53:108 / 109 (51.4%), covers 100.0% of PF07338, 57.2 bits

• Genome-wide fitness analysis identifies genes required for in vitro growth and macrophage infection by African and global epidemic pathovariants of Salmonella enterica Enteritidis
  Fong, Microbial genomics 2023
  • “...yjfI Conserved hypothetical protein D7795_04792 SEN4136 P125109_04696 STMMW_43141 STM4370 1.59 yjfO Putative exported protein D7795_04801 SEN4145 P125109_04705 STMMW_43231 STM4379 1.24 pepA Cytosol aminopeptidase D7795_04888 SEN4230 P125109_04792 STMMW_44231 STM4477 1.03 repA2 CDO50996.1 D7795_05036 SEN_p0018 P125109_04939 SLT-BT0121 PSLT023 1.97 pefB CDO50994.1 D7795_05038 SEN_p0016 P125109_04941 SLT-BT0111 PSLT019 1.30 traY...”
• Genome-wide fitness analysis identifies genes required for in vitro growth and macrophage infection by African and Global Epidemic pathovariants of Salmonella Enteritidis
  Fong, 2022

STM0565 putative periplasmic protein from Salmonella typhimurium LT2
Aligns to 25:78 / 78 (69.2%), covers 100.0% of PF07338, 57.2 bits

• Exposure to sub-inhibitory concentrations of cefotaxime enhances the systemic colonization of Salmonella Typhimurium in BALB/c mice
  Molina-Quiroz, Open biology 2015
  • “...23S rRNA pseudouridylate synthase STM0765 putative cation transporter STM3833 putative mandelate racemase/muconate lactonizing enzyme family STM0565 putative periplasmic protein STM1931 araH putative intracellular protease/amidase 3.4. Exposure to a sub-inhibitory concentration of cefotaxime during aerobic growth induces a switch to anaerobic metabolism Our genetic screen suggested a...”
• Salmonella enterica virulence genes are required for bacterial attachment to plant tissue
  Barak, Applied and environmental microbiology 2005
  • “...Membraneassociated proteins gtrB STM0278 STM3650 STM0565 stcC STM3832 Glycosyl transferase Periplasmic* Periplasmic* Periplasmic* Outer membrane* Membrane...”

STM4379 putative lipoprotein from Salmonella typhimurium LT2
SENTW_4482, STMMW_43231 biofilm peroxide resistance protein BsmA from Salmonella enterica subsp. enterica serovar Weltevreden str.
Aligns to 53:108 / 109 (51.4%), covers 100.0% of PF07338, 57.2 bits

• Genome-wide fitness analysis identifies genes required for in vitro growth and macrophage infection by African and global epidemic pathovariants of Salmonella enterica Enteritidis
  Fong, Microbial genomics 2023
  • “...protein D7795_04792 SEN4136 P125109_04696 STMMW_43141 STM4370 1.59 yjfO Putative exported protein D7795_04801 SEN4145 P125109_04705 STMMW_43231 STM4379 1.24 pepA Cytosol aminopeptidase D7795_04888 SEN4230 P125109_04792 STMMW_44231 STM4477 1.03 repA2 CDO50996.1 D7795_05036 SEN_p0018 P125109_04939 SLT-BT0121 PSLT023 1.97 pefB CDO50994.1 D7795_05038 SEN_p0016 P125109_04941 SLT-BT0111 PSLT019 1.30 traY CDO51040.1 D7795_05058 SEN_p0063...”
• Genome-wide fitness analysis identifies genes required for in vitro growth and macrophage infection by African and Global Epidemic pathovariants of Salmonella Enteritidis
  Fong, 2022
• Genome-wide fitness analysis identifies genes required for in vitro growth and macrophage infection by African and global epidemic pathovariants of Salmonella enterica Enteritidis
  Fong, Microbial genomics 2023
  • “...hypothetical protein D7795_04792 SEN4136 P125109_04696 STMMW_43141 STM4370 1.59 yjfO Putative exported protein D7795_04801 SEN4145 P125109_04705 STMMW_43231 STM4379 1.24 pepA Cytosol aminopeptidase D7795_04888 SEN4230 P125109_04792 STMMW_44231 STM4477 1.03 repA2 CDO50996.1 D7795_05036 SEN_p0018 P125109_04939 SLT-BT0121 PSLT023 1.97 pefB CDO50994.1 D7795_05038 SEN_p0016 P125109_04941 SLT-BT0111 PSLT019 1.30 traY CDO51040.1 D7795_05058...”
• Transcriptional profile of Salmonella enterica subsp. enterica serovar Weltevreden during alfalfa sprout colonization
  Brankatschk, Microbial biotechnology 2014
  • “...Glycerol uptake facilitator protein glpQ SENTW_2410 6.15 Glycerophosphodiester phosphodiesterase cdh1 SENTW_4154 4.81 CDP-diacylglycerol pyrophosphatase yjfO SENTW_4482 13.03 Lipoprotein ybaY SENTW_0451 6.20 Uncharacterized lipoprotein Fatty acid metabolism fadB SENTW_4073 6.14 Enoyl-CoA hydratase fadA SENTW_4072 4.47 Small (beta) subunit of the fatty acid-oxidizing multienzyme complex Post-transcriptional modification queA...”

SC0602 putative periplasmic protein from Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67
SEN0541 hypothetical secreted protein from Salmonella enterica subsp. enterica serovar Enteritidis str. P125109
Aligns to 25:78 / 78 (69.2%), covers 100.0% of PF07338, 57.2 bits

• The addition of lac+ chromosome fragments to the E. coli proA-proB-lac deletion 13 chromosome
  Stodolsky, Genetics 1972
  • “...develop on minimal agar. Transduction of the recombination-deficient recipient SC0602 A l l l recAl has not been detected. For m.0.i. of less than one, the...”
  • “...A l l l CA7033 A l l 1 SCO905 A l l 1 pro-l+ SC0602 A l l l recA1 SC0905 A l l 1 pro-l+ sCO905 A111 pro-l+ SCO905 A l l 1 pro-l+ SC0905 A l l 1 pro-l+ CA7033...”
• Transcriptional Profiling and Molecular Characterization of the yccT Mutant Link: A Novel STY1099 Protein with the Peroxide Stress Response and Cell Division of Salmonella enterica Serovar Enteritidis
  Vidovic, Biology 2019
  • “...of the 22 genes, 13 genes ( narGHIJK , hycDF , dmsA3 , rrmJ , SEN0541, SEN1163, SEN1249 and SEN3184) were unique to the oxidative response, and nine genes ( citEFT , kdgT , nirC , yccT , SEN0167, SEN0271 and SEN0992) of the oxidative stimulon...”
  • “...was a group of genes that encodes proteins of unknown function (SEN0167, SEN0271, SEN1163 and SEN0541). To investigate how the yccT gene deletion specifically affected the physiology of growing cells, we compared the transcriptomes of exponentially growing culture of the yccT mutant to that of the...”

ECs5165 hypothetical protein from Escherichia coli O157:H7 str. Sakai
Aligns to 53:108 / 109 (51.4%), covers 100.0% of PF07338, 57.0 bits

• Influence of Glucose Availability and CRP Acetylation on the Genome-Wide Transcriptional Response of Escherichia coli: Assessment by an Optimized Factorial Microarray Analysis
  Guebel, Frontiers in microbiology 2018
  • “...as significant classes a set of four genes that codify periplasmic proteins with dodecin-like structure (ECs5165, ECs0884, ECs5164, ECs5175; FDR = 2.1 10 2 ) and another set of five genes which codify enzymes involved in L-arginine degradation ( astA [arginine N-succinyltransferase], astB [N-succinylarginine dihydrolase], astC...”
• Whole-Transcriptome Analysis of Verocytotoxigenic Escherichia coli O157:H7 (Sakai) Suggests Plant-Species-Specific Metabolic Responses on Exposure to Spinach and Lettuce Extracts
  Crozier, Frontiers in microbiology 2016
  • “...NS NS 4.87 ECs4976 x x Galactidol-1-phosphatol dehydrogenase, Citrobacter rodentium (92) NS NS NS 7.13 ECs5165 Biofilm stress and motility protein A, Shigella flexneri Shi06HN006 (99) -6.01 60.15 NS -7.03 Homologs in E. coli K-12 strain MG1655 and O157:H7 isolate EDL933 are indicated by or x...”
• In vitro transcription profiling of the σS subunit of bacterial RNA polymerase: re-definition of the σS regulon and identification of σS-specific promoter sequence elements
  Maciag, Nucleic acids research 2011
  • “...yddM ) N.A. 1.71 c0703 Unknown, annotated in CFT073 (antisense of citF ) N.A. 1.74 ECs5165 yjfO (biofilm-related protein) in O157:H7 SAKAI N.A. 1.86 IG1903284_1903567-r Intergenic region downstream of yobD , transcribed in opposite direction N.A. 1.87 IG3358642_3358810-f Intergenic region downstream of gltD N.A. 1.89 IG2190243_2190534-r...”

UTI89_C4789 hypothetical protein from Escherichia coli UTI89
Aligns to 86:141 / 142 (39.4%), covers 100.0% of PF07338, 56.2 bits

• Plasmid parB contributes to uropathogenic Escherichia coli colonization in vivo by acting on biofilm formation and global gene regulation
  Song, Frontiers in molecular biosciences 2022 (no snippet)

y0640 hypothetical protein from Yersinia pestis KIM
Aligns to 48:103 / 103 (54.4%), covers 100.0% of PF07338, 55.9 bits

• Role of the PhoP-PhoQ gene regulatory system in adaptation of Yersinia pestis to environmental stress in the flea digestive tract
  Vadyvaloo, Microbiology (Reading, England) 2015
  • “...1998 ). The Y. pestis KIM6+ genome contained five YhcN protein family genes (y1667, y0666, y0640, y3909 and y2136) that encoded predicted proteins of 86, 87, 53, 92 and 317 amino acids, respectively. In E. coli , four of the 10 YhcN family proteins were shown...”

Pat9b_3745 DUF1471 domain-containing protein from Pantoea sp. At-9b
Aligns to 33:90 / 90 (64.4%), covers 100.0% of PF07338, 54.1 bits

• Structural and functional characterization of DUF1471 domains of Salmonella proteins SrfN, YdgH/SssB, and YahO
  Eletsky, PloS one 2014
  • “...Enterobacter aerogenes EAE_13230, YP_004592839 (70%); Kpn, Klebsiella pneumonia , KPK_4095, YP_002239898 (68%); Pan, Pantoea sp., Pat9b_3745, YP_004117591 (61%). Notes: Other Salmonella, Klebsiella, and Enterobacter species and strains contain identical or nearly identical sequences to the representatives shown here. However, some Pantoea species do not contain homologues...”

B2G73_RS15900 biofilm peroxide resistance protein BsmA from Citrobacter werkmanii
Aligns to 53:108 / 109 (51.4%), covers 100.0% of PF07338, 53.0 bits

• Expression of a Shiga-Like Toxin during Plastic Colonization by Two Multidrug-Resistant Bacteria, Aeromonas hydrophila RIT668 and Citrobacter freundii RIT669, Isolated from Endangered Turtles (Clemmys guttata)
  Thomas, Microorganisms 2020
  • “...(53) T m C KC489166 16S RNA 16S ribosomal RNA (house-keeping gene) TTACCTACTCTTGACATC 55.0 GACTTAACCCAACATTTC B2G73_RS15900 bsmA biofilm peroxide resistance protein TAATGGGTTACAGCGAATAG 53.1 ATAAGACCACATAATAATCAGC 50.6 B2G73_RS10300 bssR biofilm formation regulatory protein CGCTTATCTGCTGTTGAG 52.9 ATACCGTGAAGTTGTGATTG 53.5 B2G73_RS09175 bssS biofilm formation regulatory protein GGACTGAAGTTGGACAAA 51.5 CGCTGATACTCATTTACCT 50.3 B2G73_RS19460...”

LV106 hypothetical protein from Klebsiella pneumoniae
Aligns to 34:86 / 86 (61.6%), covers 96.4% of PF07338, 52.8 bits

• Comparison of paenibacillus azotofixans strains isolated from rhizoplane, rhizosphere, and non-root-associated soil from maize planted in two different brazilian soils
  Seldin, Applied and environmental microbiology 1998
  • “...MRV100, MRV105, MRV106, MRV108, MRV111, MRV117 PV104, LV106, LV107, LV114, LV115, CRiP103, CRiP104, CRiP105, CRiP115, CRiP125, CRiP126, CRiP127, CRiP128,...”
  • “...MSV55, MSV63, MSV66, MSV68, LV53, LV56, MSV108, LV106, MRV153, MRV154, MRV156, CRiP21, CRiL56, CSM56, CRiP57, CSM116, CRiL151, CRiP165 LV107, LV115, PV104,...”

P0E69_12140 biofilm peroxide resistance protein BsmA from Chimaeribacter arupi
Aligns to 47:102 / 102 (54.9%), covers 100.0% of PF07338, 52.5 bits

• Chimaeribacter arupi a new member of the Yersineacea family has the characteristics of a human pathogen
  Riediger, Frontiers in cellular and infection microbiology 2023
  • “...In addition, we found two copies encoding the biofilm peroxide resistance protein BsmA (P0E69_02430 & P0E69_12140). This protein plays a role to resist acid and peroxide stress in biofilms and promotes microcolony formation, which precedes biofilm formation, by inhibiting flagellar motility ( Weber etal., 2010 )....”
  • “...2184435..2184938 thiol peroxidase P0E69_11445 sodC 2519256..2519777 superoxide dismutase [Cu-Zn] SodC P0E69_11665 2562846..2563397 glutathione peroxidase/thioredoxin peroxidase P0E69_12140 bsmA 2656927..2657235 biofilm peroxide resistance protein BsmA P0E69_13125 trxB 2861489..2862463 thioredoxin-disulfide reductase P0E69_15240 3311777..3312379 peroxiredoxin C P0E69_15980 trxC 3464961..3465389 thioredoxin TrxC P0E69_17060 yaaA 3715309..3716082 peroxide stress protein YaaA P0E69_19075 trxA...”

EDL933_0387 DUF1471 family periplasmic protein YahO from Escherichia coli O157:H7 str. EDL933
ECs0383 hypothetical protein from Escherichia coli O157:H7 str. Sakai
Aligns to 37:89 / 91 (58.2%), covers 100.0% of PF07338, 51.8 bits

• Overexpressed Proteins in Hypervirulent Clade 8 and Clade 6 Strains of Escherichia coli O157:H7 Compared to E. coli O157:H7 EDL933 Clade 3 Strain
  Amigo, PloS one 2016
  • “...3.6808 0.0001 ECSP_5106 [TW14359] b 3.25 0.021 General secretion pathway protein G EDL933_p0034 3.2944 0.00078 EDL933_0387 3.14 0.00078 Type III secretion protein EscF 3.2944 0.021 YicS, putative secreted protein (EDL933_4982) 3.12 0.0001 Conserved phage protein EDL933_1401 3.1383 0.0001 Phage protein ECSP_2742 [TW14359] b 2.91 0.0001 Phage...”
  • “...ECSP_5106 present in clade 8 and present but not annotated in EDL933 and Sakai; and EDL933_0387 are also overexpressed; as well as two putative exported proteins, YebF and YicS. YebF was found in the cell extract of the three stains tested in this study ( S2...”
• Physiological Response of Escherichia coli O157:H7 Sakai to Dynamic Changes in Temperature and Water Activity as Experienced during Carcass Chilling
  King, Molecular & cellular proteomics : MCP 2016
  • “.../ ECs2098 ), cell filamentation ( fic / ECs4212 ), and encoding hypothetical proteins ( ECs0383 , ECs0886 , ycaC / ECs0982 , ECs1692 , ECs2695 , ECs2785 , ECs2888 , ECs3588 , ECs4112 , yhfG / ECs4213 , ECs4323 , ysgA / ECs4760 , ECs5089...”
• Global transcriptional response of Escherichia coli O157:H7 to growth transitions in glucose minimal medium
  Bergholz, BMC microbiology 2007
  • “...dinJ 2.46 2 ECs0991 aroA -4.24 1 ECs0269 proB -2.11 1 ECs1007 mukB -2.12 1 ECs0383 yahO 4.53 2 ECs1013 asnS -2.74 1 ECs0384 prpR 3.63 2 ECs1014 pncB -2.37 1 ECs0390 codA -2.78 1 ECs1022 ycbR -3.16 1 ECs0415 afuA 5.21 2 ECs1048 - 2.44...”

YahO / b0329 DUF1471 domain-containing protein YahO from Escherichia coli K-12 substr. MG1655 (see 3 papers)
ETEC_0386 DUF1471 family periplasmic protein YahO from Escherichia coli ETEC H10407
P75694 Uncharacterized protein YahO from Escherichia coli (strain K12)
b0329 hypothetical protein from Escherichia coli str. K-12 substr. MG1655
Aligns to 37:89 / 91 (58.2%), covers 100.0% of PF07338, 50.1 bits

• The molecular basis for control of ETEC enterotoxin expression in response to environment and host
  Haycocks, PLoS pathogens 2015
  • “...G C G TTCCACG TCACA (ETEC_0150) (hemL) 408885 TGTGA TCTCTC TC G CA ETEC_0385 / ETEC_0386 yahN / yahO 461874 TGTG CGCAAGA TCACA ETEC_0434 ddlA 463095 TT TG CGCGAGG TCACA (ETEC_0436) (phoA) 468009 A G G GA TCTGCG TCACA ETEC_0443 aroM 492973 ATC GA TTGCGT TCAC...”
• Identification of specific protein amino acid substitutions of extended-spectrum β-lactamase (ESBL)-producing Escherichia coli ST131: a proteomics approach using mass spectrometry
  Nakamura, Scientific reports 2019
  • “...this study. The m/z 7655 peak was identified as uncharacterized protein YahO (Uniprot accession no. P75694) belonging to the Bhs/McbA family. The chain domain of the YahO protein was DUF1471, and its function is unknown. The m/z 8351 peak was identified as UPF0337 protein YjbJ (Uniprot...”
• Top-Down LESA Mass Spectrometry Protein Analysis of Gram-Positive and Gram-Negative Bacteria
  Kocurek, Journal of the American Society for Mass Spectrometry 2017
  • “...temperature -Met 978.9706 +6 5867.78 -2.0 YciG P21361 36 -Met 1101.2759 +7 7701.88 -1.5 YahO P75694 91 -signal peptide 1189.5904 +7 8320.08 -1.3 UPF0337 protein YjbJ a P68206 80 1254.2614 +7 8772.78 -2.2 YdfK P76154 31 1494.9477 +7 10,457.58 +1.02 Da YbgS P0AAV6 45 -signal peptide;...”
• Identification of RpoS (sigma(S))-regulated genes in Salmonella enterica serovar typhimurium
  Ibanez-Ruiz, Journal of bacteriology 2000
  • “...P37663 (YhjY), P07003 (PoxB), P76114 (YncC), P27250 (YjgB), P75694 (YahO), P39169 (YgaU), P31677 (OtsA), P77391 (YeaG), P21179 (KatE), P21362 (YciF), and P29013...”
• A Molecular Genetic Basis Explaining Altered Bacterial Behavior in Space
  Zea, PloS one 2016
  • “...16 genes, we have data for 15 (we did not find the expression of yahO (b0329) in the E . coli (DH10B) sequence that was downloaded from the UCSC genome browser), 12 of which were overexpressed (80%) in the spaceflight samples in between 2.10x and 24.76x....”
• Evolutionary dynamics of small RNAs in 27 Escherichia coli and Shigella genomes
  Skippington, Genome biology and evolution 2012
  • “...sdaC b2796 omrA 27 Core Incongruent No ompR b3405 omrA 27 Core Incongruent No yahO b0329 omrA 20 Variable Incongruent No dppB b3543 omrA 27 Core Incongruent No yjcH b4068 omrA 24 Variable Congruent No dppF b3540 omrA 27 Core Incongruent No fimA b4314 omrA 2...”
• Reconfiguring the quorum-sensing regulator SdiA of Escherichia coli to control biofilm formation via indole and N-acylhomoserine lactones
  Lee, Applied and environmental microbiology 2009
  • “...ompF expression Hypothetical yahK yahO ybaS b0325 b0329 b0485 5.7 7.0 7.5 2.6 2.8 2.3 Hypothetical zinc-type alcohol dehydrogenase-like protein Hypothetical...”
• Autoinducer 2 controls biofilm formation in Escherichia coli through a novel motility quorum-sensing regulator (MqsR, B3022)
  González, Journal of bacteriology 2006
  • “...b3717 b1511 b2252 b3143 b4217 b1160 b1257 b3690 b0513 b1258 b0329 b4068 b1443 yncG spf yjcO ymgB ymgC yeaQ amyA gatC b1454 b3864 b4078 b1166 b1167 b1795 b1927...”
• Parallel adaptive evolution cultures of Escherichia coli lead to convergent growth phenotypes with different gene expression states
  Fong, Genome research 2005
  • “...Hypothetical/putative None Annotated ppsA, yihK p=1- i=0 Glycerol b0329, b1266, b1678, b1934, b2302, b3021, b4109, proM, alaX, murA, prfC, psiF, rpsV, motA,...”
• SigmaS-dependent gene expression at the onset of stationary phase in Escherichia coli: function of sigmaS-dependent genes and identification of their promoter sequences
  Lacour, Journal of bacteriology 2004
  • “...(adherence) protein (b0232) Hypothetical protein (b0329) Hypothetical (inner membrane) protein (b0707) Putative enzyme (b0865) Hypothetical protein,...”
• Global analysis of genes regulated by EvgA of the two-component regulatory system in Escherichia coli
  Nishino, Journal of bacteriology 2003
  • “...b3512 b0867 b1597 b2359 b1492 b2390 b0897 b0329 b2358 b3514 b0485 b4242 b2371 Adaptation (starvation) Regulation Metabolism Adaptation (stress) Extrachromosomal...”
• Definition of the Escherichia coli MC4100 genome by use of a DNA array
  Peters, Journal of bacteriology 2003
  • “...b0309, b0317, b0319, b0320, b0321, b0322, b0326, b0327, b0329, b0332, b0334, b0335, b0347, b1137,a b1138, b1141, b1142, b1143, b1144, b1146, b1147, b1148,...”
• More

UTI89_C0362 hypothetical protein from Escherichia coli UTI89
Q1RFK1 YdgH/BhsA/McbA-like domain-containing protein from Escherichia coli (strain UTI89 / UPEC)
Aligns to 37:89 / 91 (58.2%), covers 100.0% of PF07338, 50.0 bits

• Defining the phylogenomics of Shigella species: a pathway to diagnostics
  Sahl, Journal of clinical microbiology 2015
  • “...EcHS_A0402 HMPREF9530_02672 ECNG_01839 ECSTEC94C_0398 ECAA86_00424 ECSE_0359 UTI89_C0362 EIQ72748 EcSMS35_0562 0.98 0.98 0.97 0.86 0.9 0.96 0.99 0.98 0.97...”
• Adhesive fiber stratification in uropathogenic Escherichia coli biofilms unveils oxygen-mediated control of type 1 pili
  Floyd, PLoS pathogens 2015
  • “...chaperone protein, HdeB (UniProt KB Q1R595, m/z 9,064), and the uncharacterized protein YahO (UniProt KB Q1RFK1, m/z 7,718) were also identified ( Table 1 ). HdeB localized to the air-liquid interface and was most abundant towards the liquid-exposed surface, while YahO localized throughout the biofilm (...”
  • “...Response Acid stress-response protein, HdeB Q1R595 12,522 aa133 / 3,475 Da 9,065 9,064 Uncharacterized YahO Q1RFK1 9,929 aa121 / 2,240 Da 7,707 7,718 *Predicted signal peptides obtained using the SignalP Server. # Observed average mass obtained from IMS analysis of one representative 48 hour UPEC biofilm....”

c3599 Hypothetical protein from Escherichia coli CFT073
Aligns to 34:86 / 86 (61.6%), covers 96.4% of PF07338, 49.4 bits

• Redox-Mediated Inactivation of the Transcriptional Repressor RcrR is Responsible for Uropathogenic Escherichia coli's Increased Resistance to Reactive Chlorine Species
  Sultana, mBio 2022
  • “...regulon confers resistance to HOCl stress. Including a gene cluster consisting of the three genes, c3599 , c3600 , and c3601 , 32.4% of the differentially expressed genes identified in our RNAseq analysis are uncharacterized and their biological function is still unknown ( Fig.2 ; TableS1...”
  • “...downstream (i.e., c3597 and c3602 , respectively) ( Fig.3A ). c3600 is located downstream of c3599 and upstream of c3601 and encodes a putative TetR-family transcriptional regulator; however, the functions of the c3599 and c3601 genes are unknown ( Fig.3A ). We renamed the c3599 ,...”

EC042_RS01800 reactive chlorine resistance periplasmic protein RclB from Escherichia coli 042
Aligns to 28:78 / 78 (65.4%), covers 90.9% of PF07338, 47.3 bits

• Overexpression of the third H-NS paralogue H-NS2 compensates fitness loss in hns mutants of the enteroaggregative Escherichia coli strain 042
  Prieto, Scientific reports 2020
  • “...4,6-dehydratase) 288.4 10.5 EC042_RS08580 (glutamate/gamma-aminobutyrateantiporter GadC) 273.3 34.7 EC042_RS03225 (LPS O-antigen length regulator) 263.4 6.1 EC042_RS01800 (DUF1471 domain-containing protein) 260.2 6.6 EC042_RS10355 (GGDEF domain-containing protein) 249.9 7.5 EC042_RS20290 (glutamate decarboxylase alpha subunit GadA) 247.8 37.6 EC042_RS07285 (ferritin-like domain-containing protein) 245.6 8.0 EC042_RS22730 (hypothetical protein) 243.5 3.4...”

ETAE_2188 hypothetical protein from Edwardsiella tarda EIB202
Aligns to 33:89 / 89 (64.0%), covers 98.2% of PF07338, 43.7 bits

• Edwardsiella piscicida: A versatile emerging pathogen of fish
  Leung, Virulence 2019
  • “...6 ETAE_2186, Trxlp T3SS Thioredoxin-like, promote inflammasome NLRC4 activation [ 72 , 73 ] 7 ETAE_2188 T3SS Hypothetical protein [ 72 ] 8 ETAE_3282 T3SS Hypothetical protein [ 72 ] 9 ETAE_1303, EseL T6SS Major cold shock protein? [ 71 ] 10 ETAE_2316, EseM T6SS Major...”
• Systematic Identification of Intracellular-Translocated Candidate Effectors in Edwardsiella piscicida
  Zhang, Frontiers in cellular and infection microbiology 2018
  • “...on T6SS (Figure 2A ). Another eight candidate effectors, including ETAE_0247, ETAE_0275, ETAE_0490, ETAE_2080, ETAE_2186, ETAE_2188, ETAE_2399, and ETAE_2473, showed similar levels of secretion from the wild-type, T3SS mutant and T6SS mutant, indicating that their secretion is not dependent on either T3SS or T6SS (Figure 2B...”

RclB / b0303 DUF1471 domain-containing protein RclB from Escherichia coli K-12 substr. MG1655 (see 2 papers)
RCLB_ECOLI / P75687 Uncharacterized protein RclB; Reactive chlorine resistance protein B from Escherichia coli (strain K12) (see paper)
b0303 orf, hypothetical protein from Escherichia coli str. K-12 substr. MG1655
Aligns to 28:78 / 78 (65.4%), covers 90.9% of PF07338, 42.7 bits

• function: Probably involved in reactive chlorine species (RCS) stress resistance.
  disruption phenotype: Mutants are more sensitive to HOCl treatment than wild-type cells.
• Molecular reframing of fibroblasts during resolution of arthritis
  Ramming, 2023
• Phosphorylation of ATG18a by BAK1 suppresses autophagy and attenuates plant resistance against necrotrophic pathogens
  Zhang, Autophagy 2021 (secret)
• Elucidation of the antibacterial mechanism of the Curvularia haloperoxidase system by DNA microarray profiling
  Hansen, Applied and environmental microbiology 2004
  • “...0.3 1.3 0.2 0.2 0.3 0.5 0.1 0.5 0.9 b0301 b0302 b0303 b0304 b0305 a The loge ratio of transcript level 9 to 10 min after stress induction with the Curvularia...”
• Definition of the Escherichia coli MC4100 genome by use of a DNA array
  Peters, Journal of bacteriology 2003
  • “...ykgE, ykg, ykgH, b0279, b0280, b0295, b0298, b030, b0303, b0309, b0317, b0319, b0320, b0321, b0322, b0326, b0327, b0329, b0332, b0334, b0335, b0347, b1137,a...”

KP1_4563 hypothetical protein from Klebsiella pneumoniae NTUH-K2044
Aligns to 35:81 / 81 (58.0%), covers 85.5% of PF07338, 35.2 bits

• A protein containing the DUF1471 domain regulates biofilm formation and capsule production in Klebsiella pneumoniae
  Horng, Journal of microbiology, immunology, and infection = Wei mian yu gan ran za zhi 2022 (PubMed)
  • “...(CPSs) are important factors involved in biofilm formation. KP1_4563 in K. pneumoniae NTUH-K2044, a small protein containing the DUF1471 domain, was reported to...”
  • “...In this study, we aimed to determine whether the KP1_4563 homolog is conserved in each K. pneumoniae isolate and what role it has in Klebsiella biofilms....”
• The KP1_4563 gene is regulated by the cAMP receptor protein and controls type 3 fimbrial function in Klebsiella pneumoniae NTUH-K2044
  Luo, PloS one 2017
  • “...and analysis methods Molecular biology techniques Genetic fingerprinting and footprinting Genetic footprinting DNA footprinting The KP1_4563 gene is regulated by the cAMP receptor protein and controls type 3 fimbrial function in Klebsiella pneumoniae NTUH-K2044 KP1_4563 controls type 3 fimbrial function Luo Mei Investigation Methodology Project administration...”
  • “...can adhere to host cells or extracellular matrix via type 1 and type 3 fimbriae. KP1_4563 is a gene encoding a hypothetical protein in K . pneumoniae NTUH-K2044. KP1_4563 is located between the type 1 and type 3 fimbrial gene clusters and is likely associated with...”

Or search for genetic data about PF07338 in the Fitness Browser