Family Search for PF07950 (MCP1_TM)

April 2024: See Interactive Tools for Functional Annotation of Bacterial Genomes for advice on using these tools.

PF07950 hits 3 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.

G0S0T5 Mitochondrial adapter protein MCP1 transmembrane domain-containing protein from Chaetomium thermophilum (strain DSM 1495 / CBS 144.50 / IMI 039719)
Aligns to 191:311 / 330 (36.7%), covers 97.1% of PF07950, 139.0 bits

• Structural and biochemical insights into lipid transport by VPS13 proteins
  Adlakha, The Journal of cell biology 2022
  • “...To generate PxP(Mcp1ct)-VABct 1,9442,635 -His 6 , residues 1532 of Mcp1 from C. thermophilum (Uniprot G0S0T5) were fused N-terminally to the VAB 1,9442,635 -His 6 construct. VAB domain (residues 1,8692,545) of Vps13p from S. cerevisiae was similarly cloned from genomic DNA into pET-29a(+) expression vector containing...”

HCBG_08366 uncharacterized protein from Histoplasma capsulatum G186AR
Aligns to 204:326 / 352 (34.9%), covers 97.1% of PF07950, 132.9 bits

• Extracellular Vesicle-Mediated RNA Release in Histoplasma capsulatum
  Alves, mSphere 2019
  • “...Protein folding HCBG_05591 3F 3F Fmn-binding split-barrel-like protein Oxidoreductase activity HCBG_06890 5F Glutaredoxin Homeostatic process HCBG_08366 3F Conserved hypothetical protein Oxidoreductase activity HCBG_01233 5R / 5F Galactose oxidase beta-propeller HCBG_00232 5F Tyrosinase Oxidoreductase activity HCBG_03159 MR Ste Ste7 Mek1 protein kinase Reproduction Transport HCBG_00485 3R Vacuolar...”

MCP1_YEAST / Q12106 Mitochondrial adapter protein MCP1; MDM10-complementing protein 1 from Saccharomyces cerevisiae (strain ATCC 204508 / S288c) (Baker's yeast) (see 6 papers)
NP_014871 Mcp1p from Saccharomyces cerevisiae S288C
YOR228C Protein of unknown function, localized to the mitochondrial outer membrane from Saccharomyces cerevisiae
2 alignments in 67:278 / 302 (66.2%), covering up to 97.1% of PF07950, 96.2 bits

• function: Recruits the lipid transfer protein Vps13 to mitochondria thereby promoting vacuole-mitochondria contacts (PubMed:28864540, PubMed:30018089, PubMed:34830155). Involved in mitochondrial lipid homeostasis (PubMed:23781023, PubMed:28864540).
  subunit: Interacts (via PxP motif) with VPS13 (via SHR-BD domain).
• Vps13-Mcp1 interact at vacuole-mitochondria interfaces and bypass ER-mitochondria contact sites.
  John, The Journal of cell biology 2017
  • GeneRIF: findings support a model in which Mcp1 and Vps13 work as functional effectors of vacuole-mitochondria contact sites, while tethering is mediated by other factors, including Vps39.
• Structural and biochemical insights into lipid transport by VPS13 proteins
  Adlakha, The Journal of cell biology 2022
  • “...https://dx.doi.org/10.17504/protocols.io.dm6gpbz68lzp/v1 . Scrambling studies for Mcp1p and XK Plasmids The coding sequences of MCP1 (Uniprot Q12106) and XK (Uniprot P51811) were PCR amplified from S. cerevisiae genomic DNA and human cDNA libraries, respectively, and subcloned into pCMV10 vector with an N-terminal 3xFLAG tag and PreScission protease...”
• A hunt for OM45 synthetic petite interactions in Saccharomyces cerevisiae reveals a role for Miro GTPase Gem1p in cristae structure maintenance
  Shvetsova, MicrobiologyOpen 2021
  • “...TIM44 This study URA3 YCp33 UGO1 This study URA3 YCp33 YGR111 This study URA3 YCp33 YOR228c This study URA3 YCplac111 Gietz & Sugino ( 1988 ) LEU2 YCplac22 Gietz & Sugino ( 1988 ) LEU2 YCplac33 Gietz & Sugino ( 1988 ) URA3 YEp112 FZO1 This...”
  • “...3/3 weak H Not sequenced 3/3 weak 3/3 weak H XV 766,540 767,312 WTM2 , YOR228C 3/3 2/3 H Not sequenced 3/3 weak 1/3 weak H XVI 830,340 834,690 YPR150W,SUE1,URN1,YPR153W 3/3 weak 0/3 L V 91,739 97,260 ( ECM10 ) SSC3 3/3 weak 7/7 weak L...”
• Novel layers of RNA polymerase III control affecting tRNA gene transcription in eukaryotes
  Leśniewska, Open biology 2017
  • “...occupied by all three components of the Pol III machinery, and four others, YGR258C , YOR228C , YBR154C and YOL141W , by TFIIIC only [ 32 ]. A region near YML089C was also occupied by all three components of Pol III machinery and was named zone...”
• Selective sorting and destruction of mitochondrial membrane proteins in aged yeast
  Hughes, eLife 2016
  • “...Outer membrane OM14 YBR230C Outer membrane SEN15 YMR059W Outer membrane PTH2 YBL057C Outer membrane MCP1 YOR228C Outer membrane SCM4 YGR049W Outer membrane MIR1 b YJR077C Inner membrane CTP1 b YBR291C Inner membrane DIC1 b YLR348C Inner membrane OAC1 b YKL120W Inner membrane MTM1 b YGR257C Inner...”
• Mcp1 and Mcp2, two novel proteins involved in mitochondrial lipid homeostasis
  Tan, Journal of cell science 2013 (PubMed)
  • “...identified two novel mitochondrial proteins (open reading frames YOR228c and YLR253w) that we named Mdm10 complementing protein (Mcp) 1 and Mcp2. Overexpression...”
  • “...Two other plasmids contained a DNA fragment encoding ARS1523, YOR228C and WTM2 as annotated sequence features (Fig. 1A, #15, and data not shown). ARS1523 is an...”
• STB5 is a negative regulator of azole resistance in Candida glabrata
  Noble, Antimicrobial agents and chemotherapy 2013
  • “...1.13 1.70 1.03 CAGL0M12947g CAGL0J04004g YIL077c (PUP1) YOR228c Protein required for nuclear migration Involved in mitochondrial function or organization...”
• TFIIIC localizes budding yeast ETC sites to the nuclear periphery
  Hiraga, Molecular biology of the cell 2012
  • “...257 RAD14-ERG2 9.3 ETC6 ( TFC6-ESC2 ) GCAACGTAGGGTTTTCGAACCGC ChrIV: 11988851198907 333 BCP1-TFC6 11.2 ETC7 ( YOR228C - WTM2 ) GCCCCGTTCGGGGTTCGAACTGC ChrXV: 768106 768128 323 WTM2-WTM1 7.2 ETC8 ( RPB5-CNS1 ) GCCTCCGTTAGGAGTCGAATAGA ChrII: 549229549251 264 RPB5-CNS1 9.1 a ETC5 locus resides in the coding region of the...”
• An iron homeostasis regulatory circuit with reciprocal roles in Candida albicans commensalism and pathogenesis
  Chen, Cell host & microbe 2011
  • “...iron-responsive genes Iron regulation: transcription factor 3.5 17.1 5.9 Hap43 orf19.6550 Putative ortholog of S.c. Yor228c, a mitochondrial outer membrane protein Mitochondrial function 3.7 2.9 Hap43 orf19.6948 CCC1 Putative vacuolar Fe2+/Mn2+ transporter Iron storage: vacuolar, Transporter: ions 3.8 2.6 Hap43 orf19.1742 HEM3 Hydroxymethylbilane synthase (uroporphyrinogen I...”
• Detection of heterozygous mutations in the genome of mismatch repair defective diploid yeast using a Bayesian approach
  Zanders, Genetics 2010
  • “...YNL225C/CMN67 YNL101W/AVT4 YNL121C/TOM70 YNR058W/BIO3 YOR296W YOR228C YOR267C/HRK1 YPL216W YPL222W/FMP40 YPL022W/RAD1 YPR007C/REC8 1284-1286 36-38 678-680...”
• More

Or search for genetic data about PF07950 in the Fitness Browser