Family Search for PF09430 (EMC7_beta-sandw)

April 2024: See Interactive Tools for Functional Annotation of Bacterial Genomes for advice on using these tools.

Running HMMer for PF09430

PF09430 hits 23 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.

EMC7_HUMAN / Q9NPA0 ER membrane protein complex subunit 7 from Homo sapiens (Human) (see 6 papers)
NP_064539 ER membrane protein complex subunit 7 precursor from Homo sapiens
Aligns to 56:168 / 242 (46.7%), covers 99.2% of PF09430, 136.9 bits

• function: Part of the endoplasmic reticulum membrane protein complex (EMC) that enables the energy-independent insertion into endoplasmic reticulum membranes of newly synthesized membrane proteins (PubMed:30415835, PubMed:29809151, PubMed:29242231, PubMed:32459176, PubMed:32439656). Preferentially accommodates proteins with transmembrane domains that are weakly hydrophobic or contain destabilizing features such as charged and aromatic residues (PubMed:30415835, PubMed:29809151, PubMed:29242231). Involved in the cotranslational insertion of multi-pass membrane proteins in which stop-transfer membrane-anchor sequences become ER membrane spanning helices (PubMed:30415835, PubMed:29809151). It is also required for the post-translational insertion of tail-anchored/TA proteins in endoplasmic reticulum membranes (PubMed:29809151, PubMed:29242231). By mediating the proper cotranslational insertion of N-terminal transmembrane domains in an N-exo topology, with translocated N- terminus in the lumen of the ER, controls the topology of multi-pass membrane proteins like the G protein-coupled receptors (PubMed:30415835). By regulating the insertion of various proteins in membranes, it is indirectly involved in many cellular processes (Probable).
  subunit: Component of the ER membrane protein complex (EMC).
• A mechanistic evaluation of human beta defensin 2 mediated protection of human skin barrier in vitro.
  Shelley, Scientific reports 2023
  • “...Q9Y6Y0 IVNS1ABP 1.21 0.00 Influenza virus NS1A-binding protein Q8IVL5 LEPREL1 1.21 0.03 Prolyl 3-hydroxylase 2 Q9NPA0 EMC7 1.12 0.03 ER membrane protein complex subunit 7 Q6PD74 AAGAB 1.04 0.04 Alpha- and gamma-adaptin-binding protein p34 Q9ULW0 TPX2 1.00 0.04 Targeting protein for Xklp2 Q12873 CHD3 -2.20 0.03...”
• Reciprocal best structure hits: using AlphaFold models to discover distant homologues
  Monzon, Bioinformatics advances 2022
  • “...previously based on homology-search algorithms. Wideman connected the human ER-membrane protein complex Emc7 subunit (UniProtKB: Q9NPA0) to the Sop4p protein in S.cerevisiae (UniProtKB: P39543) using BLAST and pHMMer ( Wideman, 2015 ). The structural matching approach confirms this finding and provides additional support for the proposed...”
• Structural and mechanistic basis of the EMC-dependent biogenesis of distinct transmembrane clients
  Miller-Vedam, eLife 2020
  • “...Q8N4V1-1, which encodes DYKDDDDK immediately after R131; EMC6 Q9BV81), pBIG1c (EMC2 Q15006; EMC3 Q9P0I2-1; EMC7 Q9NPA0), pBIG1d (EMC8 O43402-1; EMC9 Q9Y3B6), pBIG1e (EMC10 Q5UCC4-1). These were subsequently combined into pBIG2abcde to yield a single expression vector containing all 10 hEMC subunits. Bacmid was generated in DH10...”
• Oral Glucose Mobilizes Triglyceride Stores From the Human Intestine
  Xiao, Cellular and molecular gastroenterology and hepatology 2019
  • “....0433 Mitochondria/redox Q96A33 Coiled-coil domain-containing protein 47 CCDC47 0.1676 .0403 Other (calcium ion homeostasis, ERAD) Q9NPA0 ER membrane protein complex subunit 7 EMC7 0.1744 .0474 Other (carbohydrate binding) Q15417 Calponin-3 CNN3 0.1993 .0488 Cytoskeleton P21281 V-type proton ATPase subunit B; brain isoform ATP6V1B2 0.2023 .0460 Ion...”
• Exploring the Mitochondrial Degradome by the TAILS Proteomics Approach in a Cellular Model of Parkinson's Disease.
  Lualdi, Frontiers in aging neuroscience 2019
  • “...Met-removal 0.67 0.07 AADTQVSETLKR Q92616 Met-removal 0.84 0.19 RASPAGGPLEDVVIER Q96AY3 ragging TP-removal 0.84 0.16 SEVPGAAAEGSGGSGVGIGDR Q9NPA0 TP-removal 0.79 0.21 * UniProt code. Qualitative change. TABLE 3 N-terminal peptides UNDER-represented in DA vs. CTRL ( n=37 ). N-term peptide sequence Protein * Type of N-term DA/CTRL (log...”
• Selective EMC subunits act as molecular tethers of intracellular organelles exploited during viral entry.
  Bagchi, Nature communications 2020
  • GeneRIF: ER membrane protein complex subunit 4 (EMC4) and EMC7 support SV40 infection by promoting from the late endosome (LE) to the endoplasmic reticulum (ER) targeting of the virus. They do this by engaging LE-associated Rab7, to stabilize contact between the LE and ER. These EMC subunits also bind to the ER-resident fusion machinery component syntaxin18, which is required for SV40-arrival to the ER.
• [Familial hypertrophic cardiomyopathy--a case report].
  Domal-Kwiatkowska, Kardiologia polska 2006 (PubMed)
  • GeneRIF: Candidate modifier gene on the phenotypic expression of hypertrophy in patients with hyperthophic cardiomyopathy.

XP_007521742 ER membrane protein complex subunit 7 from Erinaceus europaeus
Aligns to 56:168 / 242 (46.7%), covers 99.2% of PF09430, 136.9 bits

• New C-Terminal Conserved Regions of Tafazzin, a Catalyst of Cardiolipin Remodeling
  Shilovsky, Oxidative medicine and cellular longevity 2019
  • “...tafazzins including shortened ones. Among 4 million proteins in RefSeq, there are only three exceptions, XP_007521742, XP_004712810, and XP_016049842 of European hedgehog ( Erinaceus europaeus ) and lesser hedgehog tenrec ( Echinops telfairi ), that are not tafazzins but include regions 2, 4, and 5 above....”
  • “...8 T2s, 6 shortened UTs of the beaver (X1, X2, and X5X8), and 1 nontafazzin XP_007521742 of the hedgehog. GDAESPD is present in 7 mammalian proteins: 4 T1s, 2 T2s, and 1 nontafazzin XP_004712810 of the tenrec ( Echinops telfairi ). GDAQSPH is present in 5...”

D3ZQL1 ER membrane protein complex subunit 7 from Rattus norvegicus
Aligns to 55:167 / 241 (46.9%), covers 99.2% of PF09430, 135.3 bits

• Transcriptomic and proteomic profiling of the anterior cingulate cortex in neuropathic pain model rats
  Qiu, Frontiers in molecular neuroscience 2023
  • “...2 (Prps2) 4 91.5 134.9 0.00253 1.26 Q64361 Latexin (Lxn) 4 83.2 121.5 0.00746 1.21 D3ZQL1 ER membrane protein complex subunit 7 (Emc7) 4 251.0 362.6 0.04083 1.20 Q923Z2 Tropomyosin 1, alpha, isoform CRA_a (Tpm1) 3 26.1 37.3 0.04930 1.31 Q5U204 Ragulator complex protein LAMTOR3 (Lamtor3)...”

XP_421207 ER membrane protein complex subunit 7 from Gallus gallus
Aligns to 60:172 / 246 (45.9%), covers 99.2% of PF09430, 135.2 bits

• Mass spectral data for 64 eluted peptides and structural modeling define peptide binding preferences for class I alleles in two chicken MHC-B haplotypes associated with opposite responses to Marek's disease
  Sherman, Immunogenetics 2008
  • “...NP_001007973, predicted: hypothetical protein; XP_421753, predicted: 30-kDa splicing factor; XP_001376044, cell division cycle protein 23; XP_421207, predicted: hypothetical protein; XP_224561, predicted: similar to Filamin-B (FLN-B; Beta-filamin); NP_001012957, hypothetical protein LOC426469; XP_416281, predicted: similar to PVA354; XP_415488, predicted: similar to Zyg-11 homolog B ( C. elegans )-like...”

PF3D7_1310500 ER membrane protein complex subunit 7, putative from Plasmodium falciparum 3D7
Aligns to 46:164 / 205 (58.0%), covers 98.4% of PF09430, 121.9 bits

• Protein control of membrane and organelle dynamics: Insights from the divergent eukaryote Toxoplasma gondii
  Ovciarikova, Current opinion in cell biology 2022
  • “...PF3D7_0306700 Yes 3.39 EMC6 TGME49_239690 3.57 No data PF3D7_1214400 No 2.76 EMC7 TGME49_243390 1.71 ER PF3D7_1310500 Yes 3.08 EMC8 TGME49_249310 4.1 ER PF3D7_1139900 Yes 2.84 Nuclear-mitochondrial contacts Recent studies have started addressing the composition and function of nuclearmitochondrial MCSs, where the first characterised contact might be...”
• Quantitative Proteomic Profiling Reveals Novel Plasmodium falciparum Surface Antigens and Possible Vaccine Candidates
  Nilsson, Molecular & cellular proteomics : MCP 2018
  • “...Generation--Recombinant ectodomain constructs for PfJ23, PIESP2, PF3D7_1310500, and PF3D7_1352500 were designed by removing predicted native signal peptide and...”
  • “...we selected a so far uncharacterized secretory antigen (Pf3D7_1310500). Antibodies were first tested for specificity by Western blot analysis, and they all...”
• Proteogenomic analysis of the total and surface-exposed proteomes of Plasmodium vivax salivary gland sporozoites
  Swearingen, PLoS neglected tropical diseases 2017
  • “...- - PVP01_1454300 PF3D7_1236200 - conserved Plasmodium protein, unknown function - - protein binding PVP01_1411500 PF3D7_1310500 - conserved protein, unknown function - - carbohydrate binding a) A combined total of 139 P . vivax proteins were identified with evidence for phosphorylation from proteomic analyses of two...”

O94694 UPF0620 protein C83.10 from Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Aligns to 37:154 / 189 (62.4%), covers 99.2% of PF09430, 98.1 bits

• Reciprocal best structure hits: using AlphaFold models to discover distant homologues
  Monzon, Bioinformatics advances 2022
  • “...these divergent ECM subunits. The RBSH approach also detects the corresponding homologs in S.pombe (UniProtKB: O94694), which was previously unconnected to S.cerevisiae Sop7p. We validated the detected RBH and RBSH using the PANTHER classification system ( Mi et al. , 2021 ) and could show that...”

LOC101262544 ER membrane protein complex subunit 7 homolog from Solanum lycopersicum
Aligns to 47:154 / 203 (53.2%), covers 95.9% of PF09430, 86.4 bits

• GTax: improving de novo transcriptome assembly by removing foreign RNA contamination
  Alvarez, Genome biology 2024
  • “...purple) in the same genomic region. The first one matched exactly to the annotated gene, LOC101262544. It is clearly validated by the RNA-Seq alignment coverage and the spanning reads (dark grey gaps between exons) in all SRA samples in this study. Samples SRR13931770 and SRR14575350 collected...”
  • “...target organism does not have a reference genome. Fig.4 Genomic view for the annotated gene LOC101262544 (green) and aligned Trinity transcripts to the same genomic region: TRINITY_DN876_c1_g1_i2 and TRINITY_DN1213_c2_g1_i2 (purple). Note: Annotated exon coverage, intron spanning reads, and intro features; pile-up of alignment coverage in log...”

AT4G32130 carbohydrate binding from Arabidopsis thaliana
Aligns to 49:156 / 202 (53.5%), covers 96.7% of PF09430, 84.2 bits

• Looking for a safe haven: tail-anchored proteins and their membrane insertion pathways
  Mehlhorn, Plant physiology 2021
  • “...AtEMC6 Plasma membrane c PSI-BLAST, TAIR EMC7 At2g25310 AtEMC7 a ER membrane c PSI-BLAST, TAIR At4g32130 AtEMC7 b ER membrane c EMC8/9 At5g55940 EMB2731 ER membrane c PSI-BLAST, TAIR EMC10 Not found PSI-BLAST a Found annotated at TAIR (Arabidopsis.org) orif designated as unknown proteinour suggestion for...”

AT2G25310 carbohydrate binding from Arabidopsis thaliana
Aligns to 55:161 / 210 (51.0%), covers 95.1% of PF09430, 80.8 bits

• Nano-Strainer: A workflow for the identification of single-copy nuclear loci for plant systematic studies, using target capture kits and Oxford Nanopore long reads
  Scheunert, Ecology and evolution 2023
  • “...too high best K , and 18 loci ( At5g66290 , At1g57760 , At1g49430 , At2g25310 , At2g40490 , At5g66080 , At2g28900 , At2g45640 , At4g32175 , At5g61640 , At5g63310 , At5g17330 , At4g33865 , At1g55910 , At1g60990 , At5g11950 , At2g04350 , At3g15610 ) rejected...”
• Looking for a safe haven: tail-anchored proteins and their membrane insertion pathways
  Mehlhorn, Plant physiology 2021
  • “...PRCE2 ER membrane c PSI-BLAST, TAIR EMC6 At5g49540 AtEMC6 Plasma membrane c PSI-BLAST, TAIR EMC7 At2g25310 AtEMC7 a ER membrane c PSI-BLAST, TAIR At4g32130 AtEMC7 b ER membrane c EMC8/9 At5g55940 EMB2731 ER membrane c PSI-BLAST, TAIR EMC10 Not found PSI-BLAST a Found annotated at TAIR...”

NOMO1_HUMAN / Q15155 BOS complex subunit NOMO1; Nodal modulator 1; pM5 protein from Homo sapiens (Human) (see 5 papers)
NP_055102 nodal modulator 1 precursor from Homo sapiens
Aligns to 339:409 / 1222 (5.8%), covers 46.7% of PF09430, 79.5 bits

• function: Component of the multi-pass translocon (MPT) complex that mediates insertion of multi-pass membrane proteins into the lipid bilayer of membranes (PubMed:36261522, PubMed:32820719). The MPT complex takes over after the SEC61 complex: following membrane insertion of the first few transmembrane segments of proteins by the SEC61 complex, the MPT complex occludes the lateral gate of the SEC61 complex to promote insertion of subsequent transmembrane regions (PubMed:36261522).
  subunit: Component of the back of Sec61 (BOS) complex, composed of NCLN/Nicalin, NOMO (NOMO1, NOMO2 or NOMO3) and TMEM147 (PubMed:20538592, PubMed:36261522). The BOS complex is part of the multi-pass translocon (MPT) complex, composed of three subcomplexes, the GEL complex (composed of RAB5IF/OPTI and TMCO1), the BOS complex (composed of NCLN/Nicalin, NOMO and TMEM147) and the PAT complex (composed of WDR83OS/Asterix and CCDC47) (PubMed:36261522, PubMed:32820719). The MPT complex associates with the SEC61 complex (PubMed:32820719, PubMed:36261522). Due to the strong similarity between NOMO1, NOMO2 and NOMO3, similar interaction pattern probably occur for the three gene copies (PubMed:20538592, PubMed:32820719).
• NOMO-1 gene is deleted in early-onset colorectal cancer.
  Perea, Oncotarget 2017
  • GeneRIF: Microsatellite-Stable (MSS) CRC showed a very high proportion of homozygous loss of NOMO1 (54 of 59 cases, 91.5%), while the deletion was observed in only 7 out of 16 MSI cases. Deletion of NOMO1 is a molecular marker predominantly associated with CRC, particularly MSS subtypes.
• The imprinted H19 gene regulates human placental trophoblast cell proliferation via encoding miR-675 that targets Nodal Modulator 1 (NOMO1).
  Gao, RNA biology 2012 (PubMed)
  • GeneRIF: H19 gene could inhibit human trophoblast cell proliferation via encoding miR-675 that targeted NOMO1 downregulation.
• Complex genomic rearrangements lead to novel primate gene function
  Ciccarelli, Genome research 2005
  • “...initiation factor 3 16p13.11 16p13.3 3 L PM5 NP_055102 pM5 protein 16q22.3 2 H PDRD NP_060460 Pyruvate dehydrogenase phosphatase 17q23.2 17p13.2 2 H USP32...”
• Exploring the molecular composition of the multipass translocon in its native membrane environment
  Gemmer, 2023
• DUSP7 inhibits cervical cancer progression by inactivating the RAS pathway.
  Bai, Journal of cellular and molecular medicine 2021
  • “...Q30167 HLADRB1 1.73 1.67 1.65 Q9UHB64 LIMA1 0.64 0.61 0.63 Q5JSK7 HMGN5 2.07 2.34 1.59 Q15155 NOMO1 0.62 0.47 0.65 P00739 HPR 1.52 2.09 1.59 P08254 MMP3 0.55 0.38 0.46 Note TMT:tandem mass tags;C1, C2, C3:cervical cancer tissue;N1N2N3:paired paracancerous tissue. John Wiley & Sons, Ltd To...”
• Proteome analysis of human amniotic mesenchymal stem cells (hA-MSCs) reveals impaired antioxidant ability, cytoskeleton and metabolic functionality in maternal obesity.
  Capobianco, Scientific reports 2016
• The proteome signature of the inflammatory breast cancer plasma membrane identifies novel molecular markers of disease.
  Suárez-Arroyo, American journal of cancer research 2016
• The interactome of the human respiratory syncytial virus NS1 protein highlights multiple effects on host cell biology
  Wu, Journal of virology 2012
  • “...Peptides SC (%) Variability (%) Abundance (ppm) Q8TCJ2 Q15155 P40939 P68363 P51148 O94826 Q9UQE7 O76031 P21964 O96005 Q969V3 O75489 P61006 Q16531 Q9BVK6 P46977...”

NOMO2_HUMAN / Q5JPE7 BOS complex subunit NOMO2; Nodal modulator 2; pM5 protein 2 from Homo sapiens (Human) (see 5 papers)
Aligns to 339:408 / 1267 (5.5%), covers 47.5% of PF09430, 78.8 bits

• function: Component of the multi-pass translocon (MPT) complex that mediates insertion of multi-pass membrane proteins into the lipid bilayer of membranes (PubMed:36261522, PubMed:32820719). The MPT complex takes over after the SEC61 complex: following membrane insertion of the first few transmembrane segments of proteins by the SEC61 complex, the MPT complex occludes the lateral gate of the SEC61 complex to promote insertion of subsequent transmembrane regions (PubMed:36261522).
  subunit: Component of the back of Sec61 (BOS) complex, composed of NCLN/Nicalin, NOMO (NOMO1, NOMO2 or NOMO3) and TMEM147 (PubMed:20538592, PubMed:36261522). The BOS complex is part of the multi-pass translocon (MPT) complex, composed of three subcomplexes, the GEL complex (composed of RAB5IF/OPTI and TMCO1), the BOS complex (composed of NCLN/Nicalin, NOMO and TMEM147) and the PAT complex (composed of WDR83OS/Asterix and CCDC47) (PubMed:36261522, PubMed:32820719). The MPT complex associates with the SEC61 complex (PubMed:32820719, PubMed:36261522). Due to the strong similarity between NOMO1, NOMO2 and NOMO3, similar interaction pattern probably occur for the three gene copies (PubMed:20538592, PubMed:32820719).
• The benefit of combining curcumin, bromelain and harpagophytum to reduce inflammation in osteoarthritic synovial cells
  Brochard, BMC complementary medicine and therapies 2021
  • “...1 0 false Q9C0H2 0.64 TTYH3 Protein tweety homolog 3 false 1 4 0 false Q5JPE7 0.64 NOMO2 Nodal modulator 2 false 0 0 1 false P69849 0.64 NOMO3 Nodal modulator 3 false 0 0 1 false P00966 0.65 ASS1 Argininuccinate synthase false 4 2 4...”
• Proteomics reveals signal peptide features determining the client specificity in human TRAP-dependent ER protein import.
  Nguyen, Nature communications 2018
  • “...SLC35B2 MDARW WAVVVLAAF PSLGAG + 23.8 0.627 Q6PIU2 NCEH1 MRS SCVLLTAL VALA + 14.3 1.617 Q5JPE7 NOMO2 MLVGQGA GLLGPAVVTAAVVLLL SGVGPAHG + + 29.0 1.259 P08236 GUSB MARGS AVAWAALGPLLW GCALG + 22.7 0.883 P00533 * EGFR MRPSGTA GAALLALLAALC PASRA + + 16.7 0.634 Q5VW38 GPR107 MAALAPVGSPASRGPR LAAGLRLLPMLGLLQLLA...”
• Differential Radiation Sensitivity in p53 Wild-Type and p53-Deficient Tumor Cells Associated with Senescence but not Apoptosis or (Nonprotective) Autophagy.
  Xu, Radiation research 2018
  • “...0.0049 0.0068 0.5840 0.1710 P62491 Ras-related protein Rab-11A RAB11A 29.8 24.488 0.2692 0.3305 0.5442 0.1878 Q5JPE7 Nodal modulator 2 NOMO2 6.2 139.38 0.1650 0.1895 0.5106 0.4930 P31930 Cytochrome b-c1 complex subunit 1, mitochondrial UQCRC1 5.4 52.645 0.3140 0.7046 0.4073 0.5895 P30040 Endoplasmic reticulum resident protein 29...”
• The proteome signature of the inflammatory breast cancer plasma membrane identifies novel molecular markers of disease.
  Suárez-Arroyo, American journal of cancer research 2016
• Radiotherapy diagnostic biomarkers in radioresistant human H460 lung cancer stem-like cells.
  Yun, Cancer biology & therapy 2016
  • “...5.46 38 124 20 Serine-type endopeptidase inhibitor activity 6 Nodal modulator 2 (NOMO2) (+)6.7 0.78 Q5JPE7 135077 5.51 30 146 25 Carbohydrate binding 7 Kinesin light chain 4 (KLC4) (+)6 1.32 Q9NSK0 70965 5.95 20 74 11 Microtubule motor activity 8 Procollagen-lysine,2-oxoglutarate 5-dioxygenase 3 (PLOD3) (+)3.1...”

NOMO3_HUMAN / P69849 BOS complex subunit NOMO3; Nodal modulator 3; pM5 protein 3 from Homo sapiens (Human) (see 4 papers)
Aligns to 339:409 / 1222 (5.8%), covers 47.5% of PF09430, 78.3 bits

• function: Component of the multi-pass translocon (MPT) complex that mediates insertion of multi-pass membrane proteins into the lipid bilayer of membranes (PubMed:36261522, PubMed:32820719). The MPT complex takes over after the SEC61 complex: following membrane insertion of the first few transmembrane segments of proteins by the SEC61 complex, the MPT complex occludes the lateral gate of the SEC61 complex to promote insertion of subsequent transmembrane regions (PubMed:36261522).
  subunit: Component of the back of Sec61 (BOS) complex, composed of NCLN/Nicalin, NOMO (NOMO1, NOMO2 or NOMO3) and TMEM147 (PubMed:20538592, PubMed:36261522). The BOS complex is part of the multi-pass translocon (MPT) complex, composed of three subcomplexes, the GEL complex (composed of RAB5IF/OPTI and TMCO1), the BOS complex (composed of NCLN/Nicalin, NOMO and TMEM147) and the PAT complex (composed of WDR83OS/Asterix and CCDC47) (PubMed:36261522, PubMed:32820719). The MPT complex associates with the SEC61 complex (PubMed:32820719, PubMed:36261522). Due to the strong similarity between NOMO1, NOMO2 and NOMO3, similar interaction pattern probably occur for the three gene copies (PubMed:20538592, PubMed:32820719).
• The benefit of combining curcumin, bromelain and harpagophytum to reduce inflammation in osteoarthritic synovial cells
  Brochard, BMC complementary medicine and therapies 2021
  • “...1 4 0 false Q5JPE7 0.64 NOMO2 Nodal modulator 2 false 0 0 1 false P69849 0.64 NOMO3 Nodal modulator 3 false 0 0 1 false P00966 0.65 ASS1 Argininuccinate synthase false 4 2 4 false O75531 0.65 BANF1 Barrier-to-autointegration factor false 0 2 2 false...”
• Alignment of virus-host protein-protein interaction networks by integer linear programming: SARS-CoV-2.
  Llabrés, PloS one 2020
  • “...Q9UHD2 0.863 0.839 1.000 P00403 50Q96HR9 0.077 0.816 Q8TEB7 50Q96ER3 0.652 O00303 50P48556 0.289 0.860 P69849 50Q9NQC3 0.873 Q9BYF1 50Q7L8L6 0.363 0.749 0.165 Q03135 50Q00765 0.801 (c) Membrane protein M (P59596, P0DTC5) SARS-CoV-1 SARS-CoV-2 BPO CCO MFO P68104 Q9HD40 0.625 0.748 0.511 B8ZZN6 Q9Y3U8 Q92499 Q9NR30...”
  • “...nsp7 (NP_828865, P0DTD1-PRO_0000449625) SARS-CoV-1 SARS-CoV-2 BPO CCO MFO P05155 Q9GZU3 P54274 Q9H173 0.200 0.655 0.216 P69849 Q9NQC3 0.873 P23588 O00566 0.477 0.701 0.917 Q9P0M6 O14745 0.535 0.804 0.102 P68104 Q9HD40 0.625 0.748 0.511 P49069 Q13868 0.088 0.762 0.080 Q96GS6 Q9Y399 0.361 0.766 P10415 Q9NQT5 0.323 0.887...”
• The proteome signature of the inflammatory breast cancer plasma membrane identifies novel molecular markers of disease.
  Suárez-Arroyo, American journal of cancer research 2016
• Down-regulation of Ras-related protein Rab 5C-dependent endocytosis and glycolysis in cisplatin-resistant ovarian cancer cell lines.
  Jin, Molecular & cellular proteomics : MCP 2014

J3KN36 Nodal modulator 3 from Homo sapiens
Aligns to 339:409 / 1267 (5.6%), covers 47.5% of PF09430, 77.8 bits

• Sequence similarity between SARS-CoV-2 nucleocapsid and multiple sclerosis-associated proteins provides insight into viral neuropathogenesis following infection
  Lake, Scientific reports 2023
  • “...L10 (Fragment) RPL10 Homo sapiens (Human) E9PB61 THO complex subunit 4 ALYREF Homo sapiens (Human) J3KN36 Nodal modulator 3 NOMO3 Homo sapiens (Human) Q16653 Myelin oligodendrocyte-glycoprotein MOG Homo sapiens (Human) P0DTC2 Spike glycoprotein S Severe acute respiratory syndrome coronavirus 2 A0A6C0T6Z7 Nucleoprotein (Nucleocapsid) N Severe acute...”

NP_694697 BOS complex subunit NOMO1 precursor from Mus musculus
Q6GQT9 BOS complex subunit NOMO1 from Mus musculus
Aligns to 331:399 / 1214 (5.7%), covers 46.7% of PF09430, 73.6 bits

• Silencing of nodal modulator 1 inhibits the differentiation of P19 cells into cardiomyocytes.
  Zhang, Experimental cell research 2015 (PubMed)
  • GeneRIF: NOMO1 gene knockdown inhibits the differentiation of P19 cells into cardiomyocytes, which highlights a potential role for NOMO1 in early cardiogenesis.
• Subproteomic profiling of sarcolemma from dystrophic mdx-4cv skeletal muscle.
  Murphy, Data in brief 2018
  • “...NDUFA4 1 1 1.8 6.61E-03 6.7 Q8BTJ4 Enpp4 Bis(5'-adenosyl)-triphosphatase enpp4 1 1 2.6 3.03E-04 6.3 Q6GQT9 Nomo1 Nodal modulator 1 1 1 2.0 4.13E-04 6.0 Q80XN0 Bdh1 D-beta-hydroxybutyrate dehydrogenase, mitochondrial 1 1 56.4 1.40E-03 6.0 Q9R0P9 Uchl1 Ubiquitin carboxyl-terminal hydrolase isozyme L1 1 1 1.9 1.24E-03...”
• Novel Insights into the Adipokinome of Obese and Obese/Diabetic Mouse Models.
  Knebel, International journal of molecular sciences 2017
  • “...10 5 Dolichyl-diphosphooligosaccharide-protein glycosyltransferase subunit 2 Q9DBG6 Rpn2 1.72 4.48 10 4 Nodal modulator 1 Q6GQT9 Nomo1 1.78 1.74 10 5 60S ribosomal protein L12 P35979 Rpl12 1.86 9.57 10 5 Ketohexokinase P97328 Khk 1.94 9.40 10 5 Carbonyl reductase 3 Q8K354 Cbr3 1.98 1.06 10...”
  • “...Q9QUR8 Sema7a + Adenosine deaminase P03958 Ada + Coronin-7 Q9D2V7 Coro7 + Nodal modulator 1 Q6GQT9 Nomo1 + Phosphoglycolate phosphatase Q8CHP8 Pgp + C-X-C motif chemokine 3 Q6W5C0 Cxcl3 + -Hexosaminidase subunit P20060 Hexb + Putative hydrolase RBBP9 O88851 Rbbp9 + Ketohexokinase P97328 Khk + Interleukin-1...”
• Hepatic lipase maturation: a partial proteome of interacting factors
  Doolittle, Journal of lipid research 2009
  • “...174,049 133,420 107,300 72,379 67,266 62,995 Q9JLA3 Q6GQT9 Q3UE86 P07823 Q8K3H8 Q9Z247 Protein folding Carbohydrate binding Protein folding Protein Folding,...”

faaB putative long-chain-fatty-acid-CoA ligase from Emericella nidulans (see paper)
Aligns to 772:917 / 1003 (14.6%), covers 100.0% of PF09430, 69.1 bits

• CharProtDB Description: Putative long-chain-fatty-acid-CoA ligase with a predicted role in fatty acid metabolism; transcript induced in the presence of short and long chain fatty acids; Source:AspGD

B0Y335 ER membrane protein complex subunit 7 beta-sandwich domain-containing protein from Aspergillus fumigatus (strain CBS 144.89 / FGSC A1163 / CEA10)
Aligns to 38:175 / 245 (56.3%), covers 89.3% of PF09430, 67.4 bits

• Assembly and disassembly of Aspergillus fumigatus conidial rodlets
  Valsecchi, Cell surface (Amsterdam, Netherlands) 2019
  • “...Lectin family integral membrane protein, putative No 0.72 16.20 327 36.197 244833 2.0 AFUB_052800 AFUA_5G04280 B0Y335 Uncharacterized protein Yes 0.83 16.70 245 26.115 229443 2.3 AFUB_034660 AFUA_3G14570 B0XZX0 Histidine acid phosphatase, putative No 0.74 7.10 462 51.295 213797 2.0 btgE btgE B0Y9Q9 Probable beta-glucosidase btgE No...”
  • “...300040 5.3 AFUB_010920 AFUA_1G11490 B0XQR8 Endopolyphosphatase Yes 0.78 3.40 668 76.206 295473 2.0 AFUB_052800 AFUA_5G04280 B0Y335 Uncharacterized protein Yes 0.83 16.70 245 26.115 293027 2.3 AFUB_023360 AFUA_2G06280 B0XW28 Oligosaccharyl transferase subunit (Gamma), putative No 0.69 7.10 325 35.939 260640 0.7 AFUB_056810 AFUA_5G09270 B0Y479 Uncharacterized protein No...”

AFUA_5G04280 conserved hypothetical protein from Aspergillus fumigatus Af293
Aligns to 38:175 / 245 (56.3%), covers 89.3% of PF09430, 67.4 bits

• Assembly and disassembly of Aspergillus fumigatus conidial rodlets
  Valsecchi, Cell surface (Amsterdam, Netherlands) 2019
  • “...B0XSP1 Lectin family integral membrane protein, putative No 0.72 16.20 327 36.197 244833 2.0 AFUB_052800 AFUA_5G04280 B0Y335 Uncharacterized protein Yes 0.83 16.70 245 26.115 229443 2.3 AFUB_034660 AFUA_3G14570 B0XZX0 Histidine acid phosphatase, putative No 0.74 7.10 462 51.295 213797 2.0 btgE btgE B0Y9Q9 Probable beta-glucosidase btgE...”
  • “...108.750 300040 5.3 AFUB_010920 AFUA_1G11490 B0XQR8 Endopolyphosphatase Yes 0.78 3.40 668 76.206 295473 2.0 AFUB_052800 AFUA_5G04280 B0Y335 Uncharacterized protein Yes 0.83 16.70 245 26.115 293027 2.3 AFUB_023360 AFUA_2G06280 B0XW28 Oligosaccharyl transferase subunit (Gamma), putative No 0.69 7.10 325 35.939 260640 0.7 AFUB_056810 AFUA_5G09270 B0Y479 Uncharacterized protein...”

XP_002662361 nodal modulator 1 from Danio rerio
Aligns to 330:401 / 1208 (6.0%), covers 47.5% of PF09430, 65.6 bits

• Nomo1 deficiency causes autism-like behavior in zebrafish.
  Zhang, EMBO reports 2024
  • GeneRIF: Nomo1 deficiency causes autism-like behavior in zebrafish.
• Scale-invariant patterning by size-dependent inhibition of Nodal signalling.
  Almuedo-Castillo, Nature cell biology 2018
  • GeneRIF: Size-dependent inhibition of Nodal signalling allows scale-invariant patterning in zebrafish blastula.
• Loss of the Nodal modulator Nomo results in chondrodysplasia in zebrafish.
  Cao, Current molecular medicine 2018 (PubMed)
  • GeneRIF: The nomo gene positively regulates the expression of the master regulator and other key development genes involved in bone formation and cartilage development and it is essential for cartilage development in zebrafish.
• Clock1a affects mesoderm development and primitive hematopoiesis by regulating Nodal-Smad3 signaling in the zebrafish embryo.
  Bian, The Journal of biological chemistry 2017
  • GeneRIF: Data suggest that Clock1a coordinates mesoderm development and primitive hematopoiesis in embryos by up-regulating Nodal-Smad3 signaling; Clock1a alterations produce embryonic defects with shortened body length, lack of ventral tail fin, or partial defect of the eyes; Clock1a activates Smad3a promoter via its E-box1 element. (Clock1a = clock circadian regulator a; Nodal = nodal modulator 1; Smad3a = SMAD family member 3a)
• [The Nodal regulated dusp4 inhibits mesendoderm formation during zebrafish gastrulation].
  Liu, Yi chuan = Hereditas 2012 (PubMed)
  • GeneRIF: our results indicate that Nodal regulated dusp4 plays a repressive role in mesendoderm induction.
• Nicalin and its binding partner Nomo are novel Nodal signaling antagonists.
  Haffner, The EMBO journal 2004
  • GeneRIF: Nicalin/Nodal modulator complex antagonizes Nodal signaling during mesendodermal patterning in zebrafish

Q54ST6 ER membrane protein complex subunit 7 homolog from Dictyostelium discoideum
Aligns to 49:161 / 216 (52.3%), covers 91.0% of PF09430, 59.4 bits

• Proteomic and Transcriptomic Profiling Identifies Early Developmentally Regulated Proteins in Dictyostelium Discoideum
  González-Velasco, Cells 2019
  • “...Ataxin-2 homolog Q55G75 PH domain-containing protein P90532 Cell division cycle protein 48 Q55BZ5 Protein dcd1A Q54ST6 Membrane protein subunit Q54F74 Sulfate adenylyltransferase Q54I92 Protein psiI...”

TGME49_243390 hypothetical protein from Toxoplasma gondii ME49
Aligns to 116:240 / 337 (37.1%), covers 96.7% of PF09430, 44.8 bits

• A Metabolomic and Transcriptomic Study Revealed the Mechanisms of Lumefantrine Inhibition of Toxoplasma gondii
  Li, International journal of molecular sciences 2023
  • “...of ribosomal protein AGCAGCCAGAGTGTTTCAGT CAGAGCGCGGGAAGAGTAAA TGME49_231350 glucosamine-fructose-6-phosphate aminotransferase GATCGCACCCTACCAGAACC TGAGCAGTTCGCCGTAGATG TGME49_297270 hypothetical protein TGGGGATACCCCATTTTCGG TGTCTCATACTCCCAGGCCA TGME49_243390 hypothetical protein ATCGAGGCATCATCAACCCC CGGGTAGGCAAGGGATCAAA TGME49_261670 ribonuclease H1/H2 small subunit protein CCACTTTCTCACCATGCCCT GAACCATCCGTTTCCCCTGT...”
• Protein control of membrane and organelle dynamics: Insights from the divergent eukaryote Toxoplasma gondii
  Ovciarikova, Current opinion in cell biology 2022
  • “...TGME49_293200 2.68 ER PF3D7_0306700 Yes 3.39 EMC6 TGME49_239690 3.57 No data PF3D7_1214400 No 2.76 EMC7 TGME49_243390 1.71 ER PF3D7_1310500 Yes 3.08 EMC8 TGME49_249310 4.1 ER PF3D7_1139900 Yes 2.84 Nuclear-mitochondrial contacts Recent studies have started addressing the composition and function of nuclearmitochondrial MCSs, where the first characterised...”

ZPR_2532 TonB-dependent siderophore receptor from Zunongwangia profunda SM-A87
Aligns to 33:119 / 773 (11.3%), covers 52.5% of PF09430, 33.3 bits

• The complete genome of Zunongwangia profunda SM-A87 reveals its adaptation to the deep-sea environment and ecological role in sedimentary organic nitrogen degradation
  Qin, BMC genomics 2010
  • “...fewer TonB proteins than TonB receptors [ 50 ]. The predicted TonB-dependent siderophore receptors (ZPR_0148, ZPR_2532) are likely to be involved in the enrichment and transport of iron into the cell. Mobile elements SM-A87 is predicted to carry many transposases, supporting the idea that transposases are...”

GFO_2191 TonB-dependent outer membrane receptor from Gramella forsetii KT0803
Aligns to 30:131 / 812 (12.6%), covers 54.9% of PF09430, 30.9 bits

• Functional characterization of polysaccharide utilization loci in the marine Bacteroidetes 'Gramella forsetii' KT0803
  Kabisch, The ISME journal 2014
  • “...a gene for a highly induced hypothetical inner membrane protein ( Supplementary Table S7 , GFO_2191) and (III) three TBDRs that were also identified in glucose-grown cultures (GFO_0361, 2138 and 1,4-alpha-glucanase associated; GFO_1029 next to two large outer membrane lipoproteins with adhesion domains), indicating regulatory overlaps...”

LIC10964 TonB-dependent outer membrane hemin receptor from Leptospira interrogans serovar Copenhageni str. Fiocruz L1-130
Aligns to 36:138 / 777 (13.3%), covers 54.9% of PF09430, 30.6 bits

• Challenges and Strategies for Developing Recombinant Vaccines against Leptospirosis: Role of Expression Platforms and Adjuvants in Achieving Protective Efficacy
  de, Pathogens (Basel, Switzerland) 2023
  • “...rBCG vectored vaccine expressing a chimeric antigen based on the TonB-dependent receptor (TBDR) epitopes (LIC10896, LIC10964, and LIC12374) from L. interrogans . Hamsters vaccinated with the rBCG:TBDRchi construct were fully protected from lethal leptospirosis, whereas the same recombinant protein as a subunit vaccine failed to protect...”
• Challenges for the development of a universal vaccine against leptospirosis revealed by the evaluation of 22 vaccine candidates
  Maia, Frontiers in cellular and infection microbiology 2022
  • “...RSV we selected several OM transporter families, including: eight TonB-dependent receptors (TBDR): LIC10714, LIC10881*, LIC10896*, LIC10964, LIC11268, LIC12374, LIC20151 and LIC20214; three alginate exporters (AlgE): LIC13229, LIC13417*, LIC13477 (*, see below); one orthologue for the COG4313 channel family: LIC11086; and six putative porins: LIC10544, LIC11271, LIC11366,...”
  • “...1.93 0.12 0.78 LIC10896* Ferripyoverdine receptor, Pseudomonas aeruginosa RSV TBDR 2w16A 0.72 1.97 0.12 0.74 LIC10964 Outer membrane transporter ZnuD, Neisseria meningitidis RSV TBDR 4rdrA 0.84 1.14 0.20 0.85 LIC11086 Outer membrane channel COG4313 protein, Pseudomonas putida F1 RSV/CSIP Channel 4rl8A 0.78 1.06 0.13 0.80 LIC11211...”
• TonB-dependent receptor epitopes expressed in M. bovis BCG induced significant protection in the hamster model of leptospirosis
  Bettin, Applied microbiology and biotechnology 2022
  • “...acquisition, and utilization (Louvel et al. 2006 ). Two leptospiral TBDRs, encoded by LIC10896 and LIC10964, were described as homologs to the ferric citrate transporter FecA and the PhuR hemin receptor (Nascimento et al. 2004 ; Louvel et al. 2006 ), respectively. Another TBDR, LIC12374, is...”
  • “...highly conserved surface-exposed regions containing B and T CD4+cell epitopes in three leptospiral TBDRs: LIC10896, LIC10964, and LIC12374. These fragments were combined on a multi-epitope fusion protein and evaluated using BCG as a vectorized vaccine carrier. Our preparation induced a protective immune response in the hamster...”
• Discovery of Novel Leptospirosis Vaccine Candidates Using Reverse and Structural Vaccinology
  Grassmann, Frontiers in immunology 2017
  • “...outer membrane receptor TonB-dependent outer membrane receptor ( fecA ) TonB-dependent outer membrane receptor TBDR LIC10964 TonB-dependent outer membrane hemin receptor TonB-dependent outer membrane hemin receptor ( phuR ) TonB-dependent outer membrane hemin receptor TBDR LIC11086 Conserved hypothetical protein Uncharacterized protein Hypothetical protein MetA-pathway of phenol...”
  • “...mey . ter . van . wolb . yan . b-OMPs LIC10496 LIC10714 LIC10881* LIC10896* LIC10964 LIC11086 LIC11211 LIC11268 LIC11458 LIC11506 LIC11623 LIC12254 LIC12374 LIC12575 LIC13477 LIC20019 LIC20087 LIC20151 OM lipoproteins LIC10024 LIC10647 LIC10713 LIC11003 LIC11755 LIC12048 LIC12690 LIC13411 LIC20172 The search for leptospiral orthologs was...”
• A model system for studying the transcriptomic and physiological changes associated with mammalian host-adaptation by Leptospira interrogans serovar Copenhageni
  Caimano, PLoS pathogens 2014
  • “...1.46E-02 LIC13465 Gly tRNA 4.69 1.69E-02 Cell Processes/Transport LIC11694 TonB-dependent outer membrane receptor 14.85 2.26E-13 LIC10964 phuR TonB-dependent outer membrane hemin receptor 3.46 2.23E-02 LIC20149 Multidrug-efflux transporter 2.82 4.22E-02 LIC12992 sulP Sulfate permease 2.81 4.05E-03 DNA Metabolism and Cell Division LIC11467 rcc1 Regulator of chromosome condensation...”
  • “...analysis, L. interrogans encodes at least 13 putative TB-DRs [58] , however, only two ( LIC10964 and LIC11694 ) were upregulated within DMCs ( Table 3 and Table S4 ). While most often associated with iron uptake, TB-DRs also may bind vitamin B 12 , a...”
• Genome-wide subcellular localization of putative outer membrane and extracellular proteins in Leptospira interrogans serovar Lai genome using bioinformatics approaches
  Viratyosin, BMC genomics 2008
  • “...vote Lai Locus Copen Locus Protein annotation LA2375 LIC11570 General secretory pathway protein D LA3149 LIC10964 Hemin receptor/TonB-dependent outer membrane hemin receptor LB328 LIC20250 Outer membrane protein OmpA/PG-associated CM protein LA3615 LIC10592 Outer membrane protein OmpA family/PG-associated CM protein LA1963 LIC11941 Outer membrane protein precursor CzcC/heavy...”
• Comparative and functional genomic analyses of iron transport and regulation in Leptospira spp
  Louvel, Journal of bacteriology 2006
  • “...LA3102 LIC10998 TB-DR -barrel OMP/plug domain NH LA3149 LIC10964 TB-DR NH LA3258 LIC10881 e-09 (22); E. coli P76115 e-41 (26); Salmonella enterica Q56145 e-11...”
• Genome features of Leptospira interrogans serovar Copenhageni
  Nascimento, Brazilian journal of medical and biological research = Revista brasileira de pesquisas medicas e biologicas 2004
  • “...the transport of iron dicitrate (LIC10714), hemin (LIC10964), ferric hydroxamate (LIC11345) and ferrienterobactin (LIC12998). In addition, an orthologue of the...”
  • “...of TonB-dependent OMPs: LIC20151, LIC20214, LIC10998, LIC10964, LIC10714, LIC12374, LIC12898, LIC12998, LIC11694, LIC11345, LIC10882, LIC10881, and LIC10896....”

Or search for genetic data about PF09430 in the Fitness Browser