Family Search for PF09995 (MPAB_Lcp_cat)
April 2024: See Interactive Tools for Functional Annotation of Bacterial Genomes for advice on using these tools.
PF09995 hits 38 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.
MAP0660 hypothetical protein from Mycobacterium avium subsp. paratuberculosis str. k10
Aligns to 64:300 / 357 (66.4%), covers 99.6% of PF09995, 256.7 bits
Rv0826 hypothetical protein from Mycobacterium tuberculosis H37Rv
Aligns to 59:295 / 351 (67.5%), covers 99.6% of PF09995, 253.4 bits
- Antigen identification strategies and preclinical evaluation models for advancing tuberculosis vaccine development
Chugh, NPJ vaccines 2024 - Small RNA MTS1338 Configures a Stress Resistance Signature in Mycobacterium tuberculosis
Martini, International journal of molecular sciences 2023 - “...higB mazE6 mazF6 Insertion seqs and phages Rv3428c Conserved hypotheticals (unknown function) Rv1954A Rv0140 Rv0142 Rv0826 Rv1044 Rv1357c Rv1989c Rv1993c Rv2035 Rv2466c cadI Rv3054c Rv3182 Rv3188 Rv3189 Rv3659c Rv0259c H 2 O 2 Regulatory proteins Rv0260c Rv1129c Rv1395 Rv1473A cmtR Rv0792c Rv2034 Rv2642 whiB6 Information pathways...”
- “...Insertion seqs and phages Rv0095c Rv0829 Conserved hypotheticals (unknown function) Rv0259c Rv2015c Rv1278 Rv1765c Rv0791c Rv0826 cadI Rv3659c Rv2035 Rv2422 NO Regulatory proteins Rv0196 Rv0792c kmtR csoR Rv1219c Rv1395 Rv1674c furA Rv1990c cmtR Rv2034 Rv2250c Rv2642 Rv2989 Rv3183 Rv3334 Rv3840 whiB6 Cell wall and cell processes...”
- The Biological and Clinical Aspects of a Latent Tuberculosis Infection
Khabibullina, Tropical medicine and infectious disease 2022 - “...nutrient starvation (Rv0287/88, Rv0470c, Rv0640, Rv0645, Rv1221, Rv1284, Rv1980, Rv2873, Rv3614/15, Rv3616, and Rv3865), hypoxia (Rv0826, Rv0991c, Rv1221, Rv1284, Rv2007, and Rv2626c), vitamin C exposure (Rv2626c, Rv0467, Rv1221, Rv0991, Rv3615c, and Rv3616c), and intra-phagosomal infection in naive and activated macrophages (Rv0467, Rv0642, Rv0826, Rv1121, Rv1980, Rv2007,...”
- In-vivo expressed Mycobacterium tuberculosis antigens recognised in three mouse strains after infection and BCG vaccination
Coppola, NPJ vaccines 2021 - “...Coppola 2016 3 Rv0470c PcaA IVE-TB Coppola 2016 4 Rv0642c MmaA4 IVE-TB Coppola 2016 5 Rv0826 Conserved hypothetical protein IVE-TB/ latency antigen Coppola 2016; Rustad 2008 6 Rv0991 Conserved serine rich protein IVE-TB Coppola 2016 7 Rv1131 PrpC IVE-TB Coppola 2016 8 Rv1221 SigE IVE-TB Coppola...”
- “...mice (Fig. 1b ). From these antigens, only one was recognised by all mouse strains (Rv0826), five by C57BL/6 and C3HeB/FeJ (Rv1886, Rv0440, Rv1980, Rv1791 and Rv1733), and 3 by C57BL/6 and BALB/c mice (Rv1131, Rv1221 and Rv0470). In the C57BL/6 mice and, to a lesser...”
- A Mycobacterium tuberculosis Specific IgG3 Signature of Recurrent Tuberculosis
Fischinger, Frontiers in immunology 2021 - “...and NR-49425), LAM (BEI resources, NR-14848), Hspx BEI resources, (NR-49428), Ag85AB complex (BEI resources, NR-14855), RV0826 and RV1363 (provided by Tom Ottenhoff, TBVI) was used. In brief, antigens were coupled to individual fluorescent magnetic carboxyl-modified microspheres (MagPlex, Luminex Corporation) using 1-Ethyl-3- (3-dimethylaminopropyl) carbodiimide (EDC) (Thermo Fisher...”
- “...are PPD, EDAT6/CFP10 and LAM, additional antigens for titer and Fc-receptor binding include Hspx, Ag85, RV0826 and RV1363, in this order. (B) IgG1 and IgG3 titers are shown over time for the recurrent TB group (top) and the no recurrence group (bottom) for PPD, ESAT6/CFP10, LAM...”
- Phenotypic and genotypic features of the Mycobacterium tuberculosis lineage 1 subgroup in central Vietnam
Le, Scientific reports 2021 - “...to be significantly associated with ZERO strains, and the most significant SNVs indicated V1A in Rv0826 and A136A in fadE27 (Rv3505) (corrected P value=2.13E14; Supplementary Table S4 b). These two SNVs were exclusively seen in the ZERO-clade strains (Fig. 1 a). We also confirmed the specificity...”
- The In Vivo Transcriptomic Blueprint of Mycobacterium tuberculosis in the Lung
Coppola, Frontiers in immunology 2021 - “...Rv0468, Rv3865, and Rv1846) and ten ranked in the interquartile range (Rv1980c, Rv2873, Rv2941, Rv2007c, Rv0826, Rv2461c, Rv1791c, Rv0645c, Rv0423c, and Rv0440) ( Figure3A ). All these genes, except nine (detected in six samples: Rv0826, Rv0991, Rv2873, Rv3407; detected in five samples: Rv1285, Rv2608, Rv2626, Rv3619;...”
- Cell-Mediated Immune Responses to in vivo-Expressed and Stage-Specific Mycobacterium tuberculosis Antigens in Latent and Active Tuberculosis Across Different Age Groups
Coppola, Frontiers in immunology 2020 - “...Rv0645 MmaA1 IVE-TB ( 11 ) 13 Rv0824c Acyl-desaturase DesA1 IVE-TB ( 11 ) 14 Rv0826 Conserved hypothetical protein IVE-TB ( 11 ) 15 Rv0991 Conserved serine rich protein IVE-TB ( 11 ) 16 Rv1038c EsxJ IVE-TB ( 11 ) 17 Rv1131 PrpC IVE-TB ( 11...”
- More
Mb0849 CONSERVED HYPOTHETICAL PROTEIN from Mycobacterium bovis AF2122/97
Aligns to 59:295 / 351 (67.5%), covers 99.1% of PF09995, 252.3 bits
WP_083036515 oxygenase MpaB family protein from Mycolicibacter algericus
Aligns to 17:242 / 284 (79.6%), covers 97.8% of PF09995, 242.6 bits
PA4734 hypothetical protein from Pseudomonas aeruginosa PAO1
Aligns to 42:272 / 293 (78.8%), covers 100.0% of PF09995, 242.2 bits
PP4703 conserved hypothetical protein from Pseudomonas putida KT2440
Aligns to 42:272 / 289 (79.9%), covers 100.0% of PF09995, 236.5 bits
- New transposon tools tailored for metabolic engineering of gram-negative microbial cell factories
Martínez-García, Frontiers in bioengineering and biotechnology 2014 - “...KT-K2-G4 ME-O 1,373,720 PP1199 Hypothetical protein KT-K2-S1 ME-O 2,904,080 PP2556 Chromate transporter KT-K2-S2 ME-O 5,347,381 PP4703 + Hypothetical protein KT-K2-S3 ME-O 1,542,387 PP1353 + Mechanosensitive ion channel protein MscS KT-K2-S4 ME-O 5,892,275 PP5166 Fis family transcriptional regulator KT-K2-G1-S1 ME-O 3,635,742 PP3202 + Predicted exporter of the...”
Rv1645c hypothetical protein from Mycobacterium tuberculosis H37Rv
Mb1672c CONSERVED HYPOTHETICAL PROTEIN from Mycobacterium bovis AF2122/97
Aligns to 19:253 / 351 (67.0%), covers 99.1% of PF09995, 231.3 bits
- A Persistent Tuberculosis Outbreak in the UK Is Characterized by Hydrophobic fadB4-Deficient Mycobacterium tuberculosis That Replicates Rapidly in Macrophages
Farzand, mBio 2022 - “...RD750 and ctpG deletions and also for the novel deletions (i.e., nrdB , fadB4 , Rv1645c , and plcC ) that have been observed in the Lro_strain_10698/10699 genomes. The phylogeny mapping and BLASTn results indicated that the nrdB deletion would be a useful identifier for a...”
- MDR-TB Outbreak among HIV-Negative Tunisian Patients followed during 11 Years
Dekhil, PloS one 2016 - “...additional IS 6110 band (12-banded IS 6110 RFLP profile) resulting from IS 6110 insertion between Rv1645c and Rv1646c [ 18 ]. To distinguish between the two IS 6110 RFLP profiles of the outbreak strains, we performed an insertion site-specific PCR using primers flanking IS 6110 insertion...”
- Generation and screening of a comprehensive Mycobacterium avium subsp. paratuberculosis transposon mutant bank
Rathnaiah, Frontiers in cellular and infection microbiology 2014 - “...survival in BoMac cells and invasion in MDMs 30H9 Vaccine 319 Tn 5367 within MAP1566 (Rv1645c) near 5-end coding sequence MAP1566 DCS hypersusceptible; attenuated for invasion in BoMac cells ORF downstream from ModA (MAP1565) in the mod operon 40A9 Vaccine 318 Tn 5367 between MAP0282c (Rv3860)...”
- “...passage; attenuated in MDMs by increased killing rate STM68 Vaccine 315 Tn 5370 within MAP1566 (Rv1645c) near 3-end coding sequence MAP1566 Identified as MAP1566 insertion by direct sequencing of Tn 5370 signature-tagged mutagenesis pool ORF downstream from ModA (MAP1565) in the mod operon a Laboratory designation...”
- Assessment of live candidate vaccines for paratuberculosis in animal models and macrophages
Scandurra, Infection and immunity 2010 - “...hypothetical protein gene with homology to M. tuberculosis Rv1645c (8). With the sequencing of the M. paratuberculosis genome (28), this gene has been...”
- Novel streptomycin resistance gene from Mycobacterium fortuitum
Ramón-García, Antimicrobial agents and chemotherapy 2006 - “...present in some M. fortuitum clinical isolates. Rv1645c from M. tuberculosis (conserved hypothetical proteins; 37.8 and 44.7% amino acid identity,...”
- Regulation of Mycobacterium tuberculosis whiB3 in the mouse lung and macrophages
Banaiee, Infection and immunity 2006 - “...RT PCR Rv1106c RT PCR Rv1200 RT PCR Rv1205 RT PCR Rv1645c RT PCR Rv1651c RT PCR Rv1874 RT PCR Rv2031c (acr) RT PCR Rv2179c RT PCR Rv2780 (ald) RT PCR Rv3106...”
- Microarray analysis of the Mycobacterium tuberculosis transcriptional response to the acidic conditions found in phagosomes
Fisher, Journal of bacteriology 2002 - “...MT3436 Rv1897c Rv2803c Rv3445c Rv3151 Rv3907c Rv3361c Rv3655c Rv1645c Rv3481c Rv3679 Rv2305 MT2405 Rv3541c MT2038 Rv2893 MT0740.1 Rv2599 Rv2791c Rv3409c a nuoA...”
- Circulating Mycobacterium bovis peptides and host response proteins as biomarkers for unambiguous detection of subclinical infection
Lamont, Journal of clinical microbiology 2014 - “...MB1929 MB1886c MB1192 MB2441c MB2275 MB2122c MB1672c MB1554c (pks5) MB1895c MB3729c MB1268 MB3017c Transcriptional regulator (LuxR family) Methyltransferase...”
- Genome-level analyses of Mycobacterium bovis lineages reveal the role of SNPs and antisense transcription in differential gene expression
Golby, BMC genomics 2013 - “...9 possible secreted lipase sSNP at 1778879; C-T in 1121/01 only T7 2 1840174-1840282 108 Mb1672c S 4 hypothetical protein T8 3 1932158-1932315 157 tRNA-Pro S 3 proline tRNA T9 5 1932452-1932707 255 Mb1749c S 4 toxin component of toxin-antitoxin system nSNP at 1932704; C-T (G...”
HZ99_22295 oxygenase MpaB family protein from Pseudomonas fluorescens
Aligns to 42:272 / 289 (79.9%), covers 100.0% of PF09995, 229.8 bits
MSMEG_3781 hypothetical protein from Mycobacterium smegmatis str. MC2 155
Aligns to 22:256 / 345 (68.1%), covers 99.1% of PF09995, 227.3 bits
MAH_RS21070 oxygenase MpaB family protein from Mycobacterium avium subsp. hominissuis TH135
Aligns to 49:282 / 314 (74.5%), covers 97.4% of PF09995, 222.8 bits
Rv0276 hypothetical protein from Mycobacterium tuberculosis H37Rv
Aligns to 41:274 / 306 (76.5%), covers 97.4% of PF09995, 220.8 bits
- An integrated whole genome analysis of Mycobacterium tuberculosis reveals insights into relationship between its genome, transcriptome and methylome
Gomez-Gonzalez, Scientific reports 2019 - “...TFTRs carrying potential eQTLs. Rv0275c is a potential regulator of its divergent oriented neighbouring gene Rv0276 . The ancient strains carried a mutation (S24L) in Rv0275c , which was associated with the under-expression of Rv0276 . Similarly, Rv3167c is a potential regulator of its divergent oriented...”
- “...this effect did not reach the statistical significance cut-off. In addition to the under-expression of Rv0276 , discussed above, three other genes ( Rv0520 , Rv2162c and Rv0826 ) were found to be under-expressed in ancient strains and are predicted to be regulated by Rv0275c ....”
- Mapping of genotype-phenotype diversity among clinical isolates of mycobacterium tuberculosis by sequence-based transcriptional profiling
Rose, Genome biology and evolution 2013 - “...binding of the regulators to upstream sequences will repress transcription of the adjacent divergent genes Rv0276 and Rv3168. Expression of Rv0276 follows Rv0275c in being 10-fold higher in Lineage 2, although it falls outside of the statistical cut-off ( P = 0.08), and Rv3178 expression is...”
- Sequence-based analysis uncovers an abundance of non-coding RNA in the total transcriptome of Mycobacterium tuberculosis
Arnvig, PLoS pathogens 2011 - “...77 Rv1793 esxN VI 71 * Rv0079 HP VI 70 * Rv2629 CHP V 68 Rv0276 CHP V 62 Rv3874 esxB VI 60 * Rv0569 CHP V 59 Rv1732c redox V 59 Rv1872c lldD2 I.B.6a 56 Rv3616c espA V 54 Rv2780 ald I.A.2 54 Rv1623c cydA...”
- Characterization of a Clp protease gene regulator and the reaeration response in Mycobacterium tuberculosis
Sherrid, PloS one 2010 - “...proteolytic subunit 2 Rv0251c heat shock protein hsp Rv2461c ATP-dependent clp protease proteolytic subunit 1 Rv0276 conserved hypothetical protein Rv2464c DNA glycosylase Rv0327c cytochrome P450 135A1 cyp135A1 Rv2465c ribose-5-phosphate isomerase Rv0332 conserved hypothetical protein Rv2504c succinyl-CoA:3-ketoacid-CoA transferase subunit Rv0350 chaperone protein dnaK Rv2516c hypothetical protein Rv0351...”
- Differential gene expression between Mycobacterium bovis and Mycobacterium tuberculosis
Rehren, Tuberculosis (Edinburgh, Scotland) 2007 - “...Probable transcriptional regulatory protein (tetr/acrr-family) Rv0276 40.5 0.00818 Conserved hypothetical protein Rv0520 7.4 0.0487 Possible...”
- responses of mycobacterium tuberculosis to growth in the mouse lung
Dubnau, Infection and immunity 2005 - “...Rv0270 ........fadD2; fatty acid oxidation Rv0276 ........Unknown Rv0288 ........esxH; ESAT-6 family of antigens Rv0315 ........Unknown Rv0406c.......Unknown...”
- Transcription regulation by the Mycobacterium tuberculosis alternative sigma factor SigD and its role in virulence
Raman, Journal of bacteriology 2004 - “...MT0196 MT1020 MT1628 MT2422 MT2890 MT3258 Rv0257c Rv0276 Rv0309 Rv1687c Rv1779c Rv2159c Rv2348c Rv2633c Rv2699c Rv2822c Rv3169 Rv3354 Rv3614c Rv3615c Rv3675...”
WP_085129074 oxygenase MpaB family protein from Mycolicibacter engbaekii
Aligns to 37:272 / 304 (77.6%), covers 97.8% of PF09995, 215.3 bits
AO090005000013 No description from Aspergillus oryzae RIB40
Aligns to 54:275 / 305 (72.8%), covers 93.0% of PF09995, 199.6 bits
- Assessing the genome-wide effect of promoter region tandem repeat natural variation on gene expression
Elmore, G3 (Bethesda, Md.) 2012 - “...Growth-arrest-specific protein 2 domain Cubic 0.95 0.004 AO090701000375 RhoGAP domain Quadratic 0.96 0.002 A. oryzae AO090005000013 Uncharacterized protein Cubic 0.96 1.00E-04 combined AO090003000121 6-phosphogluconate dehydrogenase Cubic 0.67 0.009 AO090012000871 PAP2 domain-containing protein Cubic 0.64 0.009 Minisatellite A. flavus AO090005000959 Hypothetical protein Linear (reciprocal) 0.83 0.002 AO090038000210...”
Rv2237 hypothetical protein from Mycobacterium tuberculosis H37Rv
Mb2261 CONSERVED HYPOTHETICAL PROTEIN from Mycobacterium bovis AF2122/97
Aligns to 1:223 / 255 (87.5%), covers 93.5% of PF09995, 196.0 bits
- Identification of two Mycobacterium tuberculosis H37Rv ORFs involved in resistance to killing by human macrophages
Miller, BMC microbiology 2001 - “...expressing Rv2233 (first open column), Rv2234 (first /// lines), Rv2235 (first \\\ lines), Rv2236c (hatched), Rv2237 (horizontal stripes), Rv2238c (vertical stripes), Rv2239c (box pattern), Rv2240c (second open column), Rv2233-Rv2235 (second /// lines), or Rv2238c-Rv2240c (second \\\ lines). Error bars represent the standard deviation in the ratio...”
- “...(pHIP7) Rv2235 This study M. smegmatis LR222 (pHIP8) Rv2236c This study M. smegmatis LR222 (pHIP9) Rv2237 This study M. smegmatis LR222 (pHIP10) Rv2238c This study M. smegmatis LR222 (pHIP11) Rv2239c This study M. smegmatis LR222 (pHIP12) Rv2240c This study M. smegmatis LR222 (pHIP13) Rv2233, Rv2234, Rv2235...”
- Single nucleotide polymorphisms in the Mycobacterium bovis genome resolve phylogenetic relationships
Joshi, Journal of clinical microbiology 2012 - “...85 86 87 88 89 90 91 Mb0244 Mb1072c Mb1404 Mb1495 Mb1794c-1 Mb1794c-2 Mb1860 Mb2067c Mb2261 Mb2439c Mb2558 T T A C G T T A A C A T T A C G T T A A C A C/Tb T/Ga...”
- Feedback for the Seventh International AIDS conference, Florence 1991
, Genitourinary medicine 1991
CC2570 hypothetical protein from Caulobacter crescentus CB15
Aligns to 31:260 / 299 (76.9%), covers 98.7% of PF09995, 180.3 bits
- DNA-Binding Properties of YbaB, a Putative Nucleoid-Associated Protein From Caulobacter crescentus
Pal, Frontiers in microbiology 2021 - “...CB15N Synchronizable derivative of wild-type strain CB15 (NA 1000) Evinger and Agabian, 1977 CJW2141 CB15N cc2570 :pTC67 ftsI (Ts) Costa et al., 2008 RP42 CB15N xyl X:pXCFPN-5- ybab Cc This work RP43 CB15N/pPAL4 This work RP45 CB15N cc2570 :pTC67 ftsI (Ts) xyl X:pXCFPN-5- ybab Cc This...”
- “...associated protein. FIGURE 3 YbaB Cc colocalizes with nucleoid in vivo . RP44 cells (CB15N cc2570 :pTC67 ftsI (Ts) xyl X:pXCFPN-5- ybab Cc ) were cultured at 30C for 1 h and then shifted to the restrictive temperature (37C) for 4.5 h in PYE medium, followed...”
- Localization of PBP3 in Caulobacter crescentus is highly dynamic and largely relies on its functional transpeptidase domain
Costa, Molecular microbiology 2008 - “...::pNJH17 xylX ::pTC34-3 CJW2136 CB15N xylX ::pTC49 CJW2137 CB15N vanA ::pNJH17 xylX ::pTC49 CJW2141 CB15N cc2570 ::pTC67 ftsI (Ts) CJW2142 CB15 divA305 str-179 cc2570 ::pTC67 CJW2143 CB15N ftsI ::pTC71 ftsZ ::pBJM1 CJW2144 CB15N ftsI ::pTC71 CJW2235 CB15N cc2570 ::pTC67 ftsI (Ts) xylX ::pTC34-3 CJW2236 CB15N cc2570...”
- “...::pTC49 CJW2577 CB15N cc2570 ::pTC67 ftsI (Ts) vanA ::pMT400 CJW2851 CB15N xylX ::pRP3 CJW2852 CB15N cc2570 ::pTC67 ftsI (Ts) xylX ::pRP3 PC7167 CB15 divA305 str-179 ( ftsI (Ts)) ( Ohta et al ., 1997 ) YB1585 CB15N ftsZ ::pBJM1 ( Wang et al ., 2001 )...”
MAP1566 hypothetical protein from Mycobacterium avium subsp. paratuberculosis str. k10
Aligns to 43:290 / 357 (69.5%), covers 99.6% of PF09995, 152.2 bits
- Vaccine approaches for the 'therapeutic management' of Mycobacterium avium subspecies paratuberculosis infection in domestic livestock
Gupta, The veterinary quarterly 2019 - “...Washington State University MAP1047 ( relA ) K-10 Park et al. 2014 University of Nebraska MAP1566 K-10 Rathnaiah et al. 2014 University of Nebraska MAP3695 and fadE5 K-10 Rathnaiah et al. 2014 University of Nebraska MAP0460 ( lsr2 ) K-10 Rathnaiah et al. 2014 University of...”
- “...2013 University of Wisconsin MAP1872c ( mbtH_2 ) ATCC19698 Kabara and Coussens, 2012 AgResearch NZ MAP1566 strain 989 Scandurra et al. 2010 AgResearch NZ MAP0011 ( ppiA ) K-10 Scandurra et al. 2010 Washington State University MAP3893c ( pknG ) K-10 Park et al. 2011 Washington...”
- Pathogenesis, Molecular Genetics, and Genomics of Mycobacterium avium subsp. paratuberculosis, the Etiologic Agent of Johne's Disease
Rathnaiah, Frontiers in veterinary science 2017 - “...MAP transposon library of 13,536 mutants, identifying genes potentially involved in pathogenesis (e.g., MAP1152, MAP1156, MAP1566, and lsr2 ) ( 128 ). Another study used the Himar1 transposon in MAP to isolate 111 mutants attenuated in BMDM from a random screen of 2,290 ( 132 )....”
- Generation and screening of a comprehensive Mycobacterium avium subsp. paratuberculosis transposon mutant bank
Rathnaiah, Frontiers in cellular and infection microbiology 2014 - “...insertion sites mapped upstream from the MAP1152-MAP1156 cluster, internal to either the Mod operon gene MAP1566 or within the coding sequence of lsr2 , and several intergenic regions. Growth curves in broth cultures, invasion assays and kinetics of survival and replication in primary bovine macrophages were...”
- “...the ATG start codon. For mutant 30H9, transposon insertion sites were mapped as internal to MAP1566. Serendipitously, another screen from a signature-tagged mutagenesis experiment (ca. 300 mutants) identified a Tn 5370 mutant (STM68) with an insertion in the same gene as in 30H9, but the insertion...”
- Evaluation of eight live attenuated vaccine candidates for protection against challenge with virulent Mycobacterium avium subspecies paratuberculosis in mice
Bannantine, Frontiers in Cellular and Infection Microbiology. 2014 - Screening of Mycobacterium avium subsp. paratuberculosis mutants for attenuation in a bovine monocyte-derived macrophage model
Lamont, Frontiers in cellular and infection microbiology 2014 - “...9th bp and 319th bp of the gene 0.0336 315 STM68 (GPM401) K-10 Internal to MAP1566, insertion is located near the 3' end Transposon mutagenesis; phAE94 to introduce Tn5370 (Liveneh et al., 2005 ) 0.0265 316 2E11 (GPM402) K-10 Intergenic, 137 bp upstream from fadE5 ,...”
- “...40A9 (GPM404) K-10 Intergenic, between MAP0282c and MAP0283c 0.018 319 30H9 (GPM405) K-10 Internal to MAP1566 0.0146 320 3H4 (GPM406) K-10 Intergenic, between MAP2296c and MAP2297c 0.0186 321 4H2 (GPM407) K-10 Intergenic between MAP1150c and MAP1151c 0.0130 322 WAg906 (TM58) 989 (C strain; Type II) MAP1566...”
- A rational framework for evaluating the next generation of vaccines against Mycobacterium avium subspecies paratuberculosis
Bannantine, Frontiers in cellular and infection microbiology 2014 - “...MAP0460 ( lsr2 ) K-10 No No Park et al., 2008a University of Nebraska 315 MAP1566 K-10 Yes Yes Rathnaiah et al., in review University of Nebraska 316 MAP3695 and fadE5 K-10 Yes Yes Rathnaiah et al., in review University of Nebraska 317 MAP0460 ( lsr2...”
- “...MAP0282c and 0283c K-10 Yes Yes Rathnaiah et al., in review University of Nebraska 319 MAP1566 K-10 Yes Yes Rathnaiah et al., in review University of Nebraska 320 MAP2296c and 2297c K-10 Yes No Rathnaiah et al., in review University of Nebraska 321 MAP1150c and 1151c...”
- Evaluation of eight live attenuated vaccine candidates for protection against challenge with virulent Mycobacterium avium subspecies paratuberculosis in mice
Bannantine, Frontiers in cellular and infection microbiology 2014 - “...None K-10 K-10-vaccinated, challenged 3 Silirum (killed vaccine) None 316F Vaccinated, challenged 4 Strain 315 MAP1566 (3 end) K-10 Vaccinated, challenged 5 Strain 316 Intergenic between MAP3695 and MAP3694c (FadE5) K-10 Vaccinated, challenged 6 Strain 317 MAP0460 K-10 Vaccinated, challenged 7 Strain 318 Intergenic between MAP0282c...”
- Evaluation of novel oral vaccine candidates and validation of a caprine model of Johne's disease
Hines, Frontiers in cellular and infection microbiology 2014 - “...316 vaccine (between MAP3695 and FadE5) * Vaccinated, challenged Group 4 (10 kids) 315 vaccine (MAP1566) * Vaccinated, challenged Group 5 (10 kids) 319 vaccine (MAP1566) * Vaccinated, challenged Group 6 (10 kids) 318 vaccine (between MAP0282c and MAP0283c) * Vaccinated, challenged Group 7 (10 kids)...”
- “...JDIP ID# Name Sequence (5-3) Length ORF ORF POI WT amplicon Mutant amplicon 315/STM68 jdip005-F MAP1566 Forward GCTCTAGAGCTGGCATCAGGGCACTCAAGAAA 32 MAP1566 1074 1032 1179 3700 estimated jdip005-R MAP1566 Reverse CCCAAGCTTGGGTATTCGCTGCACAGCATGTCAGGT 36 316/2E11 jdip006-F 2E11-IP-F GCTGCAGCAACCAGCCGA 18 FadE5 1 1836 137 bp upstream 1845 5241 jdip006-R 2E11-IP-R CCACCGTCACCGCAGGTAGA...”
- More
MAV_2862 hypothetical protein from Mycobacterium avium 104
Aligns to 55:302 / 369 (67.2%), covers 99.6% of PF09995, 151.7 bits
HCBG_04208 uncharacterized protein from Histoplasma capsulatum G186AR
Aligns to 90:321 / 361 (64.3%), covers 95.7% of PF09995, 146.4 bits
- Extracellular Vesicle-Mediated RNA Release in Histoplasma capsulatum
Alves, mSphere 2019 - “...MR Conserved hypothetical protein HCBG_04193 3R 3R Conserved hypothetical protein HCBG_04201 3F Hypothetical protein HCBG_04201 HCBG_04208 3F 3F Conserved hypothetical protein HCBG_04365 MF Hypothetical protein HCBG_04365 HCBG_04371 5R / 5F Bifunctional uridylyltransferase uridylyl-removing enzyme HCBG_04380 3R 3R Predicted protein HCBG_04393 3R Protein HCBG_04452 3R 3R Predicted...”
A1S_0172 hypothetical protein from Acinetobacter baumannii ATCC 17978
Aligns to 65:306 / 351 (68.9%), covers 95.2% of PF09995, 89.3 bits
FFUJ_00037 uncharacterized protein from Fusarium fujikuroi IMI 58289
Aligns to 111:355 / 461 (53.1%), covers 96.5% of PF09995, 85.8 bits
- The GATA-Type Transcription Factor Csm1 Regulates Conidiation and Secondary Metabolism in Fusarium fujikuroi
Niehaus, Frontiers in microbiology 2017 - “...STC1 cluster because STC1 ( FFUJ_00036 ) and one adjacent gene with unknown function ( FFUJ_00037 ) are up-regulated in the csm1 strain in media with both 6 and 60 mM glutamine ( Figure 5 and Supplementary Table S2). The genes upstream ( FFUJ_00034 and FFUJ_00035...”
- “...F. fujikuroi genome ( Niehaus et al., 2016a ). The gene next to STC1 ( FFUJ_00037 ) is transcribed from the same promoter in opposite direction and displays similarly elevated expression levels. Such a bidirectional arrangement of two co-regulated genes has also been reported for several...”
nfa21740 hypothetical protein from Nocardia farcinica IFM 10152
Aligns to 124:360 / 413 (57.4%), covers 89.6% of PF09995, 70.3 bits
SCO0564 hypothetical protein from Streptomyces coelicolor A3(2)
Aligns to 87:380 / 386 (76.2%), covers 89.6% of PF09995, 69.6 bits
- Cross-Recognition of Promoters by the Nine SigB Homologues Present in Streptomyces coelicolor A3(2)
Sevcikova, International journal of molecular sciences 2021 - “...Operon Directed by Identified Promoter Encoded Protein/Function SCO0279 putative glycosyl hydrolase SCO0566 , SCO0565 , SCO0564 , SCO0563 putative membrane protein, polyprenyl synthase, HP, HP SCO0775 HP SCO1089 , SCO1088 , SCO1087 , SCO1086 HP, putative oxidoreductase, L-treonine aldolase, HP SCO1566 putative acetyltransferase SCO2315 putative membrane...”
NF2_RS04895 oxygenase MpaB family protein from Nocardia farcinica NBRC 15532
Aligns to 124:361 / 413 (57.6%), covers 89.6% of PF09995, 69.1 bits
Q1HUS3 endo-cleaving rubber dioxygenase (EC 1.13.11.87) from Nocardia farcinica (see 2 papers)
Aligns to 124:360 / 413 (57.4%), covers 89.1% of PF09995, 68.9 bits
MSMEG_6811 oxygenase MpaB family protein from Mycolicibacterium smegmatis MC2 155
MSMEG_6811 hypothetical protein from Mycobacterium smegmatis str. MC2 155
Aligns to 122:363 / 407 (59.5%), covers 85.7% of PF09995, 66.8 bits
A0A165QBG6 endo-cleaving rubber dioxygenase (EC 1.13.11.87) from Rhodococcus rhodochrous (see paper)
Aligns to 124:359 / 408 (57.8%), covers 89.1% of PF09995, 64.4 bits
ACTI_59640 oxygenase MpaB family protein from Actinoplanes sp. OR16
Aligns to 112:343 / 389 (59.6%), covers 84.3% of PF09995, 57.7 bits
5o1lA / Q3L8N0 Structure of latex clearing protein lcp in the open state with bound imidazole (see paper)
Aligns to 99:333 / 375 (62.7%), covers 91.7% of PF09995, 56.3 bits
- Ligands: protoporphyrin ix containing fe; (r,r)-2,3-butanediol (5o1lA)
lcp / Q3L8N0 endo-cleaving rubber dioxygenase Lcp (EC 1.13.11.87) from Streptomyces sp. (strain K30) (see 6 papers)
LCP_STRK3 / Q3L8N0 Rubber oxygenase; Latex clearing protein; b-type cytochrome Lcp; EC 1.13.-.- from Streptomyces sp. (strain K30) (see 5 papers)
Q3L8N0 exo-cleaving rubber dioxygenase (EC 1.13.11.85); endo-cleaving rubber dioxygenase (EC 1.13.11.87) from Streptomyces sp. K30 (see 9 papers)
Aligns to 127:361 / 407 (57.7%), covers 91.7% of PF09995, 56.0 bits
- function: Involved in the initial step of rubber degradation (PubMed:22950008, PubMed:15638519, PubMed:18606806). Catalyzes the oxidative C-C cleavage of poly(cis-1,4-isoprene) in synthetic as well as in natural rubber by the addition of oxygen (O2) to the double bonds, leading to a mixture of oligonucleotide-isoprenoids with terminal keto and aldehyde groups (endo-type cleavage) (PubMed:25819959, PubMed:24907333). The cleavage products are of different lengths, ranging from C20 (four isoprene units) to higher oligo-isoprenoids (PubMed:24907333). Is not able to cleave low- molecular-weight substrate analogs with isoprenoid structure such as squalene (1,4-trans-isoprenoid), carotenoids, or alpha-tocopherol (PubMed:24907333).
cofactor: heme b (Binds 1 b-type heme group non-covalently per subunit.)
disruption phenotype: Cells lacking this gene exhibit reduced growth in medium containing poly(cis-1,4-isoprene) as the sole carbon and energy source. Additionally, they show no detectable Lcp activity on latex overlay agar plates, being unable to form a clear zone and to produce aldehydes. Complementation with the wild-type lcp gene restores the wild-type phenotype. - Cleavage of Rubber by the Latex Clearing Protein (Lcp) of Streptomyces sp. Strain K30: Molecular Insights
Röther, Applied and environmental microbiology 2016 (secret)
H6N4Z1 endo-cleaving rubber dioxygenase (EC 1.13.11.87) from Gordonia polyisoprenivorans (see paper)
Aligns to 102:339 / 388 (61.3%), covers 91.3% of PF09995, 54.4 bits
ACTI_59630 oxygenase MpaB family protein from Actinoplanes sp. OR16
Aligns to 117:354 / 399 (59.6%), covers 88.7% of PF09995, 54.3 bits
BLA60_08475 oxygenase MpaB family protein from Actinophytocola xinjiangensis
Aligns to 128:359 / 405 (57.3%), covers 90.4% of PF09995, 54.2 bits
- Rubber Degrading Strains: Microtetraspora and Dactylosporangium
Basik, Polymers 2021 - “...lcp1 gene (1281 bp) showed 80.20% blast homology to latex clearing protein of Actinophytocola xinjiangensis (BLA60_08475). Lcp1 amino acid sequence was 51.37% similar to characterized Lcp of Gordonia polyisoprenivorans VH2 (ABV68923.1). The lcp2 gene (MW659699) is located on contig 3 at 28,435 to 27,206 bp, 277...”
SCO6780 secreted protein from Streptomyces coelicolor A3(2)
Aligns to 118:353 / 401 (58.9%), covers 93.0% of PF09995, 54.1 bits
ACTI_69520 oxygenase MpaB family protein from Actinoplanes sp. OR16
Aligns to 118:356 / 404 (59.2%), covers 88.7% of PF09995, 44.6 bits
MAB_3076 hypothetical protein from Mycobacterium abscessus ATCC 19977
Aligns to 148:381 / 454 (51.5%), covers 64.8% of PF09995, 41.9 bits
MPAB_PENRF / W6R4H8 ER-bound oxygenase mpaB; Mycophenolic acid biosynthesis cluster protein B; EC 1.-.-.- from Penicillium roqueforti (strain FM164) (see paper)
Aligns to 81:296 / 298 (72.5%), covers 88.3% of PF09995, 33.5 bits
- function: ER-bound oxygenase; part of the gene cluster that mediates the biosynthesis of mycophenolic acid (MPA), the first isolated antibiotic natural product in the world obtained from a culture of Penicillium brevicompactum in 1893 (PubMed:26751579). MpaB catalyzes the oxidative cleavage the C19-C20 double bond in farnesyl-DHMP (FDHMP) to yield FDHMP-3C via a mycophenolic aldehyde intermediate (By similarity). The first step of the pathway is the synthesis of 5- methylorsellinic acid (5MOA) by the cytosolic polyketide synthase mpaC. 5MOA is then converted to the phthalide compound 5,7-dihydroxy-4,6- dimethylphthalide (DHMP) by the endoplasmic reticulum-bound cytochrome P450 monooxygenase mpaDE. MpaDE first catalyzes hydroxylation of 5-MOA to 4,6-dihydroxy-2-(hydroxymethyl)-3-methylbenzoic acid (DHMB). MpaDE then acts as a lactone synthase that catalyzes the ring closure to convert DHMB into DHMP. The next step is the prenylation of DHMP by the Golgi apparatus-associated prenyltransferase mpaA to yield farnesyl- DHMP (FDHMP). The ER-bound oxygenase mpaB then mediates the oxidative cleavage the C19-C20 double bond in FDHMP to yield FDHMP-3C via a mycophenolic aldehyde intermediate. The O-methyltransferase mpaG catalyzes the methylation of FDHMP-3C to yield MFDHMP-3C. After the cytosolic methylation of FDHMP-3C, MFDHMP-3C enters into peroxisomes probably via free diffusion due to its low molecular weight. Upon a peroxisomal CoA ligation reaction, catalyzed by a beta-oxidation component enzyme acyl-CoA ligase ACL891, MFDHMP-3C-CoA would then be restricted to peroxisomes for the following beta-oxidation pathway steps. The peroxisomal beta-oxidation machinery than converts MFDHMP- 3C-CoA into MPA_CoA, via a beta-oxidation chain-shortening process. Finally mpaH acts as a peroxisomal acyl-CoA hydrolase with high substrate specificity toward MPA-CoA to release the final product MPA (PubMed:26751579) (Probable).
catalytic activity: 4-farnesyl-3,5-dihydroxy-6-methylphthalide + AH2 + 2 O2 = (4E,8E)-10-(4,6-dihydroxy-7-methyl-3-oxo-1,3-dihydro-2-benzofuran-5- yl)-4,8-dimethyldeca-4,8-dienoate + A + acetone + H(+) + H2O (RHEA:66688)
disruption phenotype: Results in dramatic reduction in MPA production.
CG31344 uncharacterized protein from Drosophila melanogaster
Aligns to 90:291 / 403 (50.1%), covers 65.7% of PF09995, 32.6 bits
- Molecular mechanisms underlying metamorphosis in the most-ancestral winged insect
Okude, Proceedings of the National Academy of Sciences of the United States of America 2022 - “...LC634400 1,915 Adenylate kinase 3 ( D. melanogaster ) 1 10 48 A5 LC634401 2,512 CG31344 ER-bound oxygenase ( D. melanogaster ) 4 10 17 A6 LC634402 1,525 Chitinase 10 ( D. melanogaster ) 2 10 26 A7 LC634403 1,850 CG9259 Ecdysteroid kinase-like protein ( D....”
- Episodes of Rapid Recovery of the Functional Activity of the ras85D Gene in the Evolutionary History of Phylogenetically Distant Drosophila Species
Chekunova, Frontiers in genetics 2021 - “...unannotated genomes were found using BLASTn or tblastn with the D. melanogaster ras85D, Rlb1 and CG31344 coding or amino acid sequence. The boundaries of non-coding sequences were revealed by the SRA-BLAST results according to the Sequence Read Archive Database NCBI (if any), or by alignment with...”
- “...ras85D gene in species of the virilis group [ GJ23372 (ortholog of the D. melanogaster CG31344 gene), GJ23373 ( D.m . Rpb7 ) and GJ23843 ( D.m. CG12241 )] are located at a distance of 5710kB in the D. melanogaster genome ( Supplementary Figure S3 )....”
- Oncogenic Pathways and Loss of the Rab11 GTPase Synergize To Alter Metabolism in Drosophila
Nie, Genetics 2019 - “...upd3* CG16959 CG7910 mus209 rho Pen CG13117 Act42A ImpL2* CG31344 CG6933 spz rempA Mip CG32284 Cht4 CG13488 Jupiter LysX cv-2 Mmp2 Sox21a RnrL GstD2 Pvf1...”
- The enhancer of trithorax and polycomb gene Caf1/p55 is essential for cell survival and patterning in Drosophila development
Anderson, Development (Cambridge, England) 2011 - “...resulted in the inclusion of several other genes: Rpb7, CG31344, Art3, mRPS10 and the 3 end of CG12241. The Caf1GR construct rescues the lethality of the most...”
- The circadian clock interacts with metabolic physiology to influence reproductive fitness
Xu, Cell metabolism 2011 - “...molecular function is unknown AR ZT13-16 CG1311 3.51E-02 2.25E-02 molecular function is unknown AR ZT21-0 CG31344 2.05E-02 2.93E-02 molecular function is unknown AR ZT21-0 CG9542 1.04E-02 3.21E-02 molecular function is unknown AR ZT9-12 CG7330 9.32E-04 3.32E-02 molecular function is unknown AR ZT1-4 CG30343 3.25E-03 8.90E-03 molecular...”
LOC105675090 uncharacterized protein LOC105675090 from Linepithema humile
Aligns to 57:234 / 344 (51.7%), covers 50.9% of PF09995, 24.1 bits
- Social environment affects the transcriptomic response to bacteria in ant queens
Viljakainen, Ecology and evolution 2018 - “...8.58E06 3.76E03 LOC105677809 Uncharacterized LOC105677809 (LOC105677809) 1.86 1.81E05 6.14E03 LOC105674506 Annulin (LOC105674506) 1.92 1.09E05 4.43E03 LOC105675090 Uncharacterized LOC105675090 (LOC105675090) 1.94 4.21E05 1.17E02 LOC105679194 Muscle segmentation homeoboxlike (LOC105679194) 1.98 3.61E05 1.05E02 LOC105679722 Uncharacterized LOC105679722 (LOC105679722) 2.06 2.27E04 3.92E02 LOC105670118 Uncharacterized methyltransferaselike protein SPBC21C3.07c (LOC105670118) 2.07 5.80E04 8.72E02...”
- “...(LOC105678833) 1.19 2.75E12 5.00E09 LOC105678901 High affinity nerve growth factor receptorlike (LOC105678901) 1.25 3.89E06 1.94E03 LOC105675090 Uncharacterized LOC105675090 (LOC105675090) 1.27 4.99E06 2.33E03 LOC105677615 Alphatocopherol transfer proteinlike (LOC105677615) 1.42 2.93E12 5.00E09 LOC105671862 Uncharacterized LOC105671862 (LOC105671862) 1.53 1.52E04 3.88E02 LOC105679194 Muscle segmentation homeoboxlike (LOC105679194) 1.54 2.47E06 1.29E03 LOC105680137...”
Or search for genetic data about PF09995 in the Fitness Browser
by Morgan Price,
Arkin group
Lawrence Berkeley National Laboratory