Family Search for PF13148 (DUF3987)
April 2024: See Interactive Tools for Functional Annotation of Bacterial Genomes for advice on using these tools.
PF13148 hits 15 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.
YfjI / b2625 CP4-57 prophage; DUF3987 domain-containing protein YfjI from Escherichia coli K-12 substr. MG1655 (see paper)
P52124 Protein YfjI from Escherichia coli (strain K12)
b2625 CP4-57 prophage; predicted protein from Escherichia coli str. K-12 substr. MG1655
Aligns to 28:389 / 469 (77.2%), covers 99.7% of PF13148, 354.0 bits
- Ferric dicitrate transport system (Fec) of Shigella flexneri 2a YSH6000 is encoded on a novel pathogenicity island carrying multiple antibiotic resistance genes
Luck, Infection and immunity 2001 - “...a b c % Similarityb Protein accession no. 49 45 66 P32053 (U36840) P52124 P33997 73 79 63 70 95 99 99 100 98 98 98 79 79 98 99 99 100 99, 73 93, 92.3 98 100...”
- An Escherichia coli FdrA Variant Derived from Syntrophic Coculture with a Methanogen Increases Succinate Production Due to Changes in Allantoin Degradation
Kim, mSphere 2021 - “...pgpC (b2560) 90.53.5 45.02.6 16.00.6 0 19.70.6 15.11.6 0.80 6.10.1 Phosphatidylglycerol phosphatase C (R91L) yfjI (b2625) 86.15.0 73.61.4 14.80.4 0 24.11.7 41.51.1 1.10.1 5.90.1 Uncharacterized protein (I384V) cysN (b2751) 82.85.4 77.33.0 14.70.2 0 20.36.4 50.24.2 1.20.1 6.10.1 Sulfate adenylyltransferase subunit 1 (D171E) rob (b4396) 83.95.0 74.77.0...”
- Comparative Genomic Analysis Reveals a Diverse Repertoire of Genes Involved in Prokaryote-Eukaryote Interactions within the Pseudovibrio Genus
Romano, Frontiers in microbiology 2016 (no snippet) - In vitro transcription profiling of the σS subunit of bacterial RNA polymerase: re-definition of the σS regulon and identification of σS-specific promoter sequence elements
Maciag, Nucleic acids research 2011 - “...b2602 1.55 yi91a Unknown, in CP4-6 prophage sequence b0255 1.56 yfjL Unknown, possible prophage gene b2625 1.57 S ( 9 ) yagL Unknown, prophage protein b0278 1.59 S -Dependent in biofilm-growing cells ( 18 ) eutA Reactivating factor for ethanolamine ammonia lyase b2451 1.59 eutH ,...”
- Evolutionary genomics of ecological specialization
Zhong, Proceedings of the National Academy of Sciences of the United States of America 2004 - “...0.01 IS1 IS1 galS::IS1 1.67 0.001 0.39 0.01 IS1 b2625 IS1 *Fitness of TD10 with respect to TD2. Duplications detected by rtPCR. ISs not identified. Not...”
- “...uvrYyecF mglA mglA galS galS galS galS galS b2625 Zhong et al. Repeatedly Isolated Mutations. Identical mutations isolated from different experiments are...”
SO1442 conserved hypothetical protein from Shewanella oneidensis MR-1
Aligns to 38:399 / 489 (74.0%), covers 99.7% of PF13148, 328.2 bits
- Genome-scale metabolic network validation of Shewanella oneidensis using transposon insertion frequency analysis
Yang, PLoS computational biology 2014 - “...corresponded to slow growth (SO2545). Insertions in ten genes (SO3178, SO1441, SO3993, SO3874, SO4283, SO2133, SO1442, SO4359, SO0730, and SO2544) may have resulted in a functional protein by reinitiating transcription and translation after transposon insertion. (PDF) Click here for additional data file. Text S1 Additional methods...”
ETEC_4464 YfjI family protein from Escherichia coli ETEC H10407
Aligns to 31:392 / 494 (73.3%), covers 99.7% of PF13148, 315.8 bits
BCAL1122 hypothetical protein from Burkholderia cenocepacia J2315
Aligns to 33:397 / 485 (75.3%), covers 99.7% of PF13148, 301.5 bits
BMEI1696 Hypothetical Membrane Spanning Protein from Brucella melitensis 16M
Aligns to 60:425 / 509 (71.9%), covers 99.2% of PF13148, 286.3 bits
- Molecular targets for rapid identification of Brucella spp
Ratushna, BMC microbiology 2006 - “...hypothetical protein 1 BMEI1695 (1738538 .. 1739155) BruAb1_0252 265457 .. 265894 618/438 hypothetical protein 1 BMEI1696 (1739125 .. 1740654) BruAb1_0251 263780 .. 265308 1530/1529 hypothetical membrane spanning protein 1 BMEI1697 (1740651 .. 1741532) BruAb1_0250 262902..263783 882 virulence-associated protein E 1 BMEI1698 (1741529 .. 1741843) BruAb1_0249 262591...”
Z1126 unknown from Escherichia coli O157:H7 EDL933
Aligns to 37:381 / 467 (73.9%), covers 99.7% of PF13148, 254.9 bits
BruAb1_0251 YfjI family protein from Brucella abortus bv. 1 str. 9-941
Aligns to 60:385 / 387 (84.2%), covers 86.8% of PF13148, 247.3 bits
BT0709 hypothetical protein from Bacteroides thetaiotaomicron VPI-5482
Aligns to 371:719 / 791 (44.1%), covers 99.5% of PF13148, 227.9 bits
BT_RS03550 DUF3987 domain-containing protein from Bacteroides thetaiotaomicron VPI-5482
Aligns to 367:715 / 787 (44.3%), covers 99.5% of PF13148, 227.9 bits
BT0404 hypothetical protein from Bacteroides thetaiotaomicron VPI-5482
BT_RS01970 DUF3987 domain-containing protein from Bacteroides thetaiotaomicron VPI-5482
Aligns to 362:706 / 775 (44.5%), covers 99.5% of PF13148, 172.3 bits
pSf2_083 DNA helicase from Shigella phage pSf-2
Aligns to 77:441 / 522 (69.9%), covers 96.7% of PF13148, 150.0 bits
SRU_0231 hypothetical protein from Salinibacter ruber DSM 13855
Aligns to 148:414 / 686 (38.9%), covers 68.1% of PF13148, 117.5 bits
- Metagenomic islands of hyperhalophiles: the case of Salinibacter ruber
Pasić, BMC genomics 2009 - “...as genes involved in biosynthesis of alginate (SRU_0258) and pseudogenes involved in biosynthesis of proteophosphoglycan (SRU_0231, SRU_0265). Figure 3 Salinibacter ruber DSM 13855 metagenomic island 1 and San Diego crystallizer metagenome . GC-content of the island is plotted with a sliding window of 1000 nucleotides. Location...”
LI0175 hyphotheical protein from Lawsonia intracellularis PHE/MN1-00
Aligns to 105:465 / 554 (65.2%), covers 94.0% of PF13148, 110.2 bits
- Comparative genome sequencing identifies a prophage-associated genomic island linked to host adaptation of Lawsonia intracellularis infections
Vannucci, Veterinary research 2013 - “...ATTGATGCTCCTGTCCCACG ACCACATGGTGGATTCGTCC LI0173 Prophage DLP12 integrase 4059867 CGTCGTATTCTGCGCTTTGG ATCATCAGCTACACGAGCGG LI0174 Hypothetical protein 4059868 CAGGAAGATGCTGTGTGGCT ATTCGCTTTCGCAATACGGC LI0175 Hypothetical protein 4059869 CCCACGGACGAAGACTTTGA TCAGCTTTCGGGCATGGATT LI0176 Hypothetical protein 4059870 ACAGACCTCTATGCTCCCGT TCAGCGTCTTGGGGCTTTAG LI0177 Hypothetical protein 4059871 ACACCACCATTACCACTGCT ACACCACCATTACCACTGCT LI0178 Hypothetical protein 4059872 TTCCTCCTGCGTGTCGTAAC ATTTCTCCCTGGCTCTGCAC LI0179 Ribosomal protection tetracycline resistance protein 4059813...”
- “...bacterial organisms; ferric reductase NAD binding domain (LI0174); RNA polymerase III subunit RPC82 helix-turn-helix domain (LI0175) and cobalamin biosynthesis protein CobT (LI0187). Figure 1 Prophage DLP12-associated genomic island. (A) Chromosome map of the porcine L . intracellularis isolate PHE/MN1-00 at passage 10 showing the genomic location...”
NE0232 hypothetical protein from Nitrosomonas europaea ATCC 19718
Aligns to 143:388 / 462 (53.2%), covers 65.4% of PF13148, 102.9 bits
YkgS CP4-6 prophage; protein YkgS from Escherichia coli K-12 substr. MG1655 (see paper)
YKGS_ECOLI / P0DPM8 Protein YkgS from Escherichia coli (strain K12) (see paper)
Aligns to 1:42 / 42 (100.0%), covers 10.4% of PF13148, 32.2 bits
Or search for genetic data about PF13148 in the Fitness Browser
by Morgan Price,
Arkin group
Lawrence Berkeley National Laboratory