Family Search for PF13898 (MINDY-3_4_CD)

April 2024: See Interactive Tools for Functional Annotation of Bacterial Genomes for advice on using these tools.

PF13898 hits 10 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.

Q4G0A6 Probable ubiquitin carboxyl-terminal hydrolase MINDY-4 from Homo sapiens
NP_115598 probable ubiquitin carboxyl-terminal hydrolase MINDY-4 from Homo sapiens
Aligns to 416:752 / 757 (44.5%), covers 100.0% of PF13898, 471.3 bits

• Specificity of Phosphorylation Responses to Mitogen Activated Protein (MAP) Kinase Pathway Inhibitors in Melanoma Cells.
  Basken, Molecular & cellular proteomics : MCP 2018
• FAM188B enhances cell survival via interaction with USP7.
  Choi, Cell death & disease 2018
  • GeneRIF: FAM188B is a putative oncogene that functions via interaction with USP7.
• Variation at the NFATC2 locus increases the risk of thiazolidinedione-induced edema in the Diabetes REduction Assessment with ramipril and rosiglitazone Medication (DREAM) study.
  Bailey, Diabetes care 2010
  • GeneRIF: Observational study of gene-disease association, gene-environment interaction, and pharmacogenomic / toxicogenomic. (HuGE Navigator)
• Gene-centric association signals for lipids and apolipoproteins identified via the HumanCVD BeadChip.
  Talmud, American journal of human genetics 2009
  • GeneRIF: Observational study of gene-disease association. (HuGE Navigator)

A8MYZ0 Inactive ubiquitin carboxyl-terminal hydrolase MINDY-4B from Homo sapiens
Aligns to 106:455 / 460 (76.1%), covers 100.0% of PF13898, 425.5 bits

• Quantitative proteomic analysis for high-throughput screening of differential glycoproteins in hepatocellular carcinoma serum
  Gao, Cancer biology & medicine 2015
  • “...8 OS=Homo sapiens GN=EXOC8 PE=1 SV=2 - [EXOC8_HUMAN] 0.83 1 1 1 725 81.7 5.49 A8MYZ0 Protein FAM188B2 OS=Homo sapiens GN=FAM188B2 PE=3 SV=2 - [F1882_HUMAN] 3.06 1 1 1 360 41.0 7.91 Q9UK73 Protein fem-1 homolog B OS=Homo sapiens GN=FEM1B PE=1 SV=1 - [FEM1B_HUMAN] 1.44 1...”

K7N7A8 Ubiquitin carboxyl-terminal hydrolase MINDY (Fragment) from Homo sapiens
Aligns to 1:213 / 449 (47.4%), covers 61.3% of PF13898, 296.8 bits

• 20S proteasomes secreted by the malaria parasite promote its growth
  Dekel, Nature communications 2021
  • “...0 0 S H7BZV9 Ankyrin repeat domain 54 76 ANKRD54 3 1 0 1 S K7N7A8, P29972 Aquaporin-1 426 AQP1 0 3 0 0 T P23634 ATPase plasma membrane Ca2+ 1162 ATP2B4 0 4 0 0 S O14523 C2CD2 like 470 C2CD2L 3 2 0 1...”
• Neoepitope targets of tumour-infiltrating lymphocytes from patients with pancreatic cancer.
  Meng, British journal of cancer 2019
  • “...+ TIL clone recognised the neoepitope (GLLR Y WRTERLF) from an aquaporin 1-like protein (gene: K7N7A8 ). Repeated stimulation of TILs with the autologous tumour cells line lead to focused recognition of several mutated targets, based on IFN- production. TILs and corresponding PBMCs from PanTT77 showed...”
  • “...WRTERLF), which derives from an uncharacterised protein product of 449 amino acids encoded by the K7N7A8 gene. The CD4 + TCR V9 + TIL clone that recognises the K7N7A8 mutated peptide GLLR Y WRTERLF produced a cytotoxic T-cell response against the autologous tumour cell line, which...”
• Neuroanatomical Quantitative Proteomics Reveals Common Pathogenic Biological Routes between Amyotrophic Lateral Sclerosis (ALS) and Frontotemporal Dementia (FTD).
  Iridoy, International journal of molecular sciences 2018
  • “...are shown in the table. The remaining two proteins were uncharacterized proteins (Uniprot code: C9JCJ5, K7N7A8) and are therefore not shown in this table. Protein Name Gene Uniprot Code Unique Peptides p -Value ALS p -Value FTLD-U Fold-Change FTLD-U (log2) Fold-Change ALS (log2) Common up-regulated proteins...”

AT1G43690 ubiquitin interaction motif-containing protein from Arabidopsis thaliana
Aligns to 115:422 / 599 (51.4%), covers 81.7% of PF13898, 216.6 bits

• The Arabidopsis Deubiquitylase OTU5 Suppresses Flowering by Histone Modification-Mediated Activation of the Major Flowering Repressors FLC, MAF4, and MAF5
  Radjacommare, International journal of molecular sciences 2023
  • “...into 14 families), 12 OTU proteins, 3 MJDs, 5 JAMNs, 3 MINDYs (At4G11860, At4G22960, and At1g43690), and 2 ZUP1 (At5G24680 and At3G48380). Recent studies with null mutants have revealed the importance of Arabidopsis DUBs of various classes in growth and development, and in adaptive responses [...”
• DYn-2 Based Identification of Arabidopsis Sulfenomes
  Akter, Molecular & cellular proteomics : MCP 2015
  • “...BETA-9 CHAIN AT3G22850 AT3G13460 AT1G77550 AT1G66680 AT1G43690 AT5G52920 AT5G19770 AT5G12250 AT4G37870 AT4G20890 Aldolase-type TIM barrel family protein...”
• Identification of novel in vivo MAP kinase substrates in Arabidopsis thaliana through use of tandem metal oxide affinity chromatography
  Hoehenwarter, Molecular & cellular proteomics : MCP 2013
  • “...PEARLI 4 family protein NSSPPS(ph)PFHPAAYK 790.34 2 51E-04 1 6.5E-01 0.968 7.8 4.2 4.9 2.49E-02 AT1G43690 ubiquitin interaction motif-containing protein MVLFPKS(ph)PSPVNK 762.38 2 18E-03 0.98 1.5E-02 0.988 47.0 28.8 57.6 1.78E-02 AT1G21380 Target of Myb protein 1 S(ph)PEHALFTKPVYDQTEQLPPAPWETQEPR 1157.87 3 80E-08 0.892 8.8E-07 0.995 1.4 1.3...”
• AGAMOUS controls GIANT KILLER, a multifunctional chromatin modifier in reproductive organ patterning and differentiation
  Ng, PLoS biology 2009
  • “...1-DSO, AT1G05100; 1-ENP, AT1G09060; 1-EPO, AT1G74300; 1-ERP, AT1G80690; 1-EXG, AT1G14455; 1-HLH, AT1G73830; 1-HMR, AT1G48620; 1-HYP, AT1G43690; 1-INV, AT1G56555; 1-LIP, AT1G10740; 1-PEX, AT1G14540; 1-RIG, AT1G80400; 1-SEC, AT1G56660; 1-SKK, AT1G60940; 1-SRP, AT1G47710; 1-TIN, AT1G22810; 1-TNY, AT1G74930; 1-TRA, AT1G64150; 2-AG5, AT2G42830; 2-ATH, AT2G35270; 2-BRA, AT2G19460; 2-BZP, AT2G36270; 2-CHA, AT2G02710;...”

PF3D7_0630600 conserved protein, unknown function from Plasmodium falciparum 3D7
3 alignments in 222:798 / 935 (37.1%), covering up to 40.7% of PF13898, 190.9 bits

• Genome-wide SNP analysis of Plasmodium falciparum shows differentiation at drug-resistance-associated loci among malaria transmission settings in southern Mali
  Coulibaly, Frontiers in genetics 2022
  • “...Serpentine receptor 12, putative (SR12) 10 3.42 PF3D7_0619600 Conserved Plasmodium protein, unknown function 1 3.07 PF3D7_0630600 Deubiquitinating enzyme MINDY, putative 10 3.20 PF3D7_0709000 Chloroquine resistance transporter (CRT) 1 2.74 PF3D7_0710200 Conserved Plasmodium protein, unknown function 3 3.30 PF3D7_0728900 RNA-binding protein, putative 1 3.14 PF3D7_0729700 Zinc finger...”
• Novel insights from the Plasmodium falciparum sporozoite-specific proteome by probabilistic integration of 26 studies
  Meerstein-Kessel, PLoS computational biology 2021
  • “...ID function No. (%) of volunteers with antibodies Non-syn SNP/kb PlasmoDB Non-syn SNPs NF135 NF166 PF3D7_0630600 Conserved hyp 20 (52.6) 2.8 0 1 PF3D7_0906500 Arginase 19 (50.0) 6.5 1 1 PF3D7_1456700 Conserved hyp. 19 (50.0) 2.9 0 0 PF3D7_0719700 40S ribosomal S10 15 (39.5) 0 0...”
• Hospital-derived antibody profiles of malaria patients in Southwest India
  Venkatesh, Malaria journal 2019
  • “...putative 238.896 71 10 PF3D7_0530100 Exon 2 of 2 SNARE protein, putative 26.69 71 11 PF3D7_0630600 Exon 2 of 2 Conserved protein, unknown function 110.12 70 12 PF3D7_0800200 Exon 2 segment 1 Erythrocyte membrane protein 1, PfEMP1 330.694 69 13 PF3D7_0935600 Exon 1 of 2 Gametocytogenesis-implicated...”
• Pooled-DNA sequencing identifies genomic regions of selection in Nigerian isolates of Plasmodium falciparum
  Oyebola, Parasites & vectors 2017
  • “...822 1007 185 12 PF3D7_0519800 - PF3D7_0524200 6 a 1039 1297 258 32 PF3D7_0625100 - PF3D7_0630600 7 238 249 11 4 PF3D7_0704550 - PF3D7_0704900 9 1060 1220 160 15 PF3D7_0929320 - PF3D7_0930500 10 1210 1557 347 10 PF3D7_1029500 - PF3D7_103880 11 1190 1310 200 8 PF3D7_1132920...”

MINY3_HUMAN / Q9H8M7 Ubiquitin carboxyl-terminal hydrolase MINDY-3; Dermal papilla-derived protein 5; Deubiquitinating enzyme MINDY-3; Protein CARP; EC 3.4.19.12 from Homo sapiens (Human) (see 3 papers)
Aligns to 20:316 / 445 (66.7%), covers 77.0% of PF13898, 186.7 bits

• function: Hydrolase that can remove 'Lys-48'-linked conjugated ubiquitin from proteins.
  catalytic activity: Thiol-dependent hydrolysis of ester, thioester, amide, peptide and isopeptide bonds formed by the C-terminal Gly of ubiquitin (a 76- residue protein attached to proteins as an intracellular targeting signal).
  subunit: Interacts with COPS5.

Q9CV28 Ubiquitin carboxyl-terminal hydrolase MINDY-3 from Mus musculus
Aligns to 20:315 / 444 (66.7%), covers 77.0% of PF13898, 185.2 bits

• A proteomic-informed view of the changes induced by loss of cellular adherence: The example of mouse macrophages.
  Ramirez, PloS one 2021
  • “...NA Proteasome/ubiquitin atg3 Q9CPX6 Ubiquitin-like-conjugating enzyme ATG3 NA brcc3 P46737 Lys-63-specific deubiquitinase BRCC36 NA mindy3 Q9CV28 Protein FAM188A NA psb4/2 P99026 Proteasome subunit beta type-4 A psd13 Q9WVJ2 26S proteasome non-ATPase regulatory subunit 13 NA Associated with signal transduction gnb2L1 P68040 Guanine nucleotide-binding protein subunit beta-2-like...”

NP_001305259 ubiquitin carboxyl-terminal hydrolase MINDY-3 isoform b precursor from Homo sapiens
Aligns to 1:143 / 272 (52.6%), covers 37.2% of PF13898, 138.8 bits

• CARP is a potential tumor suppressor in gastric carcinoma and a single-nucleotide polymorphism in CARP gene might increase the risk of gastric carcinoma.
  Lu, PloS one 2014
  • GeneRIF: CARP is a potential tumor suppressor of gastric carcinoma and the rs2297882 C>T phenotype of CARP may serve as a predictor of gastric carcinoma.
• C10ORF97 is a novel tumor-suppressor gene of non-small-cell lung cancer and a functional variant of this gene increases the risk of non-small-cell lung cancer.
  Shi, Oncogene 2011 (PubMed)
  • GeneRIF: results indicated that C10ORF97 functions as a novel tumor suppressor by modulating several key G(1)/S-regulatory proteins by interacting with JAB1
• CARP is a novel caspase recruitment domain containing pro-apoptotic protein.
  Liu, Biochemical and biophysical research communications 2002 (PubMed)
  • GeneRIF: CARP is a novel caspase recruitment domain containing pro-apoptotic protein. (CARP, CARD containing Protein)

B4E220 Aquaporin-1 from Homo sapiens
Aligns to 1:93 / 329 (28.3%), covers 26.2% of PF13898, 123.4 bits

• Proteomic Classification and Identification of Proteins Related to Tissue Healing of Platelet-Rich Plasma
  Lee, Clinics in orthopedic surgery 2020
  • “...CPB2 Carboxypeptidase B2 48,393 7.61 0.0003 H0YAS8 CLU Clusterin beta chain (fragment) 16,167 5.51 0.0616 B4E220 AQP1 Aquaporin-1 35,552 5.32 0.0001 E9PK25 CFL1 Cofilin-1 22,714 8.51 0.0020 P00746 CFD Complement factor D 27,016 7.64 0.0003 P04899-4 GNAI2 Isoform sGi2 of Guanine nucleotide-binding protein G(i) subunit alpha-2...”

GL50803_7349 hypothetical protein from Giardia intestinalis
Aligns to 328:582 / 587 (43.4%), covers 63.1% of PF13898, 95.8 bits

• A new gene inventory of the ubiquitin and ubiquitin-like conjugation pathways in Giardia intestinalis
  Castellanos, Memorias do Instituto Oswaldo Cruz 2020
  • “...Desumoylating isopeptidase 1 H. sapiens 64 40 OTU GL50803_88556 Otubain H. sapiens 41 21 MINDY GL50803_7349 Ubiquitin carboxyl-terminal hydrolase MINDY-4 B. taurus 47 31 Fig. 1: homology modeling and evaluation of Ubiquitin (Ub) and Ub-like proteins (Ub-Ls) structures. Three-dimensional structure of proteins was determined using the...”
  • “...reported: One deNEDDylase (GL50803_10218); an OTU enzyme (GL50803_88556), and a member of the MINDY-4 family (GL50803_7349). Other OTU enzymes have been reported in protozoans such as Plasmodium falciparum, Cryptosporidium parvum , Toxoplasma gondii and Eimeria acervulina , 18 , 19 while orthologs of MINDY have not...”
• Drug-Free Approach To Study the Unusual Cell Cycle of Giardia intestinalis
  Horlock-Roberts, mSphere 2017
  • “...GL50803__136020), GAPDH (glyceraldehyde-3-phosphate dehydrogenase) (GL50803_6687), glycyl tRNA synthetase (GL50803_9011), ribosomal protein L2 (GL50803_16086), and ubiquitin (GL50803_7349). The geNorm program calculates expression stability measurements (M values) for all the genes, with the most stable genes (i.e., those most suitable for use as normalizers) possessing the lowest M...”
  • “...L2 GL50803_16086 F ACAGACAAGCCCCTTCTCAA R GGTCAACAGGGTTCATTGCT tRNA glycyl synthetase GL50803_9011 F GCAAAGCCATTGTTTTACCTCTTC R TGCTATTCCACTACGCCTCA Ubiquitin GL50803_7349 F CGAGAACGCTTCGTGAAATC R GTTTGTGAATAGGCTGTCCGA Histone H4 GL50803_135001, GL50803_135002, GL50803_135003 F GTGGAGGTGTGAAGCG R TGTGTATGTGAGGGAGTCG Histone H3 GL50803_14212, GL50803_35231 F TACCAGAAGTCCACAGACC R TGGAAGCGGATGTCGGA Histone H2A GL50803_14256, GL50803_27521 F GTCGTGGCAGAGGTCTT R CTCCTTGTCCTTGCGGA Histone...”

Or search for genetic data about PF13898 in the Fitness Browser