PaperBLAST

PaperBLAST – Find papers about a protein or its homologs

PaperBLAST

PaperBLAST Hits for tr|Q9HZV9|Q9HZV9_PSEAE Geranyl-CoA carboxylase, beta-subunit OS=Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1) OX=208964 GN=atuC PE=1 SV=1 (538 a.a., MPAIQSELDV...)

Other sequence analysis tools:

Find functional residues: SitesBLAST

Search for conserved domains

Find the best match in UniProt

Compare to protein structures

Predict transmenbrane helices: Phobius

Predict protein localization: PSORTb

Find homologs in fast.genomics

Fitness BLAST: loading...

Show query sequence

Found 250 similar proteins in the literature:

atuC / Q9HZV9 cis-geranyl-CoA carboxylase β-subunit (EC 6.4.1.5) from Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1) (see paper)
Q9HZV9 geranoyl-CoA carboxylase (EC 6.4.1.5) from Pseudomonas aeruginosa (see paper)
PA2888 probable biotin-dependent carboxylase from Pseudomonas aeruginosa PAO1
100% identity, 100% coverage

The Pseudomonas aeruginosa Isohexenyl Glutaconyl Coenzyme A Hydratase (AtuE) Is Upregulated in Citronellate-Grown Cells and Belongs to the Crotonase Family
Poudel, Applied and environmental microbiology 2015
- “...PA2011 PA2012 PA2013 PA2014 PA2015 PA2886 PA2887 PA2888 PA2889 PA2890 PA2891 PA2892 PA4330 Gene Structure-Function of Pseudomonas aeruginosa AtuE corresponding...”
Pseudomonas aeruginosa twitching motility-mediated chemotaxis towards phospholipids and fatty acids: specificity and metabolic requirements
Miller, Journal of bacteriology 2008
- “...PA2554 PA2555 PA2557 PA2634 PA2764 PA2862 PA2863 PA2887 PA2888 PA2889 PA3013 PA3014 PA3267 PA3277 PA3300 PA3415 PA3427 PA3429 PA3567 PA3568 PA3569 PA3581 PA3582...”
The atu and liu clusters are involved in the catabolic pathways for acyclic monoterpenes and leucine in Pseudomonas aeruginosa
Aguilar, Applied and environmental microbiology 2006
- “...PAO1::ISlacZ/hah (ID 10287), transposon insertion in ORF PA2888 PAO1::ISlacZ/hah (ID 15357), transposon insertion in ORF PA2889 PAO1::ISlacZ/hah (ID 8388),...”
- “...the PAO1 genome, a putative atu cluster containing ORFs PA2888, PA2889, PA2890, and PA2891 was located, which corresponded with the atu cluster named for its...”
Methylcrotonyl-CoA and geranyl-CoA carboxylases are involved in leucine/isovalerate utilization (Liu) and acyclic terpene utilization (Atu), and are encoded by liuB/liuD and atuC/atuF, in Pseudomonas aeruginosa
Höschle, Microbiology (Reading, England) 2005 (PubMed)
- “...4/5 and 6, Fig. 2A) corresponded to liuB (PA2014), atuC (PA2888) and the product of PA5436, Fig. 2. SDS-PAGE and Western blot analysis of P. aeruginosa PAO1 for...”
- “...to gnyA and gnyB; Diaz-Perez et al., 2004), and PA2888 and PA2891 (atuC and atuF) have been suggested to encode MCase; this is contrary to our findings....”

GO593_03810 acyl-CoA carboxylase subunit beta from Acinetobacter baumannii
65% identity, 100% coverage

Complete genome sequence and genome-scale metabolic modelling of Acinetobacter baumannii type strain ATCC 19606
Zhu, International journal of medical microbiology : IJMM 2020
- “...databases identified an L-leucine degradation pathway via 2-oxoisovalerate dehydrogenase (GO593_16095-16110), isovaleryl-CoA:FAD oxidoreductase (GO593_14460), methylcrotonoyl-CoA carboxylase (GO593_03810, 03795, 14445 and 14455), and methylglutaconyl-CoA hydratase (GO593_03800 and 14450). Biolog test used NADH production as a universal reporter for nutrient utilisation; therefore, the positive Biolog result might indicate only...”

A1S_3008 Acetyl-CoA carboxylase from Acinetobacter baumannii ATCC 17978
69% identity, 85% coverage

Molecular mechanisms of ethanol-induced pathogenesis revealed by RNA-sequencing
Camarena, PLoS pathogens 2010
- “...COG3162 2.1 A1S_2710 2.5 0.076 Type II Citrate synthase(gltA) A1S_0179 3.1 0.121 Predicted flavodoxin, COG0655 A1S_3008 4.8 0.115 acetyl-CoA carboxylase, COG4799 A1S_0359 3.9 0.108 Predicted -lactamase, COG1680 A1S_0618 2.5 0.126 MarR transcriptional regulator, COG1846 A1S_1601 2.7 0.119 Malate synthase G, cd00728 A1S_1380 3.6 0.162 Predicted porine,...”

blr0986 3-methylcrotonyl-CoA carboxylase beta subunit from Bradyrhizobium japonicum USDA 110
53% identity, 100% coverage

Induction by Bradyrhizobium diazoefficiens of Different Pathways for Growth in D-mannitol or L-arabinose Leading to Pronounced Differences in CO₂ Fixation, O₂ Consumption, and Lateral-Flagellum Production
Cogo, Frontiers in microbiology 2018
- “...membrane-enriched fraction, and a 3-methylcrotonyl-CoA carboxylase (alpha subunit Blr 4421 along with a beta subunit Blr0986; EC 6.4.1.4) was upregulated in both the cytoplasmic- and membrane-enriched fractions (Supplementary Table S2 ). In contrast, no carboxylases were detected in the AraDP. The presence of the probable biotin-sulfoxide...”

F3P16_RS11275 carboxyl transferase domain-containing protein from Acinetobacter baumannii
45% identity, 100% coverage

Overexpression of BIT33_RS14560 Enhances the Biofilm Formation and Virulence of Acinetobacter baumannii
Yang, Frontiers in microbiology 2022
- “...CoA transferase subunit A 1.098553066 8.82E-07 0.000314477 down F3P16_RS11250 DcaP-like protein 1.209536537 1.62E-06 0.000518977 down F3P16_RS11275 Methylcrotonoyl-CoA carboxylase 1.052143105 1.93E-06 0.000541303 down F3P16_RS11640 Phenylacetate-CoA oxygenase subunit PaaJ 1.227463257 9.57E-05 0.013948752 down Differentially expressed genes were screened by DESeq2 software, under a threshold of |log 2 (FC)|1...”

Q0KA97 Acetyl/propionyl-CoA carboxylase,carboxyltransferase subunit from Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
46% identity, 100% coverage

Purification of polyhydroxybutyrate synthase from its native organism, Ralstonia eutropha: implications for the initiation and elongation of polymer formation in vivo
Cho, Biochemistry 2012
- “...75 kDa proteins are annotated as the and subunits of an acetyl/propionyl-CoA carboxylase (Accession # Q0KA97 and # Q0KA96), the first committed step of fatty acid biosynthesis ( 35 ). The subunit of this enzyme is biotinylated, is known to co-purify with the subunit, and therefore...”

ABUW_2453 carboxyl transferase domain-containing protein from Acinetobacter baumannii
45% identity, 100% coverage

Comparative Transcriptomic Profiling of Pellicle and Planktonic Cells from Carbapenem-Resistant Acinetobacter baumannii
Ng, Antibiotics (Basel, Switzerland) 2023
- “...this pathway, five DEGs were found to be upregulated: ABUW_2506 ( hmgL1 ), hcaD , ABUW_2453, ABUW_2456 ( hmgL2 ), and ABUW_2455. Additionally, one DEG, namely, ABUW_1150, was downregulated. Furthermore, the metabolism pathways of other amino acids including lysine, arginine, proline, glycine, serine, threonine, tyrosine, and...”
- “...acid metabolism ko00280 Valine, leucine, and isoleucine degradation 1.9510 0.0112 6 21 ABUW_2506, hcaD , ABUW_2453, ABUW_2456, ABUW_2455 ABUW_1150 ko00310 Lysine degradation 1.1016 0.0791 3 11 ABUW_1519 gabD2 , ABUW_1150 ko00330 Arginine and proline metabolism 0.7820 0.1652 3 15 astA2, ABUW_2807 ABUW_1150 ko00260 Glycine, serine, and...”

A9801_RS14880 carboxyl transferase domain-containing protein from Acinetobacter baumannii
45% identity, 100% coverage

Characterization and Transcriptome Studies of Autoinducer Synthase Gene from Multidrug Resistant Acinetobacter baumannii Strain 863
Ng, Genes 2019
- “...carbon source metabolism were down-regulated in the abaI :Km strain. The genes (A9801_RS14885, liuA ; A9801_RS14880, liuB ; A9801_RS14875, liuC ; A9801_RS14870, liuD ; A9801_RS14865, liuE ) from the leucine/isovalerate utilization (Liu) operon were highly repressed in the mutant strain compared to the wild type. These...”

AUO97_RS14375 carboxyl transferase domain-containing protein from Acinetobacter baumannii
45% identity, 100% coverage

The abaI/abaR Quorum Sensing System Effects on Pathogenicity in Acinetobacter baumannii
Sun, Frontiers in microbiology 2021
- “...and AUO97_RS12705 involved in the propanoate metabolism pathway were upregulated. In the abaIR mutant, AUO97_RS14380, AUO97_RS14375, and AUO97_RS14370 involved in the propanoate metabolism pathway were upregulated. Lipids play an important role in both the physiology and pathophysiology of living systems ( Pereira-Dutra et al., 2019 )....”

SCO2776 acetyl/propionyl CoA carboxylase, beta subunit from Streptomyces coelicolor A3(2)
47% identity, 100% coverage

Origin of the 3-methylglutaryl moiety in caprazamycin biosynthesis
Bär, Microbial cell factories 2022
- “...analysis of S. coelicolor M1154 revealed genes homologue to liuA ( sco2779 ), liuB ( sco2776 ), liuD ( sco2777 ) and liuE ( sco2778 ) (Additional file 1 : Fig. S6). No homologue was found for liuC in this cluster though, raising the question if...”
- “...: Fig. S7A). To investigate if the Liu-pathway is connected to caprazamycin biosynthesis, we deleted sco2776 to sco2779 in the heterologous host S. coelicolor M1154 resulting in S. coelicolor M1154 sco2776 - sco2779 . Successful deletion and absence of wildtype genes was verified by PCR and...”
Comparative Proteomic Analysis of Transcriptional and Regulatory Proteins Abundances in S. lividans and S. coelicolor Suggests a Link between Various Stresses and Antibiotic Production
Clara, International journal of molecular sciences 2022
- “...of malonyl or methyl-malonylCoA, possibly used for fatty acids and/or polyketide (ACT) biosynthesis. SCO2777 and SCO2776 were highly abundant in SC but poorly abundant in SL , in both Pi conditions (Figure S2A of [ 9 ]), suggesting that SCO2775 represses the expression of the corresponding...”
AccR, a TetR Family Transcriptional Repressor, Coordinates Short-Chain Acyl Coenzyme A Homeostasis in Streptomyces avermitilis
Lyu, Applied and environmental microbiology 2020 (secret)
Iron competition triggers antibiotic biosynthesis in Streptomyces coelicolor during coculture with Myxococcus xanthus
Lee, The ISME journal 2020
- “...accumulated acetyl-CoA; (ii) the acetyl-CoA synthetase (SCO6195) converted acetate to acetyl-CoA; and (iii) acetyl-CoA carboxylases (SCO2776, SCO2777, and SCO4921) converted acetyl-CoA to malonyl-CoA (Fig. 1e ). Considering that the transcription levels of genes involved in other acetyl-CoA-associated pathways, such as glycolysis and the citrate cycle, showed...”
A Novel Two-Component System, Encoded by the sco5282/sco5283 Genes, Affects Streptomyces coelicolor Morphology in Liquid Culture
Arroyo-Pérez, Frontiers in microbiology 2019
- “...G 1.45E-45 1.41E-03 1.44E-15 SCO2774 Acyl-CoA dehydrogenase 1.56 Amino acid degradation I 8.90E-09 1.41E-04 4.44E-16 SCO2776 Carboxylase 2.11 Amino acid degradation I 3.14E-15 1.33E-01 3.77E-15 SCO2777 Carboxylase 2.12 Amino acid degradation I 1.85E-15 1.16E-01 0.00E+00 SCO2778 Hydroxymethylglutaryl-CoA lyase 1.96 Amino acid degradation I 2.54E-13 2.75E-01 1.06E-03...”
Role of Wax Ester Synthase/Acyl Coenzyme A:Diacylglycerol Acyltransferase in Oleaginous Streptomyces sp. Strain G25
Röttig, Applied and environmental microbiology 2016
- “...AccA2, PccA, and SCO4381), four subunits (AccB, PccB, SCO2776, and SCO4380), and two subunits (AccE, PccE) from S. coelicolor (49) AcpP from S. coelicolor...”
The ROK family regulator Rok7B7 pleiotropically affects xylose utilization, carbon catabolite repression, and antibiotic production in streptomyces coelicolor
Świątek, Journal of bacteriology 2013
- “...of branched-chain amino acids (SCO2008 to SCO2012 and SCO2776 to SCO2779) and an enolase (SCO7638) were 2- to 3-fold enhanced in the mutant. Furthermore,...”
Crp is a global regulator of antibiotic production in streptomyces
Gao, mBio 2012
- “...SCO5877 , SCO5878 , SCO6271 , SCO6275 , and SCO5222 ) and primary metabolism ( SCO2776 , SCO4921 , SCO5144 , and SCO5535 ). All displayed at least a 2-fold change in their transcriptional levels following Crp induction. Asterisks indicate changes in expression that are statistically...”
More

BCG_1028c putative acetyl-/propionyl-coa carboxylase subunit beta accD2 from Mycobacterium bovis BCG str. Pasteur 1173P2
JTY_RS05160 acyl-CoA carboxylase subunit beta from Mycobacterium tuberculosis variant bovis BCG str. Tokyo 172
46% identity, 99% coverage

InbR, a TetR family regulator, binds with isoniazid and influences multidrug resistance in Mycobacterium bovis BCG
Yang, Scientific reports 2015
- “...fadE12 BCG_1027c 1.15 2.06 Rv0973c accA2 acetyl-/propionyl-coenzyme A carboxylase alpha chain subunit alpha accA2 Up BCG_1028c 1.00 2.47 Rv0974c accD2 acetyl-/propionyl-coa carboxylase subunit beta accD2 11 BCG_1191 6.64 1.40 Rv1130 hypothetical protein BCG_1192 5.64 1.51 Rv1131 gltA1 citrate synthase NA BCG_1193 2.00 1.36 Rv1132 hypothetical protein...”
The prominent alteration in transcriptome and metabolome of Mycobacterium bovis BCG str. Tokyo 172 induced by vitamin B₁
Song, BMC microbiology 2019
- “...for TB treatment. In Mtb, there are six accD genes encoding for acyl-CoA carboxylases. Notably, JTY_RS05160 ( rv0974c ) or known as accD2 , is believed to take part in mycolic aicd biosynthesis. Cell wall-bound mycolic acids were absent in accD2 and accD3 mutants, suggesting that...”

H16_A0177 carboxyl transferase domain-containing protein from Cupriavidus necator H16
H16_A0177 Carboxyltransferase from Ralstonia eutropha H16
45% identity, 100% coverage

Detection of phase-dependent transcriptomic changes and Rubisco-mediated CO2 fixation into poly (3-hydroxybutyrate) under heterotrophic condition in Ralstonia eutropha H16 based on RNA-seq and gene deletion analyses
Shimizu, BMC microbiology 2013
- “...then slightly decreased in the PHA production phase (Figure 4 ). accC1 (H16_A0184, BC-BCCP) and H16_A0177 (CT) may be another pair of ACC or the related carboxylase, because these had weak and similar expression behaviors to each other. The expression levels of accA2 (H16_A2142, BC-BCCP) and...”

ACCD2_MYCTU / O86318 Probable biotin-dependent acyl-coenzyme A carboxylase beta2 subunit; EC 2.1.3.- from Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv) (see paper)
NP_215489 acetyl-/propionyl-CoA carboxylase subunit beta from Mycobacterium tuberculosis H37Rv
Rv0974c PROBABLE ACETYL-/PROPIONYL-CoA CARBOXYLASE (BETA SUBUNIT) ACCD2 from Mycobacterium tuberculosis H37Rv
46% identity, 99% coverage

function: Component of a biotin-dependent acyl-CoA carboxylase complex. This subunit transfers the CO2 from carboxybiotin to the CoA ester substrate.
subunit: The biotin-dependent acyl-CoA carboxylase complex is composed of an AccA protein, which contains the biotin carboxylase (BC) and biotin carboxyl carrier protein (BCCP) domains, and an AccD protein, which contains the carboxyl transferase (CT) domain.
Acyl-CoA carboxylases (accD2 and accD3), together with a unique polyketide synthase (Cg-pks), are key to mycolic acid biosynthesis in Corynebacterianeae such as Corynebacterium glutamicum and Mycobacterium tuberculosis.
Gande, The Journal of biological chemistry 2004 (PubMed)
- GeneRIF: Acyl-CoA carboxylases (accD2 and accD3), together with a unique polyketide synthase (Cg-pks), have key roles in mycolic acid biosynthesis in Corynebacterianeae
Polyphosphate kinase-1 regulates bacterial and host metabolic pathways involved in pathogenesis of Mycobacterium tuberculosis
Chugh, Proceedings of the National Academy of Sciences of the United States of America 2024
- “...to the ACC family of enzymes. These included AccA1 (Rv2501c), AccD1 (Rv2502c), AccA2 (Rv0973c), AccD2 (Rv0974c), AccD4 (Rv3799c), AccD5 (Rv3280), and AccE5 (Rv3281) ( SI Appendix , Table S1 and Dataset S1 ). Since polyP has been demonstrated to replace ATP as a phosphate donor in...”
The functional response of human monocyte-derived macrophages to serum amyloid A and Mycobacterium tuberculosis infection
Kawka, Frontiers in immunology 2023
- “...unknown function. Among the eight genes ( Rv1405c , Rv2661c , Rv1684 , Rv1137c , Rv0974c , Rv0744ac , Rv1815 , Rv0157a ) exclusively downregulated in hSAA-1 opsonized mycobacteria infecting macrophages, Rv1405c encodes a virulence-associated methyltransferase involved in the adaptation of Mtb to acid stress (...”
- “...). Rv1137c may be involved in the posttranslational modification of prenylated proteins ( 100 ), Rv0974c encodes acyl-CoA carboxylase AccD2, which is probably involved in amino acid biosynthesis ( 101 ) and Rv0744Ac is a possible transcriptional regulatory protein. Our study also identified 28 genes whose...”
Commonalities of Mycobacterium tuberculosis Transcriptomes in Response to Defined Persisting Macrophage Stresses
Vilchèze, Frontiers in immunology 2022
- “...systems and two-component systems ( regX3, mtrB, cite, devR ). The most upregulated genes were Rv0974c ( accD2 ), Rv0972c ( fadE12 ) and Rv0971c ( echA17 ), which are part of the Rv0971c-Rv0976c operon upregulated in both hypoxic and stationary phase conditions (see above) and...”
Bayesian reconstruction of Mycobacterium tuberculosis transmission networks in a high incidence area over two decades in Malawi reveals associated risk factors and genomic variants
Sobkowiak, Microbial genomics 2020
- “...0.01 phyC 12 bp deletion Rv3751 . Probable integrase 8.810 5 GWAS S* SNP (A31A) Rv0974c accD2 Acetyl-CoA carboxylase 2.610 4 GWAS NS** SNP (N125H) Rv3812 PE_PGRS62 PE / PPE gene 3.110 4 GWAS Gene Rv0056 rplI 50S ribosomal protein L9 3.910 4 GWAS 3 bp...”
Lineage-Specific Proteomic Signatures in the Mycobacterium tuberculosis Complex Reveal Differential Abundance of Proteins Involved in Virulence, DNA Repair, CRISPR-Cas, Bioenergetics and Lipid Metabolism
Yimer, Frontiers in microbiology 2020
- “...subunit) AccA2 accA2 Rv0973c 4, 7 3, 5 Probable acetyl-/propionyl-CoA carboxylase (Beta subunit) AccD2 accD2 Rv0974c 4, 7 3, 5 Propionyl-CoA carboxylase beta chain 6 AccD6 accD6 Rv2247 4, 7 3, 5 Malonyl CoA-acyl carrier protein transacylase fadD Rv0166 5, 7 3, 4 Long-chain-fatty-acidAMP ligase FadD32...”
Transcriptional signatures of Mycobacterium tuberculosis in mouse model of intraocular tuberculosis
Abhishek, Pathogens and disease 2019
- “...and five of these transcripts (Rv0962c, Rv0984, Rv2612c, Rv0974c and Rv0971c) were also identified in human clinically confirmed cases of IOTB. Conclusions:...”
- “...M. tuberculosis genes were Rv0962c, Rv0984, Rv2612c, Rv0974c, Rv2411c, Rv2811, Rv1744c, ORF00110, Rv0996, Rv1765c, Rv0971c and Rv0772. The significantly...”
The prominent alteration in transcriptome and metabolome of Mycobacterium bovis BCG str. Tokyo 172 induced by vitamin B₁
Song, BMC microbiology 2019
- “...treatment. In Mtb, there are six accD genes encoding for acyl-CoA carboxylases. Notably, JTY_RS05160 ( rv0974c ) or known as accD2 , is believed to take part in mycolic aicd biosynthesis. Cell wall-bound mycolic acids were absent in accD2 and accD3 mutants, suggesting that these mutants...”
- “...are indeed deficient for mycolic acid synthesis [ 87 ]. The transcriptomic analysis demonstrated that rv0974c was almost 4-fold lower when treated with V B1 (Additional file 2 : Table S2). JTY_RS10525 ( Rv2032c ) or acg gene, encoding the NAD(P) H nitroreductase, was downregulated about...”
Whole genome sequencing, analyses of drug resistance-conferring mutations, and correlation with transmission of Mycobacterium tuberculosis carrying katG-S315T in Hanoi, Vietnam
Hang, Scientific reports 2019
- “...eis Rv2416c 2-bp deletion at 27145272714528 3.219E-06 12 0/60 1.32E-05 AP018033.1HN024|01030| accD2 Best hit with Rv0974c 238-bp deletion from 1086195 to 1086432 2.991E-06 12 AP018033.1HN024|02797| HN024_02796 Best hit with Rv2690c 12-bp deletion 1.720E-05 12 AP018036.1HN506|03217| HN506_03216 Best hit with Rv3077 459-bp insertion 1.720E-05 12 PC-9 correlated...”
More

MCCB_DROME / Q9V9A7 Probable methylcrotonoyl-CoA carboxylase beta chain, mitochondrial; MCCase subunit beta; 3-methylcrotonyl-CoA carboxylase 2; 3-methylcrotonyl-CoA carboxylase non-biotin-containing subunit; 3-methylcrotonyl-CoA:carbon dioxide ligase subunit beta; EC 6.4.1.4 from Drosophila melanogaster (Fruit fly) (see paper)
44% identity, 93% coverage

function: Carboxyltransferase subunit of the 3-methylcrotonyl-CoA carboxylase, an enzyme that catalyzes the conversion of 3- methylcrotonyl-CoA to 3-methylglutaconyl-CoA, a critical step for leucine and isovaleric acid catabolism (By similarity). Vital for adult survival.
catalytic activity: 3-methyl-(2E)-butenoyl-CoA + hydrogencarbonate + ATP = 3- methyl-(2E)-glutaconyl-CoA + ADP + phosphate + H(+) (RHEA:13589)

BAB1_0019 Carboxyl transferase family from Brucella melitensis biovar Abortus 2308
BruAb1_0019 carboxyl transferase family protein from Brucella abortus biovar 1 str. 9-941
46% identity, 100% coverage

Genome sequence of Brucella abortus vaccine strain S19 compared to virulent strains yields candidate virulence genes
Crasta, PloS one 2008
- “...(510 aa) and BAB1_2109 (AccD, 301 aa). It is not clear if the mutation in BAB1_0019 may be compensated for by the presence of two additional ACCase beta subunit genes. Mycobacterium tuberculosis encodes six AccDase proteins, and at least three of these have a putative role...”
Genome sequence of Brucella abortus vaccine strain S19 compared to virulent strains yields candidate virulence genes
Crasta, PloS one 2008
- “...-_EryC, D-erythrulose-1-phosphate dehydrogenase 4 0 BruAb2_0372 68 68 G_ribose ABC transporter, permease protein 5 1 BruAb1_0019 7 7 FS I_carboxyl transferase family protein 6 1 BruAb1_0443 2 2 FS I_enoyl-(acyl carrier protein) reductase 7 2 BAB1_0967 1 1 PS I_Membrane protein involved in aromatic hydrocarbon degradation...”
- “...grouped into 11 classes based on the COG classification. Only two minor OCDs, carboxyl transferase (BruAb1_0019) and Enoyl-acyl-carrier proteins and (BruAb1_0443) showed more than 1 bp difference (priority 1 in Table 7 ) resulting in frameshifts, while the remaining 39 minor OCDs showed only single nucleotide...”

MAB_1072c Pobable propionyl-CoA carboxylase beta subunit AccD2 from Mycobacterium abscessus ATCC 19977
46% identity, 100% coverage

Characterization of In Vitro Resistance to Linezolid in Mycobacterium abscessus
Negatu, Microbiology spectrum 2023
- “...15 MAB_4384 27delC R9fs MAB_4324c LZD_r11 2 8 40 2 20 MAB_4384 469_470del P157fs MAB_4362, MAB_1072c LZD_r12 2 15 35 3 15 MAB_4384 217_328del D73fs LZD_r13 2 15 35 3 20 MAB_4384 541dupT R180fs LZD_r14 2 12 40 2.5 20 MAB_4384 200dupT I67fs MAB_1681 a WT,...”

SCLAV_1943 carboxyl transferase domain-containing protein from Streptomyces clavuligerus
48% identity, 95% coverage

Comparative Transcriptome Analysis of Streptomyces Clavuligerus in Response to Favorable and Restrictive Nutritional Conditions
Pinilla, Antibiotics (Basel, Switzerland) 2019
- “...10 3 2.237 10 2 SCLAV_3942 Penicillin-binding protein 3.525 4.230 10 4 1.155 10 2 SCLAV_1943 Acetyl/propionyl CoA carboxylase 3.410 2.440 10 5 1.086 10 3 SCLAV_3597 Two-component system sensor kinase 3.380 2.453 10 3 4.380 10 2 SCLAV_p0423 Transcriptional regulator, XRE family protein 3.266 1.760...”

3u9sF / Q9I297 Crystal structure of p. Aeruginosa 3-methylcrotonyl-coa carboxylase (mcc) 750 kd holoenzyme, coa complex (see paper)
46% identity, 100% coverage

Ligands: 5-(hexahydro-2-oxo-1h-thieno[3,4-d]imidazol-6-yl)pentanal; coenzyme a (3u9sF)

liuB / Q9I297 methylcrotonyl-CoA carboxylase β-subunit (EC 6.4.1.4) from Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1) (see paper)
Q9I297 methylcrotonoyl-CoA carboxylase (EC 6.4.1.4) from Pseudomonas aeruginosa (see paper)
PA14_38460 acyl-CoA carboxyltransferase beta chain from Pseudomonas aeruginosa UCBPP-PA14
PA2014 beta subunit of geranoyl-CoA carboxylase, GnyB from Pseudomonas aeruginosa PAO1
46% identity, 100% coverage

3-methylcrotonyl-CoA carboxylase deficiency: clinical, biochemical, enzymatic and molecular studies in 88 individuals
Grünert, Orphanet journal of rare diseases 2012
- “...human MCCC2 (hMCCC2, Uniprot Q9HCC0), as well as the structurally characterized P. aeruginosa MCCC2 (paMCCC2, Q9I297), Propionibacterium shermanii methylmalonyl-CoA carboxyltransferase (psMMCC, Q8GBW6), Streptomyces coelicolor PCC (scPCCB, Q9X4K7) and Roseobacter denitrificans PCC (bPCCA, Q168G2). Novel MCCC2 missense mutations are asterisked. Click here for file Acknowledgements We thank...”
Gene Expression Profiling of Pseudomonas aeruginosa Upon Exposure to Colistin and Tobramycin
Cianciulli, Frontiers in microbiology 2021
- “...gene of gnyRDBHAL cluster. GnyR 12.88 ND gnyD PA14_38440 Citronelloyl-CoA dehydrogenase. GnyD 30.42 2.32 gnyB PA14_38460 Acyl-CoA carboxyltransferase subunit beta 27.71 X gnyH PA14_38470 Gamma-carboxygeranoyl-CoA hydratase 33.85 3.73 gnyA PA14_38480 Alpha subunit of geranoyl-CoA carboxylase. GnyA 26.11 X ilvA2 PA14_47100 Threonine dehydratase 24.7 7.68 Peptidoglycan biosynthesis...”
Identification of genes involved in enhanced membrane vesicle formation in Pseudomonas aeruginosa biofilms: surface sensing facilitates vesiculation
Kanno, Frontiers in microbiology 2023
- “...(0.96) 1.0 PAMK73D10 PA2013 (2203019) liuC Putative 3-methylglutaconyl-CoA hydratase 0.31 (0.047) 0.67 (0.31) 1.3 PAMK11H7 PA2014 (2204985) liuB Methylcrotonyl-CoA carboxylase, beta-subunit 0.20 (0.0049) 0.71 (0.29) 1.3 PAMK54D11 PA2014 (2204172) liuB Methylcrotonyl-CoA carboxylase, beta-subunit 0.25 (0.023) 1.6 (0.58) 1.5 PAMK5B11 PA3584 (4017261) glpD G3P dehydrogenase 0.088 (0.025)...”
The development of a new parameter for tracking post-transcriptional regulation allows the detailed map of the Pseudomonas aeruginosa Crc regulon
Corona, Scientific reports 2018
- “...1-2dioxygenase 3,36 1,68 1,43 Catabolism liuC PA2013 Putative 3-methylglutaconyl-CoA hydratase 2,27 1,76 2,74 Catabolism liuB PA2014 Methylcrotonyl-CoA carboxylase 2,37 1,32 1,39 Catabolism liuA PA2015 Putative isovaleryl-CoA dehydrogenase 2,16 2,06 3,69 Catabolism pauA4 PA2040 Glutamylpolyamine synthetase 1 0,16 1,47 Catabolism kynU PA2080 Kynureninase KynU 0,48 0,54 1,05...”
Small Colony Variants and Single Nucleotide Variations in Pf1 Region of PB1 Phage-Resistant Pseudomonas aeruginosa
Lim, Frontiers in microbiology 2016
- “...PA2012 gnyA Alpha subunit of geranoyl-CoA carboxylase -2.6 4.E-02 PA2013 gnyH Gamma-carboxygeranoyl-CoA hydratase -2.6 2.E-02 PA2014 gnyB Beta subunit of geranoyl-CoA carboxylase -2.3 2.E-02 PA2247 bkdA1 2-oxoisovalerate dehydrogenase (alpha subunit) -2.7 1.E-02 PA2248 bkdA2 2-oxoisovalerate dehydrogenase (beta subunit) -3.4 4.E-03 PA2249 bkdB Branched-chain alpha-keto acid dehydrogenase...”
The Pseudomonas aeruginosa Isohexenyl Glutaconyl Coenzyme A Hydratase (AtuE) Is Upregulated in Citronellate-Grown Cells and Belongs to the Crotonase Family
Poudel, Applied and environmental microbiology 2015
- “...Berkeley PA1535 PA1982 PA1984 PA2011 PA2012 PA2013 PA2014 PA2015 PA2886 PA2887 PA2888 PA2889 PA2890 PA2891 PA2892 PA4330 Gene Structure-Function of Pseudomonas...”
Inhibition of Pseudomonas aeruginosa swarming motility by 1-naphthol and other bicyclic compounds bearing hydroxyl groups
Oura, Applied and environmental microbiology 2015
- “...Metabolism PA0895 PA1562 PA1984 PA2007 PA2008 PA2009 PA2014 PA2015 PA2016 PA2247 PA2248 PA2249 PA2250 PA2321 PA2554 PA2555 PA3183 PA3194 PA3195 PA3559...”
Pseudomonas aeruginosa twitching motility-mediated chemotaxis towards phospholipids and fatty acids: specificity and metabolic requirements
Miller, Journal of bacteriology 2008
- “...PA0887 PA1137 PA1288 PA1736 PA1737 PA2011 PA2012 PA2013 PA2014 PA2015 PA2142 PA2552 PA2553 PA2554 PA2555 PA2557 PA2634 PA2764 PA2862 PA2863 PA2887 PA2888 PA2889...”
The atu and liu clusters are involved in the catabolic pathways for acyclic monoterpenes and leucine in Pseudomonas aeruginosa
Aguilar, Applied and environmental microbiology 2006
- “...PAO1SM liuB::Gmr mutant obtained by recombination in ORF PA2014 PAO1SM liuD::Gmr mutant obtained by recombination in ORF PA2012 PAO1SM liuE::Gmr mutant obtained...”
- “...contain the disrupted liuD (ORF PA2012), liuB (ORF PA2014), and liuE (ORF PA2011) genes, respectively, as described by Diaz-Perez et al. (5). Transconjugants...”
Methylcrotonyl-CoA and geranyl-CoA carboxylases are involved in leucine/isovalerate utilization (Liu) and acyclic terpene utilization (Atu), and are encoded by liuB/liuD and atuC/atuF, in Pseudomonas aeruginosa
Höschle, Microbiology (Reading, England) 2005 (PubMed)
- “...nos 4/5 and 6, Fig. 2A) corresponded to liuB (PA2014), atuC (PA2888) and the product of PA5436, Fig. 2. SDS-PAGE and Western blot analysis of P. aeruginosa...”
More

Psest_1083 3-methylcrotonyl-CoA carboxylase, beta subunit (EC 6.4.1.4) from Pseudomonas stutzeri RCH2
45% identity, 100% coverage

mutant phenotype: Specifically important for utilizing L-Leucine. Automated validation from mutant phenotype: the predicted function (METHYLCROTONYL-COA-CARBOXYLASE-RXN) was linked to the condition via a MetaCyc pathway. This annotation was also checked manually.

PST_3214 probable acyl-CoA carboxyltransferase beta chain from Pseudomonas stutzeri A1501
45% identity, 100% coverage

Poly-3-hydroxybutyrate production from acetate by recombinant Pseudomonas stutzeri with blocked L-leucine catabolism and enhanced growth in acetate
Zhu, Frontiers in bioengineering and biotechnology 2023
- “...Figures 2A, B ). Isovaleryl-CoA is eventually transformed into acetyl-CoA and acetoacetate via pst_3213 , pst_3214 , pst_3215 , pst_3216 , and pst_3217 , while acetoacetate is catabolized into acetoacetyl-CoA by pst_3218 and pst_3219 and finally degraded to acetyl-CoA. Besides pst_3217 , other genes involved in...”
- “...A1501. (B) The catabolism pathway of l -leucine in P. stutzeri A1501. PST_3213, isovaleryl-CoA dehydrogenase; PST_3214, methylcrotonyl-CoA carboxylase, subunit; PST_3215, -methylglutaconyl-CoA hydratase; PST_3216, methylcrotonyl-CoA carboxylase, subunit; PST_3217, hydroxymethylglutaryl-CoA lyase; PST_3218, CoA transferase, subunit A; PST_3219, CoA transferase, subunit B. (C) The growth of different strains in...”

MSMEG_5492 acetyl-CoA carboxylase carboxyltransferase from Mycobacterium smegmatis str. MC2 155
46% identity, 100% coverage

The influence of AccD5 on AccD6 carboxyltransferase essentiality in pathogenic and non-pathogenic Mycobacterium
Pawelczyk, Scientific reports 2017
- “...investigated which of the other remaining AccD proteins are involved in malonyl-CoA synthesis. MSMEG_4717 (AccD1), MSMEG_5492 (AccD2) and MSMEG_5642 (AccD3) proteins are not essential for fatty acid synthesis We previously assessed the essentiality of accD1 accD6 in Msm by directed mutagenesis and found that only MSMEG_6391...”
- “...smegmatis accD1 accD4 gene replacement vectors To create an unmarked deletion of (MSMEG_4717) accD1 , (MSMEG_5492) accD2 , (MSMEG_5642) accD3 and (MSMEG_6391) accD4 for each gene, a suicidal recombination delivery vector based on p2NIL was used 39 . Each vector carried the region upstream of accD...”

C6369_RS19850 acyl-CoA carboxylase subunit beta from Rhodococcus rhodochrous
45% identity, 100% coverage

Catabolism of Alkylphenols in Rhodococcus via a Meta-Cleavage Pathway Associated With Genomic Islands
Levy-Booth, Frontiers in microbiology 2019
- “...C6369_RS05465), enoylCoA hydratase (C6369 _RS19405, C6369_RS19860), 3-hydroxybutyryl-CoA dehydrogenase (C6369_RS03325, C6369_RS06400), and acetyl-CoA acyltransferase (C6369_RS17095, C6369_RS15900, C6369_RS19850) ( Supplementary Figure 2 ). The catABC cluster encoding catechol 1,2-dioxygenase and other enzymes feeding into the -ketoadipate pathway was also significantly upregulated during growth on 4-ethylphenol, although much less...”

FRAAL2343 Methylcrotonyl-CoA carboxylase beta chain, mitochondrial precursor (3-Methylcrotonyl-CoA carboxylase 2) (MCCase beta subunit) (3-methylcrotonyl-CoA:carbon dioxide ligase beta subunit) from Frankia alni ACN14a
46% identity, 99% coverage

The Proteogenome of Symbiotic Frankia alni in Alnus glutinosa Nodules
Pujic, Microorganisms 2022
- “...(FRAAL3159, FC = 0.55; FRAAL1213, FC = 0.43; FRAAL3158, FC = 0.23), a methyl-crotonoyl-CoA carboxylase (FRAAL2343, FC = 0.15) and two propionyl-CoA carboxylases (FRAAL5672, FC = 0.05; FRAAL1210, FC = 0.68). The only overabundant one was a phosphoribosylaminoimidazole carboxylase (FRAAL6664, FC = 4.9) involved in the...”

Q3ULD5 Methylcrotonoyl-CoA carboxylase beta chain, mitochondrial from Mus musculus
B2RUK5 methylcrotonoyl-CoA carboxylase from Mus musculus
45% identity, 95% coverage

Proteomic profiling of retina and retinal pigment epithelium combined embryonic tissue to facilitate ocular disease gene discovery.
Aryal, Human genetics 2023
- “...Q9QYI3 DnaJ homolog subfamily C member 7 - 74 Pnn O35691 Pinin - 75 Mccc2 Q3ULD5 Methylcrotonoyl-CoA carboxylase beta chain, mitochondrial (MCCase subunit beta) - 76 Nipbl Q6KCD5 Nipped-B-like protein - 77 Ank3 G5E8K5 Ankyrin-3 (ANK-3) Retinal defects; transport of cyclic nucleotide-gated channels to the plasma...”
Proteomic profiling of retina and retinal pigment epithelium combined embryonic tissue to facilitate ocular disease gene discovery.
Aryal, Research square 2023
- “...Q9QYI3 DnaJ homolog subfamily C member 7 - 74 Pnn O35691 Pinin - 75 Mccc2 Q3ULD5 Methylcrotonoyl-CoA carboxylase beta chain, mitochondrial (MCCase subunit beta) - 76 Nipbl Q6KCD5 Nipped-B-like protein - 77 Ank3 G5E8K5 Ankyrin-3 (ANK-3) Retinal defects* ( Kizhatil et al. 2009a ) 78 Rbp1...”
Extensive mitochondrial proteome disturbance occurs during the early stages of acute myocardial ischemia.
Wang, Experimental and therapeutic medicine 2022
- “...0.043 a Up Q8R5L1 C1QBP Complement component 1 Q subcomponent-binding protein, mitochondrial 1.591 0.027a Up Q3ULD5 MCCC2 Methylcrotonoyl-CoA carboxylase chain, mitochondrial 1.612 0.013 a Up Q9ER35 FN3K Fructosamine-3-kinase 1.654 0.013 a Up P84096 RHOG Rho-related GTP-binding protein RhoG 1.676 0.031 a Up Q7TSQ8 PDPR Pyruvate dehydrogenase...”
Palm Oil-Rich Diet Affects Murine Liver Proteome and S-Palmitoylome
Ziemlińska, International journal of molecular sciences 2021
- “...Q91XD4 Ftcd Formimidoyltransferase-cyclodeaminase 0.59 1.25 0.99 0.98 Q8VC12 Uroc1 Urocanate hydratase 0.60 1.24 0.84 1.02 Q3ULD5 Mccc2 Methylcrotonoyl-CoA carboxylase chain, mitochondrial 0.63 1.12 0.84 1.07 P49429 Hpd 4-Hydroxyphenylpyruvate dioxygenase 0.64 1.27 1.28 1.08 Q9DBA8 Amdhd1 Probable imidazolonepropionase 0.79 1.13 6.28 0.95 O88986 * Gcat 2-amino-3-ketobutyrate CoA...”
Mapping protein interactions of sodium channel Na_V1.7 using epitope-tagged gene-targeted mice
Kanellopoulos, The EMBO journal 2018
- “...KI only Nfasc Neurofascin Q810U3 4.96E08 0.00E+00 KI only Mccc2 MethylcrotonoylCoA carboxylase beta chain, mitochondrial Q3ULD5 4.63E08 0.00E+00 KI only Mpdz Isoform 2 of Multiple PDZ domain protein Q8VBX62 3.66E08 0.00E+00 KI only Tln1 Talin1 P26039 3.32E08 0.00E+00 KI only Dsp Desmoplakin E9Q557 2.17E08 0.00E+00 KI...”
Does reversible cysteine oxidation link the Western diet to cardiac dysfunction?
Behring, FASEB journal : official publication of the Federation of American Societies for Experimental Biology 2014
Identification and quantification of the basal and inducible Nrf2-dependent proteomes in mouse liver: biochemical, pharmacological and toxicological implications.
Walsh, Journal of proteomics 2014
- “...Mesencephalic astrocyte-derived neurotrophic factor 4 1.30 0.033 P62827 GTP-binding nuclear protein Ran 6 1.30 0.042 Q3ULD5 Methylcrotonoyl-CoA carboxylase beta chain, mitochondrial 14 0.58 <0.001 O09158 Cytochrome P450 3A25 4 0.54 0.032 Q64459 Cytochrome P450 3A11 27 0.46 <0.001 Q99LY9 NADH dehydrogenase [ubiquinone] iron-sulfur protein 5 2...”
CypD(-/-) hearts have altered levels of proteins involved in Krebs cycle, branch chain amino acid degradation and pyruvate metabolism
Menazza, Journal of molecular and cellular cardiology 2013
- “...58 (P56379) 6.8 kDa mitochondrial proteolipid 68MP_MOUSE 29.31 11 0.926 0.036 1.330 0.099 0.009 44 (Q3ULD5) Methylcrotonoyl-CoA carboxylase beta chain, mitochondrial MCCB_MOUSE 18.83 11 1.139 0.071 1.615 0.018 0.001 42 (Q8CC88) Uncharacterized protein KIAA0564 homolog K0564_MOUSE 2.73 6 0.858 0.053 1.098 0.031 0.008 28 (Q9R112) Sulfide:quinone...”
More
Downregulation of the antioxidant protein peroxiredoxin 2 contributes to angiotensin II-mediated podocyte apoptosis.
Hsu, Kidney international 2011
- “...UniProtKB accession no. Annotation Change (-fold) P -value Metabolic enzymes P17182 -Enolase +2.10 3.0e 006 B2RUK5 Methylcrotonoyl-coenzyme A carboxylase 2 +1.91 0.013 P09411 Phosphoglycerate kinase 1 +1.73 0.0040 P40142 Transketolase +1.64 0.0071 P17751 Triosephosphate isomerase +1.63 4.1e 008 Protein biosynthesis Q3TJZ1 Eukaryotic translation elongation factor 2...”

CPI83_20025 carboxyl transferase domain-containing protein from Rhodococcus sp. H-CA8f
46% identity, 95% coverage

Rhodococcus comparative genomics reveals a phylogenomic-dependent non-ribosomal peptide synthetase distribution: insights into biosynthetic gene cluster connection to an orphan metabolite
Undabarrena, Microbial genomics 2021
- “...CPI83_20040 la2 Arginine/Ornithine Antiporter CPI83_20035 la3 cross GTP Pyrophosphokinase CPI83_20030 la4 Transcriptional Regulator (TetR/AcrR Family) CPI83_20025 la5 heart CoA Carboxylase (subunit ) CPI83_20020 la6 CoA Carboxylase (subunit ) CPI83_20015 la7 Acyl-CoA Dehydrogenase CPI83_20010 la8 Dehydratase CPI83_20005 la9 CoA Ester Lyase CPI83_20000 la10 inverted triangle CoA Transferase...”

Q5XIT9 Methylcrotonoyl-CoA carboxylase beta chain, mitochondrial from Rattus norvegicus
45% identity, 95% coverage

The Connection between Chronic Liver Damage and Sporadic Alzheimer's Disease: Evidence and Insights from a Rat Model
Jakhmola, Brain sciences 2023
- “...norvegicus OX = 10,116 GN = Inpp5d PE = 1 SV = 1 66.43 0.095369171 Q5XIT9 Methylcrotonoyl-CoA carboxylase beta chain, mitochondrial OS = Rattus norvegicus OX = 10,116 GN = Mccc2 PE = 2 SV = 1 69.03 0.099261257 A1A5Q6 Sperm motility kinase OS = Rattus...”
Paeoniflorin Upregulates Mitochondrial Thioredoxin of Schwann Cells to Improve Diabetic Peripheral Neuropathy Indicated by 4D Label-Free Quantitative Proteomics.
Yang, Oxidative medicine and cellular longevity 2022
- “...Prdx4 O35244 Peroxiredoxin-6 0.863 Down 0.0048 Prdx6 P07632 Superoxide dismutase [Cu-Zn] 0.777 Down 0.0388 Sod1 Q5XIT9 Methylcrotonoyl-CoA carboxylase beta chain, mitochondrial 0.733 Down 0.0222 Mccc2 A0A0G2K1W9 Lactate dehydrogenase D 0.38 Down 0.0414 Ldhd...”
Differences in the Hemolytic Behavior of Two Isomers in Ophiopogon japonicus In Vitro and In Vivo and Their Risk Warnings
Xu, Oxidative medicine and cellular longevity 2020
- “...OPD and OPD may contribute to lipid metabolic disorders (e.g., Q5M872 [ 41 ] and Q5XIT9), mitochondrial energy metabolism (e.g., D3ZAQ0 [ 42 ] and Q03344), high mobility group protein binding (e.g., P63159 and Q4KLJ0 [ 43 ]) and cytoskeletal (e.g., Q6IFU7 [ 44 , 45...”
Metabolic syndrome diminishes insulin-induced Akt activation and causes a redistribution of Akt-interacting proteins in cardiomyocytes
Landa-Galvan, PloS one 2020
- “...nucleotide transhydrogenase 36 35 168.2 -7.0 P15650 Long-chain specific acyl-CoA dehydrogenase 11 10 88.7 -6.6 Q5XIT9 Methylcrotonoyl-CoA carboxylase beta chain 3 2 20.1 -6.4 P03889 NADH-ubiquinone oxidoreductase chain 1 4 4 27.0 -6.3 E9PT79 Translin 2 1 10.3 -5.6 D3ZB81 Solute carrier family 25 member 31...”
Diaphragm weakness and proteomics (global and redox) modifications in heart failure with reduced ejection fraction in rats.
Kelley, Journal of molecular and cellular cardiology 2020
- “...0.026 614 3.0 0.8* 0.009 P15178 Aspartate-tRNA ligase, cytoplasmic 1.06 0.33 267 2.3 7.0 0.003 Q5XIT9 Methylcrotonoyl-CoA carboxylase beta chain, mitochondrial 1.23 0.09 167 1.5 3.7 0.018 P45953 Very long-chain specific acyl-CoA dehydrogenase, mitochondrial 1.0 0.98 477 284.0 92.6* 0.045 P12346 Serotransferrin 0.81 0.14 693 0.07...”
2-Methoxyestradiol protects against pressure overload-induced left ventricular hypertrophy
Maayah, Scientific reports 2018
- “...(0.15) P14604 Enoyl-CoA hydratase 0.60 (0.039) 1.01 (0.97) Q64591 2,4-Dienoyl-CoA reductase 0.39 (0.145) 2.76 (0.038) Q5XIT9 Methylcrotonoyl-CoA carboxylase beta chain 0.85 (0.086) 1.63 (0.041) P35738 2-Oxoisovalerate dehydrogenase 0.63 (0.028) 2.61 (0.14) Q920L2 Succinate dehydrogenase 0.56 (0.022) 1.55 (0.013) P80254 D-dopachrome decarboxylase 2.65 (0.039) 0.63 (0.21) P29419...”
Functional proteomic analysis of corticosteroid pharmacodynamics in rat liver: Relationship to hepatic stress, signaling, energy regulation, and drug metabolism.
Ayyar, Journal of proteomics 2017
- “...well as L-alpha-amino acids DOWN Q58FK9 Kat3 Kynurenine-oxoglutarate transaminase 3 L-kynurenine to kynurenic acid UP Q5XIT9 Mccc2 Methylcrotonoyl-CoA carboxylase beta chain Amino acid (L-leucine) metabolism UP P04182 Oat Ornithine aminotransferase, mitochondrial Formation of proline from acid ornithine UP P04176 Pah Phenylalanine-4-hydroxylase (PAH) Hydroxylation of the aromatic...”
Proteomic analysis of immature rat pups brain in response to hypoxia and ischemia challenge.
Yang, International journal of clinical and experimental pathology 2014
More

ACCD1_MYCTU / I6YDK7 Biotin-dependent 3-methylcrotonyl-coenzyme A carboxylase beta1 subunit; 3-methylcrotonyl-CoA carboxylase; MCC; EC 2.1.3.- from Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv) (see 2 papers)
Rv2502c PROBABLE ACETYL-/PROPIONYL-CoA CARBOXYLASE (BETA SUBUNIT) ACCD1 from Mycobacterium tuberculosis H37Rv
48% identity, 92% coverage

function: Component of a biotin-dependent acyl-CoA carboxylase complex. This subunit transfers the CO2 from carboxybiotin to the CoA ester substrate (PubMed:25695631). When associated with the alpha1 subunit AccA1, is involved in branched amino-acid catabolism with methylcrotonyl coenzyme A as the substrate (PubMed:25695631). Shows residual with propionyl-CoA and acetyl-CoA (PubMed:25695631).
catalytic activity: 3-methyl-(2E)-butenoyl-CoA + N(6)-carboxybiotinyl-L-lysyl- [protein] = 3-methyl-(2E)-glutaconyl-CoA + N(6)-biotinyl-L-lysyl- [protein] (RHEA:13025)
subunit: The biotin-dependent acyl-CoA carboxylase complex is composed of AccA1, which contains the biotin carboxylase (BC) and biotin carboxyl carrier protein (BCCP) domains, and AccD1, which contains the carboxyl transferase (CT) domain (PubMed:25695631). The AccA1/AccD1 complex forms a dodecamer (PubMed:25695631).
Polyphosphate kinase-1 regulates bacterial and host metabolic pathways involved in pathogenesis of Mycobacterium tuberculosis
Chugh, Proceedings of the National Academy of Sciences of the United States of America 2024
- “...700 interacting proteins belonged to the ACC family of enzymes. These included AccA1 (Rv2501c), AccD1 (Rv2502c), AccA2 (Rv0973c), AccD2 (Rv0974c), AccD4 (Rv3799c), AccD5 (Rv3280), and AccE5 (Rv3281) ( SI Appendix , Table S1 and Dataset S1 ). Since polyP has been demonstrated to replace ATP as...”
Global-scale GWAS associates a subset of SNPs with animal-adapted variants in M. tuberculosis complex
Brenner, BMC medical genomics 2023
- “...CitE (citrase) (citratase) (citritase) (citridesmolase) (citrase aldolase) Synonymous 2,817,446 0 0.997 4100 2250 9 8 Rv2502c AccD1 Probable acetyl-/propionyl-CoA carboxylase (beta subunit) AccD1 Essential in murine spleen (Sassetti and Rubin, 2003) Phe343Leu 2,912,516 0 0.998 4100 2250 9 3 Rv2585c Possible conserved lipoprotein Synonymous 2,927,291 0...”
Genomic characteristics of two most widely used BCG vaccine strains: Danish 1331 and Pasteur 1173P2
Asadian, BMC genomics 2022
- “...+ + 26 Rv2483c pls C Bifunctional L-3 phosphoserine phosphatase/1-acyl-sn-glycerol-3-phosphate acyltransferase C189G + + 27 Rv2502c acc D1 Acetyl/propionyl-CoA carboxylase subunit beta F343L, G77S + + 27 Rv2692 ceo C TRK system potassium uptake protein CeoC I133V + + 29 Rv2696c - Hypothetical protein D164N +...”
Mycobacteriophage SWU1 gp39 can potentiate multiple antibiotics against Mycobacterium via altering the cell wall permeability
Li, Scientific reports 2016
- “...MSMEG_1390 3.39 Rv0675 enoyl-CoA hydratase EchA5 MSMEG_5996 3.24 Rv3546 involved in lipid degradation MSMEG_4717 3.00 Rv2502c fatty acid metabolism MSMEG_6041 2.41 Rv3573c lipid degradation MSMEG_3465 2.18 Rv1925 lipid degradation MSMEG_4716 2.51 Rv2501c lipid metabolism MSMEG_5907 2.15 Rv3505 involved in lipid degradation MSMEG_5923 2.10 Rv3523 lipid carrier...”
Characterization of the mycobacterial acyl-CoA carboxylase holo complexes reveals their functional expansion into amino acid catabolism
Ehebauer, PLoS pathogens 2015
- “...subsequent section. Creation of expression and complementation construct The sequence of M . tuberculosis AccD1 (Rv2502c) and AccA1 (Rv2501c) are encoded in an operon, with only a 4 base-pair intergenic region whereas M . tuberculosis AccD2 (RV0974c) and AccA2 (Rv0973c) are encoded in one operon lacking...”
- “...function, additional functional gene codes are also presented. The genes Rv2591c ( accD1 ) and Rv2502c ( accA1 ) from M . tuberculosis , the subject of this contribution, and homologous genes from other shown organisms are boxed. (TIF) Click here for additional data file. S2...”
bkaR is a TetR-type repressor that controls an operon associated with branched-chain keto-acid metabolism in Mycobacteria
Balhana, FEMS microbiology letters 2013
- “...4.8E-01 bkaR Rv2506 TetR transcriptional regulator ( bkaR ) * MSMEG_4717 9.0 * 3.7E-05 accD1 Rv2502c Acetyl/propionyl-coenzyme A carboxylase ( subunit) MSMEG_4716 15.0 1.5E-05 accA1 Rv2501c Acetyl/propionyl-coenzyme A carboxylase ( subunit) MSMEG_4715 13.7 5.8E-06 fadE19 Rv2500c Acyl-CoA dehydrogenase MSMEG_4714 9.5 1.1E-04 Rv2499c Rv2499c Hydratase MSMEG_4713 16.5...”
Disruption of cell wall fatty acid biosynthesis in Mycobacterium tuberculosis using a graph theoretic approach
Baths, Theoretical biology & medical modelling 2011
- “...i (Nearness Index) RV2501C 15 RV2967C 15 RV0973C 15 Rv3285 14.5 RV0263C 12 RV3280 11.5 RV2502C 11.5 RV3799C 11.5 RV0974C 11.5 RV2247 11.5 RV2888C 10 RV3375 10 RV3011C 10 RV1263 10 RV2363 10 RV1384 9 package nearnessindex; import java.util.Scanner; import java.util.regex .*; import java.io .*; /**...”
Development and analysis of an in vivo-compatible metabolic network of Mycobacterium tuberculosis
Fang, BMC systems biology 2010
- “...glycine betaine, and proline together with the TN genes proZ , proW , and proX Rv2502c accD1 Sugar metabolism Convert propionyl-CoA into S -methylmalonyl-CoA The product of this gene catalyzes the reaction together with the TN gene accA2 Rv2072c cobL Porphyrin metabolism Production of S -adenosyl-...”
More

E1BPP6 methylcrotonoyl-CoA carboxylase from Bos taurus
45% identity, 92% coverage

CircCLTH promotes skeletal muscle development and regeneration.
Chen, Epigenetics 2022

SACE_7039 propionyl-CoA carboxylase, beta subunit from Saccharopolyspora erythraea NRRL 2338
45% identity, 100% coverage

A novel multidomain acyl-CoA carboxylase in Saccharopolyspora erythraea provides malonyl-CoA for de novo fatty acid biosynthesis
Livieri, Scientific reports 2019
- “...instead of the -carbon of saturated acids (e.g. acetyl-CoA, propionyl-CoA). This group contains SACE_3241 and SACE_7039 that are closer related to CT domains of geranyl-CoA and methylcrotonyl-CoA carboxylases, respectively 21 . The CT domain of SACE_3154 clusters in group III together with other CT domains from...”

jk1551 acyl-CoA carboxylase, beta subunit from Corynebacterium jeikeium K411
44% identity, 98% coverage

Complete genome sequence and analysis of the multiresistant nosocomial pathogen Corynebacterium jeikeium K411, a lipid-requiring bacterium of the human skin flora
Tauch, Journal of bacteriology 2005
- “...three others coding for subunits of this enzyme (jk1551 [accD1], jk1662 [accD2]), and jk0139 [accD3]). In addition, 11 fadD genes encoding fatty acyl-CoA...”

SAV_5278 acetyl/propionyl CoA carboxylase, beta subunit from Streptomyces avermitilis MA-4680
46% identity, 96% coverage

Characterization of a pleiotropic regulator MtrA in Streptomyces avermitilis controlling avermectin production and morphological differentiation
Tian, Microbial cell factories 2024
- “...genes related to precursor synthesis on days 2 and 6 of fermentation, including accD1 ( sav_5278 , encoding the beta subunit of acetyl/propionyl coenzyme A carboxylase), acsA3 ( sav_562 , encoding acetyl-CoA synthase), ccrA1 ( sav_2890 , encoding crotonyl-CoA reductase), ccrA2 ( sav_1911 , encoding crotonyl-CoA...”

A1S_1375 putative propionyl-CoA carboxylase (Beta subunit) from Acinetobacter baumannii ATCC 17978
45% identity, 96% coverage

Mucin acts as a nutrient source and a signal for the differential expression of genes coding for cellular processes and virulence factors in Acinetobacter baumannii
Ohneck, PloS one 2018
- “...Hydroxymethylglutaryl-CoA lyase, MvaB A1S_1373 3.25732149 0.003228408 3-methylcrotonyl-CoA carboxylase subunit alpha A1S_1374 3.345393954 0.002883219 3-methylglutaconyl-CoA hydratase A1S_1375 3.012793835 0.01043401 3-methylcrotonyl-CoA carboxylase subunit beta A1S_1376 3.238990899 0.004131094 Isovaleryl-CoA dehydrogenase A1S_1610 2.081951258 2.45929E -05 Zn-dependent metalloendopeptidase A1S_1852 4.637517532 0.001480446 Phenylacetaldehyde dehydrogenase, FeaB A1S_1853 4.401870192 0.007821506 Putative tynE tynA (A1S_1854)...”

MSMEG_4717 Carboxyl transferase domain protein from Mycobacterium smegmatis str. MC2 155
47% identity, 97% coverage

The influence of AccD5 on AccD6 carboxyltransferase essentiality in pathogenic and non-pathogenic Mycobacterium
Pawelczyk, Scientific reports 2017
- “...We thus investigated which of the other remaining AccD proteins are involved in malonyl-CoA synthesis. MSMEG_4717 (AccD1), MSMEG_5492 (AccD2) and MSMEG_5642 (AccD3) proteins are not essential for fatty acid synthesis We previously assessed the essentiality of accD1 accD6 in Msm by directed mutagenesis and found that...”
- “...Construction of M. smegmatis accD1 accD4 gene replacement vectors To create an unmarked deletion of (MSMEG_4717) accD1 , (MSMEG_5492) accD2 , (MSMEG_5642) accD3 and (MSMEG_6391) accD4 for each gene, a suicidal recombination delivery vector based on p2NIL was used 39 . Each vector carried the region...”
Mycobacteriophage SWU1 gp39 can potentiate multiple antibiotics against Mycobacterium via altering the cell wall permeability
Li, Scientific reports 2016
- “...hydratase EchA4 MSMEG_1390 3.39 Rv0675 enoyl-CoA hydratase EchA5 MSMEG_5996 3.24 Rv3546 involved in lipid degradation MSMEG_4717 3.00 Rv2502c fatty acid metabolism MSMEG_6041 2.41 Rv3573c lipid degradation MSMEG_3465 2.18 Rv1925 lipid degradation MSMEG_4716 2.51 Rv2501c lipid metabolism MSMEG_5907 2.15 Rv3505 involved in lipid degradation MSMEG_5923 2.10 Rv3523...”
bkaR is a TetR-type repressor that controls an operon associated with branched-chain keto-acid metabolism in Mycobacteria
Balhana, FEMS microbiology letters 2013
- “...analysis M.smegmatis CTCG GTTA A T CGTG A C TAAC GTAC 1.4e-05 bkaR Msm / MSMEG_4717 + + + CTGA GTTA A T GACG A C TAAC TCGT 3.9E-05 MSMEG_4717/bkaR Msm + ND + GCCG GTTA A T CATCGT TAAC ACAG 0.6 MSMEG_4920 + ND +...”
- “...Acetyl-CoA acetyltransferase MSMEG_4718 1.8 * 4.8E-01 bkaR Rv2506 TetR transcriptional regulator ( bkaR ) * MSMEG_4717 9.0 * 3.7E-05 accD1 Rv2502c Acetyl/propionyl-coenzyme A carboxylase ( subunit) MSMEG_4716 15.0 1.5E-05 accA1 Rv2501c Acetyl/propionyl-coenzyme A carboxylase ( subunit) MSMEG_4715 13.7 5.8E-06 fadE19 Rv2500c Acyl-CoA dehydrogenase MSMEG_4714 9.5 1.1E-04...”

Pfl01_3657 propionyl-CoA carboxylase from Pseudomonas fluorescens Pf0-1
44% identity, 100% coverage

Transcriptional and antagonistic responses of Pseudomonas fluorescens Pf0-1 to phylogenetically different bacterial competitors
Garbeva, The ISME journal 2011
- “...protein; Pfl01_3656, isovaleryl-CoA dehydrogenase; Pfl01_3657, propionyl-CoA carboxylase; Pfl01_3658, g-carboxygeranoyl-CoA hydratase; and Pfl01_3659,...”

D174_19735 carboxyl transferase domain-containing protein from Mycolicibacterium neoaurum VKM Ac-1815D
46% identity, 97% coverage

Effect of TetR Family Transcriptional Regulator PccD on Phytosterol Metabolism of Mycolicibacterium
Xiao, Microorganisms 2024
- “...of S. albidoflavus J1074. By analyzing the genes adjacent to D174_19740, the results indicate that D174_19735 encodes the subunit of propionyl-CoA carboxylase (PccB), and D174_19730 encodes the subunit of propionyl-CoA carboxylase (PccA). The gene cluster of pcc in Msp was named pcc operon, and the genes...”
Combined enhancement of the propionyl-CoA metabolic pathway for efficient androstenedione production in Mycolicibacterium neoaurum
Su, Microbial cell factories 2022
- “...methyl-branched lipid synthesis pathway of the MTB [ 12 ]. The AccA1 D174_19730 and AccD1 D174_19735 were localized on the MNR VKM Ac-1815D (TAX:700508) genome by bioinformatics methods. Based on the functions of AccA1 and AccD1, their expression in MNR was aimed at enhancing the cytosolic...”

LA_3803 acetyl-CoA carboxylase carboxyltransferase component from Leptospira interrogans serovar lai str. 56601
44% identity, 96% coverage

Characterization of acetyl-CoA and propionyl-CoA carboxylases encoded by Leptospira interrogans serovar Lai: an initial biochemical study for leptospiral gluconeogenesis via anaplerotic CO(2) assimilation
Peng, Acta biochimica et biophysica Sinica 2012 (PubMed)
- “...(PCC) activities. The trisubunit holoenzyme (LA_2736-LA_2735 and LA_3803), although failed to be purified, was designated ACC based on its substrate preference...”
- “...five genes (LA_2432, LA_2433, LA_2736, LA_2735, and LA_3803), which inferred a partial 3-hydroxypropionate pathway for anaplerotic CO2 assimilation [27]. In...”

AO356_01585 3-methylcrotonyl-CoA carboxylase, beta subunit (EC 6.4.1.4) from Pseudomonas fluorescens FW300-N2C3
44% identity, 100% coverage

mutant phenotype: Specifically important for utilizing L-Leucine. Automated validation from mutant phenotype: the predicted function (6.4.1.4) was linked to the condition via a SEED subsystem. This annotation was also checked manually.

BV82_2130 carboxyl transferase domain-containing protein from Pseudomonas donghuensis
44% identity, 100% coverage

Host-adaptive traits in the plant-colonizing Pseudomonas donghuensis P482 revealed by transcriptomic responses to exudates of tomato and maize
Krzyżanowska, Scientific reports 2023
- “...BV82_1237 aceA Isocitrate lyase 2.00 0.27 BV82_2129 ivd Acyl-CoA dehydrogenase, N-terminal domain protein 1.86 0.19 BV82_2130 accD1 Carboxyl transferase domain protein 1.68 0.71 BV82_2131 liuC Enoyl-CoA hydratase/isomerase family protein 2.27 0.52 BV82_2132 mccA hlyD secretion family protein 2.53 0.32 BV82_4665 aceE/mdeB Pyruvate dehydrogenase (acetyl-transferring), homodimeric type...”

PSPTO_2738 carboxyl transferase domain protein from Pseudomonas syringae pv. tomato str. DC3000
44% identity, 100% coverage

A computational model of Pseudomonas syringae metabolism unveils a role for branched-chain amino acids in Arabidopsis leaf colonization
Tubergen, PLoS computational biology 2023
- “...BCAAs biosynthesis. The leucine minimal medium rendered three additional genes predicted to be essential: PSPTO_2736, PSPTO_2738, and PSPTO_2739. The three genes show high sequence homology to the leucine catabolic genes liuD , liuB , and liuA , respectively. 10.1371/journal.pcbi.1011651.g003 Fig 3 iPst19 predicts genes of the...”
- “...iso-propyl-malate dehydrogenase (PSPTO_2175) were essential to metabolize glucose, three genes of the liu operon (PSPTO_2736, PSPTO_2738, and PSPTO_2739) were essential to use leucine as the sole carbon source. (C) Predicted gene essentiality changes with mixed carbon sources where iPst19 gene essentiality was simulated in conditions where...”

Pf6N2E2_2192 3-methylcrotonyl-CoA carboxylase, beta subunit (EC 6.4.1.4) from Pseudomonas fluorescens FW300-N2E2
44% identity, 100% coverage

mutant phenotype: Specifically important for utilizing L-Leucine. Automated validation from mutant phenotype: the predicted function (6.4.1.4) was linked to the condition via a SEED subsystem. This annotation was also checked manually.

SM_b21122 3-methylcrotonyl-CoA carboxylase, beta subunit (EC 6.4.1.4) from Sinorhizobium meliloti 1021
45% identity, 100% coverage

mutant phenotype: Specifically important for utilizing L-Leucine. Automated validation from mutant phenotype: the predicted function (6.4.1.4) was linked to the condition via a SEED subsystem. This annotation was also checked manually.

PP4065 3-methylcrotonyl-CoA carboxylase, beta subunit, putative from Pseudomonas putida KT2440
44% identity, 100% coverage

PpoR is a conserved unpaired LuxR solo of Pseudomonas putida which binds N-acyl homoserine lactones
Subramoni, BMC microbiology 2009
- “...PP4621 homogentisate 1,2-dioxygenase 7.574 5. PP1742 hypothetical protein 7.057 6. PP4064 isovaleryl-CoA dehydrogenase 6.120 7. PP4065 3-methylcrotonyl-CoA carboxylase, beta subunit, putative 6.042 8. PP0882 dipeptide ABC transporter, periplasmic dipeptide-binding protein 5.896 9. PP4402 2-oxoisovalerate dehydrogenase, beta subunit 5.677 10. PP4864 branched-chain amino acid ABC transporter, ATP-binding...”
Genome-scale reconstruction and analysis of the Pseudomonas putida KT2440 metabolic network facilitates applications in biotechnology
Puchałka, PLoS computational biology 2008
- “...-Piperideine-2-carboxylate reductase; EC 1.5.1.21 [36] PP4066 Enoyl-CoA hydratase, putative; EC:4.2.1.17 Methylglutaconyl-CoA hydratase; EC 4.2.1.18 [88] PP4065 3-Methylcrotonyl-CoA carboxylase, beta subunit, putative EC:6.4.1.3 Methylcrotonoyl-CoA carboxylase; EC 6.4.1.4 [88] PP4067 AcCoA carboxylase, biotin carboxylase, putative; EC:6.4.1.3 Methylcrotonoyl-CoA carboxylase; EC 6.4.1.4 [88] PP4223 Diaminobutyrate-2-oxoglutarate transaminase; EC:2.6.1.76 Putrescine aminotransferase; EC...”

SACE_3241 propionyl-CoA carboxylase, beta subunit from Saccharopolyspora erythraea NRRL 2338
44% identity, 100% coverage

A novel multidomain acyl-CoA carboxylase in Saccharopolyspora erythraea provides malonyl-CoA for de novo fatty acid biosynthesis
Livieri, Scientific reports 2019
- “...unsaturated acids, instead of the -carbon of saturated acids (e.g. acetyl-CoA, propionyl-CoA). This group contains SACE_3241 and SACE_7039 that are closer related to CT domains of geranyl-CoA and methylcrotonyl-CoA carboxylases, respectively 21 . The CT domain of SACE_3154 clusters in group III together with other CT...”

FRAAL3158 Propionyl-CoA carboxylase beta chain from Frankia alni ACN14a
46% identity, 96% coverage

The Proteogenome of Symbiotic Frankia alni in Alnus glutinosa Nodules
Pujic, Microorganisms 2022
- “...were underabundant such as three acetyl-CoA carboxylases (FRAAL3159, FC = 0.55; FRAAL1213, FC = 0.43; FRAAL3158, FC = 0.23), a methyl-crotonoyl-CoA carboxylase (FRAAL2343, FC = 0.15) and two propionyl-CoA carboxylases (FRAAL5672, FC = 0.05; FRAAL1210, FC = 0.68). The only overabundant one was a phosphoribosylaminoimidazole carboxylase...”

I1I750 methylcrotonoyl-CoA carboxylase from Brachypodium distachyon
45% identity, 91% coverage

Proteomic and metabolic disturbances in lignin-modified Brachypodium distachyon
Barros, The Plant cell 2022
- “...BdPTAL1i (chlorophyll a-b binding protein, A0A0Q3LCW1; alpha-amylase, I1GWZ8; chitinase, I1HTL6; aldo-keto reductase, I1HIH2; 3-methylcrotonyl-CoA carboxylase, I1I750); BdC4H1i (magnesium chelatase, I1GRM4; FAD diphosphatase, I1ISL9; beta-ureidopropionase, I1GUE5; asparaginase, I1J2P3; glutathione transferase, I1I5M2; glutathione transferase, I1H6R5; glutathione transferase, I1GZH6; glutathione transferase, I1HNH0; chitinase, I1HTL6; GPI-anchor transamidase, I1ILR8; gamma-glutamylcyclotransferase, I1IY91);...”
- “...asparaginase, I1J2P3; glutathione transferase, I1HCG7; glutathione transferase, I1GZH6; glutathione transferase, I1I5M1; gamma-glutamylcyclotransferase, I1IY91; 3-methylcrotonyl-CoA carboxylase, I1I750). Full metabolic shifts by RNAi line are provided in Supplemental Figures S8S12 . BdPAL2i lines PALs are soluble cytoplasmic proteins and the largest family of cytosolic lignin biosynthetic enzymes. Brachypodium...”

SCO4380 acetyl/propionyl CoA carboxylase, beta subunit from Streptomyces coelicolor A3(2)
45% identity, 100% coverage

AccR, a TetR Family Transcriptional Repressor, Coordinates Short-Chain Acyl Coenzyme A Homeostasis in Streptomyces avermitilis
Lyu, Applied and environmental microbiology 2020 (secret)
Role of Wax Ester Synthase/Acyl Coenzyme A:Diacylglycerol Acyltransferase in Oleaginous Streptomyces sp. Strain G25
Röttig, Applied and environmental microbiology 2016
- “...PccA, and SCO4381), four subunits (AccB, PccB, SCO2776, and SCO4380), and two subunits (AccE, PccE) from S. coelicolor (49) AcpP from S. coelicolor (22) FabD...”
Fatty acid biosynthesis in actinomycetes
Gago, FEMS microbiology reviews 2011
- “...subunits ( accA1, accA2, pccA, SCO4381 ), four genes encoding subunits ( accB, pccB, SCO2776, SCO4380 ) and two genes encoding subunits ( accE, pccE ) ( Bramwell et al. , 1996 ; Diacovich et al. , 2004 ; Rodriguez and Gramajo, 1999 ; Rodriguez et...”
- “...This is the case for the and subunits pccA and SCO2776 and for SCO4381 and SCO4380 , respectively. An enzymatic PCC complex was partially characterized in S. coelicolor ( Bramwell et al. , 1996 ) consisting of a biotinylated protein, PccA, of 88 kDa, and the...”

CVAR_2092 carboxyl transferase domain-containing protein from Corynebacterium variabile DSM 44702
48% identity, 91% coverage

Complete genome sequence of Corynebacterium variabile DSM 44702 isolated from the surface of smear-ripened cheeses and insights into cheese ripening and flavor generation
Schröder, BMC genomics 2011
- “...acid metabolism of C. variabile DSM 44702 includes genes coding for putative acyl-CoA carboxylase subunits (CVAR_2092 and CVAR_2091), an acyl-CoA dehydrogenase domain-containing protein (CVAR_2090), an enoyl-CoA hydratase domain-containing protein (CVAR_2089), a citrate lyase -subunit ( citE ), an acyl-CoA synthetase ( fadD6 ), aycl-CoA:3-ketoacid-CoA transferase subunits...”

8j4zJ / Q9HCC0 Human 3-methylcrotonyl-coa carboxylase in bccp-cts state with substrate (see paper)
45% identity, 99% coverage

Ligands: 5-(hexahydro-2-oxo-1h-thieno[3,4-d]imidazol-6-yl)pentanal; ~{s}-[2-[3-[[(2~{r})-4-[[[(2~{s},3~{s},4~{s},5~{s})-5-(6-aminopurin-9-yl)-4-oxidanyl-3-phosphonooxy-oxolan-2-yl]methoxy-oxidanyl-phosphoryl]oxy-oxidanyl-phosphoryl]oxy-3,3-dimethyl-2-oxidanyl-butanoyl]amino]propanoylamino]ethyl] 3-methylbut-2-enethioate (8j4zJ)

MCCC2 / Q9HCC0 3-methylcrotonyl-CoA carboxylase β subunit (EC 6.4.1.4) from Homo sapiens (see 4 papers)
MCCB_HUMAN / Q9HCC0 Methylcrotonoyl-CoA carboxylase beta chain, mitochondrial; MCCase subunit beta; 3-methylcrotonyl-CoA carboxylase 2; 3-methylcrotonyl-CoA carboxylase non-biotin-containing subunit; 3-methylcrotonyl-CoA:carbon dioxide ligase subunit beta; EC 6.4.1.4 from Homo sapiens (Human) (see 14 papers)
NP_071415 methylcrotonoyl-CoA carboxylase beta chain, mitochondrial isoform 1 precursor from Homo sapiens
45% identity, 95% coverage

function: Carboxyltransferase subunit of the 3-methylcrotonyl-CoA carboxylase, an enzyme that catalyzes the conversion of 3- methylcrotonyl-CoA to 3-methylglutaconyl-CoA, a critical step for leucine and isovaleric acid catabolism.
catalytic activity: 3-methyl-(2E)-butenoyl-CoA + hydrogencarbonate + ATP = 3- methyl-(2E)-glutaconyl-CoA + ADP + phosphate + H(+) (RHEA:13589)
subunit: Probably a dodecamer composed of six biotin-containing alpha subunits (MCCC1) and six beta (MCCC2) subunits
Molecular Fingerprint of Human Pathological Synoviocytes in Response to Extractive Sulfated and Biofermentative Unsulfated Chondroitins
Vassallo, International journal of molecular sciences 2022
- “...Q00059 TFAM Transcription factor A, mitochondrial 1.2 1.1 P67809 YBX1 Y-box-binding protein 1 1.2 1.1 Q9HCC0 MCCC2 Methylcrotonoyl-CoA carboxylase beta chain, mitochondrial 1.2 1.1 Q01433 AMPD2 AMP deaminase 2 1.2 1.1 O00534 VWA5A von Willebrand factor A domain-containing protein 5A 1.3 1.1 P33527 ABCC1 Multidrug resistance-associated...”
Insight into the Molecular Signature of Skeletal Muscle Characterizing Lifelong Football Players
Orrù, International journal of environmental research and public health 2022
- “...2.06 Q8NBS9 Thioredoxin domain-containing protein 5 TXNDC5 2.06 O00148 ATP-dependent RNA helicase DDX39A DDX39A 2.06 Q9HCC0 Methylcrotonoyl-CoA carboxylase beta chain, mitochondrial MCCC2 2.06 Q9NZN4 EH domain-containing protein 2 EHD2 2.06 P23246 Splicing factor, proline- and glutamine-rich SFPQ 2.06 Q9NUB1 Acetyl-coenzyme A synthetase 2-like, mitochondrial ACSS1 2.06...”
Naturally Occurring Epsilon Gamma Glutamyl Lysine Isopeptide Crosslinks in Human Neuroblastoma SH-SY5Y Cells
Lockridge, ACS omega 2022
- “...IQ 511 NLEQKLSGDSR Q9Y2G4 ANKR6 6 +4 52.2 + 4.7 79.5 KVVRNLNYQK 298 K a Q9HCC0 MCCB VKVGSLQ 710 TTAK Q96NW7 LRRC7 7 +4 43.7 + 15.1 50.0 YK 338 AYLYLDEAHSIGALGPTGR O15270 SPTC2 LVEYLQ 721 AMoxR Q96RT8 GCP5 8 +4 42.1 + 10.9 73.5 K 48...”
Depletion of Mdig Changes Proteomic Profiling in Triple Negative Breast Cancer Cells.
Thakur, Biomedicines 2022
- “...interactor 1 7.096 NOP58 Q9Y2X3 Nucleolar protein 58 7.083 NAMPT P43490 Nicotinamide phosphoribosyltransferase 7.006 MCCC2 Q9HCC0 Methylcrotonoyl-CoA carboxylase beta chain, mitochondrial 6.863...”
Angiogenic and Immunologic Proteins Identified by Deep Proteomic Profiling of Human Retinal and Choroidal Vascular Endothelial Cells: Potential Targets for New Biologic Drugs.
Smith, American journal of ophthalmology 2018
- “...8.2911E-02 Syntaxin-binding protein 2 Q15833 1.55 7.5917E-02 Methylcrotonoyl-CoA carboxylase beta chain, mitochondrial (MCCase subunit beta) Q9HCC0 1.52 6.3742E-02 Unconventional myosin-Ie Q12965 1.50 7.0378E-02 Interleukin-6 receptor subunit beta (IL-6 receptor subunit beta; IL-6R subunit beta; IL-6R-beta; IL-6RB) P40189 1.49 5.5532E-02 Peptidyl-prolyl cis-trans isomerase FKBP9 (PPIase FKBP9) O95302...”
SAMHD1 Posttranscriptionally Controls the Expression of Foxp3 and Helios in Human T Regulatory Cells.
Kim, Journal of immunology (Baltimore, Md. : 1950) 2018
- “...6 , 7 ) Category Accession Score Descriptions Mitochondrial enzymes with Biotin cofactor MCCB_HUMAN 348.2093251 (Q9HCC0) Methylcrotonoyl-CoA carboxylase beta chain, mitochondrial Mitochondrial enzymes with Biotin cofactor MCCA_HUMAN 249.9351293 (Q96RQ3) Methylcrotonoyl-CoA carboxylase subunit alpha, mitochondrial Mitochondrial enzymes with Biotin cofactor PCCA_HUMAN 93.580363 (P05165) Propionyl-CoA carboxylase alpha chain,...”
Identification of LEFTY as a molecular marker for ovarian clear cell carcinoma.
Akiya, Oncotarget 2017
- “...1 3 3 2 3 2 4 0 2 3 2 3 0 8 3 Q9HCC0 Methylcrotonoyl-CoA carboxylase beta chain, mitochondrial MCCC2 3 4 4 3 4 2 1 1 1 1 0 2 1 2 2 1 3 1 1 1 P22570 NADPH:adrenodoxin oxidoreductase, mitochondrial...”
Mechanistic Study of the Phytocompound, 2- β -D-Glucopyranosyloxy-1-hydroxytrideca-5,7,9,11-tetrayne in Human T-Cell Acute Lymphocytic Leukemia Cells by Using Combined Differential Proteomics and Bioinformatics Approaches
Shiau, Evidence-based complementary and alternative medicine : eCAM 2015
- “...protein L39 Q9NYK5 34204 6.47 26 7 Metabolism MS, MS/MS MCCB Methylcrotonoyl-CoA carboxylase beta chain Q9HCC0 61294 7.57 31 12 Metabolism; energy pathways MS, MS/MS TXNL1 Thioredoxin-like protein 1 O43396 32100 4.84 58 10 4.4 Metabolism MS, MS/MS C3orf60 Chromosome 3 open reading fragment 60 AAH02873...”
More
ECHDC2 inhibits the proliferation of gastric cancer cells by binding with NEDD4 to degrade MCCC2 and reduce aerobic glycolysis.
He, Molecular medicine (Cambridge, Mass.) 2024
- GeneRIF: ECHDC2 inhibits the proliferation of gastric cancer cells by binding with NEDD4 to degrade MCCC2 and reduce aerobic glycolysis.
MCCC2 is a novel mediator between mitochondria and telomere and functions as an oncogene in colorectal cancer.
Liu, Cellular & molecular biology letters 2023
- GeneRIF: MCCC2 is a novel mediator between mitochondria and telomere and functions as an oncogene in colorectal cancer.
[Analysis of MCCC2 gene variant in a pedigree affected with 3-methylcrotonyl coenzyme A carboxylase deficiency].
Li, Zhonghua yi xue yi chuan xue za zhi = Zhonghua yixue yichuanxue zazhi = Chinese journal of medical genetics 2021 (PubMed)
- GeneRIF: [Analysis of MCCC2 gene variant in a pedigree affected with 3-methylcrotonyl coenzyme A carboxylase deficiency].
MCCC2 overexpression predicts poorer prognosis and promotes cell proliferation in colorectal cancer.
Dai, Experimental and molecular pathology 2020 (PubMed)
- GeneRIF: MCCC2 overexpression predicts poorer prognosis and promotes cell proliferation in colorectal cancer.
Methylcrotonoyl-CoA carboxylase 2 overexpression predicts an unfavorable prognosis and promotes cell proliferation in breast cancer.
Liu, Biomarkers in medicine 2019 (PubMed)
- GeneRIF: MCCC2 overexpression predicts an unfavorable prognosis and promotes cell proliferation in breast cancer
[Genetic analysis of newborns with abnormal metabolism of 3-hydroxyisovalerylcarnitine].
Wu, Zhejiang da xue xue bao. Yi xue ban = Journal of Zhejiang University. Medical sciences 2019
- GeneRIF: Mutations on MCCC1 and MCCC2 genes are the major genetic causes for the increased C5-OH in neonates
3-Methylcrotonyl-CoA carboxylase deficiency: Mutational spectrum derived from comprehensive newborn screening.
Fonseca, Gene 2016 (PubMed)
- GeneRIF: This study reports data mainly obtained from the Portuguese newborn screening program collected over a ten-year period. Analysis of the MCCC1 and MCCC2 genes yielded 26 previously unreported mutations and a variant of clinically unknown significance.
Identification of eight novel mutations and transcript analysis of two splicing mutations in Chinese newborns with MCC deficiency.
Yang, Clinical genetics 2015 (PubMed)
- GeneRIF: Novel mutation in MCCC2 gene was identified in Chinese population.
More

B6SWZ4 methylcrotonoyl-CoA carboxylase from Zea mays
45% identity, 92% coverage

Nitric Oxide Regulates Seedling Growth and Mitochondrial Responses in Aged Oat Seeds
Mao, International journal of molecular sciences 2018
- “...B4G146 AT5G06580 d -lactate dehydrogenase [cytochrome] mitochondrial Zea mays 0.69 1.58 ns Amino acid metabolism B6SWZ4 AT4G34030 Methylcrotonoyl-CoA carboxylase beta chain mitochondrial Zea mays ns ns 1.21 Co-factor and vitamine metabolism, lipoic acid U5H066 AT5G08415 Lipoyl synthase, mitochondrial Microbotryum lychnidis-dioicae ns 0.73 0.72 Redox, Glutaredoxins Q0JQ97...”

Rru_A1943 Propionyl-CoA carboxylase from Rhodospirillum rubrum ATCC 11170
45% identity, 100% coverage

The metabolic pathways of carbon assimilation and polyhydroxyalkanoate production by Rhodospirillum rubrum in response to different atmospheric fermentation
Tang, PloS one 2024
- “...), crotonyl-CoA carboxylase/ reductase ( Rru_A3063 ), pyruvate-flavodoxin oxidoreductase ( Rru_A2398 ), propionyl-CoA carboxylase ( Rru_A1943 ), 2-oxoglutarate synthase ( Rru_A2721 ), PHA synthase ( Rru_A0275 ), PHA polymerase homologous gene ( Rru_A1816 ), ketothiolase ( Rru_A0274 ), acetoacetyl-CoA reductase ( Rru_A0273 ), carbon-monoxide dehydrogenase (...”
- “...carboxylases related to TCA cycle were also highly upregulated in gas fermentation stage. Propionyl-CoA carboxylase (Rru_A1943) catalyzed propionyl-CoA yielding methylmalonyl-CoA linking to succinyl-CoA synthesis and pyruvate carboxylase (Rru_A2317) catalyzed pyruvate yielding oxaloacetate ( Fig 5 ). 10.1371/journal.pone.0306222.g005 Fig 5 Expression analysis of CO 2 fixation related...”
New perspectives on butyrate assimilation in Rhodospirillum rubrum S1H under photoheterotrophic conditions
De, BMC microbiology 2020
- “...of Sh. oneidensis , respectively, were detected with a higher abundance in the butyrate-assimilating cultures. Rru_A1943, Rru_A1941 and Rru_A1940, corresponding to LiuB, LiuD and LiuE, respectively, could not be detected at the protein level. The homologues of LiuF and LiuG could not be found in this...”
Synthesis Gas (Syngas)-Derived Medium-Chain-Length Polyhydroxyalkanoate Synthesis in Engineered Rhodospirillum rubrum
Heinrich, Applied and environmental microbiology 2016
- “...crotonyl-CoA reductase (Rru_A3063 [8]), a propionylCoA carboxylase (Rru_A1943 [9]), and a 2-oxoglutarate synthase (Rru_A2721 [10]). HS-CoA, coenzyme A thiol;...”

Tfu_0948 propionyl-CoA carboxylase from Thermobifida fusca YX
43% identity, 99% coverage

The Effects of Carbon Source and Growth Temperature on the Fatty Acid Profiles of Thermobifida fusca
Winkelman, Frontiers in molecular biosciences 2022
- “...Gene name ACCase A ACCase BC and BCCP subunits Tfu_0947 ACCase B ACCase CT subunit Tfu_0948 AcCCase A AcCCase BC and BCCP subunit Tfu_2557 AcCCase B AcCCase CT subunit Tfu_2555 AcCCase E AcCCase E subunit Tfu_2556 ACCase B Additional ACCase CT subunit Tfu_1228, Tfu_1215 BCCP Biotin...”
- “...T. fusca genome identified additional genes that encode homologs of biotin-containing carboxylase proteins, namely Tfu_0947, Tfu_0948, Tfu_1215, Tfu_1228, Tfu_1513, and Tfu_1530. The adjacent Tfu_0947 and Tfu_0948 genes suggest that they are on a single operon, with Tfu_0947 encoding a subunit with the BC and BCCP domains,...”

LOC107447145 methylcrotonoyl-CoA carboxylase beta chain, mitochondrial from Parasteatoda tepidariorum
44% identity, 93% coverage

Microarray data on the comparison of transcript expression between normal and Pt-Delta RNAi embryos in the common house spider Parasteatoda tepidariorum
Oda, Data in brief 2019
- “...0.524 eS7_SB_012_D04 end eS7_SB_012_D04 6032 FY378611 g27733 LOC107442734 0.567 eS7_SB_012_D04 end At_eW_016_B19 4625 FY221307 g1624 LOC107447145 0.498 At_eW_016_B19* At_eW_016_C08 10970 FY221318 g17631 n/a 0.562 At_eW_016_C08* At_eW_017_E05 11338 FY221647 g7733 LOC107447731 0.589 At_eW_017_E05* At_eW_021_K03 11455 FY223147 g25961 LOC107436162 0.577 eS7_SB_047_G11* At_eW_022_C14 7174 FY223344 g58 LOC107440897 0.552 At_eW_022_C14*...”

VT47_11885 carboxyl transferase domain-containing protein from Pseudomonas syringae pv. syringae
43% identity, 100% coverage

Identification of the Genes of the Plant Pathogen Pseudomonas syringae MB03 Required for the Nematicidal Activity Against Caenorhabditis elegans Through an Integrated Approach
Ali, Frontiers in microbiology 2022
- “...regulator (VT47_13020), isovaleryl-CoA dehydrogenase (VT47_11890), putative acyl-CoA carboxylase alpha chain (VT47_11875), acyl-CoA carboxyltransferase beta chain (VT47_11885), prpC (VT47_09990), and PrpB (VT47_09985). On the other hand, crfX (VT47_10030), (VT47_19750) and hypothetical protein (VT47_10035) were down regulated ( Table 2 ). Regarding nematicidal genes of PAO1, homologs of...”
- “...regulator |VT47_11890 Yes Unchanged Up Isovaleryl-CoA dehydrogenase VT47_11875 Yes Unchanged Up 3-Methylcrotonyl-CoA carboxylase alpha subunit VT47_11885 Yes Unchanged Up Propionyl-CoA carboxylase prpC VT47_09990 Yes Unchanged Up 2-Methylcitrate synthase prpB VT47_09985 Yes Unchanged Up 2-Methylisocitrate lyase cmpX VT47_10035 Yes Unchanged Down Hypothetical protein ibaG VT47_19750 Yes Unchanged...”

XAC0264 acyl-CoA carboxyltransferase beta chain from Xanthomonas axonopodis pv. citri str. 306
43% identity, 100% coverage

3-methylcrotonyl Coenzyme A (CoA) carboxylase complex is involved in the Xanthomonas citri subsp. citri lifestyle during citrus infection
Tomassetti, PloS one 2018
- “...(ACCase) enzymes dependent of biotin. In this work, we have identified two ORFs (XAC0263 and XAC0264) encoding for the and subunits of an acyl-CoA carboxylase complex from Xanthomonas and demonstrated that this enzyme has MCC activity both in vitro and in vivo . We also found...”
- “...and Mycobacterium [ 44 , 45 ]. Particularly Xcc has two ORFs, named XAC0263 and XAC0264, encoding for the putative and subunits of an ACCase complex in this bacterium, respectively. The subunit displays four highly conserved domains present in the subunits of several ACCases already identified...”

Sama_1361 3-methylcrotonyl-CoA carboxylase, beta subunit (EC 6.4.1.4) from Shewanella amazonensis SB2B
43% identity, 100% coverage

mutant phenotype: Specifically important for utilizing L-Leucine. Automated validation from mutant phenotype: the predicted function (6.4.1.4) was linked to the condition via a SEED subsystem. This annotation was also checked manually.

N646_4049 carboxyl transferase domain-containing protein from Vibrio alginolyticus NBRC 15630 = ATCC 17749
43% identity, 100% coverage

Identification of Antibacterial Components in the Methanol-Phase Extract from Edible Herbaceous Plant Rumex madaio Makino and Their Antibacterial Action Modes
Liu, Molecules (Basel, Switzerland) 2022
- “...N646_4585 2.117 Acetoacetyl-coenzyme A synthetase N646_4506 2.127 Putative 3-hydroxyisobutyrate dehydrogenase N646_4019 2.293 Acetoacetyl-coenzyme A synthetase N646_4049 2.793 Putative acyl-CoA carboxyltransferase beta chain N646_4047 3.123 Putative acyl-CoA carboxylase alpha chain N646_4057 3.302 3-hydroxyisobutyrate dehydrogenase N646_4048 4.128 Putative enoyl-CoA hydratase/isomerase N646_4053 4.602 Putative aldehyde dehydrogenase N646_4050 4.619 Putative...”

SO1896 3-methylcrotonyl CoA carboxylase, beta subunit from Shewanella oneidensis MR-1
42% identity, 100% coverage

Profiling the membrane proteome of Shewanella oneidensis MR-1 with new affinity labeling probes
Tang, Journal of proteome research 2007
- “...SO1776 SO1778 SO1779 SO1798 SO1825 SO1826 SO1827 SO1829 SO1896 SO1928 SO1930 SO1931 SO2001 SO2361 SO2363 SO2397 SO2427 SO2469 60469 44635 56190 48709 45291...”
Transcriptome profiling of Shewanella oneidensis gene expression following exposure to acidic and alkaline pH
Leaphart, Journal of bacteriology 2006
- “...4.5-fold at the 30-min time point). The genes pccB-1 (so1896) and ivd (so1897), which are both induced eightfold in response to alkaline pH (Table 2), are...”
- “...Berkeley so1336 so1337 so1338 so1339 so1417 so1689 so1870 so1896 so1897 so1898 so1946 so1965 so2881 so2903 so3142 so3599 so3600 so3601 so3602 so3723 so3726...”

PAAG_04103 methylcrotonoyl-CoA carboxylase beta chain from Paracoccidioides lutzii Pb01
43% identity, 92% coverage

Prediction of Conserved Peptides of Paracoccidioides for Interferon-γ Release Assay: The First Step in the Development of a Lab-Based Approach for Immunological Assessment during Antifungal Therapy
Rosa, Journal of fungi (Basel, Switzerland) 2020
- “...0.0 100% 98% Methyltransferase PADG_01183 0.0 100% 94% Methyltransferase PAAG_09014 0.0 94% 100% Methylcronotonoil-CoA carboxylase PAAG_04103 0.0 98% 100% Methilmalonate-semialdehyde dehydrogenase PAAG_07036 0.0 98% 100% Metalo hydrolase PADG_03136 0.0 100% 97% Mitochondrial PAAG_05350 0.0 97% 100% Mitochondrial acetonate hydratase PAAG_00845 0.0 100% 99% NADP-especific glutamate dehydrogenase...”
Differential Metabolism of a Two-Carbon Substrate by Members of the Paracoccidioides Genus
Baeza, Frontiers in microbiology 2017
- “...from leucine, while the enzymes in this pathway were not up-regulated and the methylcrotonyl-CoA carboxylase (PAAG_04103) was repressed (Figure 7 and Supplementary Figure 8 ). The conversion of valine and isoleucine to succinyl-CoA may be more predominant in Pb EPM83 and Pb 01 because of up-regulation...”

Dshi_1300 Propionyl-CoA carboxylase from Dinoroseobacter shibae DFL 12
47% identity, 91% coverage

Transcriptional response of the photoheterotrophic marine bacterium Dinoroseobacter shibae to changing light regimes
Tomasch, The ISME journal 2011
- “...Caur_0180 Dshi_0131 Dshi_3146 Dshi_2182 Dshi_3553 Dshi_1300 Dshi_2630 Dshi_1057 Dshi_1057 Dshi_2490 Dshi_2871 Dshi_2494 Dshi_2493 Acetyl-CoA carboxylase,...”

PADG_07370 uncharacterized protein from Paracoccidioides brasiliensis Pb18
C1GJD4 methylcrotonoyl-CoA carboxylase from Paracoccidioides brasiliensis (strain Pb18)
43% identity, 92% coverage

Effect of Nitrosative Stress on the S-Nitroso-Proteome of Paracoccidioides brasiliensis
Navarro, Frontiers in microbiology 2020
- “...PADG_01797 C1G4D1 Uncharacterized protein 279.19 PADG_00443 C1G0Q3 Dihydropteroate synthase 188.75 PADG_07627 C1GK41 Uncharacterized protein 180.29 PADG_07370 C1GJD4 Uncharacterized protein 172.67 PADG_00210 C1G020 Glycine dehydrogenase 156.30 PAD.G_04192 C1GAA6 Uncharacterized protein 122.04 PADG_01100 C1FZ74 Uracil phosphoribosyltransferase 120.38 PADG_06992 C1GIA6 GrpE protein homolog 114.80 PADG_00599 C1G159 26S protease regulatory...”
Differential Metabolism of a Two-Carbon Substrate by Members of the Paracoccidioides Genus
Baeza, Frontiers in microbiology 2017
- “...may efficiently produce acetyl-CoA from leucine because of the induction of the enzyme methylcrotonyl-CoA carboxylase (PADG_07370) in both isolates, as depicted in Figure 7 and Supplementary Figure 8 . Related to this pathway, the enzymes isovaleryl-CoA dehydrogenase (PADG_07369) and methylglutaconyl-CoA hydratase (PADG_00643) were induced in Pb...”
Effect of Nitrosative Stress on the S-Nitroso-Proteome of Paracoccidioides brasiliensis
Navarro, Frontiers in microbiology 2020
- “...C1G4D1 Uncharacterized protein 279.19 PADG_00443 C1G0Q3 Dihydropteroate synthase 188.75 PADG_07627 C1GK41 Uncharacterized protein 180.29 PADG_07370 C1GJD4 Uncharacterized protein 172.67 PADG_00210 C1G020 Glycine dehydrogenase 156.30 PAD.G_04192 C1GAA6 Uncharacterized protein 122.04 PADG_01100 C1FZ74 Uracil phosphoribosyltransferase 120.38 PADG_06992 C1GIA6 GrpE protein homolog 114.80 PADG_00599 C1G159 26S protease regulatory subunit...”

SPO2790 carboxyl transferase domain-containing protein from Ruegeria pomeroyi DSS-3
46% identity, 98% coverage

Diel investments in metabolite production and consumption in a model microbial system
Uchimiya, The ISME journal 2022
- “...Amino Acid Leucine SPO2793 ivD isovaleryl-CoA dehydrogenase 2.6 SPO2789 mccA methylcrotonyl-CoA carboxylase, alpha subunit 3.1 SPO2790 mccB methylcrotonyl-CoA carboxylase, beta subunit 3.4 SPO0390 glutamate/leucine/phenylalanine/valine dehydrogenase 1.2 (n.s.) Amino acid derivative Ectoine/ 5-hydroxyectoine SPO1146 uehB TRAP transporter, small integral membrane protein 48.4 [ 31 ] SPO1147 uehA...”
Experimental Identification of Small Non-Coding RNAs in the Model Marine Bacterium Ruegeria pomeroyi DSS-3
Rivers, Frontiers in microbiology 2016
- “...AraC family transcriptional regulator Transcriptional regulation 0.006 SPO3662 Hypothetical protein 0.008 SPO2067 Hypothetical protein 0.010 SPO2790 Methylcrotonyl-CoA carboxylase, beta subunit Lipid metabolism 0.010 SPO3333 Hypothetical protein 0.010 trans48 142 SPO1762 6,7-dimethyl-8-ribityllumazine synthase Coenzyme metabolism 0.004 SPO1508 Quinoprotein ethanol dehydrogenase 0.005 SPO3019 Xanthine dehydrogenase family, large subunit...”

M892_24080 carboxyl transferase domain-containing protein from Vibrio campbellii ATCC BAA-1116
43% identity, 100% coverage

Vibrio campbellii hmgA-mediated pyomelanization impairs quorum sensing, virulence, and cellular fitness
Wang, Frontiers in microbiology 2013
- “...IvdA 1.98E-05 1.94 0.79 2.46 I M892_24075 Isovaleryl-CoA dehydrogenase LiuA 3.91E-06 2.13 0.87 2.45 I M892_24080 Methylcrotonyl-CoA carboxylase carboxyl transferase LiuB 5.84E-05 1.46 0.66 2.21 I M892_24525 Polyhydroxyalkanoic acid synthase PhaC 1.27E-05 1.05 0.10 10.50 I M892_24530 PHA granule-associated protein PhaD 5.48E-05 3.07 0.57 5.39 I...”

mccB non-biotin containing subunit of 3-methylcrotonyl-CoA carboxylase; EC 6.4.1.4 from Emericella nidulans (see paper)
mccB / AAR23111.1 non-biotin containing subunit of 3-methylcrotonyl CoA carboxylase from Aspergillus nidulans (see paper)
42% identity, 92% coverage

CharProtDB Description: beta subunit of 3-methylcrotonyl-CoA carboxylase, involved in leucine degradation; Source:Eurofung

AO090020000492 No description from Aspergillus oryzae RIB40
44% identity, 89% coverage

Genomic and transcriptomic comparison of Aspergillus oryzae strains: a case study in soy sauce koji fermentation
Zhong, Journal of industrial microbiology & biotechnology 2018
- “...alpha-keto acid dehydrogenase 1.58 2.40 1.03 43 ivdA 1.3.8.4 Isovaleryl-CoA dehydrogenase 1.58 1.66 0.35 44 AO090020000492 6.4.1.4 3-Methylcrotonyl-coA carboxylase 1.35 1.35 0.12 45 AO090009000195 2.8.3.5 3-Oxoacid CoA-transferase 1.37 1.12 1.28 46 AO090103000406 2.3.1.9 Acetyl-CoA acetyltransferase 1.43 0.87 1.00 47 AO090023000518 1.1.1.31 3-Hydroxyisobutyrate dehydrogenase 0.72 0.36 1.08...”
Sequence- and Structure-Based Functional Annotation and Assessment of Metabolic Transporters in Aspergillus oryzae: A Representative Case Study
Raethong, BioMed research international 2016
- “...the ambiguous function group (7 of 65 transporter genes), namely, genes AO090005001300, AO090120000224, AO090011000320, AO090020000415, AO090020000492, AO090010000212, and AO090012000733. 3.4. Structure and Function Relationship Assessment of Unambiguous Metabolic Transporter To ensure the functional role of the unambiguous metabolic transporter, a combination of homology modeling and MD...”

Caur_2034 / A9WEI4 propionyl-CoA carboxylase α subunit (EC 6.4.1.3) from Chloroflexus aurantiacus (strain ATCC 29366 / DSM 635 / J-10-fl) (see paper)
Caur_2034 Propionyl-CoA carboxylase from Chloroflexus aurantiacus J-10-fl
42% identity, 100% coverage

Complete genome sequence of the filamentous anoxygenic phototrophic bacterium Chloroflexus aurantiacus
Tang, BMC genomics 2011
- “...accC (Caur_1378, Caur_3421), accA (Caur_1647), accD (Caur_1648), accB (Caur_3739), mcr (Caur_2614), pcs (Caur_ 0613), pccB (Caur_2034, Caur_3435), mcee (Caur_3037), mut (Caur_1844, Caur_2508, Caur_2509), smtA (Caur_0179), smtB (Caur_0178), sdhBAC (Caur_1880 to Caur_1882), fh (Caur_1443), mcl (Caur_0174), mch (Caur_0173), mct (Caur_0174), meh (Caur_0180) Glycolate assimilation and glyoxylate cycle...”
- “...propionyl-CoA synthase ( pcs , Caur_0613) [ 81 ], (4) propionyl-CoA carboxylase ( pccB , Caur_2034, Caur_3435), (5) methylmalonyl-CoA epimerase ( mcee , Caur_3037), (6) L -methylmalonyl-CoA mutase (MCM) ( mut , Caur_1844, Caur_2508, Caur_2509), (7) succinyl-CoA:( S )-malyl-CoA transferase ( smtA (Caur_0179), smtB (Caur_0178)), (8)...”
Transcriptional response of the photoheterotrophic marine bacterium Dinoroseobacter shibae to changing light regimes
Tomasch, The ISME journal 2011
- “...Descriptionb Caur_1648 Caur_1647 Caur_2614 Caur_0613 Caur_2034 Caur_3037 Caur_0179 Caur_0178 Caur_0174 Caur_0173 Caur_0175 Caur_0180 Dshi_0131 Dshi_3146...”

RSP_2508 Methylcrotonyl-CoA carboxylase beta chain from Rhodobacter sphaeroides 2.4.1
47% identity, 88% coverage

An integrated approach to reconstructing genome-scale transcriptional regulatory networks
Imam, PLoS computational biology 2015
- “...RSP_0577 (hypothetical protein), RSP_1420 (TRAP-T family transporter), RSP_1613 (TRAP-T family transporter), RSP_2401 (putative 6-aminohexanoate-cyclic-dimer hydrolase), RSP_2508 (Methylcrotonyl-CoA carboxylase beta chain), RSP_1883 (ABC polyamine/opine transporter), RSP_2506 (Isovaleryl-CoA dehydrogenase), RSP_3168 (ABC transporter), RSP_3169 (FAA-hydrolase-family protein). (B) Direct binding of RSP_0489 to the uxaC , RSP_0490, uxuA , RSP_3372...”

ATEG_06573 methylcrotonoyl-CoA carboxylase beta chain, mitochondrial precursor from Aspergillus terreus NIH2624
43% identity, 89% coverage

Twists and Turns in the Salicylate Catabolism of Aspergillus terreus, Revealing New Roles of the 3-Hydroxyanthranilate Pathway
Martins, mSystems 2021
- “...branched-chain -keto acid dehydrogenase complex (ATEG_03862, ATEG_06635, and ATEG_09087), isovaleryl-CoA dehydrogenase (ATEG_06574), and 3-methylcrotonyl-CoA carboxylase (ATEG_06573 and ATEG_06576). However, the remaining genes of the leucine catabolism were downregulated or only moderately expressed ( TableS5 ). Taken together, it remains unclear if those genes that underwent upregulation...”

Q9LDD8 methylcrotonoyl-CoA carboxylase (EC 6.4.1.4) from Arabidopsis thaliana (see 2 papers)
NP_567950 3-methylcrotonyl-CoA carboxylase from Arabidopsis thaliana
AT4G34030 MCCB (3-METHYLCROTONYL-COA CARBOXYLASE); biotin carboxylase/ methylcrotonoyl-CoA carboxylase from Arabidopsis thaliana
43% identity, 90% coverage

Genetic dissection of methylcrotonyl CoA carboxylase indicates a complex role for mitochondrial leucine catabolism during seed development and germination.
Ding, The Plant journal : for cell and molecular biology 2012 (PubMed)
- GeneRIF: Studies indicate that mutations in either 3-methylcrotonyl CoA carboxylase MCCA (At1g03090) or MCCB (At4g34030) block mitochondrial Leu catabolism, as inferred from the increased accumulation of Leu.
Analysis of Alternative Splicing During the Combinatorial Response to Simultaneous Copper and Iron Deficiency in Arabidopsis Reveals Differential Events in Genes Involved in Amino Acid Metabolism
Mancini, Frontiers in plant science 2022
- “...L -Asparaginase/ L -asparagine amidohydrolase (ASPGA1) Branched-chain group.shared AT3G08860 Alanine-glyoxylate aminotransferase, putative (PYD4) Branched-chain group.leucine AT4G34030 3-METHYLCROTONYL-COA CARBOXYLASE (MCCB) Branched chain group.isoleucine AT5G48880 PEROXISOMAL 3-KETO-ACYL-COA THIOLASE 2 (KAT5) Aromatic aa.tryptophan AT5G65940 BETA-HYDROXYISOBUTYRYL-COA HYDROLASE 1 (CHY1) Specific differentially expressed genes (DEGs) and differentially spliced genes (DSGs) detected...”
Network Topological Analysis for the Identification of Novel Hubs in Plant Nutrition
Di, Frontiers in plant science 2021
- “...Homology Score F Ratio Prob > F +Fe +Mo Fe Mo (A) A0A0A0K4Q8 Csa_7G073600 MCCB (AT4G34030) 77% 918 11,1 1,1E-04 55 5 2 9 Methylcrotonyl-CoA carboxylase, subunit beta A0A0A0LM23 Csa_2G382440 FLOT1 (AT5G25250) 75% 723 4,6 1,2E-02 51 Flotilins-like A0A0A0LXD4 Csa_1G424875 AT4G30010 69% 142 42 1 2...”
HSFA2 Functions in the Physiological Adaptation of Undifferentiated Plant Cells to Spaceflight
Zupanska, International journal of molecular sciences 2019
- “...cells on the ground. In accordance, DIN3 DARK INDUCIBLE 3 (AT3G06850) and MCCB 3-methylcrotonyl-CoA carboxylase (AT4G34030), both mitochondrial proteins involved in valine, leucine, and isoleucine degradation during sugar starvation [ 87 , 88 ] were also down-regulated. Glucose level may influence protein folding, as high glucose...”
- “...-ketoacid dehydrogenase complex (BCKDC), and two other genes important to small amino acid degradation, MCCB (At4g34030) coding for subunit of methylcrotonyl-CoA carboxylase participating in BCKDC reactions, and ALDH6B2 (At2g14170) methylmalonate semi-aldehyde dehydrogenase (see Table A3 ). A large increase in BCAA accumulation can be observed due...”
Identification of SNP loci and candidate genes related to four important fatty acid composition in Brassica napus using genome wide association study
Zhu, PloS one 2019
- “...10385625 10391818 10433764 41.946 AT4G33790 1014677010233049 CER4 Eceriferum 4 BnaA08g11650D A08 10512857 10515956 10433764 79.093 AT4G34030 1033791110495999 MCCB 3-methylcrotonyl-CoA carboxylase BnaA08g11810D A08 10599612 10600625 10507743 91.869 AT4G233355 1033791110495999 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein BnaA08g11640D A08 10507282 10508723 10582811 75.529 AT4G34050 1050774310625538 CCOAOMT1 Caffeoyl-CoA...”
Nitric Oxide Regulates Seedling Growth and Mitochondrial Responses in Aged Oat Seeds
Mao, International journal of molecular sciences 2018
- “...AT5G06580 d -lactate dehydrogenase [cytochrome] mitochondrial Zea mays 0.69 1.58 ns Amino acid metabolism B6SWZ4 AT4G34030 Methylcrotonoyl-CoA carboxylase beta chain mitochondrial Zea mays ns ns 1.21 Co-factor and vitamine metabolism, lipoic acid U5H066 AT5G08415 Lipoyl synthase, mitochondrial Microbotryum lychnidis-dioicae ns 0.73 0.72 Redox, Glutaredoxins Q0JQ97 AT3G15660...”
Association Mapping Analysis of Fatty Acid Content in Different Ecotypic Rapeseed Using mrMLM
Guan, Frontiers in plant science 2018
- “...4 (CER4) K13356: Cutin, suberine and wax biosynthesis Rowland et al., 2006 A08 BnaA08g11650D b AT4G34030 3-methylcrotonyl-CoA carboxylase (MCCB) K01969: 3-methylcrotonyl-CoA carboxylase beta subunit Ding et al., 2012 A08 BnaA08g11810D b AT4G33355 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein A09 BnaA09g02110D a AT3G27660 oleosin 4...”
Transcriptome-Wide Discovery of PASRs (Promoter-Associated Small RNAs) and TASRs (Terminus-Associated Small RNAs) in Arabidopsis thaliana
Ma, PloS one 2017
- “...specifically accumulated in roots ( AT1G18420 , AT1G50110 , AT4G25580 , AT4G25590 , AT4G30993 , AT4G34030 , AT5G06130 , AT5G52360 , AT5G60280 and ATMG00070 ) or seedlings ( ATCG00270 , ATCG00420 , ATCG00840 , ATCG01300 and ATMG00900 ). Some of the TASRs preferentially associated with AGO4...”
A Conserved Carbon Starvation Response Underlies Bud Dormancy in Woody and Herbaceous Species
Tarancón, Frontiers in plant science 2017
- “...AMINOTRANSFERASE TAT2 II At5g54080 HOMOGENTISATE 1,2-DlOXYGENASE II-III-IV At3g45300 ISOVALERYL-COA DEHYDROGENASE II-III-IV At1g64660 METHIONINE GAMMA-LYASE II-III At4g34030 METHYLCROTONOYL-COA CARBOXYLASE IV At1g03090 METHYLCROTONOYL-COA CARBOXYLASE III-IV At1g08630 THREONINE ALDOLASE 1 III Protein degradation At5g57360 ADAGIO 1 II At1g80440 KMD1 I-III-IV At2g18915 ADAGIO 2 II At1g15670 KMD2 III At1g05840 ASPARTYL...”
More

Mlut_06850 carboxyl transferase domain-containing protein from Micrococcus luteus NCTC 2665
44% identity, 95% coverage

Impact of Branched-Chain Amino Acid Catabolism on Fatty Acid and Alkene Biosynthesis in Micrococcus luteus
Surger, Frontiers in microbiology 2018
- “...among the surrounding branched amino acid degradation genes, the levels of expression of Mlut_06800 and Mlut_06850 in the deletion mutant trpE16 06840 (markerless) and in the parental strain trpE16 were analyzed by qPCR. Relative quantification by the 2 - C T method revealed that the product...”
- “...of deletion of the transcriptional regulator Mlut_06840 on the expression levels of Mlut_06800 (A) and Mlut_06850 (B) . Gene expression was measured by qPCR and is expressed relative to the parental strain, using the 2 - C T method. The mean of three technical replicates from...”

8rthF / Q385A6 Trypanosoma brucei 3-methylcrotonyl-coa carboxylase (see paper)
43% identity, 92% coverage

Ligand: 5-(hexahydro-2-oxo-1h-thieno[3,4-d]imidazol-6-yl)pentanal (8rthF)

8jxmC / Q9HCC0 Human 3-methylcrotonyl-coa carboxylase in bccp-h2 state with mcoa (see paper)
42% identity, 99% coverage

Ligands: ~{s}-[2-[3-[[(2~{r})-4-[[[(2~{s},3~{s},4~{s},5~{s})-5-(6-aminopurin-9-yl)-4-oxidanyl-3-phosphonooxy-oxolan-2-yl]methoxy-oxidanyl-phosphoryl]oxy-oxidanyl-phosphoryl]oxy-3,3-dimethyl-2-oxidanyl-butanoyl]amino]propanoylamino]ethyl] 3-methylbut-2-enethioate; 5-(hexahydro-2-oxo-1h-thieno[3,4-d]imidazol-6-yl)pentanal (8jxmC)

A4HUX0 methylcrotonoyl-CoA carboxylase from Leishmania infantum
44% identity, 86% coverage

A Computational Approach Using Bioinformatics to Screening Drug Targets for Leishmania infantum Species
Chávez-Fumagalli, Evidence-based complementary and alternative medicine : eCAM 2018
- “...A4I398 Putative propionyl-CoA carboxylase beta chain 0,867 2 E 34 54 7 E 33 54 A4HUX0 Putative 3-methylcrotonyl-CoA carboxylase beta subunit 0,867 0 E + 00 59 0 E + 00 61 E9AG50 Kinase-like protein 0,848 4 E 64 39 5 E 65 38 A4HZ66 Metallo-beta-lactamase...”

8f3dA / A0A640KGP9 3-methylcrotonyl-coa carboxylase in filament, beta-subunit centered (see paper)
45% identity, 81% coverage

Ligand: 5-(hexahydro-2-oxo-1h-thieno[3,4-d]imidazol-6-yl)pentanal (8f3dA)

SCLAV_3405 acyl-CoA carboxylase subunit beta from Streptomyces clavuligerus
43% identity, 96% coverage

Transcriptomic analysis of Streptomyces clavuligerus ΔccaR::tsr: effects of the cephamycin C-clavulanic acid cluster regulator CcaR on global regulation
Alvarez-Álvarez, Microbial biotechnology 2014
- “...2.18 <1E 06 SCLAV_3406 Putative acetyl/propionyl CoA carboxylase alpha 1.49 2.87E 03 2.15 <1E 06 SCLAV_3405 Putative acetyl/propionyl CoA carboxylase beta 1.64 <1E 06 2.41 <1E 06 Transcriptional and regulatory proteins SCLAV_p0826 Putative AraC-family transcriptional regulator 0.88 2.87E 05 0.05 8.17E 01 SCLAV_p0894 brp Gamma-butyrolactone receptor...”
- “...This was the case for the genes encoding putative acetyl-CoA synthetases and acetyl-CoA carboxylases (SCLAV_4986, SCLAV_3405, SCLAV_3406) and the same occurred with the acetyltransferase-and methyltransferase-encoding genes (SCLAV_4530 and SCLAV_p1123). A set of genes whose function is unknown (SclaA2_010100027930, SclaA2_010100028330 and SclaA2_010100028335) all located in plasmid pSCL2,...”

AURANDRAFT_71183 hypothetical protein from Aureococcus anophagefferens
42% identity, 20% coverage

Influence of light on the infection of Aureococcus anophagefferens CCMP 1984 by a "giant virus"
Gann, PloS one 2020
- “...-2.92 AURANDRAFT_70174 K07562 NMD3; nonsense-mediated mRNA decay protein 3 - - - 1.76 3.2 2.25 AURANDRAFT_71183 K14521 NAT10; N-acetyltransferase 10 [EC:2.3.1.-] - - - - - 1.58 AURANDRAFT_71380 K14561 IMP4; U3 small nucleolar ribonucleoprotein protein IMP4 - - - - 2.24 3.05 AURANDRAFT_72347 K14537 NUG2; nuclear...”

DR_1542 propionyl-CoA carboxylase, beta subunit, putative from Deinococcus radiodurans R1
38% identity, 86% coverage

Proteomic Response of Deinococcus radiodurans to Short-Term Real Microgravity during Parabolic Flight Reveals Altered Abundance of Proteins Involved in Stress Response and Cell Envelope Functions
Moors, Life (Basel, Switzerland) 2021
- “...DR_0291 0.36 Uncharacterized protein DR_A0190 0.37 Site-determining protein DR_0752 0.34 Propionyl-CoA carboxylase, beta subunit, putative DR_1542 0.36 DUF11 domain-containing protein DR_0685 0.33 Uncharacterized protein DR_0574 0.33 Uncharacterized protein DR_2057 0.30 Uncharacterized protein DR_A0022 0.32 Chromosome partitioning ATPase, putative, ParA family DR_A0001 0.27 life-12-00023-t002_Table 2 Table 2...”

pccB / Q3J4E3 propionyl-CoA carboxylase β subunit (EC 6.4.1.3) from Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.) (see paper)
PCCB_CERS4 / Q3J4E3 Propionyl-CoA carboxylase beta chain; PCCase; Propanoyl-CoA:carbon dioxide ligase; EC 6.4.1.3 from Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.) (Rhodobacter sphaeroides) (see paper)
RSP_2189 propionyl-CoA carboxylase beta chain from Rhodobacter sphaeroides 2.4.1
33% identity, 85% coverage

catalytic activity: propanoyl-CoA + hydrogencarbonate + ATP = (S)-methylmalonyl- CoA + ADP + phosphate + H(+) (RHEA:23720)
subunit: Probably a dodecamer composed of six biotin-containing alpha subunits and six beta subunits.
Transcriptional Regulation by the Short-Chain Fatty Acyl Coenzyme A Regulator (ScfR) PccR Controls Propionyl Coenzyme A Assimilation by Rhodobacter sphaeroides
Carter, Journal of bacteriology 2015
- “...pccB transcript. The pccB gene of R. sphaeroides, rsp_2189, encodes the subunit of propionyl-CoA carboxylase (PCC), an enzyme of the methylmalonyl-CoA pathway...”
Acrylyl-coenzyme A reductase, an enzyme involved in the assimilation of 3-hydroxypropionate by Rhodobacter sphaeroides
Asao, Journal of bacteriology 2013
- “...subunits encoded by RSP_2191 and RSP_2189, respectively), ethylmalonyl-CoA/methylmalonyl-CoA epimerase (encoded by RSP_0812), and (2R)-methylmalonyl-CoA mutase...”

BSU18210 putative propionyl-CoA carboxylase from Bacillus subtilis subsp. subtilis str. 168
36% identity, 77% coverage

The program of gene transcription for a single differentiating cell type during sporulation in Bacillus subtilis
Eichenberger, PLoS biology 2004
- “...yknU (BSU14320), yknV (BSU14330), ykuD (BSU14040), ykvI (BSU13710), ykvU (BSU13830), ylbJ (BSU15030), ylbO/gerR (BSU15090), yngE (BSU18210), yngF (BSU18220), yngG (BSU18230), yngH (BSU18240), yngI (BSU18250), yngJ (BSU18260), yoaB (BSU18540), yoaD (BSU18560), yodU (BSU19810), ypqA (BSU22240), ypqP (BSU21670), yqfT (BSU25120), yqhV (BSU24440), yrdK (BSU26680), yydB (BSU40220), yydC (BSU40210),...”

1vrgA / Q9WZH5 Crystal structure of propionyl-coa carboxylase, beta subunit (tm0716) from thermotoga maritima at 2.30 a resolution
TM0716 propionyl-CoA carboxylase, beta subunit from Thermotoga maritima MSB8
32% identity, 91% coverage

Ligand: bicarbonate ion (1vrgA)
De Novo Structural Pattern Mining in Cellular Electron Cryotomograms
Xu, Structure (London, England : 1993) 2019
- “...activator PA26 from Trypanosome Brucei Whitby et al, 2000 PDB: 1FNT Propionyl-CoA carboxylase, beta subunit (TM0716) from Thermotoga Maritima Joint Center for Structural Genomics (unpublished) PDB: 1VRG Glutamine Synthetase Yamashita et al, 1989 PDB: 2GLS Human carboxypeptidase A4 in complex with human latexin Pallares et al,...”
QSCOP-BLAST--fast retrieval of quantified structural information for protein sequences of unknown structure
Suhrer, Nucleic acids research 2007
- “...propionyl-CoA carboxylase of Thermotoga maritima at 2.30 resolution. Incidentally 1vrg is the structural genomics target TM0716 of the Joint Center of Structural Genomics (JCSG) with the PDB release date 22 February 2005. The chain is not classified in SCOP. The top hit, c1vrgA2, corresponding to the...”

TRQ7_RS01075 acyl-CoA carboxylase subunit beta from Thermotoga sp. RQ7
33% identity, 91% coverage

Adapted laboratory evolution of Thermotoga sp. strain RQ7 under carbon starvation
Gautam, BMC research notes 2022
- “...TTA Frame shift, run-through 1426409 TRQ7_RS07315 2-hydroxyacid dehydrogenase i1: AGAGG Frame shift, truncation SNPs 205012 TRQ7_RS01075 Methylmalonyl-CoA carboxyltransferase Transversion: GT Silent: V360 262000 TRQ7_RS01400 Hypothetical protein Transition: GA Silent: L346 323128 TRQ7_RS01715 Queuosine precursor transporter Transition: GA Silent: T204 459761 TRQ7_RS02405 Tyrosine-tRNA ligase Transition: CT Silent:...”

FTV88_3237 acyl-CoA carboxylase subunit beta from Heliorestis convoluta
32% identity, 96% coverage

Analysis of the Complete Genome of the Alkaliphilic and Phototrophic Firmicute Heliorestis convoluta Strain HH^T
Dewey, Microorganisms 2020
- “...was not identified in the Hrs. convoluta genome, a gene predicted to encode methylmalonyl-CoA carboxyltransferase (FTV88_3237), which could circumvent this deficiency, was identified. Unlike other Heliorestis species, Hrs. convoluta and a few other heliobacteria can use butyrate as a carbon source [ 19 , 20 ,...”

pccB / Q877I3 acyl CoA carboxylase carboxyltransferase subunit (EC 2.1.3.15; EC 6.4.1.3; EC 6.3.4.14) from Acidianus brierleyi (see 2 papers)
Q877I3 acetyl-CoA carboxylase (subunit 1/3) (EC 6.4.1.2); propionyl-CoA carboxylase (subunit 2/3) (EC 6.4.1.3) from Acidianus brierleyi (see paper)
pccB / BAC55869.1 carboxyltransferase subunit of acetyl-CoA carboxylase from Acidianus brierleyi (see paper)
31% identity, 92% coverage

A0RY61 Acetyl-CoA carboxylase, carboxyltransferase component (Subunit alpha and beta) from Cenarchaeum symbiosum (strain A)
32% identity, 86% coverage

Genome-scale metabolic analysis of Clostridium thermocellum for bioethanol production.
Roberts, BMC systems biology 2010
- “...succinate--CoA ligase Cthe_1907 amino acid adenylation domain A3P3B3 3.00E-40 6.4.1.2 acetyl-CoA carboxylase Cthe_0699 carboxyl transferase A0RY61 8.00E-169 6.3.4.14 biotin carboxylase Cthe_0949 carbamoyl-phosphate synthase, large subunit B2J980 0 4.1.3.38 aminodeoxychorismate lyase Cthe_0026 queuosine biosynthesis protein Q03L66 3.00E-54 3.1.3.1 alkaline phosphatase Cthe_2965 binding-protein-dependent transport systems inner membrane component...”

BA2552 carboxyl transferase domain protein from Bacillus anthracis str. Ames
BAS2375 carboxyl transferase domain protein from Bacillus anthracis str. Sterne
34% identity, 87% coverage

Identification of Novel Thermosensors in Gram-Positive Pathogens
Fernández, Frontiers in molecular biosciences 2020
- “...CTGCAG TAATTAAAGATGTCATGC SAOUHSC_ 01314 SA1314ATG UP AT GGATCC ACATCTTTAATTATTGCAG SA59 DW T CTGCAG TTTGTATTTAGATCCAGCC BA_RS26385 Ba2552 A ATCGAT AGGGAGGCGTATAAATGATAGA GAAGAAG BAC3 AG GTCGAC TTCGAATCATGCCCTCACC BA_RS26385C BAC5 CG GGATCC GTATGCGCAACTTTAATCAG BAC3 AG GTCGAC TTCGAATCATGCCCTCACC BA_RS26380 5597Up TCG GGATCC GAAAACCTGTATTTTCAGGA TGATTCGAATTATTATTGC 5597BxDw AGGGGATCCTCTAGATCATATCCATCCCT TTTCTTC Restriction sites are underlined....”
Role of luxS in Bacillus anthracis growth and virulence factor expression
Jones, Virulence 2010
- “...biotin carboxylase, putative -1.66 -7.06 -17.27 -9.99 BA2552 carboxyl transferase domain protein -1.24 -16.45 -11.39 -10.27 BA3479 transcriptional regulator,...”
Identification of a protein subset of the anthrax spore immunome in humans immunized with the anthrax vaccine adsorbed preparation
Kudva, Infection and immunity 2005
- “...925d BAS4590 BAS3944 BAS2375 BAS0485 BAS0484 BA4946 BA4253 BA2552 BA0514 BA0513 941a 941b 1038 345 1272 BAS2700 BAS2061 BAS4188 BAS3788 BAS5123f BA2899 BA2217...”
Identification of a protein subset of the anthrax spore immunome in humans immunized with the anthrax vaccine adsorbed preparation
Kudva, Infection and immunity 2005
- “...BA2225 BA2226 746 239 473 925d BAS4590 BAS3944 BAS2375 BAS0485 BAS0484 BA4946 BA4253 BA2552 BA0514 BA0513 941a 941b 1038 345 1272 BAS2700 BAS2061 BAS4188...”

Q1D5Y2 Carboxyl transferase domain protein from Myxococcus xanthus (strain DK1622)
36% identity, 77% coverage

Proteome Analyses of Soil Bacteria Grown in the Presence of Potato Suberin, a Recalcitrant Biopolymer
Sidibé, Microbes and environments 2016
- “...acetyl-CoA acetyltransferase 0.33 0.10 I Q1D9B8 long-chain-fatty-acid-CoA ligase 0.20 I Q1D233 3-hydroxyacyl-CoA dehydrogenase 0.17 E Q1D5Y2 carboxyl transferase domain protein 0.19 I Q1D009 YceI-like family protein 0.27 0.14 E Q1D3D6 acyl-CoA dehydrogenase 0.13 0.12 I BKT -ketothiolase 0.17 I Q1D5U4 acyl-CoA dehydrogenase 0.10 I Q1D984 acetyl-coenzyme...”

Saci_0262 propionyl-CoA carboxylase beta chain from Sulfolobus acidocaldarius DSM 639
31% identity, 91% coverage

Versatile Genetic Tool Box for the Crenarchaeote Sulfolobus acidocaldarius
Wagner, Frontiers in microbiology 2012
- “...confirmed by mass spectrometry. Two other proteins were co-purified that were identified as Saci_0260 and Saci_0262, subunits of the pyruvate carboxylase. These two proteins seem to be biotinylated proteins that bind to the chromatography material. The same proteins have been observed during Strep affinity purifications from...”

PTH_1364 methylmalonyl-CoA decarboxylase, alpha subunit from Pelotomaculum thermopropionicum SI
31% identity, 92% coverage

Genome analysis of Desulfotomaculum kuznetsovii strain 17(T) reveals a physiological similarity with Pelotomaculum thermopropionicum strain SI(T)
Visser, Standards in genomic sciences 2013
- “...82 PTH_1362 mmcG Desku_1364 Methylmalonyl-CoA epimerase 86 PTH_1363 mmcH Desku_1365 Methylmalonyl-CoA decarboxylase, alpha subunit 75 PTH_1364 mmcI Desku_1366 Methylmalonyl-CoA decarboxylase, epsilon subunit 82 PTH_1365 mmcJ Desku_1367 Methylmalonyl-CoA decarboxylase, gamma subunit 56 PTH_1366 mmcK Desku_1368 Malate dehydrogenase 75 PTH_1367 mmcL Desku_1369 Transcarboxylase 5S subunit 66 PTH_1368 pykF...”

Dshi_0718 Propionyl-CoA carboxylase carboxyl transferase subunit (EC 6.4.1.3) from Dinoroseobacter shibae DFL-12
32% identity, 79% coverage

mutant phenotype: Specifically important for utilizing Sodium propionate. Automated validation from mutant phenotype: the predicted function (PROPIONYL-COA-CARBOXY-RXN) was linked to the condition via a MetaCyc pathway. This annotation was also checked manually.

Msed_1375 / A4YGI1 acyl CoA carboxylase carboxyltransferase subunit from Metallosphaera sedula (strain ATCC 51363 / DSM 5348 / JCM 9185 / NBRC 15509 / TH2) (see paper)
Q8J2Z5 acetyl-CoA carboxylase (EC 6.4.1.2) from Metallosphaera sedula (see paper)
Msed_1375 carboxyl transferase from Metallosphaera sedula DSM 5348
A4YGI1 Acetyl-CoA carboxylase carboxyltransferase subunit alpha / acetyl-CoA carboxylase carboxyltransferase subunit beta / propionyl-CoA carboxylase carboxyltransferase subunit from Metallosphaera sedula (strain ATCC 51363 / DSM 5348 / JCM 9185 / NBRC 15509 / TH2)
31% identity, 93% coverage

Ancillary contributions of heterologous biotin protein ligase and carbonic anhydrase for CO₂ incorporation into 3-hydroxypropionate by metabolically engineered Pyrococcus furiosus
Lian, Biotechnology and bioengineering 2016
- “...M. sedula genes encoding the -, -, and -subunits of the carboxylase (Msed_0147, Msed_1048, and Msed_1375) were cloned by a ligation-independent method using pET46 Ek/LIC, pRSF-2 Ek/LIC, and pCDF-2 Ek/LIC (EMD4 Biosciences), respectively, which are compatible vectors enabling co-expression of these genes in various combinations: (N-terminal...”
Novel Transcriptional Regulons for Autotrophic Cycle Genes in Crenarchaeota
Leyn, Journal of bacteriology 2015
- “...hyp1-2 hyp3 hyp4 hyp5 Msed_0147- Msed_0148 Msed_1375 SSO2178 Msed_1993 Msed_1456 Msed_1426 Msed_0639 Msed_0638 Msed_2055 Msed_1424 Msed_1422 Msed_1321 Msed_0656...”
Bioprocessing analysis of Pyrococcus furiosus strains engineered for CO₂-based 3-hydroxypropionate production
Hawkins, Biotechnology and bioengineering 2015
- “...P. furiosus MW56, the COM1 strain engineered to contain genes encoding acetyl-CoA carboxylase (Msed_0147, Msed_0148, Msed_1375), malonyl-CoA reductase (Msed_0709), and malonate semialdehyde reductase (Msed_1993), was compared to the parent strain COM1; both strains were grown in 1L bottles at 95C on complex media containing yeast extract...”
- “...Enzyme Abbrev Enzyme ORF Reference ACC/PCC Acetyl-CoA/Propionyl-CoA carboxylase Msed_0147 NCE (Hgler et al., 2003) Msed_0148 Msed_1375 MCR/SCR Malonyl-CoA/Succinyl-CoA reductase (NADPH) Msed_0709 R (Kockelkorn and Fuchs, 2009) MSR Malonate semialdehyde reductase (NADPH) Msed_1993 R (Kockelkorn and Fuchs, 2009) CA Carbonic anhydrase Msed_0390 R ( Lian, 2014 )...”
Propionyl coenzyme A (propionyl-CoA) carboxylase in Haloferax mediterranei: Indispensability for propionyl-CoA assimilation and impacts on global metabolism
Hou, Applied and environmental microbiology 2015
- “...M. sedula are encoded by Msed_0147, Msed_0148, and Msed_1375, respectively (9). Based on their amino acid sequences, in silico analysis of the H. mediterranei...”
Conversion of 4-hydroxybutyrate to acetyl coenzyme A and its anapleurosis in the Metallosphaera sedula 3-hydroxypropionate/4-hydroxybutyrate carbon fixation pathway
Hawkins, Applied and environmental microbiology 2014
- “...(NADH) Acetoacetyl-CoA -ketothiolase Msed_0147, Msed_0148, Msed_1375 Msed_0709 Msed_1993 Msed_1456 Msed_2001 Msed_1426 Msed_0639 Msed_0638, Msed_2055 Msed_1424...”
- “...acetyl-CoA/propionyl-CoA carboxylase (ACC) (Msed_0147, Msed_0148, Msed_1375; 7- to 30-fold), 4-hydroxybutyryl-CoA dehydratase (Msed_1321; 27-fold), and carbonic...”
Exploiting microbial hyperthermophilicity to produce an industrial chemical, using hydrogen and carbon dioxide
Keller, Proceedings of the National Academy of Sciences of the United States of America 2013
- “...carboxylase, encoded by Msed_0147, Msed_0148, and Msed_1375), E2 (malonyl/succinylCoA reductase, Msed_0709), and E3 (malonate semialdehyde reductase, Msed_1993)...”
- “...carboxylase (, encoded by Msed_0147, Msed_0148, Msed_1375), E2 is malonyl/succinyl-CoA reductase (Msed_0709), and E3 is malonate semialdehyde reductase...”
Role of 4-hydroxybutyrate-CoA synthetase in the CO2 fixation cycle in thermoacidophilic archaea
Hawkins, The Journal of biological chemistry 2013
- “...2017 E11 E12 E13 ORF Msed_0147 Msed_0148 Msed_1375 Msed_0709 Msed_1993 Msed_1456 Msed_2001 Msed_1426 Msed_0639 Msed_0638 Msed_2055 Msed_1424 Msed_0394 Msed_0406...”
Epimerase (Msed_0639) and mutase (Msed_0638 and Msed_2055) convert (S)-methylmalonyl-coenzyme A (CoA) to succinyl-CoA in the Metallosphaera sedula 3-hydroxypropionate/4-hydroxybutyrate cycle
Han, Applied and environmental microbiology 2012
- “...MCE MCM MCM Msed_0147() Msed_0148() Msed_1375() Msed_0709 Msed_1993 Msed_1456 Msed_2001 Msed_1426 Msed_0639 Msed_0638 Msed_2055 Acetyl-CoA/propionyl-CoA...”
- “...(B) Heat plot showing ACC (Msed_0147, Msed_0148, Msed_1375), MCE (Msed_0639), and MCM (Msed_0638, Msed_2055) under autotrophic (columns A) and heterotrophic...”
More
Genome analysis of the thermoacidophilic archaeon Acidianus copahuensis focusing on the metabolisms associated to biomining activities
Urbieta, BMC genomics 2017
- “...subunit accB A4YD23 167 EZQ11107 167 2.00E -84 64 - Acetyl-CoA/propionyl-CoA carboxylase, beta subunit accC A4YGI1 524 EZQ11108 523 0 81 + (53) Acetyl-CoA/propionyl-CoA carboxylase, gamma subunit mcr A4YEN2 357 EZQ11004 356 0 82 ? (274) Malonyl-CoA/succinyl-CoA reductase msr A4YI81 314 EZQ04857 317 2.00E -174 75...”

Smar_1426 carboxyl transferase from Staphylothermus marinus F1
31% identity, 91% coverage

The complete genome sequence of Staphylothermus marinus reveals differences in sulfur metabolism among heterotrophic Crenarchaeota
Anderson, BMC genomics 2009
- “...decarboxylase). There are two possibilities for the activity of this decarboxylase (Figure 2 ). With Smar_1426 and Smar_1427 these genes could form a methylmalonyl-CoA decarboxylase. Smar_1426 and Smar_1504 are closely related to predicted methylmalonyl-CoA decarboxylase subunits of Pyrococcus species. This enzyme would be involved in catabolism...”

PCCB_ROSDO / Q168G2 Propionyl-CoA carboxylase beta chain; EC 6.4.1.3 from Roseobacter denitrificans (strain ATCC 33942 / OCh 114) (Erythrobacter sp. (strain OCh 114)) (Roseobacter denitrificans) (see paper)
31% identity, 86% coverage

function: This is one of the 2 subunits of the biotin-dependent propionyl-CoA carboxylase (PCC), the enzyme catalyzing the carboxylation of propionyl-CoA/propanoyl-CoA to D-methylmalonyl- CoA/(S)-methylmalonyl-CoA (PubMed:20725044). Within the holoenzyme, the alpha subunit catalyzes the ATP-dependent carboxylation of the biotin carried by the biotin carboxyl carrier (BCC) domain, while the beta subunit then tranfers the carboxyl group from carboxylated biotin to propionyl-CoA (Probable).
catalytic activity: propanoyl-CoA + hydrogencarbonate + ATP = (S)-methylmalonyl- CoA + ADP + phosphate + H(+) (RHEA:23720)
subunit: The holoenzyme is a dodecamer composed of 6 PccA/alpha subunits and 6 PccB/beta subunits.
3-methylcrotonyl-CoA carboxylase deficiency: clinical, biochemical, enzymatic and molecular studies in 88 individuals
Grünert, Orphanet journal of rare diseases 2012
- “...shermanii methylmalonyl-CoA carboxyltransferase (psMMCC, Q8GBW6), Streptomyces coelicolor PCC (scPCCB, Q9X4K7) and Roseobacter denitrificans PCC (bPCCA, Q168G2). Novel MCCC2 missense mutations are asterisked. Click here for file Acknowledgements We thank the following doctors and physicians for providing clinical information: Dr. M. Du Moulin (Mnster, Germany), Prof. Dr....”

3n6rB / Q168G2 Crystal structure of the holoenzyme of propionyl-coa carboxylase (pcc) (see paper)
31% identity, 86% coverage

Ligand: 5-(hexahydro-2-oxo-1h-thieno[3,4-d]imidazol-6-yl)pentanal (3n6rB)

PGN_0500 methylmalonyl-CoA decarboxylase alpha subunit from Porphyromonas gingivalis ATCC 33277
PG1612 methylmalonyl-CoA decarboxylase, alpha subunit from Porphyromonas gingivalis W83
31% identity, 90% coverage

Post-translational Modifications in Oral Bacteria and Their Functional Impact
Ma, Frontiers in microbiology 2021
- “...2010 SpxB Thr409, 415, 508 Mediating pyruvate conversion S. sanguinis Mu et al., 2021 PGN_0375, PGN_0500, PGN_0724, PGN_0733, PGN_0880 Ser and/or Thr Not determined P. gingivalis Izumigawa et al., 2016 Tyrosine phosphorylation Php1 Tyr159, 166 Exopolysaccharide production, proteinases phosphorylation P. gingivalis Jung et al., 2019 RprY...”
- “...Ser and/or Thr were identified in P. gingivalis , referred to as PGN_0375 (phosphoribulose/uridine kinase), PGN_0500 (methylmalonyl-CoA decarboxylase), PGN_0724 (NAD-dependent hydroxybutyrate dehydrogenase), PGN_0733 (alpha-glucan phosphorylase), and PGN_0880 (tryptophanase), using the phosphate-affinity chromatography and anti-Ser and -Thr antibodies. However, the specific functions and regulatory mechanisms should be...”
Identification and characterization of a UbK family kinase in Porphyromonas gingivalis that phosphorylates the RprY response regulator
Perpich, Molecular oral microbiology 2021
- “...regulon. Interestingly, genes that were downregulated in the rpry mutant strain relative to WT (PGN_1419, PGN_0500, and PGN_0726) ( Shen et al., 2020 ) were increased in the UbK1 overexpression strain, whereas genes that were upregulated (PGN_0795 and PGN_1032) in the rpry mutant strain were unchanged...”
Separation of novel phosphoproteins of Porphyromonas gingivalis using phosphate-affinity chromatography
Izumigawa, Microbiology and immunology 2016 (PubMed)
- “...activities were identified, namely PGN_0004, PGN_0375, PGN_0500, PGN_0724, PGN_0733 and PGN_0880, having been separated by phosphateaffinity chromatography. The...”
- “...27 2 3 4 5 6 70 55 50 45 40 ND PGN_0500 PGN_0375 PGN_0880 PGN_0724 - - - - - 11 12 6 9 7 8 32 26 PGN_0004 ND ND Methylmalonyl-CoA decarboxylase...”
Microarray analysis of the transcriptional responses of Porphyromonas gingivalis to polyphosphate
Moon, BMC microbiology 2014
- “...PG0690 4-hydroxybutyrate CoA-transferase 1.66 PG0689 NAD-dependent 4-hydroxybutyrate dehydrogenase 1.58 PG1609 Methylmalonyl-CoA decarboxylase, gamma subunit 1.87 PG1612 Methylmalonyl-CoA decarboxylase, alpha subunit 1.71 PG1608 Methylmalonyl-CoA decarboxylase, beta subunit 1.64 PG0675 Indolepyruvate ferredoxin oxidoreductase, alpha subunit 1.53 PG1809 2-oxoglutarate oxidoreductase, gamma subunit 2.18 PG1956 4-hydroxybutyrate CoA-transferase 1.74 Energy metabolism...”
Response of Porphyromonas gingivalis to heme limitation in continuous culture
Dashper, Journal of bacteriology 2009
- “...PG1079h PG1081 15 PG1082 16 PG1232 17 PG1271 18 PG1417 19 PG1612 20 PG1614 21 PG1615 22 PG1741 23 PG1810 24 PG1949 a Scorec nd ICAT ne Fold change by...”

Pnuc_0912 carboxyl transferase from Polynucleobacter sp. QLW-P1DMWA-1
32% identity, 89% coverage

Combined Methylome, Transcriptome and Proteome Analyses Document Rapid Acclimatization of a Bacterium to Environmental Changes
Srivastava, Frontiers in microbiology 2020
- “...Pnuc_0772 Tryptophan synthase beta chain (EC 4.2.1.20) 0.99 0.012556 Pnuc_1138 Acetyl-coenzyme A synthetase 0.99 0.012013 Pnuc_0912 Carboxyl transferase 0.97 0.000049 Pnuc_1286 RNA-binding protein Hfq 0.97 0.000455 Pnuc_0842 Dihydrolipoyl dehydrogenase (EC 1.8.1.4) 0.97 0.000569 Pnuc_1400 4Fe4S ferredoxin 0.96 0.009343 Pnuc_1433 Phosphoenolpyruvate synthase (PEP synthase) 0.95 0.003936 Pnuc_1063...”

BF638R_3367 acyl-CoA carboxylase subunit beta from Bacteroides fragilis 638R
32% identity, 78% coverage

New functions of pirin proteins and a 2-ketoglutarate: Ferredoxin oxidoreductase ortholog in Bacteroides fragilis metabolism and their impact on antimicrobial susceptibility to metronidazole and amixicile
Gough, MicrobiologyOpen 2024
- “...MMCE, methylmalonylCoA epimerase (BF638R_3151); MmdA1 (PccB), propionylCoA carboxylase betachain (BF638R_1625); MmdA2 (PccB), propionylCoA carboxylase betachain (BF638R_3367); MutAB, methylmalonylCoA mutase, small (A) and large (B) subunits (BF638R_36163615); Nad2, NADH dehydrogenase, FADcontaining subunit (BF638R_1612); Nqr, Na+translocating NADHquinone oxidoreductase, NqrABCDE, (BF638R_2136_2140); Nuo, NADH,ubiquinone oxidoreductase, NuoABC/DHIJKLMN (BF638R_08500841); OadA1, pyruvate/oxaloacetate carboxyltransferase...”

Q1DDA0 Propionyl-CoA carboxylase, beta subunit from Myxococcus xanthus (strain DK1622)
31% identity, 87% coverage

Proteome Analyses of Soil Bacteria Grown in the Presence of Potato Suberin, a Recalcitrant Biopolymer
Sidibé, Microbes and environments 2016
- “...suberin did not provide sufficient energy for bacterial proliferation. The presence of several carboxylases (Q1CYB4, Q1DDA0, Q1D0B9, Q1DOT9, Q1D555, Q1DDA2, and Q1D8V2) in the Myxococcus proteome also supports this hypothesis. Carboxylation represents a cellular biosynthetic mechanism to replenish tricarboxylic acid cycle intermediates used in biosynthetic pathways...”
- “...BKT -ketothiolase 0.17 I Q1D5U4 acyl-CoA dehydrogenase 0.10 I Q1D984 acetyl-coenzyme A synthetase 0.06 I Q1DDA0 propionyl-CoA carboxylase 0.07 0.02 I Q1DFT0 3-oxoacyl-[acyl-carrier protein] reductase 0.21 I Q1D0B9 acetyl-CoA carboxylase 0.10 I Q1D340 malonyl CoA-acyl carrier protein transacylase 0.11 I Q1D5U1 3-hydroxyacyl-CoA dehydrogenase 0.18 I Q1D5U2...”

CP258_RS02980 acyl-CoA carboxylase subunit beta from Corynebacterium pseudotuberculosis 258
31% identity, 93% coverage

Co-Expression Networks for Causal Gene Identification Based on RNA-Seq Data of Corynebacterium pseudotuberculosis
Franco, Genes 2020
- “...Cp-13 Product Genes Cp-258 Product Genes Cp-1002 Product Genes Cp-T1 Product mca Mycothiol S-conjugate amidase CP258_RS02980 Methylmalonyl-CoA carboxyltransferase 12S subunit Cp1002B_RS03590 Hypothetical protein pknL Serine/threonine protein kinase hisN Histidinol-phosphatase CP258_RS03105 LPxTG domain-containing protein mcbR TetR family transcriptional regulator fhs Formatetetrahydrofolate ligase rbsK Ribokinase CP258_RS03110 Aminotransferase ureE...”

Tfu_1215 methylmalonyl-CoA decarboxylase alpha chain from Thermobifida fusca YX
32% identity, 89% coverage

The Effects of Carbon Source and Growth Temperature on the Fatty Acid Profiles of Thermobifida fusca
Winkelman, Frontiers in molecular biosciences 2022
- “...subunit Tfu_2555 AcCCase E AcCCase E subunit Tfu_2556 ACCase B Additional ACCase CT subunit Tfu_1228, Tfu_1215 BCCP Biotin Carboxyl-Carrier Protein Tfu_1513 LCCase LCCase Tfu_1530 AcpP Acyl-carrier protein (ACP) Tfu_1975 MCAT Malonyl-CoA:ACP transacylase Tfu_1231, Tfu_1973 FabH 3-ketoacyl-ACP synthase III Tfu_1229, Tfu_1974 FabF 3-ketoacyl-ACP synthase III isozyme Tfu_1976...”
- “...fusca genome identified additional genes that encode homologs of biotin-containing carboxylase proteins, namely Tfu_0947, Tfu_0948, Tfu_1215, Tfu_1228, Tfu_1513, and Tfu_1530. The adjacent Tfu_0947 and Tfu_0948 genes suggest that they are on a single operon, with Tfu_0947 encoding a subunit with the BC and BCCP domains, and...”

mmdA / Q57079 (S)-methylmalonyl-CoA decarboxylase α subunit (EC 7.2.4.3) from Veillonella parvula (see 5 papers)
MMDA_VEIPA / Q57079 Methylmalonyl-CoA decarboxylase subunit alpha; Carboxyltransferase; EC 7.2.4.3 from Veillonella parvula (Staphylococcus parvulus) (see 8 papers)
TC 3.B.1.1.2 / Q57079 Alpha-subunit,methylmalonyl-CoA decarboxylase, component of Na+-transporting methylmalonyl-CoA decarboxylase from Veillonella parvula (see paper)
AAC36820.1 methylmalonyl-CoA decarboxylase alpha-subunit from Veillonella parvula (see paper)
CAA80872.1 alpha-subunit,methylmalonyl-CoA decarboxylase from Veillonella parvula (see paper)
31% identity, 78% coverage

function: Carboxyltransferase subunit of the sodium ion pump methylmalonyl-CoA decarboxylase, which converts the chemical energy of a decarboxylation reaction into an electrochemical gradient of Na(+) ions across the cytoplasmic membrane, thereby creating a sodium ion motive force that is used for ATP synthesis. The alpha subunit catalyzes the Na(+)-independent carboxyltransfer from methylmalonyl-CoA to the prosthetic biotin group located on the gamma subunit (PubMed:1991479, PubMed:2920730, PubMed:3609308, PubMed:6852015, PubMed:7070502, PubMed:7601825). Can also convert malonyl-CoA into acetyl-CoA (PubMed:2920730, PubMed:6852015).
catalytic activity: (S)-methylmalonyl-CoA + Na(+)(in) + H(+)(out) = propanoyl-CoA + Na(+)(out) + CO2 (RHEA:21396)
subunit: The methylmalonyl-CoA decarboxylase is composed of five subunits: the carboxyltransferase alpha subunit (MmdA), the tunnel beta subunit (MmdB), the biotin-containing gamma subunit (MmdC), and the delta (MmdD) and epsilon (MmdE) subunits (PubMed:7601825, PubMed:8227015). Interacts with the gamma subunit (PubMed:7601825).
substrates: Na+
Stratification of human gut microbiomes by succinotype is associated with inflammatory bowel disease status
Anthamatten, Microbiome 2024
- “...based on the similarity to the mmdA gene of the Veillonella parvula succinate-to-propionate cluster (UniProt Q57079). We first looked for putative hits in all translated genomes from GTDB release 214 with phmmer (HMMER 3.3) and filtered for those with an e -value below 10 \documentclass[12pt]{minimal} \usepackage{amsmath}...”

A0QTE7 Propionyl-CoA carboxylase beta chain from Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
MSMEG_1813 propionyl-CoA carboxylase beta chain from Mycobacterium smegmatis str. MC2 155
30% identity, 89% coverage

An in vivo crosslinking system for identifying mycobacterial protein-protein interactions.
Lougheed, Journal of microbiological methods 2014
- “...Tuf Elongation factor Tu 12 A0QQC8 dnaK Chaperone protein DnaK 9 A4ZHR8 MSMEG1842 Adenosylhomocysteinase 3 A0QTE7 MSMEG_1813 Propionyl-CoA carboxylase beta chain a 2 A0R616 MSMEG_6391 Propionyl-CoA carboxylase beta chain a 2 a Known biotinylated proteins. We believe that our system for the expression of tagged target...”
Pupylated proteins are subject to broad proteasomal degradation specificity and differential depupylation
Laederach, PloS one 2019
- “...positive member of the pupylome, and in accordance with this report our attempts to pupylate MSMEG_1813 in vitro failed to produce pupylated product [ 27 ]. In fact, due to their biotin cofactor and their high abundance, carboxylases tend to be retained significantly in Strep-tag based...”
The NnaR orphan response regulator is essential for the utilization of nitrate and nitrite as sole nitrogen sources in mycobacteria
Antczak, Scientific reports 2018
- “...control, we selected two genes unrelated to nitrogen metabolism: the gene encoding AccD5 carboxyltransferase ( msmeg_1813 ), involved in cell envelope lipid biosynthesis 20 , and rpoB ( msmeg_1367 ), encoding the -subunit of the RNA polymerase 21 . The same RNA samples as extracted for...”
- “...of expression for: msmeg_0427 , msmeg_0433 , msmeg_5360 , msmeg_5765 , msmeg_2425 , msmeg_2982 , msmeg_1813 and msmeg_1367 . The qRT-PCR reactions were performed using SYBR green chemistry and data are normalized to sigA rRNA levels. Mean values and standard deviations from three independent experiments are...”
Mycobacteriophage Fruitloop gp52 inactivates Wag31 (DivIVA) to prevent heterotypic superinfection
Ko, Molecular microbiology 2018
- “...known to interact with Wag31 complexes including CwsA (MSMEG_0023), AccA3 (MSMEG_1807), AccD4 (MSMEG_6391), and AccD5 (MSMEG_1813), were overexpressed and tested for their ability to rescue M. smegmatis from Fruitloop gp52 toxicity ( Fig. 2D ). Overexpression of Wag31 clearly results in rescue of Fruitloop gp52 toxicity,...”
- “...(MSMEG_6391 , coordinates 6455190 6456743 complement, with start codon changed from GTG to ATG), AccD5 MSMEG_1813 , coordinates 1888497 1890125), and cwsA (MSMEG_0023 , coordinates 44692 45102) genes of M. smegmatis mc 2 155 were individually cloned into plasmid pLO74 to replace mCherry gene using NEBuilder...”
Protein Composition of Mycobacterium smegmatis Differs Significantly Between Active Cells and Dormant Cells With Ovoid Morphology
Trutneva, Frontiers in microbiology 2018
- “...found in active cells, there are additional unique enzymes in the dormant cell proteome: MSMEG_1821, MSMEG_1813, MSMEG_6008, MSMEG_6391, MSMEG_2938, MSMEG_5184, and MSMEG_6511). Similarly, enzymes with proteolytic activity were found in both types of cells. However, proteolytic enzymes are more diverse and more represented in the dormant...”
The influence of AccD5 on AccD6 carboxyltransferase essentiality in pathogenic and non-pathogenic Mycobacterium
Pawelczyk, Scientific reports 2017
- “...essentiality of accD1 accD6 in Msm by directed mutagenesis and found that only MSMEG_6391 and MSMEG_1813 ( Mtb accD4 and accD5 homologs, respectively) are essential for survival 14 . The TLC/autoradiography analysis of [ 14 C]acetate-labeled FAMEs and MAMEs extracted from the accD1 Msm , accD2...”
- “...acyl-CoA as the only substrate of AccD4 Msm in vivo . AccD5 of M. smegmatis (MSMEG_1813) but not that of M. tuberculosis (Rv3280) acts as acetyl-CoA carboxyltransferase in vivo In view of the above-mentioned results, the protein encoded by the MSMEG_1813 gene, homologous to Mtb accD5...”
Monitoring global protein thiol-oxidation and protein S-mycothiolation in Mycobacterium smegmatis under hypochlorite stress
Hillion, Scientific reports 2017
- “...MSMEG_0531 MSMEG_0531 Acyl-CoA dehydrogenase (R)AAYEYALDYAC 285 (+484)QR(E) 4,50 MSMEG_6208 MSMEG_6208 Acyl-CoA thioesterase (R)DGDVFC 21 (+484)IREPEPNTIER(L) MSMEG_1813 AccD5 Propionyl-CoA carboxylase beta chain (R)VEGRPVGIVANQPTQFAGC 356 (+484)LDINASEK(A) 11,49 MSMEG_4329 AccD6 Acetyl/propionyl-CoA carboxylase (R)LGGC 294 (+484)LNSESAEK(S) 12,96 Metabolism of nucleotides MSMEG_2299 NrdE2 Ribonucleoside-diphosphate reductase (K)ITHSNLC 380 (+484)SEILQVSTPSEFNDDLSYAK(V) MSMEG_1602 GuaB Inosine-5-monophosphate...”
- “...26,4 MSMEG_1807 accA3 Acetyl-/propionyl-CoA carboxylase alpha chain 236* B 13,4 12,6 26,0 22,8 25,7 45,7 MSMEG_1813 accD5 Methylmalonyl-CoA carboxyltransferase 356 (MSH;Cys) B 11,5 17,2 26,4 10,7 30,9 41,6 MSMEG_2207 MSMEG_2207 Beta-ketothiolase 9 B 12,9 11,0 26,2 2,9 39,4 36,9 MSMEG_4116 MSMEG_4116 3-hydroxyacyl-CoA DH 148 B 18,8...”
An in vivo crosslinking system for identifying mycobacterial protein-protein interactions
Lougheed, Journal of microbiological methods 2014
- “...Elongation factor Tu 12 A0QQC8 dnaK Chaperone protein DnaK 9 A4ZHR8 MSMEG1842 Adenosylhomocysteinase 3 A0QTE7 MSMEG_1813 Propionyl-CoA carboxylase beta chain a 2 A0R616 MSMEG_6391 Propionyl-CoA carboxylase beta chain a 2 a Known biotinylated proteins. We believe that our system for the expression of tagged target proteins...”

BT1917 propionyl-CoA carboxylase beta chain from Bacteroides thetaiotaomicron VPI-5482
30% identity, 92% coverage

Investigation and Alteration of Organic Acid Synthesis Pathways in the Mammalian Gut Symbiont Bacteroides thetaiotaomicron
Porter, Microbiology spectrum 2022
- “...9.170.39 8.270.72 1.780.17 5.230.60 0.120.02 8.030.33 BT1686-9 16.250.39 0.020.01 7.920.14* 9.310.62 2.080.31 ND* 0.120.02 15.000.27** BT1917 16.070.02 0.020.01 9.090.34 9.240.65 2.070.22 5.010.22 0.140.00** 8.100.31 BT2090-1 15.770.29 0.060.01 8.750.49 8.981.08 1.880.76 ND* 0.170.02 14.770.60* BT3193 1.720.25** ND ND** 2.730.40** ND* ND* 1.170.35 0.740.35** BT1969 14.610.94 0.030.01 7.230.61...”
- “...forms of methylmalonyl-CoA and may also be necessary before decarboxylation. Two other genes, BT1450 and BT1917, are annotated as propionyl-CoA carboxylase beta chains (subunit of methylmalonyl-CoA decarboxylase, similar to BT1686), and are found within loci predicted to encode biotin-dependent carboxylases, similar to BT1686-9. We generated deletion...”

cg0811 acetyl/propionyl CoA carboxylase subunit beta from Corynebacterium glutamicum ATCC 13032
NCgl0677 acyl-CoA carboxylase subunit beta from Corynebacterium glutamicum ATCC 13032
31% identity, 79% coverage

Functional Genomics Uncovers Pleiotropic Role of Rhomboids in Corynebacterium glutamicum
Luenenschloss, Frontiers in microbiology 2022
- “...consists of the subunits AccbC (Cg0802) and AccD1 (Cg0812), the latter of AccbC (Cg0802), AccD2 (Cg0811), AccD3 (Cg3177), and AccE (Cg0810) ( Gande et al., 2007 ). The malonyl-CoA is utilized for fatty acid synthesis with Fas-IB (Cg0957) or Fas-IA (Cg2743). Isolated Fas-IA synthesizes stearate and...”
Genome Sequence of the Bacteriophage CL31 and Interaction with the Host Strain Corynebacterium glutamicum ATCC 13032
Hünnefeld, Viruses 2021
- “...Gene Locus Base Amino Acid Position Frequency Mutation resmod BX927147 dtsR 2 ( accD 2) Cg0811 C -> T Gly350Asp 728777 97.7% missense MB001 CP005959 pccB ( accD 3) Cg3177 C -> T Gly341Asp 2831759 95.4% missense WT BX927147 pks Cg3178 A -> T Tyr886Asp 3038431...”
Genome-wide identification of novel genes involved in Corynebacteriales cell envelope biogenesis using Corynebacterium glutamicum as a model
de, PloS one 2020
- “...lipid carrier decaprenyl pyrophosphate [ 43 ] Mycolic acid biosynthesis pr- dtsR2 and dtsR2 (ort- cg0811 ) 3 DtsR2/AccD2: subunit of the acetyl-CoA carboxylase involved in MA biosynthesis [ 44 ] pptT (ort- cg2171 ) 1 PptT: 4-phosphopantetheinyl transferase that activates the mycolic acid condensing enzyme...”
The influence of AccD5 on AccD6 carboxyltransferase essentiality in pathogenic and non-pathogenic Mycobacterium
Pawelczyk, Scientific reports 2017
- “...of AccD5 was deduced from comparative studies on the homologous carboxylase subunit of C. glutamicum (Cg0811) and S. coelicolor (SCO4926) 12 18 23 . Despite clear substrate preference for propionyl-CoA, the enzyme also presented a minor ability to bind and carboxylate acetyl-CoA. Such bi-substrate specificity was...”
Fatty acid biosynthesis in actinomycetes
Gago, FEMS microbiology reviews 2011
- “...ligase birA ( SCO4027 ) ( Fig. 5 ). In C. glutamicum the accD2 ( CG0811 ), accE ( CG0810 ), and accBC genes are also clustered, showing a partial synteny with their corresponding genes from streptomycetes and mycobacteria that includes the gene birA ( CG0814...”
Altered acetylation and succinylation profiles in Corynebacterium glutamicum in response to conditions inducing glutamate overproduction
Mizuno, MicrobiologyOpen 2016
- “...change in protein abundance (34.1fold decrease in the glutamate producing condition). AccBC (NCgl0670) and DtsR2 (NCgl0677), the other subunits of acetylCoA carboxylase, were 2.4fold and 1.2fold less abundant in the glutamateproducing condition, respectively. These results were consistent with the transcriptome analysis reporting severe downregulation of dtsR1...”

Caur_3435 / A9WKJ2 propionyl-CoA carboxylase β subunit (EC 6.4.1.3) from Chloroflexus aurantiacus (strain ATCC 29366 / DSM 635 / J-10-fl) (see paper)
Caur_3435 Propionyl-CoA carboxylase from Chloroflexus aurantiacus J-10-fl
33% identity, 79% coverage

Complete genome sequence of the filamentous anoxygenic phototrophic bacterium Chloroflexus aurantiacus
Tang, BMC genomics 2011
- “...(Caur_1378, Caur_3421), accA (Caur_1647), accD (Caur_1648), accB (Caur_3739), mcr (Caur_2614), pcs (Caur_ 0613), pccB (Caur_2034, Caur_3435), mcee (Caur_3037), mut (Caur_1844, Caur_2508, Caur_2509), smtA (Caur_0179), smtB (Caur_0178), sdhBAC (Caur_1880 to Caur_1882), fh (Caur_1443), mcl (Caur_0174), mch (Caur_0173), mct (Caur_0174), meh (Caur_0180) Glycolate assimilation and glyoxylate cycle glcDEF...”
- “...synthase ( pcs , Caur_0613) [ 81 ], (4) propionyl-CoA carboxylase ( pccB , Caur_2034, Caur_3435), (5) methylmalonyl-CoA epimerase ( mcee , Caur_3037), (6) L -methylmalonyl-CoA mutase (MCM) ( mut , Caur_1844, Caur_2508, Caur_2509), (7) succinyl-CoA:( S )-malyl-CoA transferase ( smtA (Caur_0179), smtB (Caur_0178)), (8) succinate...”

PFJ30894_RS01595 acyl-CoA carboxylase subunit beta from Phascolarctobacterium faecium
30% identity, 89% coverage

Microbial interaction between the succinate-utilizing bacterium Phascolarctobacterium faecium and the gut commensal Bacteroides thetaiotaomicron
Ikeyama, MicrobiologyOpen 2020
- “...the succinate pathway PFJ30894_RS01590 + Cobalamin B 12 binding domaincontaining protein K01849 295.72 0 0 PFJ30894_RS01595 + MethylmalonylCoA carboxyltransferase K01604 338.18 0 0 PFJ30894_RS03730 + Succinate CoA transferase K18118 333.54 60.91 32.15 PFJ30894_RS03735 + MethylmalonylCoA mutase K01848 224.08 0 31.48 PFJ30894_RS04255 + MethylmalonylCoA mutase K01847 207.62...”

Pden_3688 carboxyl transferase from Paracoccus denitrificans PD1222
PDEN_RS18310 acyl-CoA carboxylase subunit beta from Paracoccus denitrificans PD1222
31% identity, 83% coverage

Functional Degeneracy in Paracoccus denitrificans Pd1222 Is Coordinated via RamB, Which Links Expression of the Glyoxylate Cycle to Activity of the Ethylmalonyl-CoA Pathway
Kremer, Applied and environmental microbiology 2023
- “...PDEN_RS02805 WP_011746908.1 pccA Propionyl-CoA Carboxylase subunit A Pden_3684 PDEN_RS18285 WP_011749920.1 pccB Propionyl-CoA Carboxylase subunit B Pden_3688 PDEN_RS18310 WP_011749924.1 mcm Methylmalonyl-CoA Pden_3681 PDEN_RS18265 WP_011749917.1 MCC prpD 2-methylcitrate dehydratase Pden_1348 PDEN_RS06660 WP_011747670.1 prpC 2-methylcitrate synthase Pden_1347 PDEN_RS06655 WP_011747669.1 prpB 2-methylisocitrate lyase Pden_1346 PDEN_RS06650 WP_041530157.1 acyl-CoA thioesterase Acyl-CoA thioesterase...”
Functional Degeneracy in Paracoccus denitrificans Pd1222 Is Coordinated via RamB, Which Links Expression of the Glyoxylate Cycle to Activity of the Ethylmalonyl-CoA Pathway
Kremer, Applied and environmental microbiology 2023
- “...WP_011746908.1 pccA Propionyl-CoA Carboxylase subunit A Pden_3684 PDEN_RS18285 WP_011749920.1 pccB Propionyl-CoA Carboxylase subunit B Pden_3688 PDEN_RS18310 WP_011749924.1 mcm Methylmalonyl-CoA Pden_3681 PDEN_RS18265 WP_011749917.1 MCC prpD 2-methylcitrate dehydratase Pden_1348 PDEN_RS06660 WP_011747670.1 prpC 2-methylcitrate synthase Pden_1347 PDEN_RS06655 WP_011747669.1 prpB 2-methylisocitrate lyase Pden_1346 PDEN_RS06650 WP_041530157.1 acyl-CoA thioesterase Acyl-CoA thioesterase Pden_1349...”

BAGQ_2413 acyl-CoA carboxylase subunit beta from Bacillus velezensis
31% identity, 91% coverage

Complete Genome Sequence of Bacillus velezensis GQJK49, a Plant Growth-Promoting Rhizobacterium with Antifungal Activity
Ma, Genome announcements 2017
- “...metabolism. Two transAT polyketide synthase-nonribosomal peptide synthetase (TATPKS-NRPS)-type clusters (BAGQ_1558 to BAGQ_1605 and BAGQ_2358 to BAGQ_2413) showed similarity with the biosynthetic gene clusters of macrolactin and difficidin, respectively. Two gene clusters (BAGQ_1833 to BAGQ_1882 and BAGQ_1959 to BAGQ_2031), which belonged to the transAT TATPKS-NRPS type, were...”

RBAM_RS11225 acyl-CoA carboxylase subunit beta from Bacillus velezensis FZB42
31% identity, 91% coverage

Key Impact of an Uncommon Plasmid on Bacillus amyloliquefaciens subsp. plantarum S499 Developmental Traits and Lipopeptide Production
Molinatto, Frontiers in microbiology 2017
- “...RBAM_RS11410 SinR antagonist 99 sinR AS588_RS03970 RBAM_RS11415 Master regulator of biofilm formation 99 spo0A AS588_RS04160 RBAM_RS11225 Master regulator of initiation of sporulation 98 srfABCD AS588_RS12405-AS588_RS12420 RBAM_RS01840-RBAM_RS01855 Surfactin synthetases 9798 swrA AS588_RS16295 RBAM_RS16170 Swarming protein 95 swrB AS588_RS07095 RBAM_RS08150 Swarming protein 96 swrC AS588_RS00450 RBAM_RS03555 Multidrug efflux...”

1on3E / Q8GBW6 Transcarboxylase 12s crystal structure: hexamer assembly and substrate binding to a multienzyme core (with methylmalonyl-coenzyme a and methylmalonic acid bound) (see paper)
30% identity, 92% coverage

Ligand: methylmalonyl-coenzyme a (1on3E)

mmdA / Q8GBW6 methylmalonyl-CoA carboxyltransferase 12S subunit (EC 2.1.3.1) from Propionibacterium freudenreichii subsp. shermanii (see 3 papers)
12S_PROFR / Q8GBW6 Methylmalonyl-CoA carboxyltransferase 12S subunit; Transcarboxylase 12S subunit; EC 2.1.3.1 from Propionibacterium freudenreichii subsp. shermanii (see 2 papers)
12S / CAD59919.1 Methylmalonyl-CoA carboxyltransferase 12S subunit from Propionibacterium freudenreichii subsp. shermanii (see paper)
PFREUD_18860 acyl-CoA carboxylase subunit beta from Propionibacterium freudenreichii subsp. shermanii CIRM-BIA1
30% identity, 92% coverage

function: The 12S subunit specifically catalyzes the transfer of the carboxyl group of methylmalonyl CoA to the biotin of the 1.3S subunit forming propanoyl-CoA and carboxylated 1.3S-biotin.
catalytic activity: (S)-methylmalonyl-CoA + pyruvate = propanoyl-CoA + oxaloacetate (RHEA:20764)
subunit: Homohexamer (PubMed:12743028, PubMed:8366018). Transcarboxylase is composed of three subunits: 1.3S, 5S, and 12S. The core of the enzyme is composed of six 12S subunits. On each side of the core there are three pairs of 5S subunits. Each 5S dimer is attached to the core by two 1.3S subunits. Thus the total number of chains is 30 (6 + 12 + 12) (Probable).
A temporal-omic study of Propionibacterium freudenreichii CIRM-BIA1 adaptation strategies in conditions mimicking cheese ripening in the cold
Dalmasso, PloS one 2012
- “...1 CH 0.7 2.7 1.7 0.9 0.053 1.5 0.008 0.7 0.4 0.8 0.001 37 mmdA PFREUD_18860 ylmalonyl-CoA carboxytransferase 12S CH 0.3 0.1 0.1 0.4 0.593 0.6 0.4 0.7 0.013 25 NC PFREUD_18870 ylmalonyl-CoA carboxytransferase 5S t CH 0.2 0.1 0 0 0.995 0 0.6 0.9 0.02...”
The complete genome of Propionibacterium freudenreichii CIRM-BIA1, a hardy actinobacterium with food and probiotic applications
Falentin, PloS one 2010
- “...P02904 and Q70AC7 from P. freudenreichii subsp. shermanii W52, respectively. The 12S subunit, encoded by PFREUD_18860, shares 96% similarity with the N-terminal part (524 amino acids) of the Swiss-Prot entry Q8GBW6, and would be a functional but truncated protein, as in the P. acnes genome [21]...”
Pre-existing antibodies targeting a linear epitope on SARS-CoV-2 S2 cross-reacted with commensal gut bacteria and shaped vaccine induced immunity
Jia, 2021
3-methylcrotonyl-CoA carboxylase deficiency: clinical, biochemical, enzymatic and molecular studies in 88 individuals
Grünert, Orphanet journal of rare diseases 2012
- “...well as the structurally characterized P. aeruginosa MCCC2 (paMCCC2, Q9I297), Propionibacterium shermanii methylmalonyl-CoA carboxyltransferase (psMMCC, Q8GBW6), Streptomyces coelicolor PCC (scPCCB, Q9X4K7) and Roseobacter denitrificans PCC (bPCCA, Q168G2). Novel MCCC2 missense mutations are asterisked. Click here for file Acknowledgements We thank the following doctors and physicians for...”
The complete genome of Propionibacterium freudenreichii CIRM-BIA1, a hardy actinobacterium with food and probiotic applications
Falentin, PloS one 2010
- “...PFREUD_18860, shares 96% similarity with the N-terminal part (524 amino acids) of the Swiss-Prot entry Q8GBW6, and would be a functional but truncated protein, as in the P. acnes genome [21] . Another coding sequence (PFREUD_18850) encodes the C-terminal part (98% similarity with the Swiss-Prot entry...”

PFCIRM129_10295 acyl-CoA carboxylase subunit beta from Propionibacterium freudenreichii subsp. freudenreichii
30% identity, 92% coverage

Mutation of the Surface Layer Protein SlpB Has Pleiotropic Effects in the Probiotic Propionibacterium freudenreichii CIRM-BIA 129
do, Frontiers in microbiology 2018
- “...cis-trans isomerase SEC O 35.9 23.0 22 4 5.8 11.5 7 2 1.2 b25 b25.a1 PFCIRM129_10295 Methylmalonyl-CoA carboxytransferase 12S subunit (EC2.1.3.1) (Transcarboxylase 12S subunit). 610 bp CYT I 56.3 31.2 11 5 0.7 15.2 7 3 0.4 b26 b26.a1 PFCIRM129_11300 Glyceraldehyde-3-phosphate dehydrogenase / erythrose 4 phosphate...”

HCN55_12915 acyl-CoA carboxylase subunit beta from Bacillus subtilis subsp. subtilis str. SMY
BSU23920 putative acyl-CoA carboxylase from Bacillus subtilis subsp. subtilis str. 168
31% identity, 89% coverage

Proteomic Analysis of the Characteristic Flavor Components in Bacillus subtilis BSNK-5-Fermented Soymilk
Hu, Foods (Basel, Switzerland) 2024
- “...2.29 2.02 A0A6H2KKS5 iolA Methylmalonate/inositol-semialdehyde dehydrogenase 0.44 0.49 G4EYT5 BSSC8_35150 Dihydrolipoyl dehydrogenase 0.13 0.17 A0A6H0H9I7 HCN55_12915 BSU23920 0.23 0.19 A0A6H0H6V2 HCN55_17715 Acetyl-CoA C-acyltransferase 0.39 0.23 Valine, leucine, and isoleucine biosynthesis P37253 ilvC Ketol-acidreductoisomerase (NADP(+)) 0.43 0.10 0.22 A0A6I4D8C8 ilvD Dihydroxy-acid dehydratase 0.41 0.45 P05645 leuB 3-isopropylmalate...”
Proteomic Analysis of the Characteristic Flavor Components in Bacillus subtilis BSNK-5-Fermented Soymilk
Hu, Foods (Basel, Switzerland) 2024
- “...2.02 A0A6H2KKS5 iolA Methylmalonate/inositol-semialdehyde dehydrogenase 0.44 0.49 G4EYT5 BSSC8_35150 Dihydrolipoyl dehydrogenase 0.13 0.17 A0A6H0H9I7 HCN55_12915 BSU23920 0.23 0.19 A0A6H0H6V2 HCN55_17715 Acetyl-CoA C-acyltransferase 0.39 0.23 Valine, leucine, and isoleucine biosynthesis P37253 ilvC Ketol-acidreductoisomerase (NADP(+)) 0.43 0.10 0.22 A0A6I4D8C8 ilvD Dihydroxy-acid dehydratase 0.41 0.45 P05645 leuB 3-isopropylmalate dehydrogenase...”
Taxonomic Identity Resolution of Highly Phylogenetically Related Strains and Selection of Phylogenetic Markers by Using Genome-Scale Methods: The Bacillus pumilus Group Case
Espariz, PloS one 2016
- “...0.000 Ribonuclease Y BSU16960 yqjD 0.137 2.778E -06 0.580 6.580 0.000 Propionyl-CoA carboxylase beta chain BSU23920 trmU 0.148 8.676E -06 0.814 6.508 0.000 tRNA 2-thiouridylase BSU27500 yusV 0.046 6.259E -08 0.209 6.489 7.692E -02 Iron(III)- siderophore transporter ATP binding component BSU32940 sigA 0.100 5.368E -07 0.337...”

Bbr_1720 acyl-CoA carboxylase subunit beta from Bifidobacterium breve UCC2003
30% identity, 87% coverage

Transcriptional landscape of the pMP7017 megaplasmid and its impact on the Bifidobacterium breve UCC2003 transcriptome
Dineen, Microbial biotechnology 2024
- “...exopolysaccharide (EPS) biosynthesis gene cluster (Fanning, Hall, Cronin, etal., 2012 ). In addition, gene accD (Bbr_1720), putatively encoding an acetyl CoA chain involved in the metabolism of fatty acids, which was previously identified as a gene involved in B. breve UCC2003 biofilm formation due to the...”
Discovering novel bile protection systems in Bifidobacterium breve UCC2003 through functional genomics
Ruiz, Applied and environmental microbiology 2012
- “...12.2 3.8 4.8 Fatty acid metabolism Bbr_1719 Bbr_1720 Bbr_1721 Bbr_1891 Type I multifunctional fatty acid synthase (fas) Acetyl/propionyl coenzyme A carboxylase...”

SCO6284 decarboxylase from Streptomyces coelicolor A3(2)
32% identity, 91% coverage

Coelimycin Synthesis Activatory Proteins Are Key Regulators of Specialized Metabolism and Precursor Flux in Streptomyces coelicolor A3(2)
Bednarz, Frontiers in microbiology 2021
- “...). We have found that ACCase subunit(s) AccA2 and/or AccA1, subunits AccB (SCO5535) and CpkK (SCO6284), and a small accessory protein AccE (SCO5536), were more abundant in cpkN along with biotin biosynthesis proteins BioA (SCO1245), BioB (SCO1244), and BioD (SCO1246). cpkO strain presented a different pattern...”
Cytosolic copper is a major modulator of germination, development and secondary metabolism in Streptomyces coelicolor
González-Quiñónez, Scientific reports 2019
- “...SCO6279 5.8 55.8 SCO6280 2.4 5.4 SCO6281 4.8 28.7 SCO6282 6.9 118.9 SCO6283 6.5 90.4 SCO6284 5.1 34.9 SCO6286 3.4 10.2 SCO6287 4.4 21.1 SCO6288 3.1 8.7 SCO6430 Dipeptide biosynthesis 1.2 2.3 SCO6431 1 2 SCO6432 0.9 1.8 SCO6436 0.8 1.7 SCO6767 Hopene biosynthesis 1 2...”
ArgR of Streptomyces coelicolor is a versatile regulator
Pérez-Redondo, PloS one 2012
- “...SCO6283 and SCO6288, respectively) or II.4 type ( cpkDE, cpkHI, cpkK , SCO72767277, SCO62816282 and SCO6284, respectively) ( Fig. 6B ). The observed effect was probably due to a cascade effect mediated by the Streptomyces type of regulators encoded by kasO and cpkN , which were...”
Biosynthetic investigations of lactonamycin and lactonamycin z: cloning of the biosynthetic gene clusters and discovery of an unusual starter unit
Zhang, Antimicrobial agents and chemotherapy 2008
- “...71/59 Glr0227 (BAC88168), 55/38 MetK (AAD22464), 91/84 SCO6284 (CAC37885), 88/80 SAV5143 (BAC72855), 69/49 SCO3305 (CAB45339), 69/52 SAV4467 (BAC72179), 90/85...”

AOT42_01525 acyl-CoA carboxylase subunit beta from Corynebacterium diphtheriae bv. gravis
31% identity, 78% coverage

Analysis of Corynebacterium diphtheriae macrophage interaction: Dispensability of corynomycolic acids for inhibition of phagolysosome maturation and identification of a new gene involved in synthesis of the corynomycolic acid layer
Ott, PloS one 2017
- “...ID Function DSM43988 DSM43989 DSM44123 DIP0658 accD1/pccB1 Propionyl CoA carboxylase beta chain 1 B178_02716 AO271_00190 AOT42_01525 DIP0660 pccB2 Propionyl CoA carboxylase beta chain 2 B178_02731 AO271_00180 AOT42_01535 DIP0740 accD2 Acyl-CoA carboxylase beta subunit B178_03126 AO271_10895 AOT42_01905 DIP0649 accBC Acyl-CoA carboxylase alpha subunit B178_03136 AO271_00235 AOT42_01480 DIP0787...”

NP_939032 Propionyl CoA carboxylase beta chain 1 from Corynebacterium diphtheriae NCTC 13129
DIP0658 acyl-CoA carboxylase subunit beta from Corynebacterium diphtheriae NCTC 13129
31% identity, 78% coverage

The role of acyl-coenzyme A carboxylase complex in lipstatin biosynthesis of Streptomyces toxytricini
Demirev, Applied microbiology and biotechnology 2010
- “...MleAccD5, AccD5 of M. leprae TN (NP_301571); CdpAccD5, AccD5 of C . diphtheriae NCTC 13129 (NP_939032), StxAccA3, AccA3 of S. toxytricini NRRL 15443; ScoAccA3, S. coelicolor A3(2) (NP_629074); SavAccA3, AccA3 of S. avermitilis MA-4680 (NP_824513); SprJadJ, JadJ of S. pristinaespiralis ATCC 25486 (ZP_05009963); SclJadJ; JadJ of...”
Analysis of Corynebacterium diphtheriae macrophage interaction: Dispensability of corynomycolic acids for inhibition of phagolysosome maturation and identification of a new gene involved in synthesis of the corynomycolic acid layer
Ott, PloS one 2017
- “...in yellow, is a pseudogene in DSM43989. NCTC 13129 Gene ID Function DSM43988 DSM43989 DSM44123 DIP0658 accD1/pccB1 Propionyl CoA carboxylase beta chain 1 B178_02716 AO271_00190 AOT42_01525 DIP0660 pccB2 Propionyl CoA carboxylase beta chain 2 B178_02731 AO271_00180 AOT42_01535 DIP0740 accD2 Acyl-CoA carboxylase beta subunit B178_03126 AO271_10895 AOT42_01905...”

Gbem_0335 carboxyl transferase from Geobacter bemidjiensis Bem
30% identity, 89% coverage

The genome of Geobacter bemidjiensis, exemplar for the subsurface clade of Geobacter species that predominate in Fe(III)-reducing subsurface environments
Aklujkar, BMC genomics 2010
- “...the same enzymes that activate acetate; (3) carboxylation to (S)-methylmalonyl-CoA by a biotin-dependent propionyl-CoA carboxyltransferase (Gbem_0335) that is 51% identical to the 12 S subunit of the Propionibacterium freudenreichii methylmalonyl-CoA:pyruvate carboxyltransferase enzyme complex [ 14 ]; (4-5) epimerization and rearrangement to succinyl-CoA; (6) hydrolysis to succinate;...”

SPO1094 acyl-CoA carboxylase subunit beta from Ruegeria pomeroyi DSS-3
SPO1094 propionyl-CoA carboxylase, beta subunit from Silicibacter pomeroyi DSS-3
33% identity, 75% coverage

High-throughput proteogenomics of Ruegeria pomeroyi: seeding a better genomic annotation for the whole marine Roseobacter clade
Christie-Oleza, BMC genomics 2012
- “...hand, we found that SPO_PG022 is co-transcribed with its downstream gene, SPO1095, and upstream gene, SPO1094, a putative propionyl-CoA carboxylase. SPO1094 converts propionyl-CoA (a derivative product from branched-chain amino acid catabolism) to methylmalonyl-CoA (a precursor of the citric acid cycle component, succinyl-CoA). Strikingly, SPO_PG022 shares similarity...”
Proteomic insights into the lifestyle of an environmentally relevant marine bacterium
Christie-Oleza, The ISME journal 2012
- “...pumps SPO1497 (16 ), SPO0111 (16 ) and SPO1094 (12 ). Differential protein detection among the five conditions used for in-depth analysis. Proteins related...”

ING2E5A_1864 acyl-CoA carboxylase subunit beta from Petrimonas mucosa
30% identity, 88% coverage

The Role of Petrimonas mucosa ING2-E5A^T in Mesophilic Biogas Reactor Systems as Deduced from Multiomics Analyses
Maus, Microorganisms 2020
- “...A, mut B ING2E5A_1046 5.1.99.1 Methylmalonyl-CoA epimerase ( R )-methylmalonyl-CoA <=> ( S )-2-Methylmalonyl-CoA ING2E5A_1045, ING2E5A_1864 6.4.1.3 Propionyl-CoA carboxylase ATP + propanoyl-CoA + HCO 3 - <=> ADP + phosphate + ( S )-methylmalonyl-CoA pcc B1 pcc B3 ING2E5A_0730 2.3.1.8 Phosphate acetyltransferase Acetyl-CoA + phosphate <=>...”

BF638R_1625 acyl-CoA carboxylase subunit beta from Bacteroides fragilis 638R
29% identity, 90% coverage

New functions of pirin proteins and a 2-ketoglutarate: Ferredoxin oxidoreductase ortholog in Bacteroides fragilis metabolism and their impact on antimicrobial susceptibility to metronidazole and amixicile
Gough, MicrobiologyOpen 2024
- “...MenF, isochorismate synthase (BF638R_1315); MK, menaquinone; MMCE, methylmalonylCoA epimerase (BF638R_3151); MmdA1 (PccB), propionylCoA carboxylase betachain (BF638R_1625); MmdA2 (PccB), propionylCoA carboxylase betachain (BF638R_3367); MutAB, methylmalonylCoA mutase, small (A) and large (B) subunits (BF638R_36163615); Nad2, NADH dehydrogenase, FADcontaining subunit (BF638R_1612); Nqr, Na+translocating NADHquinone oxidoreductase, NqrABCDE, (BF638R_2136_2140); Nuo, NADH,ubiquinone...”

AO271_00190 acyl-CoA carboxylase subunit beta from Corynebacterium diphtheriae
31% identity, 78% coverage

Analysis of Corynebacterium diphtheriae macrophage interaction: Dispensability of corynomycolic acids for inhibition of phagolysosome maturation and identification of a new gene involved in synthesis of the corynomycolic acid layer
Ott, PloS one 2017
- “...Gene ID Function DSM43988 DSM43989 DSM44123 DIP0658 accD1/pccB1 Propionyl CoA carboxylase beta chain 1 B178_02716 AO271_00190 AOT42_01525 DIP0660 pccB2 Propionyl CoA carboxylase beta chain 2 B178_02731 AO271_00180 AOT42_01535 DIP0740 accD2 Acyl-CoA carboxylase beta subunit B178_03126 AO271_10895 AOT42_01905 DIP0649 accBC Acyl-CoA carboxylase alpha subunit B178_03136 AO271_00235 AOT42_01480...”

ING2E5A_1045 acyl-CoA carboxylase subunit beta from Petrimonas mucosa
31% identity, 86% coverage

The Role of Petrimonas mucosa ING2-E5A^T in Mesophilic Biogas Reactor Systems as Deduced from Multiomics Analyses
Maus, Microorganisms 2020
- “...mut A, mut B ING2E5A_1046 5.1.99.1 Methylmalonyl-CoA epimerase ( R )-methylmalonyl-CoA <=> ( S )-2-Methylmalonyl-CoA ING2E5A_1045, ING2E5A_1864 6.4.1.3 Propionyl-CoA carboxylase ATP + propanoyl-CoA + HCO 3 - <=> ADP + phosphate + ( S )-methylmalonyl-CoA pcc B1 pcc B3 ING2E5A_0730 2.3.1.8 Phosphate acetyltransferase Acetyl-CoA + phosphate...”

PFJ30894_RS04435, PFJ30894_RS04455 carboxyl transferase domain-containing protein from Phascolarctobacterium faecium
29% identity, 90% coverage

Microbial interaction between the succinate-utilizing bacterium Phascolarctobacterium faecium and the gut commensal Bacteroides thetaiotaomicron
Ikeyama, MicrobiologyOpen 2020
- “...binding domaincontaining protein K01849 765.35 169.18 671.45 PFJ30894_RS04430 + MethylmalonylCoA epimerase K05606 534.06 209.5 448.4 PFJ30894_RS04435 + MethylmalonylCoA carboxyltransferase K01604 356.74 0 91.02 PFJ30894_RS04440 + OadG family protein K23352 228.87 67.9 115.87 PFJ30894_RS04445 + Biotin/lipoylbinding protein K23351 551.21 121.18 128.31 PFJ30894_RS04450 + Sodium iontranslocating decarboxylase subunit...”
- “...K23351 551.21 121.18 128.31 PFJ30894_RS04450 + Sodium iontranslocating decarboxylase subunit beta K20509 277.59 279.98 242.45 PFJ30894_RS04455 + MethylmalonylCoA carboxyltransferase K01604 311.37 14.59 82.38 PFJ30894_RS04460 + Sodium pump decarboxylase K23352 138.97 0 0 PFJ30894_RS04465 + Biotin/lipoylbinding protein K23351 141.67 0 0 PFJ30894_RS04470 + Sodium iontranslocating decarboxylase subunit...”

BT1686 propionyl-CoA carboxylase beta chain from Bacteroides thetaiotaomicron VPI-5482
30% identity, 91% coverage

Investigation and Alteration of Organic Acid Synthesis Pathways in the Mammalian Gut Symbiont Bacteroides thetaiotaomicron
Porter, Microbiology spectrum 2022
- “...and BT1917, are annotated as propionyl-CoA carboxylase beta chains (subunit of methylmalonyl-CoA decarboxylase, similar to BT1686), and are found within loci predicted to encode biotin-dependent carboxylases, similar to BT1686-9. We generated deletion mutants for BT1450, BT1917, BT2090-1, and BT3193, and measured OA production as before. A...”
- “...as encoding the beta chain of propionyl-CoA carboxylase. However, deletion of only one of them, BT1686 (as part of a larger deletion), leads to abolishment of propionate production ( Fig.5 ). Rather than specifically propionyl-CoA carboxylases, the two other loci, BT1448-50 and BT1915-17, likely encode other...”

PF0671 methylmalonyl-CoAdecarboxylase, subunit alpha from Pyrococcus furiosus DSM 3638
30% identity, 91% coverage

SurR: a transcriptional activator and repressor controlling hydrogen and elemental sulphur metabolism in Pyrococcus furiosus
Lipscomb, Molecular microbiology 2009
- “...PF1563; 4, Cell division control protein 48, aaa family, PF0963; 5, methylmalonyl-CoA decarboxylase, subunit alpha, PF0671; 6, methionine synthase vitamin B 12 -independent isozyme, PF1269; 7, conserved hypothetical protein, PF1268; 8, conserved hypothetical protein, PF1827; 9, conserved hypothetical protein, PF0496; 10, conserved hypothetical protein (SurR), PF0095;...”

DR_1316 propionyl-CoA carboxylase, alpha subunit, putative from Deinococcus radiodurans R1
29% identity, 91% coverage

Atypical Bacilliredoxin AbxC Plays a Role in Responding to Oxidative Stress in Radiation-Resistant Bacterium Deinococcus radiodurans
Jeong, Antioxidants (Basel, Switzerland) 2021
- “...glycolysis (DR_1742), NAD + generation (DR_2428), amino acid metabolism (DR_0814, DR_1451, DR_1519), lipid metabolism (DR_1072, DR_1316, DR_A0143), etc. Among them, glucose-6-phosphate isomerase and proline dehydrogenase have been shown to play roles in protecting cells from oxidative stress in E . coli [ 43 , 44 ]....”
- “...kDa SS-A/Ro ribonucleoprotein 57 kDa 5 2 DR_1298 radical SAM superfamily 58 kDa 6 5 DR_1316 propionyl-CoA carboxylase 57 kDa 10 4 DR_1742 glucose-6-phosphate isomerase 60 kDa 3 2 #2 DR_0615 transcriptional regulator OxyR 35 kDa 3 1 DR_0814 proline dehydrogenase 35 kDa 6 2 DR_1072...”

pccB / Q5UWC0 propionyl-CoA carboxylase (EC 6.4.1.3) from Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809) (see paper)
34% identity, 70% coverage

BT1450 propionyl-CoA carboxylase beta chain from Bacteroides thetaiotaomicron VPI-5482
BT_RS07345 acyl-CoA carboxylase subunit beta from Bacteroides thetaiotaomicron VPI-5482
31% identity, 80% coverage

Iron Deficiency Modulates Metabolic Landscape of Bacteroidetes Promoting Its Resilience during Inflammation
Lewis, Microbiology spectrum 2023
- “...to 340 BT1448 to 49 Biotin/lipoyl-binding protein, acetyl-coa carboxylase biotin carboxylase subunit 5.1 2E-12 BT_RS07345 BT1450 Acyl-coa carboxylase subunit beta 4.2 0.353 BT_RS07405 BT1462 Hypothetical protein 2.5 0.57 BT_RS07435 BT1468 TolC family protein 3.1 0.222 to 0 BT_RS08345 to 50 BT1646 to 47 Glycosyltransferase family 2...”
Investigation and Alteration of Organic Acid Synthesis Pathways in the Mammalian Gut Symbiont Bacteroides thetaiotaomicron
Porter, Microbiology spectrum 2022
- “...9.760.19 2.260.11 4.640.15 0.140.03 8.820.53 BT1575 /4455-7 16.590.74 0.020.02 9.600.91 8.280.45 1.860.44 4.970.60 0.170.05 8.900.32 BT1450 16.480.70 0.010.00 9.170.39 8.270.72 1.780.17 5.230.60 0.120.02 8.030.33 BT1686-9 16.250.39 0.020.01 7.920.14* 9.310.62 2.080.31 ND* 0.120.02 15.000.27** BT1917 16.070.02 0.020.01 9.090.34 9.240.65 2.070.22 5.010.22 0.140.00** 8.100.31 BT2090-1 15.770.29 0.060.01 8.750.49...”
- “...S - forms of methylmalonyl-CoA and may also be necessary before decarboxylation. Two other genes, BT1450 and BT1917, are annotated as propionyl-CoA carboxylase beta chains (subunit of methylmalonyl-CoA decarboxylase, similar to BT1686), and are found within loci predicted to encode biotin-dependent carboxylases, similar to BT1686-9. We...”
Iron Deficiency Modulates Metabolic Landscape of Bacteroidetes Promoting Its Resilience during Inflammation
Lewis, Microbiology spectrum 2023
- “...BT_RS07335 to 340 BT1448 to 49 Biotin/lipoyl-binding protein, acetyl-coa carboxylase biotin carboxylase subunit 5.1 2E-12 BT_RS07345 BT1450 Acyl-coa carboxylase subunit beta 4.2 0.353 BT_RS07405 BT1462 Hypothetical protein 2.5 0.57 BT_RS07435 BT1468 TolC family protein 3.1 0.222 to 0 BT_RS08345 to 50 BT1646 to 47 Glycosyltransferase family...”

AO271_10895 acyl-CoA carboxylase subunit beta from Corynebacterium diphtheriae
31% identity, 91% coverage

Analysis of Corynebacterium diphtheriae macrophage interaction: Dispensability of corynomycolic acids for inhibition of phagolysosome maturation and identification of a new gene involved in synthesis of the corynomycolic acid layer
Ott, PloS one 2017
- “...CoA carboxylase beta chain 2 B178_02731 AO271_00180 AOT42_01535 DIP0740 accD2 Acyl-CoA carboxylase beta subunit B178_03126 AO271_10895 AOT42_01905 DIP0649 accBC Acyl-CoA carboxylase alpha subunit B178_03136 AO271_00235 AOT42_01480 DIP0787 accDA Acetyl-CoA carboxylase carboxyl transferase subunit B178_03318B178_03323 AO271_01375 AOT42_07885 DIP0657 accE Acetyl-CoA carboxylase subunit B178_02711 AO271_00195 AOT42_01520 DIP2188 -...”

AOT42_01905 acyl-CoA carboxylase subunit beta from Corynebacterium diphtheriae bv. gravis
31% identity, 91% coverage

Analysis of Corynebacterium diphtheriae macrophage interaction: Dispensability of corynomycolic acids for inhibition of phagolysosome maturation and identification of a new gene involved in synthesis of the corynomycolic acid layer
Ott, PloS one 2017
- “...carboxylase beta chain 2 B178_02731 AO271_00180 AOT42_01535 DIP0740 accD2 Acyl-CoA carboxylase beta subunit B178_03126 AO271_10895 AOT42_01905 DIP0649 accBC Acyl-CoA carboxylase alpha subunit B178_03136 AO271_00235 AOT42_01480 DIP0787 accDA Acetyl-CoA carboxylase carboxyl transferase subunit B178_03318B178_03323 AO271_01375 AOT42_07885 DIP0657 accE Acetyl-CoA carboxylase subunit B178_02711 AO271_00195 AOT42_01520 DIP2188 - Propionyl...”

I3242_09040 acyl-CoA carboxylase subunit beta from Bifidobacterium longum subsp. longum
30% identity, 87% coverage

Novel Insights into the Molecular Mechanisms Underlying Robustness and Stability in Probiotic Bifidobacteria
Schöpping, Applied and environmental microbiology 2023
- “...synthase (FAS, I3242_09035, log 2 [FC]: 3.3), the transcription of 2 genes encoding acetyl-CoA carboxylase (I3242_09040, I3242_09045, log 2 [FC]: 3.7, 4.6), and a gene coding for a biotin transporter BioY, were significantly upregulated. The latter was the most upregulated gene in BB-46 between the growth...”

DIP0740 methylmalonyl-CoA decarboxylase, alpha-subunit from Corynebacterium diphtheriae NCTC 13129
31% identity, 91% coverage

Corynebacterium diphtheriae Proteome Adaptation to Cell Culture Medium and Serum
Möller, Proteomes 2021
- “...This cluster includes 15 proteins (DIP1636, DIP1902, DIP1987, DIP1322, DIP1786, DIP0938, DIP2115, DIP2294, DIP2331, DIP1350, DIP0740, DIP2189, DIP1888, DIP2190, and DIP0446), three proteins (DIP0740, DIP2189, and DIP2190) are thought to be involved in mycolic acid synthesis [ 43 ] and a homologue of DIP1350 is essential...”
Analysis of Corynebacterium diphtheriae macrophage interaction: Dispensability of corynomycolic acids for inhibition of phagolysosome maturation and identification of a new gene involved in synthesis of the corynomycolic acid layer
Ott, PloS one 2017
- “...1 B178_02716 AO271_00190 AOT42_01525 DIP0660 pccB2 Propionyl CoA carboxylase beta chain 2 B178_02731 AO271_00180 AOT42_01535 DIP0740 accD2 Acyl-CoA carboxylase beta subunit B178_03126 AO271_10895 AOT42_01905 DIP0649 accBC Acyl-CoA carboxylase alpha subunit B178_03136 AO271_00235 AOT42_01480 DIP0787 accDA Acetyl-CoA carboxylase carboxyl transferase subunit B178_03318B178_03323 AO271_01375 AOT42_07885 DIP0657 accE Acetyl-CoA...”

BMEI0801 PROPIONYL-COA CARBOXYLASE BETA CHAIN from Brucella melitensis 16M
32% identity, 75% coverage

Completion of the genome sequence of Brucella abortus and comparison to the highly similar genomes of Brucella melitensis and Brucella suis
Halling, Journal of bacteriology 2005
- “...149 780 2,653 BR0404 BR0389-0391 BR0355 BR0221 BMEI0217-0218 BMEI0801 BMEI1554-1555 BMEI1742 BMEI1873 BMEI1659 BRA0173 BRA0541-0542 BRA0630-0636 I I I I I I I I...”
Comparative whole-genome hybridization reveals genomic islands in Brucella species
Rajashekara, Journal of bacteriology 2004
- “...regions Chromosome I BMEI0284 BMEI0728 BMEI0801 BMEI0899-900 BMEI0926 BMEI0929 BMEI0993-1012 BMEI1314 BMEI1435 BMEI1657 BMEI1661-1662 BMEI1674-1703 BMEI1747...”
- “...California, Berkeley Chromosome I BMEI0284 BMEI0801 BMEI0899-0900 BMEI0926 BMEI0929 BMEI0899-0907 BMEI0993-1012 BMEI1435 BMEI1657 BMEI1661-1662 BMEI1661-1662...”
The Brucella suis genome reveals fundamental similarities between animal and plant pathogens and symbionts
Paulsen, Proceedings of the National Academy of Sciences of the United States of America 2002
- “...family secretion protein OMP31-like outer membrane protein BMEI0801 BMEI0899 Outer membrane protein Phage integrase, DNA-binding protein, RepA, trbL, trbJ,...”

Dsui_0517 Propionyl-CoA carboxylase carboxyl transferase subunit (EC 6.4.1.3) from Dechlorosoma suillum PS
31% identity, 86% coverage

mutant phenotype: Specifically important for utilizing Sodium propionate. Automated validation from mutant phenotype: the predicted function (PROPIONYL-COA-CARBOXY-RXN) was linked to the condition via a MetaCyc pathway. This annotation was also checked manually.

Q9V0A4 Methylmalonyl-CoA decarboxylase, subunit alpha from Pyrococcus abyssi (strain GE5 / Orsay)
31% identity, 80% coverage

Bioinformatic analyses of integral membrane transport proteins encoded within the genome of the planctomycetes species, Rhodopirellula baltica.
Paparoditis, Biochimica et biophysica acta 2014
- “...proteins protein Q7UL75 1 3.B Decarboxylation-driven transporters 3.B.1 Na+-transporting Carboxylic Acid Decarboxylase (NaT-DC) Family 3.B.1.1.5 Q9V0A4 3 cation Na + Q7UHX0 2 3.D Oxidoreduction-driven Active Transporters 3.D.1 H+ or Na+-translocating NADH Dehydrogenase (NDH) Family 3.D.1.4.1 Q8U101 3 cations H + Q7UXC1 3 3.D.1.4.1 Q8U107 3 cations...”

NJ7G_1889 acyl-CoA carboxylase subunit beta from Natrinema sp. J7-2
32% identity, 73% coverage

The complete genome sequence of Natrinema sp. J7-2, a haloarchaeon capable of growth on synthetic media without amino acid supplements
Feng, PloS one 2012
- “...to succinyl-CoA via methylmalonyl-CoA (methylmalonate pathway): acetyl-CoA synthetase (EC: 6.2.1.1, NJ7G_1887), propionyl-CoA carboxylase (EC: 6.4.1.3, NJ7G_1889), methylmalonyl-CoA epimerase (EC: 5.1.99.1, NJ7G_1205), and methylmalonyl-CoA mutase (EC: 5.4.99.2 NJ7G_3672). Some haloarchaea, such as Halorubrum lacusprofundi [39] and Nmn. pharaonis [44] can grow on propionate as a sole carbon...”

Cthe_0699 carboxyl transferase from Clostridium thermocellum ATCC 27405
27% identity, 91% coverage

A blue native-PAGE analysis of membrane protein complexes in Clostridium thermocellum
Peng, BMC microbiology 2011
- “...26 58 1 3 Cthe_2253 125974738 ATP-dependent metalloprotease FtsH 66652.9 253 34 45 2 4 Cthe_0699 125713442 carboxyl transferase 56037.9 700 39 49 5 Cthe_1020 125973535 solute-binding protein 49976.2 164 28 45 6 Cthe_0016 125972541 Ferritin and Dps 18602.9 61 9 42 7 Cthe_0016 125972541 Ferritin...”
- “...17 26 14 Cthe_3148 125975626 ABC transporter related protein 70461.1 95 12 16 5 15 Cthe_0699 125973217 carboxyl transferase 56037.9 148 25 38 16 Cthe_1020 125973535 solute-binding protein 49976.2 486 33 48 17 Cthe_1557 125974066 ABC transporter related protein ATP-binding protein 30203.7 175 21 47 18...”
Genome-scale metabolic analysis of Clostridium thermocellum for bioethanol production
Roberts, BMC systems biology 2010
- “...A4YEK0 2.00E-85 6.2.1.5 succinate--CoA ligase Cthe_1907 amino acid adenylation domain A3P3B3 3.00E-40 6.4.1.2 acetyl-CoA carboxylase Cthe_0699 carboxyl transferase A0RY61 8.00E-169 6.3.4.14 biotin carboxylase Cthe_0949 carbamoyl-phosphate synthase, large subunit B2J980 0 4.1.3.38 aminodeoxychorismate lyase Cthe_0026 queuosine biosynthesis protein Q03L66 3.00E-54 3.1.3.1 alkaline phosphatase Cthe_2965 binding-protein-dependent transport systems...”

B5X54_RS07175 acyl-CoA carboxylase subunit beta from Caldicellulosiruptor bescii
31% identity, 79% coverage

Gene targets for engineering osmotolerance in Caldicellulosiruptor bescii
Sander, Biotechnology for biofuels 2020
- “...upstream of B5X54_RS06355 (the first gene in a putative fatty acid biosynthesis transcription unit) and B5X54_RS07175 (the first gene in a putative malonyl-CoA biosynthesis transcription unit). Direct and indirect regulatory actions of FapR and Cra in C. bescii In order to provide a more complete assessment...”
- “...1.8 1.7 B5X54_RS06390 Ribonuclease III 2.2 1.3 1.3 B5X54_RS06395 Radical SAM protein 2.3 1.3 1.5 B5X54_RS07175 Methylmalonyl-CoA carboxyl transferase 3.6 1.6 1.9 B5X54_RS07180 Hypothetical protein 3.6 1.8 2.2 B5X54_RS07185 Acetyl-CoA carboxylase biotin carboxyl carrier protein subunit 3.6 1.8 2.1 B5X54_RS07190 Oxaloacetate decarboxylase 3.7 1.7 2.0 Colors...”

AOV_02715 acyl-CoA carboxylase subunit beta from Anaplasma ovis str. Haibei
31% identity, 87% coverage

The Anaplasma ovis genome reveals a high proportion of pseudogenes
Liu, BMC genomics 2019
- “...2175 AOV_01970 infB 387 X AOV_02590 2502 AOV_01975 infB 702 X AOV_02035 pccB 2035 X AOV_02715 1533 AOV_02120 purA 195 X AOV_03080 1281 AOV_02180 purA 195 X AOV_02195 trxB2 228 X AOV_02205 1023 AOV_02200 trxB2 669 X AOV_02415 pepA 1158 X AOV_03525 1497 AOV_02440 pepA 540...”

AOT42_01535 acyl-CoA carboxylase subunit beta from Corynebacterium diphtheriae bv. gravis
33% identity, 75% coverage

Analysis of Corynebacterium diphtheriae macrophage interaction: Dispensability of corynomycolic acids for inhibition of phagolysosome maturation and identification of a new gene involved in synthesis of the corynomycolic acid layer
Ott, PloS one 2017
- “...chain 1 B178_02716 AO271_00190 AOT42_01525 DIP0660 pccB2 Propionyl CoA carboxylase beta chain 2 B178_02731 AO271_00180 AOT42_01535 DIP0740 accD2 Acyl-CoA carboxylase beta subunit B178_03126 AO271_10895 AOT42_01905 DIP0649 accBC Acyl-CoA carboxylase alpha subunit B178_03136 AO271_00235 AOT42_01480 DIP0787 accDA Acetyl-CoA carboxylase carboxyl transferase subunit B178_03318B178_03323 AO271_01375 AOT42_07885 DIP0657 accE...”

SMb20755 putative propionyl-CoA carboxylase beta chain protein from Sinorhizobium meliloti 1021
33% identity, 75% coverage

Role of the regulatory gene rirA in the transcriptional response of Sinorhizobium meliloti to iron limitation
Chao, Applied and environmental microbiology 2005
- “...SMb20072 SMb20099 SMb20127 SMb20203 SMb20545 SMb20600 SMb20755 SMb20757 SMb20924 SMb20946 SMb20949 SMb20959 SMb20960 SMb20993 SMb21285 SMb21337 SMb21432...”

BAB1_1210 Carboxyl transferase family:Acetyl-CoA carboxylase carboxyl transferase, beta subunit from Brucella melitensis biovar Abortus 2308
32% identity, 75% coverage

Genome sequence of Brucella abortus vaccine strain S19 compared to virulent strains yields candidate virulence genes
Crasta, PloS one 2008
- “...to assess its impact on the virulence, as B. abortus encodes two additional carboxyl transferases, BAB1_1210 (510 aa) and BAB1_2109 (AccD, 301 aa). It is not clear if the mutation in BAB1_0019 may be compensated for by the presence of two additional ACCase beta subunit genes....”

Rru_A0053 Carboxyl transferase from Rhodospirillum rubrum ATCC 11170
Q2RYD7 Carboxyl transferase from Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
31% identity, 76% coverage

The metabolic pathways of carbon assimilation and polyhydroxyalkanoate production by Rhodospirillum rubrum in response to different atmospheric fermentation
Tang, PloS one 2024
- “...carboxylase 0.015 1.137 ND ND methylmalonyl-CoA (MMC) pathway Rru_A0052 Biotin carboxylase ND ND 1.18E-90 2.350 Rru_A0053 Carboxyl transferase ND ND 2.41E-83 2.305 Rru_A2318 2-methylcitrate dehydratase 1.72E-49 5.708 4.62E-28 3.536 Rru_A2320 Phosphoenolpyruvate phosphomutase 6.41E-28 4.305 6.84E-11 1.857 Rru_A2319 2-methylcitrate synthase/Citrate synthase 4.49E-15 5.863 8.30E-11 2.855 ethylmalony-CoA (EMC)...”
Study of the Production of Poly(Hydroxybutyrate-co-Hydroxyhexanoate) and Poly(Hydroxybutyrate-co-Hydroxyvalerate-co-Hydroxyhexanoate) in Rhodospirillum rubrum
Cabecas, Applied and environmental microbiology 2022 (secret)
Effects of Mixing Volatile Fatty Acids as Carbon Sources on Rhodospirillum rubrum Carbon Metabolism and Redox Balance Mechanisms
Cabecas, Microorganisms 2021
- “...3 ), confirming the previous reports [ 18 ]. This pathway requires five enzymes (Rru_A0052, Rru_A0053, Rru_A1572, Rru_A2480, Rru_A1927), among which three were significantly more abundant in propionate conditions than in butyrate conditions: the biotin carboxylase (Rru_A0052, fold change: 0.63), the methylmalonyl-CoA mutase (Rru_A2480, fold change:...”
- “...pathway tr|Q2RYD8 Rru_A0052 0.63 3.41 10 2 1.81 9.50 10 3 5 Biotin carboxylase tr|Q2RYD7 Rru_A0053 0.83 8.70 10 2 1.81 4.95 10 2 6 Carboxyl transferase tr|Q2RU23 Rru_A1572 1.30 3.49 10 1 1.67 1.00 10 2 5 Methylmalonyl-CoA epimerase tr|Q2RRG6 Rru_A2479 0.72 8.21 10 2...”
New perspectives on butyrate assimilation in Rhodospirillum rubrum S1H under photoheterotrophic conditions
De, BMC microbiology 2020
- “...Rru_A0052 Biotin carboxylase 1.2 7e-02 6 0.8 3e-05 0.9 4e-02 1.0 1e-01 1.1 1e-02 6 Rru_A0053 Carboxyl transferase 1.2 8e-03 6 0.8 8e-05 0.9 2e-02 1.0 1e-01 1.1 9e-03 6 Rru_A2479 Methylmalonyl-CoA mutase 1.3 2e-02 5 1.0 8e-01 1.2 1e-01 1.5 3e-01 0.7 6e-01 6 Rru_A1927...”
- “...3.11 1e-05 Rru_A1200 b Malyl-CoA thioesterase n.a. n.a. n.a. Rru_A0052 Biotin carboxylase 0.03 1.83 2e-05 Rru_A0053 Carboxyl transferase 0.09 1.77 2e-04 Rru_A2479 Methylmalonyl-CoA mutase 0.12 0.53 1e-02 Rru_A1927 Acetyl-CoA hydrolase 0.01 0.1 3e-01 Rru_A2129 Fumarate hydratase class II 0.15 0.03 1e-01 Rru_A2206 Fumarate hydratase class I...”
Photoheterotrophic Assimilation of Valerate and Associated Polyhydroxyalkanoate Production by Rhodospirillum rubrum
Bayon-Vicente, Applied and environmental microbiology 2020 (secret)
Genetic Plasticity and Ethylmalonyl Coenzyme A Pathway during Acetate Assimilation in Rhodospirillum rubrum S1H under Photoheterotrophic Conditions
De, Applied and environmental microbiology 2018
- “...Rru_A3064 Rru_A1201 Rru_A0217 Rru_A1200b Rru_A0052 Rru_A0053 Rru_A2479 Locus Ethylmalonyl-CoA pathway Rru_A1927 Rru_A2964 Rru_A3063 Rru_A1572a Phaeobacter...”
- “...Q2RRG6 Rru_A3062 Rru_A3064 Rru_A1201 Rru_A0217 Rru_A1200 Rru_A0052 Rru_A0053 Rru_A2479 1.4e3 3.4e4 2.1e4 3.3e4 5.1e4 1.2e6 4.4e6 3.4e1 7.89 6.37 1.34 0.68...”
Genetic Plasticity and Ethylmalonyl Coenzyme A Pathway during Acetate Assimilation in Rhodospirillum rubrum S1H under Photoheterotrophic Conditions
De, Applied and environmental microbiology 2018
- “...3 Q2RPT8 Q2RPT6 Q2RV43 Q2RXX3 Q2RV44 Q2RYD8 Q2RYD7 Q2RRG6 Rru_A3062 Rru_A3064 Rru_A1201 Rru_A0217 Rru_A1200 Rru_A0052 Rru_A0053 Rru_A2479 1.4e3 3.4e4 2.1e4...”

BLJAPNOD_06208 acyl-CoA carboxylase subunit beta from Ensifer sp. M14
32% identity, 75% coverage

Genomic and Biotechnological Characterization of the Heavy-Metal Resistant, Arsenic-Oxidizing Bacterium Ensifer sp. M14
diCenzo, Genes 2018
- “..., BLJAPNOD_04938 ), a putative 3-oxopropanoate oxidoreductase ( BLJAPNOD_03990 ), putative propanoyl-CoA carboxylases ( BLJAPNOD_06206, BLJAPNOD_06208 ), a putative pyruvate carboxylase ( BLJAPNOD_00700 ), and a phosphoenolpyruvate carboxylase ( BLJAPNOD_01050 ). 3.4.4. Iron Transport and Metabolism Due to the involvement of iron in arsenic oxidation, the...”

TON_0041 methylmalonyl-CoA decarboxylase, alpha subunit from Thermococcus onnurineus NA1
30% identity, 91% coverage

Proteome analyses of hydrogen-producing hyperthermophilic archaeon Thermococcus onnurineus NA1 in different one-carbon substrate culture conditions
Moon, Molecular & cellular proteomics : MCP 2012
- “...TON_0904 TON_1234 TON_1480 TON_1481 TON_1482 TON_1665 TON_0041 TON_0327 TON_1074 TON_1076 TON_1097 TON_1110 TON_0061 TON_0157 TON_0162 TON_0231 TON_0327...”
- “...pathway, including a propionyl-CoA carboxylase (TON_0041), a methylmalonyl-CoA epimerase (TON_1074), and a methylmalonyl-CoA mutase (methylmalonyl-CoA mutase...”

BIF_01198 acyl-CoA carboxylase subunit beta from Bifidobacterium animalis subsp. lactis BB-12
29% identity, 88% coverage

Novel Insights into the Molecular Mechanisms Underlying Robustness and Stability in Probiotic Bifidobacteria
Schöpping, Applied and environmental microbiology 2023
- “...(I3242_09050, log 2 [FC]: 7.4). In BB-12, the expression of the corresponding orthologous genes (BIF_00783, BIF_01198 BIF_01200) was instead slightly downregulated in the stationary phase, while being among the most expressed genes in the exponential phase. Moreover, the transcription of all 4 genes possibly encoding for...”

AO271_00180 acyl-CoA carboxylase subunit beta from Corynebacterium diphtheriae
32% identity, 75% coverage

Analysis of Corynebacterium diphtheriae macrophage interaction: Dispensability of corynomycolic acids for inhibition of phagolysosome maturation and identification of a new gene involved in synthesis of the corynomycolic acid layer
Ott, PloS one 2017
- “...beta chain 1 B178_02716 AO271_00190 AOT42_01525 DIP0660 pccB2 Propionyl CoA carboxylase beta chain 2 B178_02731 AO271_00180 AOT42_01535 DIP0740 accD2 Acyl-CoA carboxylase beta subunit B178_03126 AO271_10895 AOT42_01905 DIP0649 accBC Acyl-CoA carboxylase alpha subunit B178_03136 AO271_00235 AOT42_01480 DIP0787 accDA Acetyl-CoA carboxylase carboxyl transferase subunit B178_03318B178_03323 AO271_01375 AOT42_07885 DIP0657...”

DIP0660 propionyl-CoA carboxylase beta chain 2 from Corynebacterium diphtheriae NCTC 13129
32% identity, 75% coverage

Analysis of Corynebacterium diphtheriae macrophage interaction: Dispensability of corynomycolic acids for inhibition of phagolysosome maturation and identification of a new gene involved in synthesis of the corynomycolic acid layer
Ott, PloS one 2017
- “...Function DSM43988 DSM43989 DSM44123 DIP0658 accD1/pccB1 Propionyl CoA carboxylase beta chain 1 B178_02716 AO271_00190 AOT42_01525 DIP0660 pccB2 Propionyl CoA carboxylase beta chain 2 B178_02731 AO271_00180 AOT42_01535 DIP0740 accD2 Acyl-CoA carboxylase beta subunit B178_03126 AO271_10895 AOT42_01905 DIP0649 accBC Acyl-CoA carboxylase alpha subunit B178_03136 AO271_00235 AOT42_01480 DIP0787 accDA...”

MB901379_01152 acyl-CoA carboxylase subunit beta from Mycobacterium basiliense
30% identity, 86% coverage

Discovery and Characterization of Mycobacterium basiliense sp. nov., a Nontuberculous Mycobacterium Isolated From Human Lungs
Seth-Smith, Frontiers in microbiology 2018
- “...within repetitive NRPS genes, which were attributed to imperfect mapping. These SNPs are located in MB901379_01152 (synonymous) and the regulator MB901379_01152 , causing A174G, in isolates 902333-16 and 903442-16. Isolate 902167-17 has two non-synonymous SNPs, causing V555G in putative ribonuclease MB901379_01783, and elimination of the STOP...”

PCCB_SACEN / P53003 Propionyl-CoA carboxylase beta chain; PCCase; Propanoyl-CoA:carbon dioxide ligase; EC 6.4.1.3 from Saccharopolyspora erythraea (strain ATCC 11635 / DSM 40517 / JCM 4748 / NBRC 13426 / NCIMB 8594 / NRRL 2338) (see paper)
SACE_3398 propionyl-CoA carboxylase beta from Saccharopolyspora erythraea NRRL 2338
30% identity, 92% coverage

catalytic activity: propanoyl-CoA + hydrogencarbonate + ATP = (S)-methylmalonyl- CoA + ADP + phosphate + H(+) (RHEA:23720)
subunit: Probably a dodecamer composed of six biotin-containing alpha subunits and six beta subunits.
disruption phenotype: Mutant lacks PCCase activity. Mutation has no effect on erythromycin production.
Engineering of a TetR family transcriptional regulator BkdR enhances heterologous spinosad production in Streptomyces albus B4 chassis
Wang, Applied and environmental microbiology 2024 (secret)
A novel multidomain acyl-CoA carboxylase in Saccharopolyspora erythraea provides malonyl-CoA for de novo fatty acid biosynthesis
Livieri, Scientific reports 2019
- “...actinobacteria 15 and CT domains of acyl-CoA carboxylases from archaea 5 . In this group, SACE_3398 clusters with non-essential CT subunits from PCC complexes of other actinobacteria. In addition, earlier studies of acyl-CoA carboxylases in S. erythraea have demonstrated that SACE_3398 is part of a non-essential...”
- “...SACE_4237 also supplies methylmalonyl-CoA for erythromycin biosynthesis under the condition tested. In previous studies, a sace_3398 deficient mutant showed reduced PCC activity, but the mutation did not have detrimental effects on erythromycin production 17 . The overlapping activities of two PCC complexes make it difficult to...”
PccD Regulates Branched-Chain Amino Acid Degradation and Exerts a Negative Effect on Erythromycin Production in Saccharopolyspora erythraea
Xu, Applied and environmental microbiology 2018
- “...regulator of propionyl-CoA carboxylase (encoded by pccBCA, SACE_3398 -3400) in erythromycinproducing S. erythraea (29). In this study, we found that the...”
- “...was obtained from the protected sequence of pccBC (SACE_3398 -3399) and April 2018 Volume 84 Issue 8 e00049-18 aem.asm.org 2 Branched-Chain Amino Acid...”
TetR Family Transcriptional Regulator PccD Negatively Controls Propionyl Coenzyme A Assimilation in Saccharopolyspora erythraea
Xu, Journal of bacteriology 2017
- “...investigated (Fig. S2). We found that gene pccB (SACE_3398) 121 was cotranscribed with the pccC (SACE_3399) (form an operon: pccBC), and wasn't 122...”
- “...I footprinting assay 442 The promoter region of pccB (SACE_3398) was amplified by PCR with primers 443 pMD18T-3398F/R (Table S1), and the amplicon was cloned...”

PCCB_HALMT / I3R7F1 Propionyl-CoA carboxylase, carboxyltransferase subunit; PCC; EC 6.4.1.3 from Haloferax mediterranei (strain ATCC 33500 / DSM 1411 / JCM 8866 / NBRC 14739 / NCIMB 2177 / R-4) (Halobacterium mediterranei) (see paper)
I3R7F1 propionyl-CoA carboxylase (subunit 2/3) (EC 6.4.1.3) from Haloferax mediterranei (see paper)
28% identity, 95% coverage

function: Part of the propionyl coenzyme A carboxylase (PCC) complex involved in propionate utilization and in the production of the poly(3- hydroxybutyrate-co-3-hydroxyvalerate)(PHBV), which is a water-insoluble biopolymer used as intracellular energy reserve material when cells grow under conditions of nutrient limitation. The complex catalyzes the carboxylation of propionyl-CoA to methylmalonyl-CoA. PCC is also able to catalyze the carboxylation of acetyl-CoA.
catalytic activity: propanoyl-CoA + hydrogencarbonate + ATP = (S)-methylmalonyl- CoA + ADP + phosphate + H(+) (RHEA:23720)
subunit: The propionyl coenzyme A carboxylase (PCC) complex is composed of three subunits: PccA (biotin carboxylase and biotin-carboxyl carrier), PccB (carboxyltransferase) and PccX.
disruption phenotype: Cells lacking pccB and pccX genes accumulate a high level of propionyl-CoA, which would then inhibit CoA-dependent enzymes such as succinyl-CoA synthetase and could partially inhibit the TCA cycle. Also affected in growth and glucose utilization. Cells are unable to produce PHBV and show morphological abnormalitiess such as a decrease of PHBV granules.

PCCB_PIG / P79384 Propionyl-CoA carboxylase beta chain, mitochondrial; PCCase subunit beta; Propanoyl-CoA:carbon dioxide ligase subunit beta; EC 6.4.1.3 from Sus scrofa (Pig) (see paper)
30% identity, 90% coverage

function: This is one of the 2 subunits of the biotin-dependent propionyl-CoA carboxylase (PCC), a mitochondrial enzyme involved in the catabolism of odd chain fatty acids, branched-chain amino acids isoleucine, threonine, methionine, and valine and other metabolites (PubMed:13752080). Propionyl-CoA carboxylase catalyzes the carboxylation of propionyl-CoA/propanoyl-CoA to D-methylmalonyl- CoA/(S)-methylmalonyl-CoA (PubMed:13752080). Within the holoenzyme, the alpha subunit catalyzes the ATP-dependent carboxylation of the biotin carried by the biotin carboxyl carrier (BCC) domain, while the beta subunit then transfers the carboxyl group from carboxylated biotin to propionyl-CoA (By similarity). Propionyl-CoA carboxylase also significantly acts on butyryl-CoA/butanoyl-CoA, which is converted to ethylmalonyl-CoA/(2S)-ethylmalonyl-CoA at a much lower rate (PubMed:13752080). Other alternative minor substrates include (2E)- butenoyl-CoA/crotonoyl-CoA (PubMed:13752080).
catalytic activity: propanoyl-CoA + hydrogencarbonate + ATP = (S)-methylmalonyl- CoA + ADP + phosphate + H(+) (RHEA:23720)
catalytic activity: butanoyl-CoA + hydrogencarbonate + ATP = (2S)-ethylmalonyl-CoA + ADP + phosphate + H(+) (RHEA:59520)
subunit: The holoenzyme is a dodecamer composed of 6 PCCA/alpha subunits and 6 PCCB/beta subunits.
Label-Free Quantitative Analysis of Pig Liver Proteome after Hepatitis E Virus Infection
Martino, Viruses 2024
- “...non-erythrocytic 1 17 65.06 0.0000 2.68 P33198 IDH2 isocitrate dehydrogenase, mitochondrial 16 66.34 0.0113 1.53 P79384 PCCB propionyl-CoA carboxylase beta chain, mitochondrial precursor 16 70.50 0.0173 1.63 A0A8D1EFW2 AGXT2 alanine-glyoxylate aminotransferase 2, mitochondrial 16 87.66 0.0012 1.98 D0G0B3 ACAA2 3-ketoacyl-CoA thiolase, mitochondrial 16 99.47 0.0057 2.21...”
An Aberrant Phosphorylation of Amyloid Precursor Protein Tyrosine Regulates Its Trafficking and the Binding to the Clathrin Endocytic Complex in Neural Stem Cells of Alzheimer's Disease Patients
Poulsen, Frontiers in molecular neuroscience 2017
- “...463 165 605 99 A0A0B8S032 Phosphoinositide-3-kinase, regulatory subunit 1 (Alpha) 83.57 913 517 1,459 364 P79384 Propionyl-CoA carboxylase beta chain, mitochondrial 58.59 169 52 F1RFF5 Protein NipSnap homolog 1 * 33.152 1,564 1,207 3,048 2,018 1,523 255 2,885 713 I3LCF3 Protein numb homolog * 70.97 471...”
Reproducible ion-current-based approach for 24-plex comparison of the tissue proteomes of hibernating versus normal myocardium in swine models
Qu, Journal of proteome research 2014
- “...Rieske-likeprotein1 0.78 Fatty Acid Metabolism, Mitochondrial CPT1B Q92523 carnitine O -palmitoyltransferase1, muscle isoform 0.71 PCCB P79384 propionyl-CoAcarboxylasebetachain 0.76 ACADL P79274 long-chainspecificacyl-CoAdehydrogenase 0.75 ACADS P79273 short-chainspecificacyl-CoAdehydrogenase 0.76 ACADV P49748 verylong-chainspecificacyl-CoA dehydrogenase 0.79 Amino Acid Catabolism, Mitochondrial IVD P26440 isovaleryl-CoAdehydrogenase 0.55 MMSA Q02252 methylmalonate-semialdehyde dehydrogenase [acylating] 0.61 Out...”

F1L4Y2 Propionyl-CoA carboxylase beta chain, mitochondrial (Fragment) from Ascaris suum
32% identity, 76% coverage

Characterisation of potential novel allergens in the fish parasite Anisakis simplex
Fæste, EuPA open proteomics 2014
- “...dehydrogenase /PF00070 & PF02852 F1L686 7 263 22 ( Asc s ) Propionyl-CoA carboxylase /PF01039 F1L4Y2 6 255 14 ( Asc s ) UTP-G-1-P-uridylyltransferase /PF01704 F1KYX7 9 240 21 ( Asc s ) Fumarase /PF00206 & PF10415 E1FRT7 6 228 21 ( Lol l ) Cytosolic...”

Ngar_c01870 acyl-CoA carboxylase subunit beta from Candidatus Nitrososphaera gargensis Ga9.2
29% identity, 89% coverage

The Thaumarchaeon N. gargensis carries functional bioABD genes and has a promiscuous E. coli ΔbioH-complementing esterase EstN1
Chow, Scientific reports 2018
- “...could complete this possible biosynthesis pathway. N . gargensis has two putative adjacent acetyl-CoA/propionyl-CoA carboxylases (Ngar_c01870 and Ngar_c01880) that could convert acetyl-CoA into malonyl-CoA for the initiation of biotin synthesis. According to KEGG, N . gargensis might even encode a solitary 3-ketoacyl-ACP-reductase FabG (Ngar_c11430). Experimental verification...”

8xl3B / P05166 Structure of human propionyl-coa carboxylase at apo-state (pcc-apo)
29% identity, 90% coverage

Ligand: biotin (8xl3B)

PCCB / P05166 propionyl-CoA carboxylase β chain, mitochondrial (EC 6.4.1.3) from Homo sapiens (see 4 papers)
PCCB_HUMAN / P05166 Propionyl-CoA carboxylase beta chain, mitochondrial; PCCase subunit beta; Propanoyl-CoA:carbon dioxide ligase subunit beta; EC 6.4.1.3 from Homo sapiens (Human) (see 11 papers)
P05166 propionyl-CoA carboxylase (subunit 2/2) (EC 6.4.1.3) from Homo sapiens (see paper)
NP_000523 propionyl-CoA carboxylase beta chain, mitochondrial isoform 1 precursor from Homo sapiens
29% identity, 90% coverage

function: This is one of the 2 subunits of the biotin-dependent propionyl-CoA carboxylase (PCC), a mitochondrial enzyme involved in the catabolism of odd chain fatty acids, branched-chain amino acids isoleucine, threonine, methionine, and valine and other metabolites (PubMed:15890657, PubMed:6765947). Propionyl-CoA carboxylase catalyzes the carboxylation of propionyl-CoA/propanoyl-CoA to D-methylmalonyl- CoA/(S)-methylmalonyl-CoA (PubMed:15890657, PubMed:6765947). Within the holoenzyme, the alpha subunit catalyzes the ATP-dependent carboxylation of the biotin carried by the biotin carboxyl carrier (BCC) domain, while the beta subunit then transfers the carboxyl group from carboxylated biotin to propionyl-CoA (By similarity). Propionyl-CoA carboxylase also significantly acts on butyryl-CoA/butanoyl-CoA, which is converted to ethylmalonyl-CoA/(2S)-ethylmalonyl-CoA at a much lower rate (PubMed:6765947). Other alternative minor substrates include (2E)- butenoyl-CoA/crotonoyl-CoA (By similarity).
catalytic activity: propanoyl-CoA + hydrogencarbonate + ATP = (S)-methylmalonyl- CoA + ADP + phosphate + H(+) (RHEA:23720)
catalytic activity: butanoyl-CoA + hydrogencarbonate + ATP = (2S)-ethylmalonyl-CoA + ADP + phosphate + H(+) (RHEA:59520)
subunit: The holoenzyme is a dodecamer composed of 6 PCCA/alpha subunits and 6 PCCB/beta subunits.
Novel compound heterozygous variants in the PCCB gene causing adult-onset propionic acidemia presenting with neuropsychiatric symptoms: a case report and literature review
Li, BMC medical genomics 2022
- “...data). The entire structure of the PCC enzyme was demonstrated according to the protein sequence (NP_000523) by SWISS-MODEL ( https://swissmodel.expasy.org/ ). The polar interactions between the mutation points and surrounding amino acids changed drastically with the specified mutations (Fig. 2 B). Additionally, the residue p.I156T site...”
An Exploratory Application of Multilayer Networks and Pathway Analysis in Pharmacogenomics.
Milano, Genes 2023
- “...by Rho GTPases, Miro GTPases, and RHOBTB3; Signalling by Rho GTPases; RHO GTPase cycle PCCB P05166 Metabolism of vitamins and cofactors; Biotin transport and metabolism FOLR1 P15328 Metabolism of proteins; Post-translational protein modification; Vesicle-mediated transport; Membrane trafficking; Asparagine N-linked glycosylation; Transport to the golgi and subsequent...”
Targeted Proteins Reveal Cathepsin D as a Novel Biomarker in Differentiating Hepatocellular Carcinoma from Cirrhosis and Other Liver Cancers.
Chuaypen, Asian Pacific journal of cancer prevention : APJCP 2022
- “...were significantly increased in tumor tissues P35232 Prohibitin 258.3 30.88 29.8 8.86971.2782 14.70002.1800 1.6573 0.0498 P05166 Propionyl-CoA carboxylase beta chain, mitochondrial 157.84 26.53 58.2 5.57601.5207 23.65671.4333 4.2426 0.0255 P07237 Protein disulfide-isomerase 135.02 15.35 57.1 14.48672.1006 20.51330.9333 1.416 0.0375 P13667 Protein disulfide-isomerase A4 385.57 19.84 72.9 3.80700.6932...”
Radiobiological effects of wound fluid on breast cancer cell lines and human-derived tumor spheroids in 2D and microfluidic culture.
Jeibouei, Scientific reports 2022
- “...% P-value Genes hsa01200:Carbon metabolism 11 14.10256 8.49E09 Q6NVY1, P08559, P36957, O75874, P40925, Q02252, P11766, P05166, P50213, Q96I99, Q9P2R7 hsa00020:Citrate cycle (TCA cycle) 7 8.974359 7.17E08 P08559, P36957, O75874, P40925, P50213, Q96I99, Q9P2R7 hsa00071:Fatty acid degradation 8 10.25641 2.05E08 P42765, Q16836, P49189, P00325, P11766, P55084, P49419,...”
- “...hsa00280:Valine, leucine and isoleucine degradation 8 10.25641 4.64E08 P42765, Q16836, Q6NVY1, P49189, Q02252, P55084, P49419, P05166 hsa00380:Tryptophan metabolism 3 3.846154 0.036413 Q16836, P49189, P49419 hsa00410:beta-Alanine metabolism 5 6.410256 7.86E05 Q6NVY1, Q96KP4, P49189, Q02252, P49419 hsa00330:Arginine and proline metabolism 4 5.128205 0.006218 Q96KP4, P49189, P12277, P49419 hsa00340:Histidine...”
SARS-CoV-2 infection in a patient with propionic acidemia.
Caciotti, Orphanet journal of rare diseases 2020
- “...by mutations in the PCCA and PCCB genes, encoding alpha and beta subunits (UniProtKBP05165 and P05166) of the mitochondrial enzyme propionyl-CoA carboxylase (PCC, EC 6.4.1.3) [ 1 ]. Biochemical characteristics include metabolic acidosis, ketosis, hyperammonaemia, altered glycemia, neutropenia, anemia and thrombocytopenia [ 1 ]. PA is...”
LANA and hnRNP A1 Regulate the Translation of LANA mRNA through G-Quadruplexes.
Dabral, Journal of virology 2020
The Fatty Acid β-Oxidation Pathway is Activated by Leucine Deprivation in HepG2 Cells: A Comparative Proteomics Study
Yan, Scientific reports 2017
- “...7.806*|- 7.806 Q93088 Betainehomocysteine S-methyltransferase 1 BHMT 7.652*|- 7.652 P52758 Ribonuclease UK114 HRSP12 6.583*|- 6.583 P05166 Propionyl-CoA carboxylase beta chain, mitochondrial PCCB 6.541*|- 6.541 B3VL17 Beta globin (Fragment) HBB 6.408*|- 6.408 Q3KPF3 Cytochrome P450, family 2, subfamily D, polypeptide 6 CYP2D6 6.326*|- 6.326 P00326 Alcohol dehydrogenase...”
- “...Q93088 Betainehomocysteine S-methyltransferase 1 BHMT 7.652* Gly, Ser and Thr metabolism; Cys and Met metabolism P05166 Propionyl-CoA carboxylase beta chain, mitochondrial PCCB 6.541* Val, Leu and Ile degradation Q9UI17 Dimethylglycine dehydrogenase, mitochondrial DMGDH 5.834* Gly, Ser and Thr metabolism P30038 Delta-1-pyrroline-5-carboxylate dehydrogenase, mitochondrial ALDH4A1 5.152* Arg...”
Combining patient proteomics and in vitro cardiomyocyte phenotype testing to identify potential mediators of heart failure with preserved ejection fraction
Raphael, Journal of translational medicine 2016
- “...Q5T1V6 Probable ATP-dependent RNA helicase DDX59 AL1A3 P47895 Aldehyde dehydrogenase family 1 member A3 PCCB P05166 Propionyl-CoA carboxylase beta chain, mitochondrial HNRCL O60812 Heterogeneous nuclear ribonucleoprotein C-like 1 BIRC3 Q13489 Baculoviral IAP repeat-containing protein 3 NDUF4 Q9P032 NADH dehydrogenase 1 alpha subcomplex assembly factor 4 MIRO2...”
The Concise Guide to PHARMACOLOGY 2015/16: Enzymes.
Alexander, British journal of pharmacology 2015
- “...Common abreviation PCCA, PCCB GGCX HGNC, UniProt PCCA , P05165 GGCX , P38435 PCCB , P05166 Subunits PropionylCoA carboxylase subunit PropionylCoA carboxylase subunit EC number 6.4.1.3 4.1.1.90 Endogenous substrates propionylCoA , ATP glutamyl peptides Products adenosine diphosphate , methylmalonylCoA , P i carboxyglutamyl peptides Cofactors biotin...”
More

SCO5535 carboxyl transferase from Streptomyces coelicolor A3(2)
29% identity, 86% coverage

σ^E of Streptomyces coelicolor can function both as a direct activator or repressor of transcription
Pospíšil, Communications biology 2024
- “...the promoter. From Group B (HrdB-dependent, Fig. 5 ), we tested SCO1595- pheS , SCO5393, SCO5535- accB , and SCO4921- accA2 as genes likely positively regulated by HrdB. Here, the selection was made based on the presence of predicted HrdB binding sequences upstream of the genes....”
- “...that are predicted to be regulated by HrdB instead of E (SCO1595- pheS , SCO5393, SCO5535- accB , and SCO4921- accA2 ). The Figure description is the same as in Fig. 4 . The blue rectangles show the -10 region of HrdB-dependent promoters (if identified in...”
Functional connexion of bacterioferritin in antibiotic production and morphological differentiation in Streptomyces coelicolor
García-Martín, Microbial cell factories 2024
- “...DagB (SCO3487), a chitosanase [ 144 ] and an agarase [ 145 ], respectively. AccB (SCO5535), an essential component from acetyl-CoA carboxylase that produces malonyl-CoA for fatty acids biosynthesis [ 146 ], was less abundant in bfr (Additional File S12 A). FabH (SCO2388), a -ketoacyl ACP...”
Heterologous overproduction of oviedomycin by refactoring biosynthetic gene cluster and metabolic engineering of host strain Streptomyces coelicolor
Gu, Microbial cell factories 2023
- “...encoded by SCO4366), methylenetetrahydrofolate dehydrogenase (MTHFD; encoded by SCO4824), and acetyl-CoA carboxylase (ACCOAC; encoded by SCO5535) (Fig. 3 a). These reactions are directly involved in the production of malonyl-CoA or NADPH, both of which are necessary for oviedomycin production. We also made efforts to predict genes...”
Coelimycin Synthesis Activatory Proteins Are Key Regulators of Specialized Metabolism and Precursor Flux in Streptomyces coelicolor A3(2)
Bednarz, Frontiers in microbiology 2021
- “...et al., 2001 ). We have found that ACCase subunit(s) AccA2 and/or AccA1, subunits AccB (SCO5535) and CpkK (SCO6284), and a small accessory protein AccE (SCO5536), were more abundant in cpkN along with biotin biosynthesis proteins BioA (SCO1245), BioB (SCO1244), and BioD (SCO1246). cpkO strain presented...”
De novo biosynthesis of myricetin, kaempferol and quercetin in Streptomyces albus and Streptomyces coelicolor
Marín, PloS one 2018
- “...subunit of acetyl-CoA carboxylase, SCO4921 gene) and accBE (beta and epsilon subunits of acetyl-CoA carboxylase, SCO5535 and SCO5536 genes respectively) [ 49 51 ]. These plasmids were amplified by PCR from S . coelicolor chromosomal DNA, using the following primers, which contain sequences for restriction enzymes...”
Crp is a global regulator of antibiotic production in streptomyces
Gao, mBio 2012
- “..., and SCO5222 ) and primary metabolism ( SCO2776 , SCO4921 , SCO5144 , and SCO5535 ). All displayed at least a 2-fold change in their transcriptional levels following Crp induction. Asterisks indicate changes in expression that are statistically significant ( P value, <0.05) based on...”
Metabolic switches and adaptations deduced from the proteomes of Streptomyces coelicolor wild type and phoP mutant grown in batch culture
Thomas, Molecular & cellular proteomics : MCP 2012
- “...Act (42, 43). SCO6271 (AccA1), SCO4921 (AccA2), and SCO5535 (AccB) encode subunits of an acetyl-CoA carboxylase (44). SCO4921 and SCO6271 have identical amino...”
- “...to distinguish between the products of these two genes. SCO5535 and SCO6271/4921 gene products were most abundant early on in growth consistent with their role...”
An orphan histidine kinase, OhkA, regulates both secondary metabolism and morphological differentiation in Streptomyces coelicolor
Lu, Journal of bacteriology 2011
- “...of a gene complex including accA2 (SCO4921), accB (SCO5535), and accE (SCO5536), which encodes the multienzyme complex acetyl coenzyme A (acetylCoA) carboxylase...”
More

ACCD5_MYCTU / P9WQH7 Biotin-dependent acetyl-/propionyl-coenzyme A carboxylase beta5 subunit; Acetyl-CoA carboxylase; ACC; Propionyl-CoA carboxylase; PCC; EC 2.1.3.15; EC 2.1.3.- from Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv) (see 6 papers)
Rv3280 PROBABLE PROPIONYL-CoA CARBOXYLASE BETA CHAIN 5 ACCD5 (PCCASE) (PROPANOYL-COA:CARBON DIOXIDE LIGASE) from Mycobacterium tuberculosis H37Rv
NP_217797 propionyl-CoA carboxylase subunit beta from Mycobacterium tuberculosis H37Rv
30% identity, 87% coverage

function: Component of a biotin-dependent acyl-CoA carboxylase complex. This subunit transfers the CO2 from carboxybiotin to the CoA ester substrate (PubMed:16354663, PubMed:16385038, PubMed:28222482). When associated with the alpha3 subunit AccA3, is involved in the carboxylation of acetyl-CoA and propionyl-CoA, with a preference for propionyl-CoA (PubMed:16354663, PubMed:16385038, PubMed:28222482). Is also required for the activity of the long-chain acyl-CoA carboxylase (LCC) complex (PubMed:28222482).
catalytic activity: N(6)-carboxybiotinyl-L-lysyl-[protein] + acetyl-CoA = N(6)- biotinyl-L-lysyl-[protein] + malonyl-CoA (RHEA:54728)
catalytic activity: N(6)-carboxybiotinyl-L-lysyl-[protein] + propanoyl-CoA = methylmalonyl-CoA + N(6)-biotinyl-L-lysyl-[protein] (RHEA:66612)
subunit: Forms homohexamers (PubMed:16492739, PubMed:17157300). The biotin-dependent acyl-CoA carboxylase complex is composed of AccA3, which contains the biotin carboxylase (BC) and biotin carboxyl carrier protein (BCCP) domains, and AccD5, which contains the carboxyl transferase (CT) domain (PubMed:16354663, PubMed:16385038). The AccA3/AccD5 complex forms a dodecamer, and can associate with the epsilon subunit AccE5 (Rv3280), which stimulates carboxylation by the complex (PubMed:16354663, PubMed:16385038). Is also part of the long- chain acyl-CoA carboxylase (LCC) complex, which is composed of AccA3, AccD4, AccD5 and AccE5. The four subunits are essential for activity, but AccD5, together with AccE5, probably plays a structural role rather than a catalytic one (PubMed:28222482).
Polyphosphate kinase-1 regulates bacterial and host metabolic pathways involved in pathogenesis of Mycobacterium tuberculosis
Chugh, Proceedings of the National Academy of Sciences of the United States of America 2024
- “...of enzymes. These included AccA1 (Rv2501c), AccD1 (Rv2502c), AccA2 (Rv0973c), AccD2 (Rv0974c), AccD4 (Rv3799c), AccD5 (Rv3280), and AccE5 (Rv3281) ( SI Appendix , Table S1 and Dataset S1 ). Since polyP has been demonstrated to replace ATP as a phosphate donor in various metabolic enzymatic reactions,...”
Phylogenomic Reappraisal of Fatty Acid Biosynthesis, Mycolic Acid Biosynthesis and Clinical Relevance Among Members of the Genus Corynebacterium
Dover, Frontiers in microbiology 2021
- “...5,202 o53579 Polyketide synthase MA condensation fadD32 Rv3801c 1914 o53580 Long-chain-fatty-acid-amp ligase MA condensation accD5 Rv3280 1,647 p9wqh7 Biotin-dependent acetyl/propionyl-coenzyme a carboxylase beta5 subunit MA condensation Rv3281 534 p96886 Conserved hypothetical protein MA condensation accA3 Rv3285 1803 p96890 Bifunctional protein acetyl/propionyl-coenzyme a carboxylase (-chain) MA condensation...”
Small RNA Mcr11 requires the transcription factor AbmR for stable expression and regulates genes involved in the central metabolism of Mycobacterium tuberculosis
Girardin, Molecular microbiology 2020
- “..., fadA3 ) restored expression to Wt levels (Figure 7 a). The expression of accD5 (Rv3280) was significantly derepressed and accE5 (Rv3281) trended toward derepression in Mtb mcr11 , and complementation partially restored Wt expression levels of both genes (Supplemental Figure 6 a). Expression of dlaT...”
One-Year Old Dormant, "Non-culturable" Mycobacterium tuberculosis Preserves Significantly Diverse Protein Profile
Trutneva, Frontiers in cellular and infection microbiology 2020
- “...Rv3841 Bacterioferritin BfrB Rv0831c Conserved protein Rv0242c Probable 3-oxoacyl-[acyl-carrier protein] reductase FabG4 Rv2971 Probable oxidoreductase Rv3280 Probable propionyl-CoA carboxylase beta chain 5 AccD5 (pccase) (propanoyl-CoA:carbon dioxide ligase) Rv3457c Probable DNA-directed RNA polymerase (alpha chain) RpoA Rv1308 Probable ATP synthase alpha chain AtpA Rv3846 Superoxide dismutase [FE]...”
The unfoldase ClpC1 of Mycobacterium tuberculosis regulates the expression of a distinct subset of proteins having intrinsically disordered termini
Lunge, The Journal of biological chemistry 2020 (secret)
More than cholesterol catabolism: regulatory vulnerabilities in Mycobacterium tuberculosis
Bonds, Current opinion in chemical biology 2018
- “...DlaT Pyruvate Transformation Pyruvate dehydrogenase E2 component Rv2241 AceE Pyruvate Transformation Pyruvate dehydrogenase E1 component Rv3280 AccD5 Methylmalonyl-CoA Pathway Propionyl-CoA carboxylase Rv3281 AccE5 Methylmalonyl-CoA Pathway Propionyl-CoA carboxylase Rv3285 AccA3 Methylmalonyl-CoA Pathway Propionyl-CoA carboxylase Rv3339c Icd1 TCA Cycle Isocitrate dehydrogenase RV3504 ChsE4 Cholesterol Side Chain Degradation Acyl-CoA...”
Impact of Genomics on Clarifying the Evolutionary Relationships amongst Mycobacteria: Identification of Molecular Signatures Specific for the Tuberculosis-Complex of Bacteria with Potential Applications for Novel Diagnostics and Therapeutics
Gupta, High-throughput 2018
- “..., Figure S3 12aa Del 5087 Non-essential putative propionyl-CoA carboxylase beta chain 5 ACCD5 (PCCASE) Rv3280 Figure S4 1aa Del 172220 Essential O-succinylbenzoic acid-CoA ligase MenE * Rv0542c Figure S5 2aa Ins 4195 Essential ligase * Rv3712 Figure S6 4aa Ins 180234 Essential arabinosyltransferase EmbB *...”
The influence of AccD5 on AccD6 carboxyltransferase essentiality in pathogenic and non-pathogenic Mycobacterium
Pawelczyk, Scientific reports 2017
- “...replacement experiments have suggested that among the six carboxyltransferases in M. tuberculosis AccD6 (Rv2247), AccD5 (Rv3280) and AccD4 (Rv3799c) are essential for cell viability 13 14 and are expressed at high levels during mycolic acid biosynthesis 14 15 . Thus, in recent years, efforts have been...”
- “...role in malonyl-CoA synthesis in this species 14 . In vitro biochemical analysis of AccD5 (Rv3280) revealed both an acetyl- and a propionyl-CoA substrate specificity with clear preference for the latter, emphasizing its putative engagement in methylmalonyl-CoA synthesis 16 . However, convincing in vivo studies are...”
More
The role of acyl-coenzyme A carboxylase complex in lipstatin biosynthesis of Streptomyces toxytricini
Demirev, Applied microbiology and biotechnology 2010
- “...(ZP_03173623); SclPccB; PccB of S. clavuligerus ATCC 27064 (ZP_03182649), MtbAccD5, AccD5 of Mycobacterium tuberculosis H37Rv (NP_217797); MboAccD5, AccD5 of M. bovis AF 2122/97 (NP_856953); MleAccD5, AccD5 of M. leprae TN (NP_301571); CdpAccD5, AccD5 of C . diphtheriae NCTC 13129 (NP_939032), StxAccA3, AccA3 of S. toxytricini NRRL...”
Phylogenomic Reappraisal of Fatty Acid Biosynthesis, Mycolic Acid Biosynthesis and Clinical Relevance Among Members of the Genus Corynebacterium
Dover, Frontiers in microbiology 2021
- “...Polyketide synthase MA condensation fadD32 Rv3801c 1914 o53580 Long-chain-fatty-acid-amp ligase MA condensation accD5 Rv3280 1,647 p9wqh7 Biotin-dependent acetyl/propionyl-coenzyme a carboxylase beta5 subunit MA condensation Rv3281 534 p96886 Conserved hypothetical protein MA condensation accA3 Rv3285 1803 p96890 Bifunctional protein acetyl/propionyl-coenzyme a carboxylase (-chain) MA condensation accE *...”

PFREUD_07170 acyl-CoA carboxylase subunit beta from Propionibacterium freudenreichii subsp. shermanii CIRM-BIA1
30% identity, 93% coverage

A unique in vivo experimental approach reveals metabolic adaptation of the probiotic Propionibacterium freudenreichii to the colon environment
Saraoui, BMC genomics 2013
- “...hga, kdgA 2-dehydro-3-deoxyphosphogluconate aldolase/4-hydroxy-2-oxoglutarate aldolase 2.1.1 Specific carbohydrate metabolic pathway 2,1 2,6E-05 2,8 2,0E-01 CUST_421_PI426428742 PFREUD_07170 pccB Propionyl-CoA carboxylase beta chain 2.1.1 Specific carbohydrate metabolic pathway 2,5 8,0E-08 1,1 3,2E-02 CUST_701_PI426428742 PFREUD_09060 dhaG Glycerol dehydratase reactivation factor DhaG 2.1.1 Specific carbohydrate metabolic pathway 3,8 5,6E-07 4,9...”
Accumulation of intracellular glycogen and trehalose by Propionibacterium freudenreichii under conditions mimicking cheese ripening in the cold
Dalmasso, Applied and environmental microbiology 2012
- “...PFREUD_01730 PFREUD_09470 PFREUD_10890 PFREUD_12590 PFREUD_01720 PFREUD_07170 PFREUD_16500 PFREUD_09600 PFREUD_06870 Locus taga Carbon starvation protein Cell...”

Sfum_1223 carboxyl transferase from Syntrophobacter fumaroxidans MPOB
29% identity, 93% coverage

Proteomic Analysis of a Syntrophic Coculture of Syntrophobacter fumaroxidans MPOB^T and Geobacter sulfurreducens PCA^T
Mollaei, Frontiers in microbiology 2021
- “...significantly lower abundance in the SF-GS coculture, i.e., pyruvate ferredoxin oxidoreductase (Sfum_279295) and carboxyl transferase (Sfum_1223) ( Figure 3 ). In contrast, two enzymes showed slightly higher abundance in the SF-GS compared to SF-MH and SF, i.e., malate dehydrogenase (Sfum_2777) (8-fold higher vs. SF-MH, and 1-fold...”
Complete genome sequence of Syntrophobacter fumaroxidans strain (MPOB(T))
Plugge, Standards in genomic sciences 2012
- “...gene cluster appears immediately downstream of a two-gene cluster predicted to encode methylmalonyl-CoA mutase (Sfum_0457-8). Sfum_1223 may encode a carboxyltransferase involved in cycling carbon dioxide between the decarboxylation of oxaloacetate and the carboxylation of propionyl-CoA to form methylmalonyl-CoA. Methylmalonyl-CoA mutase (Sfum_0457-8) then converts methylmalonyl-CoA to succinyl-CoA....”
- “...oxaloacetate to pyruvate is concomitant with a carboxyl transfer reaction to form methylmalonyl-CoA from propionyl-CoA (Sfum_1223). Acetyl-CoA is formed from pyruvate by pyruvate ferredoxin oxidoreductase (Sfum_2792-95) and the CoA moiety is recycled to activate propionate to propionyl-CoA. Acetyl-CoA could also be converted to acetyl-phosphate and acetate...”

PCCB_MOUSE / Q99MN9 Propionyl-CoA carboxylase beta chain, mitochondrial; PCCase subunit beta; Propanoyl-CoA:carbon dioxide ligase subunit beta; EC 6.4.1.3 from Mus musculus (Mouse) (see paper)
Q99MN9 propionyl-CoA carboxylase (EC 6.4.1.3) from Mus musculus (see paper)
32% identity, 75% coverage

function: This is one of the 2 subunits of the biotin-dependent propionyl-CoA carboxylase (PCC), a mitochondrial enzyme involved in the catabolism of odd chain fatty acids, branched-chain amino acids isoleucine, threonine, methionine, and valine and other metabolites. Propionyl-CoA carboxylase catalyzes the carboxylation of propionyl- CoA/propanoyl-CoA to D-methylmalonyl-CoA/(S)-methylmalonyl-CoA (By similarity). Within the holoenzyme, the alpha subunit catalyzes the ATP-dependent carboxylation of the biotin carried by the biotin carboxyl carrier (BCC) domain, while the beta subunit then transfers the carboxyl group from carboxylated biotin to propionyl-CoA (By similarity). Propionyl-CoA carboxylase also significantly acts on butyryl-CoA/butanoyl-CoA, which is converted to ethylmalonyl-CoA/(2S)- ethylmalonyl-CoA (By similarity). Other alternative minor substrates include (2E)-butenoyl-CoA/crotonoyl-CoA (By similarity).
catalytic activity: propanoyl-CoA + hydrogencarbonate + ATP = (S)-methylmalonyl- CoA + ADP + phosphate + H(+) (RHEA:23720)
catalytic activity: butanoyl-CoA + hydrogencarbonate + ATP = (2S)-ethylmalonyl-CoA + ADP + phosphate + H(+) (RHEA:59520)
subunit: The holoenzyme is a dodecamer composed of 6 PCCA/alpha subunits and 6 PCCB/beta subunits.
Proteomic Assessment of C57BL/6 Hippocampi after Non-Selective Pharmacological Inhibition of Nitric Oxide Synthase Activity: Implications of Seizure-like Neuronal Hyperexcitability Followed by Tauopathy
Hendrickx, Biomedicines 2022
- “...0.00661 P22315 Fech Ferrochelatase, mitochondrial 1.25 0.00661 Q8BFU3 Rnf214 RING finger protein 214 1.28 0.00661 Q99MN9 Pccb Propionyl-CoA carboxylase beta chain, mitochondrial 0.526 0.00661 P04444 Hbb-bh1 Hemoglobin subunit beta-H1 1.16 0.00671 Q61548 Snap91 Clathrin coat assembly protein AP180 0.434 0.00671 Q62418 Dbnl Drebrin-like protein 0.436 0.00682...”
ISG15 Is a Novel Regulator of Lipid Metabolism during Vaccinia Virus Infection.
Albert, Microbiology spectrum 2022
- “...Description Std log 2 (FC) b (VACV versus uninfected Isg15 +/+ ) Fatty acid oxidation Q99MN9 Pccb Propionyl-CoA carboxylase beta chain, mitochondrial 10.02 P51174 Acadl Long-chain-specific acyl-CoA dehydrogenase, mitochondrial 8.64 Q91ZA3 Pcca Propionyl-CoA carboxylase alpha chain, mitochondrial 8.63 Q9EPL9 Acox3 Peroxisomal acyl-coenzyme A oxidase 3 8.62...”
Interferon-Inducible Transmembrane Protein 3-Containing Exosome as a New Carrier for the Cell-to-Cell Transmission of Anti-Brucella Activity.
Yi, Frontiers in veterinary science 2021
- “...P41731 CD63 antigen Cd63 2.08 0.0329 Up Q8CIH5 phospholipase C-gamma (1) Plc2 2.01 0.0112 Up Q99MN9 Propionyl-CoA carboxylase beta chain, mitochondrial Pccb 2.00 0.0378 Up Q8VBV7 COP9 signalosome complex subunit 8 Cops8 0.49 0.0011 Down P40237 CD82 antigen Cd82 0.49 0.0180 Down P51863 V-type proton ATPase...”
Bioenergetic shift and actin cytoskeleton remodelling as acute vascular adaptive mechanisms to angiotensin II in murine retina and ophthalmic artery
Perumal, Redox biology 2020
- “...4.83E-02 -1.72606 Q61490 CD166 antigen Alcam 4.48E-02 -1.54606 P08228 Superoxide dismutase [Cu-Zn] Sod1 2.38E-02 -1.51161 Q99MN9 Propionyl-CoA carboxylase beta chain, mitochondrial Pccb 4.62E-03 -1.25907 Q8VCT4 Carboxylesterase 1D Ces1d 3.15E-03 -1.07386 Q9CQ54 NADH dehydrogenase [ubiquinone] 1 subunit C2 Ndufc2 2.72E-02 -1.03234 P68871 Hemoglobin subunit beta HBB 4.76E-02...”
A Neuroprotective Dose of Isatin Causes Multilevel Changes Involving the Brain Proteome: Prospects for Further Research.
Medvedev, International journal of molecular sciences 2020
- “...transport 12 P84309 ADCY5 6.87 10 10 2.72 Adenylate cyclase type 5 Cell signaling 13 Q99MN9 PCCB 7.83 10 10 2.249 Propionyl-CoA carboxylase beta chain, mitochondrial Fatty acid beta-oxidation 14 P07759 SPA3K 4.90 10 9 4.156 Serine protease inhibitor A3K A member of serine protease inhibitors,...”
Suppression of the Peripheral Immune System Limits the Central Immune Response Following Cuprizone-Feeding: Relevance to Modelling Multiple Sclerosis
Sen, Cells 2019
- “...Glud1 324/12 7 61.3/8 106.8/6.8 2.24(0.2PT) M - [ 94 ] [ 95 ] A16/MP Q99MN9 Propionyl co-enzyme A carboxylase- Pccb 277/16 6 50.4/5.7 60.5/6.3 0.43(0.1PT) M - - - B20/MP P30275 Creatine kinase U-type Ckmt1 137/22 11 46.9/8.4 83.2/7.5 0.44(0.2PT) 0.35(0.1) S - - -...”
Mapping protein interactions of sodium channel Na_V1.7 using epitope-tagged gene-targeted mice
Kanellopoulos, The EMBO journal 2018
- “...only Ppp1r9a Protein Ppp1r9a H3BJD0 6.25E08 0.00E+00 KI only Pccb PropionylCoA carboxylase beta chain, mitochondrial Q99MN9 6.16E08 0.00E+00 KI only Des Desmin P31001 5.91E08 0.00E+00 KI only Cdh2 Cadherin2 P15116 5.88E08 0.00E+00 KI only Agpat3 1acylsnglycerol3phosphate acyltransferase gamma Q9D517 5.50E08 0.00E+00 KI only Ogt Isoform 2...”
Subproteomic profiling of sarcolemma from dystrophic mdx-4cv skeletal muscle.
Murphy, Data in brief 2018
- “...3.32E-04 2.1 Q9CZ13 Uqcrc1 Cytochrome b-c1 complex subunit 1, mitochondrial 1 1 2.7 2.28E-04 2.0 Q99MN9 Pccb Propionyl-CoA carboxylase beta chain, mitochondrial 1 1 2.6 4.71E-03 2.0 Q8CI51 Pdlim5 PDZ and LIM domain protein 5 1 1 48.0 2.39E-03 2.0 Q62433 Ndrg1 Protein NDRG1 1 1...”
More

NP_856953 PROBABLE PROPIONYL-COA CARBOXYLASE BETA CHAIN 5 ACCD5 (PCCASE) (PROPANOYL-COA:CARBON DIOXIDE LIGASE) from Mycobacterium bovis AF2122/97
30% identity, 87% coverage

The role of acyl-coenzyme A carboxylase complex in lipstatin biosynthesis of Streptomyces toxytricini
Demirev, Applied microbiology and biotechnology 2010
- “...(ZP_03182649), MtbAccD5, AccD5 of Mycobacterium tuberculosis H37Rv (NP_217797); MboAccD5, AccD5 of M. bovis AF 2122/97 (NP_856953); MleAccD5, AccD5 of M. leprae TN (NP_301571); CdpAccD5, AccD5 of C . diphtheriae NCTC 13129 (NP_939032), StxAccA3, AccA3 of S. toxytricini NRRL 15443; ScoAccA3, S. coelicolor A3(2) (NP_629074); SavAccA3, AccA3...”

MAB_3631 Probable propionyl-CoA carboxylase beta chain 5 AccD5 from Mycobacterium abscessus ATCC 19977
30% identity, 89% coverage

Mycobacterium abscessus extracellular vesicles increase mycobacterial resistance to clarithromycin in vitro
Vermeire, Proteomics 2024 (secret)

CpC231_0491 acyl-CoA carboxylase subunit beta from Corynebacterium pseudotuberculosis C231
D9QEQ5 Methylmalonyl-CoA carboxyltransferase from Corynebacterium pseudotuberculosis (strain C231)
32% identity, 77% coverage

Changes in protein abundance are observed in bacterial isolates from a natural host
Rees, Frontiers in cellular and infection microbiology 2015
- “...D9QEQ0 maf CpC231_0486 Maf-like protein CpC231_0486 0.886 * 0.324 0.300 Cell cycle control D9QEQ5 pccB2 CpC231_0491 Propionyl-CoA carboxylase beta chain 2 0.201 2.348 * 2.676 * Lipid transport and metabolism D9QEV7 CpC231_0543 CpC231_0543 Uncharacterized protein 0.923 * 1.119 * 0.183 D9Q935 CpC231_0574 CpC231_0574 Methylmalonyl-CoA carboxyltransferase 1.3S...”
Changes in protein abundance are observed in bacterial isolates from a natural host
Rees, Frontiers in cellular and infection microbiology 2015
- “...1.610 * D9QEQ0 maf CpC231_0486 Maf-like protein CpC231_0486 0.886 * 0.324 0.300 Cell cycle control D9QEQ5 pccB2 CpC231_0491 Propionyl-CoA carboxylase beta chain 2 0.201 2.348 * 2.676 * Lipid transport and metabolism D9QEV7 CpC231_0543 CpC231_0543 Uncharacterized protein 0.923 * 1.119 * 0.183 D9Q935 CpC231_0574 CpC231_0574 Methylmalonyl-CoA...”

SRIMR7_11535 acyl-CoA carboxylase subunit beta from Streptomyces rimosus subsp. rimosus
30% identity, 93% coverage

Systems biology of industrial oxytetracycline production in Streptomyces rimosus: the secrets of a mutagenized hyperproducer
Beganovic, Microbial cell factories 2023
- “...3.3 0 SRIMR7_35410 Phenylacetate-CoA ligase 3.1 1.3 SRIMR7_34430 Coenzyme A biosynthesis protein CoaBC 2.9 0 SRIMR7_11535 Putative propionyl-CoA carboxylase -chain 1.1 2.6 SRIMR7_11575 BC amino-acid aminotransferase 1.0 1.0 SRIMR7_01685 Crotonyl-CoA carboxylase/reductase 6.4 0 SRIMR7_07230 Methylmalonyl-CoA mutase 2.5 2.5 SRIMR7_07225 Crotonyl-CoA carboxylase/reductase 2.4 2.4 SRIMR7_21110 Valine dehydrogenase...”

NP_301571 acetyl/propionyl CoA carboxylase [beta] subunit from Mycobacterium leprae TN
29% identity, 89% coverage

The role of acyl-coenzyme A carboxylase complex in lipstatin biosynthesis of Streptomyces toxytricini
Demirev, Applied microbiology and biotechnology 2010
- “...(NP_217797); MboAccD5, AccD5 of M. bovis AF 2122/97 (NP_856953); MleAccD5, AccD5 of M. leprae TN (NP_301571); CdpAccD5, AccD5 of C . diphtheriae NCTC 13129 (NP_939032), StxAccA3, AccA3 of S. toxytricini NRRL 15443; ScoAccA3, S. coelicolor A3(2) (NP_629074); SavAccA3, AccA3 of S. avermitilis MA-4680 (NP_824513); SprJadJ, JadJ...”

NP_741742 Propionyl-CoA carboxylase beta chain, mitochondrial from Caenorhabditis elegans
31% identity, 78% coverage

Propionyl-CoA carboxylase pcca-1 and pccb-1 gene deletions in Caenorhabditis elegans globally impair mitochondrial energy metabolism.
Chapman, Journal of inherited metabolic disease 2018
- GeneRIF: Two C. elegans model animals of propionic acidemia with single-gene pcca-1 or pccb-1 deletions have reduced lifespan with significantly reduced mitochondrial energy metabolism and increased oxidative stress

Q20676 propionyl-CoA carboxylase (subunit 1/2) (EC 6.4.1.3) from Caenorhabditis elegans (see paper)
31% identity, 78% coverage

G7YFK3 Propionyl-CoA carboxylase beta chain, mitochondrial from Clonorchis sinensis
31% identity, 76% coverage

Identification and Analysis of the Tegument Protein and Excretory-Secretory Products of the Carcinogenic Liver Fluke Clonorchis sinensis
Shi, Frontiers in microbiology 2020
- “...G7YLC0 6.86 13.61 1 Glutamate dehydrogenase + + + G7YHC3 0.00 15.35 1 Uncharacterized protein G7YFK3 10.36 12.52 2 Propionyl-CoA carboxylase beta chain + G7YFT8 2.06 21.43 1 Fatty acid-binding protein type 3 + + A7XWR4 14.68 21.19 2 ADP/ATP carrier + + + + G7YXC3...”

Tfu_2555 propionyl-CoA carboxylase complex B subunit from Thermobifida fusca YX
WP_011292978 acyl-CoA carboxylase subunit beta from Thermobifida fusca YX
31% identity, 76% coverage

The Effects of Carbon Source and Growth Temperature on the Fatty Acid Profiles of Thermobifida fusca
Winkelman, Frontiers in molecular biosciences 2022
- “...subunit Tfu_0948 AcCCase A AcCCase BC and BCCP subunit Tfu_2557 AcCCase B AcCCase CT subunit Tfu_2555 AcCCase E AcCCase E subunit Tfu_2556 ACCase B Additional ACCase CT subunit Tfu_1228, Tfu_1215 BCCP Biotin Carboxyl-Carrier Protein Tfu_1513 LCCase LCCase Tfu_1530 AcpP Acyl-carrier protein (ACP) Tfu_1975 MCAT Malonyl-CoA:ACP transacylase...”
- “...ACCase in the T. fusca genome. Previous studies have experimentally characterized the T. fusca operon (Tfu_2555, Tfu_2556, Tfu_2557) that encodes the B, E, and A subunits of an acyl-CoA carboxylase (AcCCase) ( Shivaiah et al., 2021 ). This enzyme is promiscuous and can carboxylate acetyl-CoA, propionyl-CoA,...”
Kinetic, Structural, and Mutational Analysis of Acyl-CoA Carboxylase From Thermobifida fusca YX
Shivaiah, Frontiers in molecular biosciences 2020
- “...(Vanee et al., 2017 ). Methods and Materials Recombinant Expression Vectors ORFs encoding the TfAcCCB (Tfu_2555; WP_011292978), TfAcCCA (Tfu_2557; WP_011292980), and TfAcCCE (Tfu_2556; WP_011292979) proteins were initially identified using The Thioester-active enzYme database (ThYme) ( http://www.enzyme.cbirc.iastate.edu/ ) (Cantu et al., 2010 , 2011 ; Chen et...”
- “...TfAcCCA subunit (62.1 kDa) that appears to carry the BC and BCCP functional components; (b) Tfu_2555 (WP_011292978) encoding the TfAcCCB subunit (57.6 kDa) that carries the CT functional component; and (c) Tfu_2556 (WP_011292979) encoding the TfAcCCE subunit (8.7 kDa), a non-catalytic structural component. More specifically, the...”
Kinetic, Structural, and Mutational Analysis of Acyl-CoA Carboxylase From Thermobifida fusca YX
Shivaiah, Frontiers in molecular biosciences 2020
- “...et al., 2017 ). Methods and Materials Recombinant Expression Vectors ORFs encoding the TfAcCCB (Tfu_2555; WP_011292978), TfAcCCA (Tfu_2557; WP_011292980), and TfAcCCE (Tfu_2556; WP_011292979) proteins were initially identified using The Thioester-active enzYme database (ThYme) ( http://www.enzyme.cbirc.iastate.edu/ ) (Cantu et al., 2010 , 2011 ; Chen et al.,...”
- “...subunit (62.1 kDa) that appears to carry the BC and BCCP functional components; (b) Tfu_2555 (WP_011292978) encoding the TfAcCCB subunit (57.6 kDa) that carries the CT functional component; and (c) Tfu_2556 (WP_011292979) encoding the TfAcCCE subunit (8.7 kDa), a non-catalytic structural component. More specifically, the T....”

Pccb / P07633 propionyl-CoA carboxylase β subunit (EC 6.4.1.3) from Rattus norvegicus (see 2 papers)
P07633 Propionyl-CoA carboxylase beta chain, mitochondrial from Rattus norvegicus
32% identity, 75% coverage

Proteomic mapping reveals dysregulated angiogenesis in the cerebral arteries of rats with early-onset hypertension
Bastrup, The Journal of biological chemistry 2023
- “...alpha chain, mitochondrial 0.20 15.31 5.55E-04 2.53E-02 Pccb Propionyl-CoA carboxylase beta chain, mitochondrial; isoform of P07633, propionyl coenzyme A carboxylase, beta polypeptide 0.26 15.65 1.29E-04 1.01E-02 Pcdh7 Protocadherin 7 1.13 8.83 1.06E-03 4.06E-02 Pde2a cGMP-dependent 3,5-cyclic phosphodiesterase 1.72 12.20 7.02E-04 2.98E-02 Pfkl ATP-dependent 6-phosphofructokinase, liver type;...”
Extracellular vesicles released by steatotic hepatocytes alter adipocyte metabolism
Mleczko, Journal of extracellular biology 2022
- “...Alpha1macroglobulin RDH7_RAT P55006 2.12 6.66E04 Retinol dehydrogenase 7 UDB15_RAT P36511 2.16 3.72E03 UDPglucuronosyltransferase 2B15 PCCB_RAT P07633 2.17 1.05E02 PropionylCoA carboxylase beta chain, mitochondrial BASI_RAT P26453 2.17 3.95E04 Basigin MBL2_RAT P08661 2.21 1.40E03 Mannosebinding protein C CP2CB_RAT P08683 2.52 1.35E04 Cytochrome P450 2C11 CD81_RAT Q62745 2.53 1.05E02...”
Myocardial proteomic profile in pulmonary arterial hypertension.
Hołda, Scientific reports 2020
- “...calcium ATPase 1 1.16 Q05962 Slc25a4 ADP/ATP translocase 1 1.09 Q704S8 Crat Carnitine O-acetyltransferase 1.17 P07633 Pccb Propionyl-CoA carboxylase beta chain, mitochondrial 1.09 P70623 Fabp4 Fatty acid-binding protein, adipocyte 1.18 P42123 Ldhb L-lactate dehydrogenase B chain 1.09 P0C2X9 Aldh4a1 Delta-1-pyrroline-5-carboxylate dehydrogenase, mitochondrial 1.19 Q561S0 Ndufa10 NADH...”
Investigation on Intestinal Proteins and Drug Metabolizing Enzymes in Simulated Microgravity Rats by a Proteomics Method.
Liu, Molecules (Basel, Switzerland) 2020
- “...4-aminobutyrate aminotransferase (ABAT) 8.96 0.0005 Q02253 Aldehyde dehydrogenase family 6 member A1 (ALDH6A1) 5.38 0.0031 P07633 Mitochondrial Propionyl-CoA carboxylase beta chain (PCCB) 5.33 0.0012 Q8K4D8 Aldehyde dehydrogenase family 1 member A3 (ALDH1A3) 3.37 0.0121 P07896 Peroxisomal bifunctional enzyme (EHHADH) 2.61 0.0353 O08590 Membrane primary amine oxidase...”
Functional proteomic analysis of corticosteroid pharmacodynamics in rat liver: Relationship to hepatic stress, signaling, energy regulation, and drug metabolism.
Ayyar, Journal of proteomics 2017
- “...Pbld Phenazine biosynthesis-like domain-containing protein *Function unclear* UP Q63598 Pls3 Plastin-3 (T-plastin) Actin-bundling protein UP P07633 Pccb Propionyl-CoA carboxylase, mitochondrial Synthesizes succinyl-CoA from propanoyl-CoA UP Q9Z2Q1 Sec31a Protein transport protein Sec31A Formation of transport vesicles from the endoplasmic reticulum UP/DOWN P26043 Rdx Radixin (ESP10) Binding of...”
Cardiac myocyte exosomes: stability, HSP60, and proteomics
Malik, American journal of physiology. Heart and circulatory physiology 2013
- “...Q4V8H5 P06214 P14604 O88600 G5BBR0 P07633 P18422 P21670 G3V7Q6 P34067 Uncharacterized Uncharacterized Uncharacterized Uncharacterized Uncharacterized...”
- “...4 Q9ER34 Q4V8H5 P06214 P14604 O88600 P07633 P18422 P21670 G3V7Q6 P34067 Uncharacterized Uncharacterized protein Uncharacterized protein Uncharacterized protein...”
Use of biotinylated ubiquitin for analysis of rat brain mitochondrial proteome and interactome.
Buneeva, International journal of molecular sciences 2012
- “...in fatty acid metabolism ( n = 2) 1 Propionyl-CoA carboxylase beta chain, mitochondrial precursor P07633 13 67.94 M 2 Propionyl-CoA carboxylase alpha chain, mitochondrial precursor P14882 5 37.33 M Transporters ( n = 4) 1 Excitatory amino acid transporter 1 P24942 6 34.57 PM 2...”
- “...P08461, Hspd1 = P63039, Hspe1 = P26772, Slc25a5 = Q09073, Pcca = P14882, Pccb = P07633, Atp1a2 = P06686, Atp1a1 = P06685, Nefm = P12839, Nefl = P19527, Camk2a = P11275, Ina = P23565, Gfap = P47819, Slc1a3 = P24942, ENSRNOG00000018630 = Q0QEU1, Krt14 = Q6IFV1,...”
Mitochondrial proteomic analysis reveals deficiencies in oxygen utilization in medullary thick ascending limb of Henle in the Dahl salt-sensitive rat.
Zheleznova, Physiological genomics 2012
More

C9JQS9 Propionyl-CoA carboxylase beta chain, mitochondrial from Homo sapiens
28% identity, 87% coverage

Proteome architecture of human-induced pluripotent stem cell-derived three-dimensional organoids as a tool for early diagnosis of neuronal disorders
Negi, Indian journal of pharmacology 2023
- “...Gene symbol Unique peptides MW (kDa) Coverage (%) Log2 FC p- value Up-regulated proteins 1 C9JQS9 Propionyl-CoA carboxylase beta chain, mitochondrial PCCB 2 60.7 8 6.64 1.000E-17 2 O75306 NADH dehydrogenase [ubiquinone] iron-sulfur protein 2, mitochondrial NDUFS2 2 52.5 9 6.64 1.000E-17 3 A0A024RDV5 Fibronectin type...”

W6NJ96 Propionyl-CoA carboxylase beta chain, mitochondrial from Haemonchus contortus
32% identity, 76% coverage

Proteomic identification of galectin-11 and 14 ligands from Haemonchus contortus
Sakthivel, PeerJ 2018
- “...23.27 222 18 3,151 No Yes No Yes 11.26 0.0062 128.6 Yes 7 / 35 W6NJ96 Carboxyl transferase GN=HCOI_00766200 23.39 123 10 1,146 No Yes No Yes 16.01 0.0103 56.1 No 0 / 7 W6NLA8 Glutamate phenylalanine leucine valine dehydrogenase GN=HCOI_01838800 42.50 102 10 957 No...”

MMDA_PROMO / O54028 Methylmalonyl-CoA decarboxylase subunit alpha; EC 7.2.4.3 from Propionigenium modestum (see paper)
29% identity, 86% coverage

function: Carboxyltransferase subunit of the sodium ion pump methylmalonyl-CoA decarboxylase, which converts the chemical energy of a decarboxylation reaction into an electrochemical gradient of Na(+) ions across the cytoplasmic membrane, thereby creating a sodium ion motive force that is used for ATP synthesis (PubMed:9428714). The alpha subunit catalyzes the Na(+)-independent carboxyltransfer from methylmalonyl-CoA to the prosthetic biotin group located on the gamma subunit (By similarity).
catalytic activity: (S)-methylmalonyl-CoA + Na(+)(in) + H(+)(out) = propanoyl-CoA + Na(+)(out) + CO2 (RHEA:21396)
subunit: The methylmalonyl-CoA decarboxylase is composed of four subunits: the carboxyltransferase alpha subunit (MmdA), the tunnel beta subunit (MmdB), the biotin-containing gamma subunit (MmdC) and the delta subunit (MmdD).

3ib9A / Q9X4K7 Propionyl-coa carboxylase beta subunit, d422l (see paper)
29% identity, 90% coverage

Ligand: biotin (3ib9A)

mmdA / CAA05137.1 methylmalonyl-CoA decarboxylase, alpha-subunit, partial from Propionigenium modestum (see paper)
29% identity, 86% coverage

NP_001171485 propionyl-CoA carboxylase beta chain, mitochondrial isoform 2 precursor from Homo sapiens
29% identity, 87% coverage

Human forebrain organoid-based multi-omics analyses of PCCB as a schizophrenia associated gene linked to GABAergic pathways.
Zhang, Nature communications 2023
- GeneRIF: Human forebrain organoid-based multi-omics analyses of PCCB as a schizophrenia associated gene linked to GABAergic pathways.
A common benign intronic deletion masking a pathogenic deep intronic PCCB variant - genome sequencing and RNA studies to the rescue.
Kurolap, Molecular genetics and metabolism 2023 (PubMed)
- GeneRIF: A common benign intronic deletion masking a pathogenic deep intronic PCCB variant - genome sequencing and RNA studies to the rescue.
Gene diagnosis and pedigree analysis of two Han ethnicity families with propionic acidemia in Fujian.
Chen, Medicine 2021
- GeneRIF: Gene diagnosis and pedigree analysis of two Han ethnicity families with propionic acidemia in Fujian.
Novel variants of the PCCB gene in Chinese patients with propionic acidemia.
Yang, Clinica chimica acta; international journal of clinical chemistry 2021 (PubMed)
- GeneRIF: Novel variants of the PCCB gene in Chinese patients with propionic acidemia.
Functional Analysis of the PCCA and PCCB Gene Variants Predicted to Affect Splicing.
Bychkov, International journal of molecular sciences 2021
- GeneRIF: Functional Analysis of the PCCA and PCCB Gene Variants Predicted to Affect Splicing.
Biochemical phenotype and its relationship to treatment in 16 individuals with PCCB c.1606A > G (p.Asn536Asp) variant propionic acidemia.
Wenger, Molecular genetics and metabolism 2020 (PubMed)
- GeneRIF: Biochemical phenotype and its relationship to treatment in 16 individuals with PCCB c.1606A > G (p.Asn536Asp) variant propionic acidemia.
Identification of 34 novel mutations in propionic acidemia: Functional characterization of missense variants and phenotype associations.
Rivera-Barahona, Molecular genetics and metabolism 2018 (PubMed)
- GeneRIF: his work represents a large-scale update on pathogenic mutations in the PCCA and PCCB genes causing Propionic acidemia (PA), and confirms previous reports indicating a major causative role of mutation-induced protein destabilization
Molecular and phenotypic characteristics of seven novel mutations causing branched-chain organic acidurias.
Stojiljkovic, Clinical genetics 2016 (PubMed)
- GeneRIF: we identified seven novel genetic variants: p.Leu549Pro, p.Glu564*, p.Leu641Pro in MUT, p.Tyr206Cys in PCCB, p.His194Arg, p.Val298Met in BCKDHA and p.Glu286_Met290del in BCKDHB gene. In silico and/or eukaryotic expression studies confirmed pathogenic effect of all novel genetic variants
More

Q9X4K7 propionyl-CoA carboxylase (EC 6.4.1.3) from Streptomyces coelicolor (see 2 papers)
NP_629079, SCO4926 propionyl-CoA carboxylase complex B subunit from Streptomyces coelicolor A3(2)
29% identity, 90% coverage

High cell density production of multimethyl-branched long-chain esters in Escherichia coli and determination of their physicochemical properties.
Menendez-Bravo, Biotechnology for biofuels 2016
- “...transesterase M. tuberculosis H37Rv Rv2939 I6YAN2 accA2, acyl-CoA carboxylase subunit S. coelicolor A3 (2) SCO4921 Q9X4K7 pccB, propionyl-CoA carboxylase subunit S. coelicolor A3 (2) SCO4926 Q9EWV4 pccE , propionyl-CoA carboxylase subunit S. coelicolor A3 (2) SCO4925 Q9EWV8 sfp , phosphopantetheinyl transferase B. subtilis BSU03570 X63158 prpE...”
3-methylcrotonyl-CoA carboxylase deficiency: clinical, biochemical, enzymatic and molecular studies in 88 individuals
Grünert, Orphanet journal of rare diseases 2012
- “...P. aeruginosa MCCC2 (paMCCC2, Q9I297), Propionibacterium shermanii methylmalonyl-CoA carboxyltransferase (psMMCC, Q8GBW6), Streptomyces coelicolor PCC (scPCCB, Q9X4K7) and Roseobacter denitrificans PCC (bPCCA, Q168G2). Novel MCCC2 missense mutations are asterisked. Click here for file Acknowledgements We thank the following doctors and physicians for providing clinical information: Dr. M....”
Genome Analysis of a Variant of Streptomyces coelicolor M145 with High Lipid Content and Poor Ability to Synthetize Antibiotics
Dulermo, Microorganisms 2023
- “..., they include SCO2445/44, SCO2776/77, SCO4380/81 as well as SCO4921 (AccA2, acyl-CoA carboxylase subunit ), SCO4926 (PccB, propionyl-CoA carboxylase subunit ) and SCO6271 (Acc1, acyl-CoA carboxylase subunit ). AcetylCoA carboxylase catalyzes the carboxylation of acetyl-CoA to produce malonyl-CoA yielding straight/iso fatty acids. Propionyl CoA carboxylase catalyzes...”
AccR, a TetR Family Transcriptional Repressor, Coordinates Short-Chain Acyl Coenzyme A Homeostasis in Streptomyces avermitilis
Lyu, Applied and environmental microbiology 2020 (secret)
The role of acyl-coenzyme A carboxylase complex in lipstatin biosynthesis of Streptomyces toxytricini
Demirev, Applied microbiology and biotechnology 2010
- “...toxytricini . StxPccB, PccB of S. toxytricini NRRL 15443; ScoPccB, PccB of S. coelicolor A3(2) (NP_629079), SavPccB; PccB of S . avermitilis MA-4680 (NP_824507); SprPccB, PccB of S. pristinaespiralis ATCC 25486 (ZP_03173623); SclPccB; PccB of S. clavuligerus ATCC 27064 (ZP_03182649), MtbAccD5, AccD5 of Mycobacterium tuberculosis H37Rv...”

8pn7A / C5AP75 Engineered glycolyl-coa carboxylase (g20r variant) with bound coa (see paper)
29% identity, 79% coverage

Ligands: coenzyme a; 5-(hexahydro-2-oxo-1h-thieno[3,4-d]imidazol-6-yl)pentanal (8pn7A)

nfa9940 putative acyl-CoA carboxylase beta subunit from Nocardia farcinica IFM 10152
30% identity, 79% coverage

Glycosylation and subsequent malonylation of isoflavonoids in E. coli: strain development, production and insights into future metabolic perspectives
Koirala, Journal of industrial microbiology & biotechnology 2014 (PubMed)
- “...the acyl-CoA carboxylase and subunits (nfa9890 and nfa9940), biotin ligase (nfa9950), and acetyl-CoA synthetase (nfa3550) from Nocardia farcinia were also...”
- “...the acyl-CoA carboxylase and subunits (nfa9890 and nfa9940), biotin ligase (nfa9950), and acetyl-CoA synthetase (nfa3550) from N. farcinia. The increase in...”
Production of 7-O-methyl aromadendrin, a medicinally valuable flavonoid, in Escherichia coli
Malla, Applied and environmental microbiology 2012
- “...the acyl-CoA carboxylase and subunits (nfa9890 and nfa9940), biotin ligase (nfa9950), and acetyl-CoA synthetase (nfa3550) from Nocardia farcinica were also...”
- “...and T7-rbs-nfa3550 from N. farcinica pET-24ma() carrying nfa9940 from N. farcinica pET-24ma() carrying nfa3550 from N. farcinica pRSFDuet-1 carrying SaOMT from...”

rrnAC0004 acetyl-CoA carboxylase alpha subunit from Haloarcula marismortui ATCC 43049
29% identity, 81% coverage

Genome information management and integrated data analysis with HaloLex
Pfeiffer, Archives of microbiology 2008
- “...in Haloarcula marismortui ORF Corrected length (aa) Original length (aa) Direction of change Homologous ORFs rrnAC0004 1,551 1,356 Extended NP4364A, OE3175F, HQ3018A rrnAC0005 624 360 Extended OE2052F, NP3952A rrnAC0012 957 1,083 Shortened HQ1987A, NP4816A rrnAC0041 279 339 Shortened NP3812A, HQ1503A, OE2950R rrnAC0053 864 717 Extended NP2042A,...”

SNOD_RS20250 acyl-CoA carboxylase subunit beta from Streptomyces nodosus
28% identity, 91% coverage

Comparative Transcriptome Analysis of Streptomyces nodosus Mutant With a High-Yield Amphotericin B
Huang, Frontiers in bioengineering and biotechnology 2020
- “...regulator. (l) SNOD_RS26215 pyruvate carboxylase. (m) Unlabeled gene2 2-oxoglutarate dehydrogenase. (n) SNOD_RS04655 succinate dehydrogenase. (o) SNOD_RS20250 propionyl-CoA carboxylase. (p) SNOD_RS22165 methylmalonyl-CoA epimerase. (q) SNOD_RS26855 methylmalonyl-CoA mutase. As acetyl-CoA enters the tricarboxylic acid cycle (TCA), the expression of SNOD _RS14500 gene (citrate synthase) and unlabeled gene 2...”

CgS9114_13431 acyl-CoA carboxylase subunit beta from Corynebacterium glutamicum S9114
31% identity, 80% coverage

Proteome analysis guided genetic engineering of Corynebacterium glutamicum S9114 for tween 40-triggered improvement in L-ornithine production
Jiang, Microbial cell factories 2020
- “...acetyl-CoA carboxylase biotin carboxyl carrier protein subunit, was downregulated by 1.22-fold, and the expression of CgS9114_13431 ( dtsR1 ), encoding an acetyl-CoA carboxyltransferase, was downregulated by 1.66-fold, suggesting that the fatty acid synthesis pathway was weakened by the addition of tween 40 in the strain of...”

cg0812 acetyl/propionyl-COA carboxylase subunit beta from Corynebacterium glutamicum ATCC 13032
NCgl0678 acyl-CoA carboxylase subunit beta from Corynebacterium glutamicum ATCC 13032
31% identity, 80% coverage

Thermo-adaptive evolution of Corynebacterium glutamicum reveals the regulatory functions of fasR and hrcA in heat tolerance
Li, Microbial cell factories 2024
- “...regulates gene expression. As shown in Fig. 4 B, in both 32C and 42C experiments, cg0812 ( acc D1, dts R1) transcript levels increased over eight-fold in fasR, whereas the acc BC, fas IA, and fas IB transcript levels were influenced by temperature. Transcription of the...”
- “...affected, in agreement with Nickels research [ 23 ]. In this study, the expression of cg0812 is a compensation for FasR deletion and is not affected by temperature. However, fas IA transcript was influenced by temperature. Transcriptional regulator FasR binds to five upstream regions of the...”
Metabolic Engineering of Corynebacterium glutamicum for the Production of Flavonoids and Stilbenoids
Chu, Molecules (Basel, Switzerland) 2024
- “...60 ]. In recent years, episomal overexpression of accBC ( cg0802 ) and accD1 ( cg0812 ) was replaced by the TetR-type transcriptional repressor FasR ; it effectively increases malonyl-CoA availability and accumulation of the flavonoid naringenin. FasR not only repressed the expression of fas-IA (...”
- “...lead to the deregulation of the expression of accBC ( cg0802 ) and accD1 ( cg0812 ). Therefore, FasR has a significant role in improving malonyl-CoA availability in cytosol of C. glutamicum ( Figure 5 ) [ 56 ]. Glucose was used as carbon source for...”
Functional Genomics Uncovers Pleiotropic Role of Rhomboids in Corynebacterium glutamicum
Luenenschloss, Frontiers in microbiology 2022
- “...the earlier assumed peptidoglycan remodeling. Lipid Transport and Metabolism Acetyl/propionyl-CoA carboxylase (Cg0802) and Acetyl-CoA carboxylase (Cg0812) decreased in the MF, whereas 3-oxoacyl-[acyl-carrier protein] reductase Fas-IB (Cg0957) increased in the MF, but decreased in the CF at 30 and 40C, yet 3-oxoacyl-[acyl-carrier protein] reductase Fas-IA (Cg2743) increased...”
- “...acids to mycolic acid, respectively. The former consists of the subunits AccbC (Cg0802) and AccD1 (Cg0812), the latter of AccbC (Cg0802), AccD2 (Cg0811), AccD3 (Cg3177), and AccE (Cg0810) ( Gande et al., 2007 ). The malonyl-CoA is utilized for fatty acid synthesis with Fas-IB (Cg0957) or...”
Comprehensive Analysis of C. glutamicum Anaplerotic Deletion Mutants Under Defined d-Glucose Conditions
Kappelmann, Frontiers in bioengineering and biotechnology 2020
- “...2.79e-08 CAF20737 cg3008 porA Porin 0.48 7.16e-06 CAF19986 cg1451 serA Phosphoglycerate dehydrogenase 0.43 5.03e-30 CAF19413 cg0812 dtsR1 Acetyl/ propionyl-CoA carboxylase beta chain 0.42 1.34e-13 All proteins with significant changes [p < 0.05, Log2(fold change) > 0.5 for upregulated proteins and Log2(fold change) < 0.5 for down-regulated...”
Tailoring Corynebacterium glutamicum towards increased malonyl-CoA availability for efficient synthesis of the plant pentaketide noreugenin
Milke, Microbial cell factories 2019
- “...flux into the tricarboxylic acid (TCA) cycle, whereas episomal overexpression of accBC (cg0802) and accD1 (cg0812) encoding the two subunits of the acetyl-CoA carboxylase complex (ACC)hardly increased product titers. In C. glutamicum , transcription of accBC and accD1 is controlled by the transcriptional repressor FasR [...”
Regulation of the pstSCAB operon in Corynebacterium glutamicum by the regulator of acetate metabolism RamB
Sorger-Herrmann, BMC microbiology 2015
- “...ATPase 5.2 cg1650 pctC , ABC transporter, permease 5.2 cg2868 nucH , putative nuclease 5.4 cg0812 accD1 , acetyl-CoA carboxylase subunit 11.3 cg1568 ugpA , glycerol 3-phosphate ABC transporter, permease 31.2 a Gene identifiers and annotations are given according to BX927147 b The mRNA levels were...”
The global repressor SugR controls expression of genes of glycolysis and of the L-lactate dehydrogenase LdhA in Corynebacterium glutamicum
Engels, Journal of bacteriology 2008
- “...fragment) sugR, transcriptional regulator of sugar metabolism cg0812 cg0957 cg2116 cg1290 cg3218 cg1763 cg1112 cg0791 cg0634 cg2430 cg1111 cg3227 cg2419 cg1379...”
The alternative sigma factor SigB of Corynebacterium glutamicum modulates global gene expression during transition from exponential growth to stationary phase
Larisch, BMC genomics 2007
- “...cg0699 guaB2 inositol-monophosphate dehydrogenase, CBS domain -1.07 cg0756 cstA putative carbon starvation protein A -1.61 cg0812 dtsR1 acetyl/propionyl-CoA carboxylase beta chain -1.24 cg1790 pgk phosphoglycerate kinase -1.06 cg1791 gap glyceraldehyde-3-phosphate dehydrogenase -2.01 cg2704 sugar ABC-transporter, permease component -1.38 cg2705 amyE sugar ABC-transporter, binding protein -1.42 cg3096...”
More
In Vivo Roles of Fatty Acid Biosynthesis Enzymes in Biosynthesis of Biotin and α-Lipoic Acid in Corynebacterium glutamicum
Ikeda, Applied and environmental microbiology 2017
- “...so that accBC (Cgl0700, NCgl0670) and accD1 (Cgl0708, NCgl0678) were constitutively expressed under the promoter of the endogenous gapA gene (Fig. S2). For the...”
Altered acetylation and succinylation profiles in Corynebacterium glutamicum in response to conditions inducing glutamate overproduction
Mizuno, MicrobiologyOpen 2016
- “...condition likely explains the enrichment of acetylated proteins in this category (Table 2 ). DtsR1 (NCgl0678) encoding a subunit of acetylCoA carboxylase showed the most drastic change in protein abundance (34.1fold decrease in the glutamate producing condition). AccBC (NCgl0670) and DtsR2 (NCgl0677), the other subunits of...”
The DeoR-type transcriptional regulator SugR acts as a repressor for genes encoding the phosphoenolpyruvate:sugar phosphotransferase system (PTS) in Corynebacterium glutamicum
Gaigalat, BMC molecular biology 2007
- “...cg2030 NCgl1735 - 1.31 10.61 Hypothetical protein cg1761 NCgl1500 nifS2 1.19 13.00 Cysteine desulfhydrase cg0812 NCgl0678 dtsR1 1.18 13.13 Acetyl/propionyl-CoA carboxylase, beta chain cg3112 NCgl2713 cysZ 1.15 12.19 Sulfate transporter cg0898 NCgl0754 - 1.14 11.73 Pyridoxine biosynthesis enzyme cg2033 NCgl1738 - 1.12 10.89 Putative secreted protein...”
Two-component systems of Corynebacterium glutamicum: deletion analysis and involvement of the PhoS-PhoR system in the phosphate starvation response
Kocan, Journal of bacteriology 2006
- “...NCgl0635 NCgl0636 NCgl0637 NCgl0639 cg0812 cg0921 cg0922 NCgl0678 NCgl0773 NCgl0774 cg0924 NCgl0776 cg0926 cg0927 cg0928 cg0957 cg1120 cg1121 cg1343 cg1344...”

R0L7C1 Propionyl-CoA carboxylase beta chain, mitochondrial (Fragment) from Anas platyrhynchos
29% identity, 90% coverage

Proteomic Analysis of Two Weight Classes of Mule Duck "foie gras" at the End of an Overfeeding Period
Lo, Frontiers in physiology 2020
- “...Enzyme Anapl_07826 5,14E03 1,79 R0L3F2 MTTP Microsomal triglyceride transfer protein Cytoplasm Transporter Anapl_12362 2,26E06 1,55 R0L7C1 PCCB Propionyl-CoA carboxylase subunit beta Cytoplasm Enzyme PCCB 6,83E05 2,06 U3I002 HSD17B10 Hydroxysteroid 17-beta dehydrogenase 10 Cytoplasm Enzyme HSD17B10 3,71E04 1,59 U3IA20 EHHADH Enoyl-CoA hydratase and 3-hydroxyacyl CoA dehydrogenase Cytoplasm...”

NP_824507, SAV_3331 propionyl-CoA carboxylase, beta subunit from Streptomyces avermitilis MA-4680
29% identity, 79% coverage

SAV742, a Novel AraC-Family Regulator from Streptomyces avermitilis, Controls Avermectin Biosynthesis, Cell Growth and Development
Sun, Scientific reports 2016
- “...acid biosynthesis and degradation: accA3 (sav_3337 , encoding the alpha subunit of acyl-CoA carboxylase), accD4 (sav_3331 , encoding the beta subunit of acyl-CoA carboxylase), fadD5 (sav_1258 , encoding a putative acyl-CoA synthetase/long chain fatty acid: CoA ligase), fadA6 (sav_7026 , encoding a putative 3-ketoacyl-CoA thiolase/acetyl-CoA acetyltransferase)...”
The role of acyl-coenzyme A carboxylase complex in lipstatin biosynthesis of Streptomyces toxytricini
Demirev, Applied microbiology and biotechnology 2010
- “...15443; ScoPccB, PccB of S. coelicolor A3(2) (NP_629079), SavPccB; PccB of S . avermitilis MA-4680 (NP_824507); SprPccB, PccB of S. pristinaespiralis ATCC 25486 (ZP_03173623); SclPccB; PccB of S. clavuligerus ATCC 27064 (ZP_03182649), MtbAccD5, AccD5 of Mycobacterium tuberculosis H37Rv (NP_217797); MboAccD5, AccD5 of M. bovis AF 2122/97...”

E7EX59 Propionyl-CoA carboxylase beta chain, mitochondrial from Homo sapiens
28% identity, 85% coverage

Mitochondrial H⁺-ATP synthase in human skeletal muscle: contribution to dyslipidaemia and insulin resistance
Formentini, Diabetologia 2017
- “...SV=1 0.40 Q9Y305 Acyl-coenzyme A thioesterase 9, mitochondrial OS= Homo sapiens GN=ACOT9 PE=1 SV=2 0.24 E7EX59 Propionyl-CoA carboxylase beta chain, mitochondrial OS= Homo sapiens GN=PCCB PE=1 SV=1 0.17 Amino acid metabolism Q02252 Methylmalonate-semialdehyde dehydrogenase [acylating], mitochondrial OS= Homo sapiens GN=ALDH6A1 PE=1 SV=2 0.60 P35914 Hydroxymethylglutaryl-CoA lyase,...”

jk0139 acyl-CoA carboxylase, beta subunit from Corynebacterium jeikeium K411
31% identity, 80% coverage

Complete genome sequence and analysis of the multiresistant nosocomial pathogen Corynebacterium jeikeium K411, a lipid-requiring bacterium of the human skin flora
Tauch, Journal of bacteriology 2005
- “...of this enzyme (jk1551 [accD1], jk1662 [accD2]), and jk0139 [accD3]). In addition, 11 fadD genes encoding fatty acyl-CoA synthetases were identified in the C....”

5iniF / A0ACI9 Structural basis for acyl-coa carboxylase-mediated assembly of unusual polyketide synthase extender units incorporated into the stambomycin antibiotics (see paper)
29% identity, 79% coverage

Ligand: hexanoyl-coenzyme a (5iniF)

8sgxE / A0A640KR17 Leishmania tarentolae propionyl-coa carboxylase (alpha-4-beta-6) (see paper)
27% identity, 89% coverage

Ligand: 5-(hexahydro-2-oxo-1h-thieno[3,4-d]imidazol-6-yl)pentanal (8sgxE)

CRM90_05925 acyl-CoA carboxylase subunit beta from Mycobacterium sp. ENV421
31% identity, 80% coverage

Genomic Analysis of Propane Metabolism in Methyl Tert-Butyl Ether-Degrading Mycobacterium Sp. Strain ENV421
Tupa, Journal of genomics 2018
- “...pathway 22 . The presence of many short fatty acid CoA ligases, propionyl-CoA carboxylases (CRM90_03095, CRM90_05925), and methylmalonyl CoA mutases (CRM90_15015, CRM90_15020) in the genome supports this notion. Although growth on 2-propanol was not detected, ENV421 can grow on acetone, the oxidation product of 2-propanol by...”

AO271_04260 acyl-CoA carboxylase subunit beta from Corynebacterium diphtheriae
29% identity, 90% coverage

Analysis of Corynebacterium diphtheriae macrophage interaction: Dispensability of corynomycolic acids for inhibition of phagolysosome maturation and identification of a new gene involved in synthesis of the corynomycolic acid layer
Ott, PloS one 2017
- “...DIP0657 accE Acetyl-CoA carboxylase subunit B178_02711 AO271_00195 AOT42_01520 DIP2188 - Propionyl CoA carboxylase beta B178_09863 AO271_04260 AO271_04260 DIP2183 mmpL1 Putative drug exporter of the RND superfamily B178_09823 AO271_04230 AOT42_05820 DIP0250 mmpL2 Putative drug exporter of the RND superfamily B178_00902B178_00917 AO271_09785 AOT42_10445 DIP1118 - Integral membrane protein...”

ACCD4_MYCTU / O53578 Biotin-dependent long chain acyl-coenzyme A carboxylase beta4 subunit; EC 2.1.3.- from Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv) (see 3 papers)
Rv3799c PROBABLE PROPIONYL-CoA CARBOXYLASE BETA CHAIN 4 ACCD4 (PCCASE) (PROPANOYL-COA:CARBON DIOXIDE LIGASE) from Mycobacterium tuberculosis H37Rv
29% identity, 88% coverage

function: Component of a biotin-dependent acyl-CoA carboxylase complex. This subunit transfers the CO2 from carboxybiotin to the CoA ester substrate (PubMed:16354663, PubMed:28222482). When associated with the alpha3 subunit AccA3, the beta5 subunit AccD5 and the epsilon subunit AccE5, forms the LCC complex, which is involved in the carboxylation of long chain acyl-CoA (PubMed:16354663, PubMed:28222482). The LCC complex can use C16-C24 substrates, the highest specific activity is obtained with carboxy-C20-CoA (PubMed:28222482). Has low activity with acetyl- CoA and propionyl-CoA (PubMed:16354663).
subunit: The biotin-dependent long-chain acyl-CoA carboxylase (LCC) complex is composed of AccA3, which contains the biotin carboxylase (BC) and biotin carboxyl carrier protein (BCCP) domains, and AccD4, which contains the carboxyl transferase (CT) domain (PubMed:16354663, PubMed:28222482). The complex also contains the beta5 subunit AccD5 and the epsilon subunit AccE5. The four subunits are essential for activity, but AccD5, together with AccE5, probably plays a structural role rather than a catalytic one (PubMed:28222482).
Polyphosphate kinase-1 regulates bacterial and host metabolic pathways involved in pathogenesis of Mycobacterium tuberculosis
Chugh, Proceedings of the National Academy of Sciences of the United States of America 2024
- “...ACC family of enzymes. These included AccA1 (Rv2501c), AccD1 (Rv2502c), AccA2 (Rv0973c), AccD2 (Rv0974c), AccD4 (Rv3799c), AccD5 (Rv3280), and AccE5 (Rv3281) ( SI Appendix , Table S1 and Dataset S1 ). Since polyP has been demonstrated to replace ATP as a phosphate donor in various metabolic...”
Revolutionizing control strategies against Mycobacterium tuberculosis infection through selected targeting of lipid metabolism
Kim, Cellular and molecular life sciences : CMLS 2023
- “...Drug Regulation Function accA3 rv3285 H Down accD4- pks13fadD32 rv3799c, rv3800c, rv3801c H Down accD6 rv2247 H VAN Up Down acpM rv2244 H, Thiolactomycin Up...”
Molecular Mechanisms of MmpL3 Function and Inhibition
Williams, Microbial drug resistance (Larchmont, N.Y.) 2023
- “...red) and is formed by the acyl-CoA carboxylase complex consisting of AccA3 (Rv3285) and AccD4 (Rv3799c). 42 Along the other branch, C 1618 short chain FAs are elongated by the -ketoacyl acyl carrier protein (ACP) synthase mtFabH (Rv0533c), which condenses a malonyl substrate, carried by the...”
The pathogenic mechanism of Mycobacterium tuberculosis: implication for new drug development
Yan, Molecular biomedicine 2022
- “...9 dfrA (Rv2763c) Dihydrofolate reductase DHFR [ 336 ] Synthesis of nucleic acid 10 accD4 (Rv3799c) AccD4-containing acyl-CoA carboxylase [ 337 ] Biosynthesis of mycolic acids 11 fabH (Rv0533c) [ 338 ] 3-oxoacyl-ACP synthase III, FabH Synthesis of mycolic acid (responsible for initiation of FAS II...”
Identification of Mycobacterium tuberculosis Antigens with Vaccine Potential Using a Machine Learning-Based Reverse Vaccinology Approach
Teahan, Vaccines 2021
- “...(Rv3682), PonA1 (Rv0050), FadD15 (Rv2187), LdtB (Rv2518c), PbpB (Rv2163c), FadD30 (Rv0404), FbpC (Ag85C) (Rv0129c), AccD4 (Rv3799c), FadD32 (Rv3801c), hypothetical protein Rv3811 (Rv3811), LprQ (Rv0483), PbpA (Rv0016c), FadD19 (Rv3515c) DNA Repair RecA (Rv2737c), HtpG (Rv2299c), UvrA (Rv1638), LigD (Rv0938), RecG (Rv2973c), UvrB (Rv1633) Interaction with host immune...”
- “...IleS (Rv1536), LprG (Rv1411c) Response to acidic pH FadD13 (Rv3089), Tgs4 (Rv3088), Icl1 (Rv0467), AccD4 (Rv3799c) Response to hypoxia GroEL2 (Rv0440), PonA1 (Rv0050), Tgs4 (Rv3088), Icl1 (Rv0467), AccD4 (Rv3799c), PE_PGRS11 (Rv0754), Tuf (Rv0685), SdhA (Rv3318), probable succinate dehydrogenase (Rv0248c) Response to nitrosative or oxidative stress Mpa...”
Phylogenomic Reappraisal of Fatty Acid Biosynthesis, Mycolic Acid Biosynthesis and Clinical Relevance Among Members of the Genus Corynebacterium
Dover, Frontiers in microbiology 2021
- “...p96927 -Hydroxyacyl-acp dehydratase subunit FAS-II hadC Rv0637 501 p9wfj9 -Hydroxyacyl-acp dehydratase subunit MA condensation accD4 Rv3799c 1,569 o53578 Biotin-dependent long chain acyl-amp carboxylase beta4 subunit MA condensation pks13 Rv3800c 5,202 o53579 Polyketide synthase MA condensation fadD32 Rv3801c 1914 o53580 Long-chain-fatty-acid-amp ligase MA condensation accD5 Rv3280 1,647...”
The influence of AccD5 on AccD6 carboxyltransferase essentiality in pathogenic and non-pathogenic Mycobacterium
Pawelczyk, Scientific reports 2017
- “...suggested that among the six carboxyltransferases in M. tuberculosis AccD6 (Rv2247), AccD5 (Rv3280) and AccD4 (Rv3799c) are essential for cell viability 13 14 and are expressed at high levels during mycolic acid biosynthesis 14 15 . Thus, in recent years, efforts have been made to identify...”
- “...vivo studies are necessary to conclusively establish the functional role of AccD5 in mycobacteria. AccD4 (Rv3799c) remains the least characterized mycobacterial carboxyltransferase. A Corynebacterium glutamicum mutant devoid of an accD4 homolog exhibited a mycolate-less phenotype and a lack of tetradecylmalonic acid, the predicted product of the...”
A systematic review of East African-Indian family of Mycobacterium tuberculosis in Brazil
Duarte, The Brazilian journal of infectious diseases : an official publication of the Brazilian Society of Infectious Diseases 2017
- “...Rv3711c Rv3711c_491t>C NS 13 4156503 Rv3711c Rv3711c_227g>A NS 13 4182695 Rv3731 Rv3731_938g>A NS 13 4255922 Rv3799c Rv3799c_27t>C S 34 S, synonymous; NS, non-synonymous. Our systematic review of the literature regarding EAI occurrence in studies of Mtb diversity performed in Brazil yielded 175 articles, of which 14...”
More

DIP2188 propionyl-CoA carboxylase complex B subunit from Corynebacterium diphtheriae NCTC 13129
29% identity, 90% coverage

Analysis of Corynebacterium diphtheriae macrophage interaction: Dispensability of corynomycolic acids for inhibition of phagolysosome maturation and identification of a new gene involved in synthesis of the corynomycolic acid layer
Ott, PloS one 2017
- “...carboxylase carboxyl transferase subunit B178_03318B178_03323 AO271_01375 AOT42_07885 DIP0657 accE Acetyl-CoA carboxylase subunit B178_02711 AO271_00195 AOT42_01520 DIP2188 - Propionyl CoA carboxylase beta B178_09863 AO271_04260 AO271_04260 DIP2183 mmpL1 Putative drug exporter of the RND superfamily B178_09823 AO271_04230 AOT42_05820 DIP0250 mmpL2 Putative drug exporter of the RND superfamily B178_00902B178_00917...”

cg3177 propionyl-CoA carboxylase beta chain from Corynebacterium glutamicum ATCC 13032
NCgl2772 acyl-CoA carboxylase subunit beta from Corynebacterium glutamicum ATCC 13032
28% identity, 88% coverage

Functional Genomics Uncovers Pleiotropic Role of Rhomboids in Corynebacterium glutamicum
Luenenschloss, Frontiers in microbiology 2022
- “...the subunits AccbC (Cg0802) and AccD1 (Cg0812), the latter of AccbC (Cg0802), AccD2 (Cg0811), AccD3 (Cg3177), and AccE (Cg0810) ( Gande et al., 2007 ). The malonyl-CoA is utilized for fatty acid synthesis with Fas-IB (Cg0957) or Fas-IA (Cg2743). Isolated Fas-IA synthesizes stearate and oleate, while...”
Genome Sequence of the Bacteriophage CL31 and Interaction with the Host Strain Corynebacterium glutamicum ATCC 13032
Hünnefeld, Viruses 2021
- “...2) Cg0811 C -> T Gly350Asp 728777 97.7% missense MB001 CP005959 pccB ( accD 3) Cg3177 C -> T Gly341Asp 2831759 95.4% missense WT BX927147 pks Cg3178 A -> T Tyr886Asp 3038431 100% missense...”
Genome-wide identification of novel genes involved in Corynebacteriales cell envelope biogenesis using Corynebacterium glutamicum as a model
de, PloS one 2020
- “...cg3173 (HP), 18: cg3174 (CmpL1 mycolic acid transporter), 19: cg3175 (HMP), 20: cg3176 (HP), 20: cg3177 (AccD3, subunit of Acyl-CoA carboxylase complex, mycolic acid biosynthesis), 21: cg3178 (Cg-Pks, mycolic acid condensase), 22: cg3179 (Cg-FadD2, fatty acyl-AMP ligase, mycolic acid biosynthesis), 23: cg3180 (Elrf, envelope lipid composition...”
Metabolic Engineering of Shikimic Acid-Producing Corynebacterium glutamicum From Glucose and Cellobiose Retaining Its Phosphotransferase System Function and Pyruvate Kinase Activities
Sato, Frontiers in bioengineering and biotechnology 2020
- “...normalized transcriptional level of each mRNA was calculated using the relative quantification method using the cg3177 (Ncgl2772) gene as the housekeeping gene. Statistical Analysis Analysis of variance (ANOVA) was conducted with Honestly Significant Difference (HSD) test by EZR software ( Kanda, 2013 ). The data of...”
Development of a novel platform for recombinant protein production in Corynebacterium glutamicum on ethanol
Yu, Synthetic and systems biotechnology 2022
- “...as described previously [ 26 ], and the 2 Ct method was adopted with gyrb (NCgl2772) as the housekeeping gene. The level of each gene in the wild-type strain was defined as 1.0. 2.6 CRISPRi-based regulation of genes involved in the EUT pathway To block the...”
Metabolic Engineering of Shikimic Acid-Producing Corynebacterium glutamicum From Glucose and Cellobiose Retaining Its Phosphotransferase System Function and Pyruvate Kinase Activities
Sato, Frontiers in bioengineering and biotechnology 2020
- “...transcriptional level of each mRNA was calculated using the relative quantification method using the cg3177 (Ncgl2772) gene as the housekeeping gene. Statistical Analysis Analysis of variance (ANOVA) was conducted with Honestly Significant Difference (HSD) test by EZR software ( Kanda, 2013 ). The data of shikimic...”
Identification and validation of appropriate reference genes for qRT-PCR analysis in Corynebacterium glutamicum
Wang, FEMS microbiology letters 2018 (PubMed)
- “...stages, the most appropriate reference genes are Ncgl2772 and leua, which encode acetyl-CoA carboxylase beta subunit and 2-isopropylmalate synthase, separately....”
- “...optimal minimum number of reference genes is 3, with Ncgl2772, gyrb encoding DNA gyrase B and siga encoding RNA polymerase sigma factor A as the most suitable...”

W6NU27 Propionyl-CoA carboxylase beta chain, mitochondrial from Haemonchus contortus
33% identity, 59% coverage

Proteomic identification of galectin-11 and 14 ligands from Haemonchus contortus
Sakthivel, PeerJ 2018
- “...27.22 46 6 477 No Yes No Yes 0.18 0.0028 40.0 No 2 / 4 W6NU27 Carboxyl transferase GN=HCOI_00766300 25.83 67 6 909 No Yes No Yes 4.35 0.0023 42.2 No 1 / 0 W6NKM1 Succinate dehydrogenase iron-sulfur subunit, GN=HCOI_01735500 32.61 64 8 521 No Yes...”

MSMEG_6391, MSMEI_6223 acyl-CoA carboxylase subunit beta from Mycolicibacterium smegmatis MC2 155
A0R616 Propionyl-CoA carboxylase beta chain from Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
MSMEG_6391 propionyl-CoA carboxylase beta chain from Mycobacterium smegmatis str. MC2 155
30% identity, 77% coverage

Interactome Analysis Identifies MSMEI_3879 as a Substrate of Mycolicibacterium smegmatis ClpC1
Ogbonna, Microbiology spectrum 2023
- “...synthase) 0.023 43.000 A0QSG5 rplR , MSMEG_1471, MSMEI_1435 50S ribosomal protein L18 0.032 6.500 A0R616 MSMEG_6391, MSMEI_6223 Propionyl-CoA carboxylase beta chain (EC 6.4.1.3) 0.039 9.500 a The normalized score is the percentage of the total ion score of a single run attributable to a given protein....”
- “...MSMEI_4153 AMP-binding enzyme 0.03 0.03 A0QYS3 MSMEG_3767, MSMEI_3678 Acyl-CoA synthase 0.07 0.09 A0R616 accD4 , MSMEG_6391, MSMEI_6223 Propionyl-CoA carboxylase beta chain (EC 6.4.1.3) 0.04 0.05 A0QQ22 fadD2 , MSMEG_0599, MSMEI_0583 Acyl-CoA synthase 0.01 0.02 A0R0B4 kasA , MSMEG_4327, MSMEI_4227 3-Oxoacyl-[acyl-carrier-protein] synthase 1 (EC 2.3.1.41) 0.06 0.06...”
- “...0.023 43.000 A0QSG5 rplR , MSMEG_1471, MSMEI_1435 50S ribosomal protein L18 0.032 6.500 A0R616 MSMEG_6391, MSMEI_6223 Propionyl-CoA carboxylase beta chain (EC 6.4.1.3) 0.039 9.500 a The normalized score is the percentage of the total ion score of a single run attributable to a given protein. Normalized...”
- “...AMP-binding enzyme 0.03 0.03 A0QYS3 MSMEG_3767, MSMEI_3678 Acyl-CoA synthase 0.07 0.09 A0R616 accD4 , MSMEG_6391, MSMEI_6223 Propionyl-CoA carboxylase beta chain (EC 6.4.1.3) 0.04 0.05 A0QQ22 fadD2 , MSMEG_0599, MSMEI_0583 Acyl-CoA synthase 0.01 0.02 A0R0B4 kasA , MSMEG_4327, MSMEI_4227 3-Oxoacyl-[acyl-carrier-protein] synthase 1 (EC 2.3.1.41) 0.06 0.06 Noncanonical...”
Interactome Analysis Identifies MSMEI_3879 as a Substrate of Mycolicibacterium smegmatis ClpC1
Ogbonna, Microbiology spectrum 2023
- “...polyketide synthase) 0.023 43.000 A0QSG5 rplR , MSMEG_1471, MSMEI_1435 50S ribosomal protein L18 0.032 6.500 A0R616 MSMEG_6391, MSMEI_6223 Propionyl-CoA carboxylase beta chain (EC 6.4.1.3) 0.039 9.500 a The normalized score is the percentage of the total ion score of a single run attributable to a given...”
- “...0.02 A0R042 MSMEG_4254, MSMEI_4153 AMP-binding enzyme 0.03 0.03 A0QYS3 MSMEG_3767, MSMEI_3678 Acyl-CoA synthase 0.07 0.09 A0R616 accD4 , MSMEG_6391, MSMEI_6223 Propionyl-CoA carboxylase beta chain (EC 6.4.1.3) 0.04 0.05 A0QQ22 fadD2 , MSMEG_0599, MSMEI_0583 Acyl-CoA synthase 0.01 0.02 A0R0B4 kasA , MSMEG_4327, MSMEI_4227 3-Oxoacyl-[acyl-carrier-protein] synthase 1 (EC...”
An in vivo crosslinking system for identifying mycobacterial protein-protein interactions.
Lougheed, Journal of microbiological methods 2014
- “...protein DnaK 9 A4ZHR8 MSMEG1842 Adenosylhomocysteinase 3 A0QTE7 MSMEG_1813 Propionyl-CoA carboxylase beta chain a 2 A0R616 MSMEG_6391 Propionyl-CoA carboxylase beta chain a 2 a Known biotinylated proteins. We believe that our system for the expression of tagged target proteins in mycobacteria combined with in vivo crosslinking...”
Understanding Metabolic Remodeling in Mycobacterium smegmatis to Overcome Energy Exigency and Reductive Stress Under Energy-Compromised State
Patil, Frontiers in microbiology 2021
- “...such as fabD (MSMEG_4325), kasA (MSMEG_4327), kasB (MSMEG_4328), mabA (MSMEG_3150), accA3 (acetyl-CoA carboxylase; MSMEG_1807), accD4 (MSMEG_6391), accD6 (MSMEG_4329), and fas (MSMEG_4757) is observed in the atpD knock-out strain as compared to the wild-type and the complemented strain ( Figure 4A ). The observed downregulation in the...”
- “...such as fabD (MSMEG_4325), kasA (MSMEG_4327), kasB (MSMEG_4328), mabA (MSMEG_3150), accA3 (acetyl-CoA carboxylase; MSMEG_1807), accD4 (MSMEG_6391), accD6 (MSMEG_4329), and fas (MSMEG_4757) in M. smegmatis wild-type (WT), atpD knock-out ( atpD ), and atpD -complemented ( atpD C ) strains. The transcript level in each case is...”
Mycobacteriophage Fruitloop gp52 inactivates Wag31 (DivIVA) to prevent heterotypic superinfection
Ko, Molecular microbiology 2018
- “...Wag31, or proteins known to interact with Wag31 complexes including CwsA (MSMEG_0023), AccA3 (MSMEG_1807), AccD4 (MSMEG_6391), and AccD5 (MSMEG_1813), were overexpressed and tested for their ability to rescue M. smegmatis from Fruitloop gp52 toxicity ( Fig. 2D ). Overexpression of Wag31 clearly results in rescue of...”
- “...(MSMEG_1807 , coordinates 1883433 1885229 complement, with start codon changed from GTG to ATG), accD4 (MSMEG_6391 , coordinates 6455190 6456743 complement, with start codon changed from GTG to ATG), AccD5 MSMEG_1813 , coordinates 1888497 1890125), and cwsA (MSMEG_0023 , coordinates 44692 45102) genes of M. smegmatis...”
Protein Composition of Mycobacterium smegmatis Differs Significantly Between Active Cells and Dormant Cells With Ovoid Morphology
Trutneva, Frontiers in microbiology 2018
- “...active cells, there are additional unique enzymes in the dormant cell proteome: MSMEG_1821, MSMEG_1813, MSMEG_6008, MSMEG_6391, MSMEG_2938, MSMEG_5184, and MSMEG_6511). Similarly, enzymes with proteolytic activity were found in both types of cells. However, proteolytic enzymes are more diverse and more represented in the dormant cell proteome....”
The influence of AccD5 on AccD6 carboxyltransferase essentiality in pathogenic and non-pathogenic Mycobacterium
Pawelczyk, Scientific reports 2017
- “...assessed the essentiality of accD1 accD6 in Msm by directed mutagenesis and found that only MSMEG_6391 and MSMEG_1813 ( Mtb accD4 and accD5 homologs, respectively) are essential for survival 14 . The TLC/autoradiography analysis of [ 14 C]acetate-labeled FAMEs and MAMEs extracted from the accD1 Msm...”
- “...Msm , AccD2 Msm and AccD3 Msm are not essential for FAS I/FAS II pathway. MSMEG_6391 (AccD4) carboxylates long-chain substrates only, enabling mycolic acid maturation The above-described results suggested that the search for an alternative acetyl-CoA carboxyltransferase in Msm should be focused on two essential acyl...”
An in vivo crosslinking system for identifying mycobacterial protein-protein interactions
Lougheed, Journal of microbiological methods 2014
- “...DnaK 9 A4ZHR8 MSMEG1842 Adenosylhomocysteinase 3 A0QTE7 MSMEG_1813 Propionyl-CoA carboxylase beta chain a 2 A0R616 MSMEG_6391 Propionyl-CoA carboxylase beta chain a 2 a Known biotinylated proteins. We believe that our system for the expression of tagged target proteins in mycobacteria combined with in vivo crosslinking is...”

MAB_0181 Propionyl-CoA carboxylase, beta subunit (PccB) from Mycobacterium abscessus ATCC 19977
29% identity, 77% coverage

Mycobacterium abscessus extracellular vesicles increase mycobacterial resistance to clarithromycin in vitro
Vermeire, Proteomics 2024 (secret)

O3I_000760 acyl-CoA carboxylase subunit beta from Nocardia brasiliensis ATCC 700358
31% identity, 78% coverage

Complete genome sequence analysis of Nocardia brasiliensis HUJEG-1 reveals a saprobic lifestyle and the genes needed for human pathogenesis
Vera-Cabrera, PloS one 2013
- “...The ortholog of accD4 in N. brasiliensis is an acyl-CoA carboxylase that is encoded by O3I_000760, which is 71% homologous to accD4 of MTB and 94% homologous to those of N. farcinica IFM 10152 and N. cyriacigeorgica GUH-2. This gene is located immediately after the pks13...”

MAP2000 AccD6 from Mycobacterium avium subsp. paratuberculosis str. k10
31% identity, 75% coverage

The Fur-like regulatory protein MAP3773c modulates key metabolic pathways in Mycobacterium avium subsp. paratuberculosis under in-vitro iron starvation
Thapa, Scientific reports 2024
- “...those in K-10 were MAP2309c (pdhA) , a pyruvate dehydrogenase with fold change of 2.64, MAP2000 (accD6, acetyl CoA carboxylase) with fold change of 2.60 times, MAP1999 (kasB_1, ketoacyl-ACP synthase) with fold change 2.52, MAP1372 (pks11, polyketide synthase) with fold change 2.46, MAP1925 (fadD15, acyl-CoA synthase)...”
- “...The genes involved in this pathway are shown including MAP2309c (pdhA), a pyruvate dehydrogenase , MAP2000 (acetyl CoA carboxylase), MAP1999 (3- oxoacyl ACP synthase), MAP1372 (3-oxoacyl synthase), MAP1925 (fadD15, CoA ligase), MAP3650 (enoyl CoA hydratase) all of which are downregulated in MAP3773c at 30min post-iron starvation....”

ACCD6_MYCTU / P9WQH5 Biotin-dependent acetyl-/propionyl-coenzyme A carboxylase beta6 subunit; Acetyl-CoA carboxylase; ACC; Propionyl-CoA carboxylase; PCC; EC 2.1.3.15; EC 2.1.3.- from Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv) (see 3 papers)
Rv2247 ACETYL/PROPIONYL-CoA CARBOXYLASE (BETA SUBUNIT) ACCD6 from Mycobacterium tuberculosis H37Rv
NP_216763 acetyl-/propionyl-CoA carboxylase subunit beta from Mycobacterium tuberculosis H37Rv
BCG_2264 Acetyl/propionyl-CoA carboxylase subunit beta accD6 from Mycobacterium bovis BCG str. Pasteur 1173P2
30% identity, 75% coverage

function: Component of a biotin-dependent acyl-CoA carboxylase complex. This subunit transfers the CO2 from carboxybiotin to the CoA ester substrate (PubMed:17114269). When associated with the alpha3 subunit AccA3, is involved in the carboxylation of acetyl-CoA and propionyl- CoA, with a preference for acetyl-CoA (PubMed:17114269).
catalytic activity: N(6)-carboxybiotinyl-L-lysyl-[protein] + acetyl-CoA = N(6)- biotinyl-L-lysyl-[protein] + malonyl-CoA (RHEA:54728)
catalytic activity: N(6)-carboxybiotinyl-L-lysyl-[protein] + propanoyl-CoA = methylmalonyl-CoA + N(6)-biotinyl-L-lysyl-[protein] (RHEA:66612)
subunit: Homodimer (PubMed:25092705). The biotin-dependent acyl-CoA carboxylase complex is composed of AccA3, which contains the biotin carboxylase (BC) and biotin carboxyl carrier protein (BCCP) domains, and AccD6, which contains the carboxyl transferase (CT) domain (PubMed:17114269). The AccA3/AccD6 complex forms a dodecamer (PubMed:17114269).
disruption phenotype: Essential. Cannot be deleted. Limited expression level affects growth, mycolic acid content and cell morphology.
Comparative Proteomic Analysis of Cell Wall Proteins of Aminoglycosides Resistant and Sensitive Mycobacterium tuberculosis Clinical Isolates
Sharma, Current protein & peptide science 2024 (PubMed)
- “...belonged to intermediary metabolism and respiration; Rv2115c to the cell wall and cell processes; Rv2501c, Rv2247 and Rv0295c to lipid metabolism; and Rv2416c to virulence, detoxification/adaptation. Notably, variations in these proteins support cell wall integrity, aiding mycobacteria's establishment and proliferation. Molecular docking study revealed that both...”
Association between two-component systems gene mutation and Mycobacterium tuberculosis transmission revealed by whole genome sequencing
Li, BMC genomics 2023
- “...C820G), Rv1747 T1102C, Rv1057 C1168T, Rv3764c ( tcrY , C284A), Rv0982 ( mprB , G910A), Rv2247 (accD6, G567A, T600C), Rv1027c ( KdpE , G178A, C626A), Rv3245c ( mtrB , A971G, G1110A), and Rv3765c (tcrX, G293C) (Additional file 2: Table S25 ). The results showed that 36...”
- “...G1151T), Rv1747 C20T, Rv3765c ( tcrX , C45G), Rv1057 C585A, Rv1032c ( trcS , G977T), Rv2247 ( accD6 , G957A), and Rv3245c ( mtrB , T33C) (Additional file 2: Table S7 ). The results showed that 30 SNPs increased the risk of transmission of lineage4. Table...”
Intrabacterial lipid inclusion-associated proteins: a core machinery conserved from saprophyte Actinobacteria to the human pathogen Mycobacterium tuberculosis
Dargham, FEBS open bio 2023
- “...MMAR_4856 MUL_0445 ML2185 RopRjos Rv3130c tgs1 Triacylglycerol synthase Nonessential MSMEG_5242 MAB_3551c MMAR_1519 MUL_2420 ML1244 RopRjos Rv2247 accD6 Acetyl/propionylCoA carboxylase Growth defect MSMEG_4329 MAB_1876c MMAR_3340 MUL_1302 ML1657 The first 16 include Rv0242c (FabG4), Rv0243 (FadA2), Rv0270 (FadD2), Rv1206 (FadD6), Rv1483 (FabG1), Rv2187 (FadD15), Rv0468 (FadB2), Rv3229c (DesA3),...”
- “...Rv0154c (FadE2), Rv2244 (AcpM), Rv3800c (Pks13), Rv2524c (Fas), Rv0400c (FadE7), Rv0824c (DesA1), Rv2501c (AccA1), and Rv2247 (AccD6). Three additional proteins, Rv1544, Rv3720, and Rv0437c, annotated as putative ketoacyl reductase, fattyacylphospholipid synthase, and phosphatidylserine decarboxylase, respectively, were also identified. A simplified representation of the potential implication of...”
Telacebec Interferes with Virulence Lipid Biosynthesis Protein Expression and Sensitizes to Other Antibiotics
Zhou, Microorganisms 2023
- “...Fold Change (Telacebec/Control) Cell wall biosynthesis and cell process Rv2950c FadD29 Long-chain-fatty-acid-AMP ligase 0.02887 0.677371423 Rv2247 AccD6 Acetyl-/propionyl-CoA carboxylase subunit beta 0.03024 0.641045938 Rv2930 FadD26 Fatty-acid-AMP ligase 0.03297 0.685370986 Rv3130c Tgs1 Diacylglycerol O-acyltransferase 0.03431 1.258329713 Rv2524c Fas Fatty acid synthase 0.03723 0.754112466 Rv2932 PpsB Phthiocerol synthesis...”
Revolutionizing control strategies against Mycobacterium tuberculosis infection through selected targeting of lipid metabolism
Kim, Cellular and molecular life sciences : CMLS 2023
- “...Down accD4- pks13fadD32 rv3799c, rv3800c, rv3801c H Down accD6 rv2247 H VAN Up Down acpM rv2244 H, Thiolactomycin Up Triclosan Down acpS rv2523c H Up desA1,...”
Phylogenomic Reappraisal of Fatty Acid Biosynthesis, Mycolic Acid Biosynthesis and Clinical Relevance Among Members of the Genus Corynebacterium
Dover, Frontiers in microbiology 2021
- “...-Ketoacyl-[acyl-carrier protein] synthase 1 FAS-II kasB Rv2246 1,317 p9wqd7 -Ketacyl-[acyl-carrier protein] synthase 2 FAS-II accD6 Rv2247 1,422 p9wqh5 Acetyl/propionyl-Coa carboxylase (beta subunit) FAS-II fabG1 Rv1483 744 p9wgt3 -Ketoacyl-[acyl-carrier protein] reductase FAS-II inhA Rv1484 810 p9wgr1 NADH-dependent enoyl-[acyl-carrier-protein] reductase FAS-II hadA Rv0635 477 p9wfk1 -Hydroxyacyl-acp dehydratase subunit...”
- “...H 4 unit. Malonyl CoA is formed by the complex that contains AccA3 and AccD6 (Rv2247) using an acetyl-CoA primer ( Dover et al., 2004 ; Marrakchi et al., 2014 ). Some polyketides incorporate methyl-branches by inclusion of a C 3 H 7 unit derived from...”
Zinc limitation triggers anticipatory adaptations in Mycobacterium tuberculosis
Dow, PLoS pathogens 2021
- “...cysK1 Cysteine synthase a (CysK1) -1.65 -1.43 Rv3734c tgs2 Putative triacylglycerol synthase (Tgs2) -1.65 -1.13 Rv2247 accD6 Acetyl/propionyl-CoA carboxylase, beta subunit (AccD6) -1.66 -1.97 Rv3149 nuoE Probable NADH dehydrogenase I, chain E (NuoE) -1.72 -1.62 Rv0250c Rv0250c Conserved protein -1.94 -1.37 Rv1566c Rv1566c Possible Inv protein...”
Lineage-Specific Proteomic Signatures in the Mycobacterium tuberculosis Complex Reveal Differential Abundance of Proteins Involved in Virulence, DNA Repair, CRISPR-Cas, Bioenergetics and Lipid Metabolism
Yimer, Frontiers in microbiology 2020
- “...subunit) AccD2 accD2 Rv0974c 4, 7 3, 5 Propionyl-CoA carboxylase beta chain 6 AccD6 accD6 Rv2247 4, 7 3, 5 Malonyl CoA-acyl carrier protein transacylase fadD Rv0166 5, 7 3, 4 Long-chain-fatty-acidAMP ligase FadD32 fadD32 fadD32 5, 7 3, 4 Galactofuranosyltransferase GlfT2 GlfT2 Rv3808c 5, 7...”
More
AccD6, a key carboxyltransferase essential for mycolic acid synthesis in Mycobacterium tuberculosis, is dispensable in a nonpathogenic strain.
Pawelczyk, Journal of bacteriology 2011
- GeneRIF: AccD6 is essential for M. tuberculosis, it can be deleted in Mycobacterium smegmatis without affecting its cell envelope integrity.
Expression, purification and preliminary crystallographic analysis of Rv2247, the β subunit of acyl-CoA carboxylase (ACCD6) from Mycobacterium tuberculosis.
Niu, Acta crystallographica. Section F, Structural biology and crystallization communications 2011
- GeneRIF: two forms of Mycobacterium tuberculosis ACCD6 crystals belonged to space groups P4(1)2(1)2 and P2(1)2(1)2(1) and diffracted to 2.9 and 2.5 A resolution, respectively, at a synchrotron-radiation source
Phylogenomic Reappraisal of Fatty Acid Biosynthesis, Mycolic Acid Biosynthesis and Clinical Relevance Among Members of the Genus Corynebacterium
Dover, Frontiers in microbiology 2021
- “...synthase 1 FAS-II kasB Rv2246 1,317 p9wqd7 -Ketacyl-[acyl-carrier protein] synthase 2 FAS-II accD6 Rv2247 1,422 p9wqh5 Acetyl/propionyl-Coa carboxylase (beta subunit) FAS-II fabG1 Rv1483 744 p9wgt3 -Ketoacyl-[acyl-carrier protein] reductase FAS-II inhA Rv1484 810 p9wgr1 NADH-dependent enoyl-[acyl-carrier-protein] reductase FAS-II hadA Rv0635 477 p9wfk1 -Hydroxyacyl-acp dehydratase subunit FAS-II hadB...”
The unfoldase ClpC1 of Mycobacterium tuberculosis regulates the expression of a distinct subset of proteins having intrinsically disordered termini
Lunge, The Journal of biological chemistry 2020 (secret)
InbR, a TetR family regulator, binds with isoniazid and influences multidrug resistance in Mycobacterium bovis BCG
Yang, Scientific reports 2015
- “...1.18 2.18 Rv2030c hypothetical protein BCG_2050c 1.84 1.94 Rv2031c hspX heat shock protein hspX 17 BCG_2264 1.04 1.94 Rv2247 accD6 acetyl/propionyl CoA carboxylase subunit beta NA BCG_2265 1.71 2.98 Rv2248 hypothetical protein BCG_2266 1.79 3.04 Rv2248 hypothetical protein BCG_2267c 2.28 Rv2249c glpD1 glycerol-3-phosphate dehydrogenase glpd1 BCG_2268c...”

PA1400 probable pyruvate carboxylase from Pseudomonas aeruginosa PAO1
31% identity, 45% coverage

Scalable and Chromatography-Free Synthesis of Efflux Pump Inhibitor Phenylalanine Arginine β-Naphthylamide for Its Validation in Wild-Type Bacterial Strains
Russo, ChemMedChem 2023
- “...our laboratory, including another general laboratory strain K799 [ 49 ] and two clinical isolates, PA1400, isolated from a patient with septicemia, and PA1651, isolated from a patient with cystic fibrosis. To narrow the scope of our experimentation, we focused on L,L-PAN 1 and D,D-PAN 1d...”
- “...absence of EPI was 0.5 g/mL instead of 1 g/mL for the laboratory strains. In PA1400, 1d was again mildly more potent than the L,L-isomer 1 , as 40 g/mL of 1 only provided a 2-fold potentiation while the same concentration of 1d provided 8-fold potentiation....”
The opportunistic pathogen Pseudomonas aeruginosa exploits bacterial biotin synthesis pathway to benefit its infectivity
Shi, PLoS pathogens 2023
- “.... aeruginosa . Genome-wide mining of P . aeruginosa reveals five putative biotinylated enzymes, namely PA1400, PA2012, PA2891, PA4847, and PA5435 ( S1 Table ). D. Streptavidin blot analyses for crude extracts of E . coli and P . aeruginosa . Unlike E . coli displaying...”
- “...with the presence of multiple biotinylated proteins. E. SDS-PAGE (12%) profile for three biotinylated enzymes (PA1400, PA2012, and PA2891). Three of five predictive biotinylated enzymes were overexpressed, purified, and judged with SDS-PAGE (12%). F. Western blot analysis of the three recombinant proteins (PA1400, PA2012, and PA2891)...”
Diastereoselective synthesis of cyclic tetrapeptide pseudoxylallemycin A illuminates the impact of base during macrolactamization
Fumo, Organic & biomolecular chemistry 2023
- “...aeruginosa, Strain PAK, NR-51337 and Pseudomonas aeruginosa, Strain Pa1400, NR-51335. We thank the Hancock Laboratory at the University of British Columbia for...”
Periodically Disturbing the Spatial Structure of Biofilms Can Affect the Production of an Essential Virulence Factor in Pseudomonas aeruginosa
Quinn, mSystems 2021
- “...obtained through BEI Resources, NIAID, NIH: Pseudomonas aeruginosa strains Shr42, NR-48982, EnvKY1, NR-51329, MX0560, NR-51334, Pa1400, NR-51335, Pa1651, NR-51336, PAK, NR-51337, Pa1414, and NR-51345. We thank Roberto Kolter for his kind gift of the pel strain, Natasha Kirienko for her kind gift of the pvd strain,...”
Comparative Genomic Analyses Reveal Core-Genome-Wide Genes Under Positive Selection and Major Regulatory Hubs in Outlier Strains of Pseudomonas aeruginosa
Sood, Frontiers in microbiology 2019
- “...et al., 2017 ). The outlier strains showed five major hubs namely gltB (glutamate synthase), PA1400 (pyruvate carboxylase), polA (DNA polymerase I), gacS (histidine kinase) and guaA (GMP synthase) whereas the classical strains had gltB, dnaK (chaperone protein), guaB (inosine 5-monophosphate dehydrogenase), hemE (uroporphyrin decarboxylase) and...”
- “...Outliers gltB 239 Glutamate synthase Provides glutamate for the glutamine synthetase reaction, absent in animals PA1400 221 Pyruvate carboxylase Irreversible carboxylation of pyruvate to form oxaloacetate (OAA) polA 171 DNA polymerase I Prokaryotic DNA replication gacS 159 Histidine kinase Play a role in signal transduction across...”
General and condition-specific essential functions of Pseudomonas aeruginosa
Lee, Proceedings of the National Academy of Sciences of the United States of America 2015
- “...oxidoreductase (mqoA, mqoB, PA1252), pyruvate carboxylase (PA1400, PA5435-PA5436), and isocitrate dehydrogenase (icd, idh). Lee et al. Concluding Remarks....”
Structure and function of a single-chain, multi-domain long-chain acyl-CoA carboxylase
Tran, Nature 2015
- “...(strain PA14) as the model organism. The P. aeruginosa enzyme (locus name PA14_46320, homolog of PA1400 in P. aeruginosa PAO1) shares 59% amino acid sequence identity with R. palustris LCC. This organism also carries the multi-subunit ACC, MCC and geranyl-CoA carboxylase (GCC) 24 , 25 ,...”
Microcolony formation by the opportunistic pathogen Pseudomonas aeruginosa requires pyruvate and pyruvate fermentation
Petrova, Molecular microbiology 2012
- “...Gene Fold change Gene Fold change PA0927, ldhA 6.73 PA1580, gltA 24.24 PA5170, arcD 6.68 PA1400 (PycA) 5.12 PA0795, prpC 13.64 PA5171, arcA 3.38 PA0854, fumC2 9.55 PA1562, acnA 39.69 PA5172, arcB 3.18 PA5046 (Mdh) 3.38 PA1787, acnB 10.05 PA5173, arcC 5.28 PA4333 (Fum) 8.33 PA2624,...”
More

CC_3214 carbamoyl-phosphate synthase/carboxyl transferase from Caulobacter crescentus CB15
30% identity, 48% coverage

Characterization of the SOS regulon of Caulobacter crescentus
da, Journal of bacteriology 2008
- “...0.0 CC_1468* CC_3130* CC_2878.1 CC_2589 CC_1928 CC_1086 CC_3214 CC_1665* CC_2433* a b c Inosine-uridinepreferring nucleoside hydrolase Sensory box protein...”

F8WBI9 Propionyl-CoA carboxylase beta chain, mitochondrial from Homo sapiens
31% identity, 62% coverage

Haptoglobin Induces a Specific Proteomic Profile and a Mature-Associated Phenotype on Primary Human Monocyte-Derived Dendritic Cells.
Torres, International journal of molecular sciences 2022
- “...II protein complex binding ITGAE P38570 Integrin alpha-E MA Integrin and metal ion binding PCCB F8WBI9 Propionyl-CoA carboxylase beta chain, mitochondrial MA Ligase activity DHX38 Q92620 Pre-mRNA-splicing factor ATP-dependent RNA helicase PRP16 MA i. RNA and nucleic acid binding ii. Helicase and ATP hydrolisis activity HMGCS1...”

CRM90_03095 acyl-CoA carboxylase subunit beta from Mycobacterium sp. ENV421
30% identity, 73% coverage

Genomic Analysis of Propane Metabolism in Methyl Tert-Butyl Ether-Degrading Mycobacterium Sp. Strain ENV421
Tupa, Journal of genomics 2018
- “...methylmalonyl-succinate pathway 22 . The presence of many short fatty acid CoA ligases, propionyl-CoA carboxylases (CRM90_03095, CRM90_05925), and methylmalonyl CoA mutases (CRM90_15015, CRM90_15020) in the genome supports this notion. Although growth on 2-propanol was not detected, ENV421 can grow on acetone, the oxidation product of 2-propanol...”

MSMEG_4329 propionyl-CoA carboxylase beta chain from Mycobacterium smegmatis str. MC2 155
MSMEG_4329 acyl-CoA carboxylase subunit beta from Mycolicibacterium smegmatis MC2 155
30% identity, 73% coverage

Intrabacterial lipid inclusion-associated proteins: a core machinery conserved from saprophyte Actinobacteria to the human pathogen Mycobacterium tuberculosis
Dargham, FEBS open bio 2023
- “...Triacylglycerol synthase Nonessential MSMEG_5242 MAB_3551c MMAR_1519 MUL_2420 ML1244 RopRjos Rv2247 accD6 Acetyl/propionylCoA carboxylase Growth defect MSMEG_4329 MAB_1876c MMAR_3340 MUL_1302 ML1657 The first 16 include Rv0242c (FabG4), Rv0243 (FadA2), Rv0270 (FadD2), Rv1206 (FadD6), Rv1483 (FabG1), Rv2187 (FadD15), Rv0468 (FadB2), Rv3229c (DesA3), Rv0154c (FadE2), Rv2244 (AcpM), Rv3800c (Pks13),...”
Understanding Metabolic Remodeling in Mycobacterium smegmatis to Overcome Energy Exigency and Reductive Stress Under Energy-Compromised State
Patil, Frontiers in microbiology 2021
- “...fabD (MSMEG_4325), kasA (MSMEG_4327), kasB (MSMEG_4328), mabA (MSMEG_3150), accA3 (acetyl-CoA carboxylase; MSMEG_1807), accD4 (MSMEG_6391), accD6 (MSMEG_4329), and fas (MSMEG_4757) is observed in the atpD knock-out strain as compared to the wild-type and the complemented strain ( Figure 4A ). The observed downregulation in the FAS-I and...”
- “...fabD (MSMEG_4325), kasA (MSMEG_4327), kasB (MSMEG_4328), mabA (MSMEG_3150), accA3 (acetyl-CoA carboxylase; MSMEG_1807), accD4 (MSMEG_6391), accD6 (MSMEG_4329), and fas (MSMEG_4757) in M. smegmatis wild-type (WT), atpD knock-out ( atpD ), and atpD -complemented ( atpD C ) strains. The transcript level in each case is compared with...”
Key Transitions in the Evolution of Rapid and Slow Growing Mycobacteria Identified by Comparative Genomics
Bachmann, Frontiers in microbiology 2019
- “...COG4178 ABC-type uncharacterized transport system MSMEG_3873 CobJ COG1010 Precorrin-3B methylase MSMEG_4286 LipA COG0320 Lipoate synthase MSMEG_4329 COG4799 Acetyl-CoA carboxylase, carboxyltransferase component MSMEG_4342 GloB COG0491 Zn-dependent hydrolases, including glyoxylases MSMEG_4484 COG1512 Beta-propeller domains of methanol dehydrogenase type MSMEG_4487 Fur COG0735 Fe2 + /Zn2 + uptake regulation proteins...”
The influence of AccD5 on AccD6 carboxyltransferase essentiality in pathogenic and non-pathogenic Mycobacterium
Pawelczyk, Scientific reports 2017
- “.... Unexpectedly, we also demonstrated that the homologous gene in the fast-growing, non-pathogenic M. smegmatis MSMEG_4329 ( accD6 Msm ) is dispensable for mycobacterial growth and that its deletion did not influence the fatty/mycolic acid content, challenging its role in malonyl-CoA synthesis in this species 14...”
- “...strain - M. smegmatis (Msm ) - have unequivocally proved that the accD6 homolog - MSMEG_4329 ( accD6 Msm ) - is dispensable in this bacterium and that gene disruption has no effect on the mutant lipid content or cell envelope integrity, thus raising questions regarding...”
Monitoring global protein thiol-oxidation and protein S-mycothiolation in Mycobacterium smegmatis under hypochlorite stress
Hillion, Scientific reports 2017
- “...Acyl-CoA thioesterase (R)DGDVFC 21 (+484)IREPEPNTIER(L) MSMEG_1813 AccD5 Propionyl-CoA carboxylase beta chain (R)VEGRPVGIVANQPTQFAGC 356 (+484)LDINASEK(A) 11,49 MSMEG_4329 AccD6 Acetyl/propionyl-CoA carboxylase (R)LGGC 294 (+484)LNSESAEK(S) 12,96 Metabolism of nucleotides MSMEG_2299 NrdE2 Ribonucleoside-diphosphate reductase (K)ITHSNLC 380 (+484)SEILQVSTPSEFNDDLSYAK(V) MSMEG_1602 GuaB Inosine-5-monophosphate dehydrogenase (K)VGVGPGSIC 325 (+484)TTR(V) 19,34 MSMEG_3634 GuaB2 Inosine-5-monophosphate dehydrogenase (K)VGVGPGAmC...”
- “...15,4 50,0 MSMEG_4328 kasB2 3-oxoacyl-(Acyl-carrier-protein) synthase 1 227 B 26,0 11,7 36,0 12,2 21,6 34,9 MSMEG_4329 accD6 Acetyl/propionyl-CoA carboxylase (Beta SU) 191 B 19,5 14,2 32,7 14,6 28,2 38,4 213 E 15,7 13,8 27,1 294 (MSH) B 13,0 9,6 20,3 MSMEG_4920 MSMEG_4920 Acetyl-CoA acetyltransferase 107* B...”
Mycobacteriophage SWU1 gp39 can potentiate multiple antibiotics against Mycobacterium via altering the cell wall permeability
Li, Scientific reports 2016
- “...AcpM, lipid metabolism MSMEG_4328 4.14 Rv2246 KasB, lipid metabolism MSMEG_4325 3.75 Rv2243 FadD, lipid metabolism MSMEG_4329 3.50 Rv2247 AccD6, lipid metabolism MSMEG_3580 2.70 Rv0129c lipid metabolism MSMEG_6179 2.12 Rv3667 lipid metabolism MSMEG_2078 2.01 Rv1886c lipid metabolism MSMEG_1387 3.64 Rv0672 involved in lipid degradation MSMEG_1388 4.16 Rv0673...”
Characterization of Mycobacterium smegmatis sigF mutant and its regulon: overexpression of SigF antagonist (MSMEG_1803) in M. smegmatis mimics sigF mutant phenotype, loss of pigmentation, and sensitivity to oxidative stress
Singh, MicrobiologyOpen 2015
- “...150 MSMEG_3945 Universal stress protein family 2.60/0.40 GGTGN 16 GGGCC 571 MSMEG_3983 Lcarnitine dehydratase 2.35/1.16 MSMEG_4329 PropionylCoA carboxylase beta chain 2.36/0.49 GGTGN 16 GGGCC 1037 MSMEG_4424 Endoribonuclease LPSP 3.48/1.03 MSMEG_4618 Isochorismatase family protein 3.08/0.79 MSMEG_5100 Pyruvate ferredoxin/flavodoxin oxidoreductase 3.82/0.72 GGTGN 15 GGGGA 361 MSMEG_5180 Conserved hypothetical...”
Organism-specific rRNA capture system for application in next-generation sequencing
Li, PloS one 2013
- “...MSMEG_2389 ( Figure 3B ). However, both methods caused a significant transcript level reduction in MSMEG_4329 (propionyl-CoA carboxylase subunit beta) and MSMEG_4290 ( glnA ). 10.1371/journal.pone.0074286.g003 Figure 3 Integrity of mRNA after rRNA depletion was determined by real-time PCR. The expression level of rRNA and 14...”
More

SACE_3154 biotin carboxylase from Saccharopolyspora erythraea NRRL 2338
31% identity, 46% coverage

A novel multidomain acyl-CoA carboxylase in Saccharopolyspora erythraea provides malonyl-CoA for de novo fatty acid biosynthesis
Livieri, Scientific reports 2019
- “...to CT domains of geranyl-CoA and methylcrotonyl-CoA carboxylases, respectively 21 . The CT domain of SACE_3154 clusters in group III together with other CT domains from long-chain acyl-CoA carboxylases (LCC) that are formed by a unique polypeptide chain and that have been previously described in mycobacteria...”
- “...ACC in S. erythraea . S. erythraea also has a smaller putative multidomain acyl-CoA carboxylase, SACE_3154. This protein is an orthologue of other carboxylases already described in different groups of bacteria like Pseudomonas and Mycobacterium 22 . Remarkably, biochemical and structural differences were found between SACE_4237...”

MMAR_3340 acetyl/propionyl-CoA carboxylase (beta subunit) AccD6 from Mycobacterium marinum M
30% identity, 73% coverage

Intrabacterial lipid inclusion-associated proteins: a core machinery conserved from saprophyte Actinobacteria to the human pathogen Mycobacterium tuberculosis
Dargham, FEBS open bio 2023
- “...Nonessential MSMEG_5242 MAB_3551c MMAR_1519 MUL_2420 ML1244 RopRjos Rv2247 accD6 Acetyl/propionylCoA carboxylase Growth defect MSMEG_4329 MAB_1876c MMAR_3340 MUL_1302 ML1657 The first 16 include Rv0242c (FabG4), Rv0243 (FadA2), Rv0270 (FadD2), Rv1206 (FadD6), Rv1483 (FabG1), Rv2187 (FadD15), Rv0468 (FadB2), Rv3229c (DesA3), Rv0154c (FadE2), Rv2244 (AcpM), Rv3800c (Pks13), Rv2524c (Fas),...”

MUL_1302 acetyl/propionyl-CoA carboxylase (beta subunit) AccD6 from Mycobacterium ulcerans Agy99
30% identity, 73% coverage

Intrabacterial lipid inclusion-associated proteins: a core machinery conserved from saprophyte Actinobacteria to the human pathogen Mycobacterium tuberculosis
Dargham, FEBS open bio 2023
- “...MSMEG_5242 MAB_3551c MMAR_1519 MUL_2420 ML1244 RopRjos Rv2247 accD6 Acetyl/propionylCoA carboxylase Growth defect MSMEG_4329 MAB_1876c MMAR_3340 MUL_1302 ML1657 The first 16 include Rv0242c (FabG4), Rv0243 (FadA2), Rv0270 (FadD2), Rv1206 (FadD6), Rv1483 (FabG1), Rv2187 (FadD15), Rv0468 (FadB2), Rv3229c (DesA3), Rv0154c (FadE2), Rv2244 (AcpM), Rv3800c (Pks13), Rv2524c (Fas), Rv0400c...”

MAB_1876c Probable propionyl-CoA carboxylase beta chain 6 from Mycobacterium abscessus ATCC 19977
30% identity, 73% coverage

Mycobacterium abscessus extracellular vesicles increase mycobacterial resistance to clarithromycin in vitro
Vermeire, Proteomics 2024 (secret)
Intrabacterial lipid inclusion-associated proteins: a core machinery conserved from saprophyte Actinobacteria to the human pathogen Mycobacterium tuberculosis
Dargham, FEBS open bio 2023
- “...synthase Nonessential MSMEG_5242 MAB_3551c MMAR_1519 MUL_2420 ML1244 RopRjos Rv2247 accD6 Acetyl/propionylCoA carboxylase Growth defect MSMEG_4329 MAB_1876c MMAR_3340 MUL_1302 ML1657 The first 16 include Rv0242c (FabG4), Rv0243 (FadA2), Rv0270 (FadD2), Rv1206 (FadD6), Rv1483 (FabG1), Rv2187 (FadD15), Rv0468 (FadB2), Rv3229c (DesA3), Rv0154c (FadE2), Rv2244 (AcpM), Rv3800c (Pks13), Rv2524c...”
Biotin-dependent cell envelope remodelling is required for Mycobacterium abscessus survival in lung infection
Sullivan, Nature microbiology 2023
- “...model than in the input library: a pyruvate carboxylase, MAB_3267c , and an acetyl-CoA/propionyl-CoA carboxylase, MAB_1876c . Pyruvate carboxylase is essential for induction of biotin synthesis in mycobacteria 51 , so we instead focused on whether an activity catalyzed by the acetyl-CoA/propionyl-CoA carboxylase gene is more...”
- “...Data Figure 3E ) including MAB_3643, which is the multifunctional biotin-bound protein that associates with MAB_1876c 52 , suggesting that propionate acts downstream of biotin and enables cell proliferation despite low biotin levels. Further, cholesterol, a biologically relevant source of propionate for mycobacteria 53 , rescues...”

AAA25676.1 methylmalonyl-CoA carboxyltransferase subunit 12S monomer from Propionibacterium freudenreichii subsp. shermanii (see paper)
28% identity, 80% coverage

MAP2372 AccD4_2 from Mycobacterium avium subsp. paratuberculosis str. k10
29% identity, 91% coverage

Comparative genomic analysis of Mycobacterium avium subspecies obtained from multiple host species
Paustian, BMC genomics 2008
- “...MAP-12 20 MAP2178 MAP2196 HOM, AV-SI MAP_RD4 LSPP12 MAP-13 21 MAP2325 MAP2325 S 3 22 MAP2372 MAP2375c AV-SI (5001, 6006, 6058, ATCC49884) MAP2523c MAP2532 HOM (5835cc, 5836cc) 23 MAP2751 MAP2769c HOM, AV-SI MAP_RD5 LSPP13 MAP-14 24 MAP2963c MAP2965c HOM, AV-SI Unnamed MAP-15 25 MAP3067c MAP3079c AV-SI...”

ML1657 acetyl/propionyl CoA carboxylase [beta] subunit from Mycobacterium leprae TN
29% identity, 73% coverage

Intrabacterial lipid inclusion-associated proteins: a core machinery conserved from saprophyte Actinobacteria to the human pathogen Mycobacterium tuberculosis
Dargham, FEBS open bio 2023
- “...MAB_3551c MMAR_1519 MUL_2420 ML1244 RopRjos Rv2247 accD6 Acetyl/propionylCoA carboxylase Growth defect MSMEG_4329 MAB_1876c MMAR_3340 MUL_1302 ML1657 The first 16 include Rv0242c (FabG4), Rv0243 (FadA2), Rv0270 (FadD2), Rv1206 (FadD6), Rv1483 (FabG1), Rv2187 (FadD15), Rv0468 (FadB2), Rv3229c (DesA3), Rv0154c (FadE2), Rv2244 (AcpM), Rv3800c (Pks13), Rv2524c (Fas), Rv0400c (FadE7),...”

PA14_46320 putative pyruvate carboxylase from Pseudomonas aeruginosa UCBPP-PA14
31% identity, 45% coverage

Structure and function of a single-chain, multi-domain long-chain acyl-CoA carboxylase
Tran, Nature 2015
- “...using Pseudomonas aeruginosa (strain PA14) as the model organism. The P. aeruginosa enzyme (locus name PA14_46320, homolog of PA1400 in P. aeruginosa PAO1) shares 59% amino acid sequence identity with R. palustris LCC. This organism also carries the multi-subunit ACC, MCC and geranyl-CoA carboxylase (GCC) 24...”
- “...an LCC deletion mutant in P. aeruginosa A markerless deletion was generated for the gene PA14_46320 in P. aeruginosa PA14 using previously described methods 42 . Briefly, ~1 kb flanking regions for PA14_46320 were amplified using primers listed in Extended Data Table 3 and recombined into...”

4g2rB / P9WQH5 Crystal structure of the carboxyltransferase subunit of acc (accd6) in complex with inhibitor haloxyfop from mycobacterium tuberculosis (see paper)
30% identity, 75% coverage

Ligand: (2r)-2-(4-{[3-chloro-5-(trifluoromethyl)pyridin-2-yl]oxy}phenoxy)propanoic acid (4g2rB)

lpl2152 hypothetical protein from Legionella pneumophila str. Lens
26% identity, 69% coverage

The surfactant of Legionella pneumophila Is secreted in a TolC-dependent manner and is antagonistic toward other Legionella species
Stewart, Journal of bacteriology 2011
- “...lpc_1691 lpl2153 lpl2154 lpl2155 lpl2156 lpl2157 lpl2158 lpl2152 lpl2151 lpl2150 lpl2149 lpl2149 lpp2180 lpp2181 lpp2182 lpp2183 lpp2184 lpp2185 lpp2178 lpp2177...”

lpp2178 hypothetical protein from Legionella pneumophila str. Paris
26% identity, 69% coverage

The surfactant of Legionella pneumophila Is secreted in a TolC-dependent manner and is antagonistic toward other Legionella species
Stewart, Journal of bacteriology 2011
- “...lpl2149 lpp2180 lpp2181 lpp2182 lpp2183 lpp2184 lpp2185 lpp2178 lpp2177 lpp2176 lpp2175 lpp2175 lpg2228 lpg2229 lpg2230 --c lpg2231 lpg2232 lpg2227 lpg2226...”

B7TVP1 glutaconyl-CoA decarboxylase (EC 7.2.4.5) from [Clostridium] symbiosum (see paper)
24% identity, 87% coverage

DRA0310 carboxylase from Deinococcus radiodurans R1
30% identity, 45% coverage

Evolution of gene fusions: horizontal transfer versus independent events
Yanai, Genome biology 2002
- “...(COG0777); (b) subunit (domain) (COG0825). Protein designations are as in Figure 2 . The proteins DRA0310 and PA1400, in addition to the domains corresponding to the and subunits of acetyl-CoA carboxylase, contain a biotin carboxylase domain and a biotin carboxyl carrier protein domain. The clustering of...”

3gmaB / B7TVP1 Glutaconyl-coa decarboxylase a subunit from clostridium symbiosum co- crystallized with glutaryl-coa (see paper)
25% identity, 90% coverage

Ligand: glutaryl-coenzyme a (3gmaB)

LPC_1694 acetyl CoA carboxylase subunit alpha from Legionella pneumophila str. Corby
25% identity, 69% coverage

The surfactant of Legionella pneumophila Is secreted in a TolC-dependent manner and is antagonistic toward other Legionella species
Stewart, Journal of bacteriology 2011
- “...lpc_1695 lpc_1696 lpc_1697 lpc_1698 lpc_1699 lpc_1700 lpc_1694 lpc_1693 lpc_1692 lpc_1691 lpc_1691 lpl2153 lpl2154 lpl2155 lpl2156 lpl2157 lpl2158 lpl2152...”

lpg2227 acetyl CoA carboxylase alpha subunit from Legionella pneumophila subsp. pneumophila str. Philadelphia 1
25% identity, 69% coverage

Informatic analysis reveals Legionella as a source of novel natural products
Johnston, Synthetic and systems biotechnology 2016
- “...acids lol1 lpg2225 GH3-family auxin responsive protein 509 lol2 lpg2226 Isovaleryl CoA dehydrogenase 563 lol3 lpg2227 Propionyl-CoA carboxylase 479 lol4 lpg2228 3-oxoacyl-(acyl carrier protein) synthase III + 353 lol5 lpg2229 Acyl CoA synthetase + 581 lol6 lpg2230 Acyl CoA ligase + 464 lol7 lpg2231 3-oxoacyl reductase...”
The surfactant of Legionella pneumophila Is secreted in a TolC-dependent manner and is antagonistic toward other Legionella species
Stewart, Journal of bacteriology 2011
- “...lpp2175 lpp2175 lpg2228 lpg2229 lpg2230 --c lpg2231 lpg2232 lpg2227 lpg2226 lpg2225 lpg2223 lpg2223 a The genome databases are slightly divergent at this...”

D8WWL0 Putative carboxyl transferase (Fragment) from Clostridia bacterium enrichment culture clone BF
25% identity, 88% coverage

A benzene-degrading nitrate-reducing microbial consortium displays aerobic and anaerobic benzene degradation pathways
Atashgahi, Scientific reports 2018
- “...100 Putative 6-oxocyclohex-1-ene-1-carbonyl-CoA hydratase BzdY D8WWK5 93 BF pimE Contig-100_24_2 BF 70 Putative carboxyl transferase D8WWL0 91 BF pimB Contig-100_24_7 BF 67 3-ketoacyl-CoA thiolase A0A0F2JL78 78 Desulfosporosinus sp. I2 acd Contig-100_40_1 Desulfosporosinus youngiae 100 Putative acyl-CoA dehydrogenase D8WWL1 84 BF gcdB Contig-100_40_5 Desulfosporosinus youngiae 100 Sodium...”

H16_A3290 biotin carboxylase from Ralstonia eutropha H16
H16_A3290 acetyl-CoA carboxylase family protein from Cupriavidus necator H16
29% identity, 42% coverage

Detection of phase-dependent transcriptomic changes and Rubisco-mediated CO2 fixation into poly (3-hydroxybutyrate) under heterotrophic condition in Ralstonia eutropha H16 based on RNA-seq and gene deletion analyses
Shimizu, BMC microbiology 2013
- “...similar expression behaviors to each other. The expression levels of accA2 (H16_A2142, BC-BCCP) and accC3 (H16_A3290, BC-BCCP-CT) were negligible throughout cultivation on fructose. The genes fabHDG - acpP - fabF (H16_A2569-A2565), fabZ (H16_A2044), and fabI1 (H16_A2410), which are involved in de novo fatty acid biosynthesis, were...”

GSU3299 carboxyl transferase domain protein from Geobacter sulfurreducens PCA
28% identity, 63% coverage

Evolution of electron transfer out of the cell: comparative genomics of six Geobacter genomes
Butler, BMC genomics 2010
- “...0.91 NADH dehydrogenase I, D subunit 39995452 GSU0343 0.91 NADH dehydrogenase I, F subunit 39998388 GSU3299 0.91 carboxyl transferase domain protein 39996631 GSU1531 0.90 phosphoribosyl-AMP cyclohydrolase 39996591 GSU1491 0.90 type IV pilus biogenesis protein PilB 39997632 GSU2537 0.90 arginine decarboxylase 39996434 GSU1332 0.90 heavy metal efflux...”

LA_2433 acetyl-CoA carboxylase carboxyltransferase component from Leptospira interrogans serovar lai str. 56601
27% identity, 79% coverage

Characterization of acetyl-CoA and propionyl-CoA carboxylases encoded by Leptospira interrogans serovar Lai: an initial biochemical study for leptospiral gluconeogenesis via anaplerotic CO(2) assimilation
Peng, Acta biochimica et biophysica Sinica 2012 (PubMed)
- “...site-directed mutagenesis analysis of its carboxyltransferase subunit (LA_2433) indicated that the A431 residue located at the bottom of the putative substrate...”
- “...acyl-CoA carboxylases [31-35] by five genes (LA_2432, LA_2433, LA_2736, LA_2735, and LA_3803), which inferred a partial 3-hydroxypropionate pathway for...”

LIC11517 acetyl-CoA carboxylase alpha subunit from Leptospira interrogans serovar Copenhageni str. Fiocruz L1-130
Q72S69 Acetyl-CoA carboxylase alpha subunit from Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
27% identity, 79% coverage

Surface proteomics and label-free quantification of Leptospira interrogans serovar Pomona
Techawiwattanaboon, PLoS neglected tropical diseases 2021
- “...lipL32 Q72SM7 LipL32 6 LIC10175 lic10175 Q72VX0 Uncharacterized protein 7 LIC11003 lipL71 Q72TL5 LipL71 8 LIC11517 accA2 Q72S69 Acetyl-CoA carboxylase alpha subunit 9 LIC11359 maoC Q72SM0 MaoC 10 LIC10754 rpoC Q72UA7 DNA-directed RNA polymerase subunit beta 11 LIC12875 tuf Q72NF9 Elongation factor Tu (EF-Tu) 12 LIC11781...”
Multilocus sequence analysis for typing Leptospira interrogans and Leptospira kirschneri
Leon, Journal of clinical microbiology 2010
- “...from http://jcm.asm.org/ on April 16, 2019 by guest LIC11517 Primer sequence (5-3)b This work received financial support from the Conseil General du Calvados,...”
Surface proteomics and label-free quantification of Leptospira interrogans serovar Pomona
Techawiwattanaboon, PLoS neglected tropical diseases 2021
- “...LipL32 6 LIC10175 lic10175 Q72VX0 Uncharacterized protein 7 LIC11003 lipL71 Q72TL5 LipL71 8 LIC11517 accA2 Q72S69 Acetyl-CoA carboxylase alpha subunit 9 LIC11359 maoC Q72SM0 MaoC 10 LIC10754 rpoC Q72UA7 DNA-directed RNA polymerase subunit beta 11 LIC12875 tuf Q72NF9 Elongation factor Tu (EF-Tu) 12 LIC11781 mdh P61975...”

FRAAL5672 Propionyl-CoA carboxylase beta chain 6 (PCCase) (Propanoyl-CoA:carbon dioxide ligase) from Frankia alni ACN14a
29% identity, 67% coverage

The Proteogenome of Symbiotic Frankia alni in Alnus glutinosa Nodules
Pujic, Microorganisms 2022
- “...FRAAL3158, FC = 0.23), a methyl-crotonoyl-CoA carboxylase (FRAAL2343, FC = 0.15) and two propionyl-CoA carboxylases (FRAAL5672, FC = 0.05; FRAAL1210, FC = 0.68). The only overabundant one was a phosphoribosylaminoimidazole carboxylase (FRAAL6664, FC = 4.9) involved in the synthesis of purines. A COG analysis ( Figure...”

blr3940 blr3940 from Bradyrhizobium japonicum USDA 110
26% identity, 86% coverage

Induction by Bradyrhizobium diazoefficiens of Different Pathways for Growth in D-mannitol or L-arabinose Leading to Pronounced Differences in CO₂ Fixation, O₂ Consumption, and Lateral-Flagellum Production
Cogo, Frontiers in microbiology 2018
- “...). We observed two such carboxylases in the MtlDP: a putative propionyl-CoA carboxylase beta chain (Blr3940; EC 6.4.1.3) was present in only the membrane-enriched fraction, and a 3-methylcrotonyl-CoA carboxylase (alpha subunit Blr 4421 along with a beta subunit Blr0986; EC 6.4.1.4) was upregulated in both the...”

6p7uC / P9WQH5 Crystal structure of the carboxyltransferase subunit of acc (accd6) in complex with inhibitor quizalofop-p from mycobacterium tuberculosis
28% identity, 73% coverage

Ligand: (2r)-2-{4-[(6-chloroquinoxalin-2-yl)oxy]phenoxy}propanoic acid (6p7uC)

gcdA / Q06700 GcdA (EC 7.2.4.5) from Acidaminococcus fermentans (strain ATCC 25085 / DSM 20731 / CCUG 9996 / CIP 106432 / VR4) (see 2 papers)
Q06700 glutaconyl-CoA decarboxylase (subunit 4/4) (EC 7.2.4.5) from Acidaminococcus fermentans (see 2 papers)
TC 3.B.1.1.3 / Q06700 GcdA, component of Na+-transporting glutaconyl-CoA decarboxylase from Acidaminococcus fermentans (see 4 papers)
Acfer_1817 carboxyl transferase from Acidaminococcus fermentans DSM 20731
24% identity, 83% coverage

substrates: Na+
Complete genome sequence of Acidaminococcus fermentans type strain (VR4)
Chang, Standards in genomic sciences 2010
- “...2-hydroxyglutaryl-CoA dehydratase D-components hgdAB (Acfer_1814 and 1815), CoA-substrate-specific enzyme activase (Acfer_1816), glutaconyl-CoA decarboxylase subunit gcdA (Acfer_1817), glutaconate CoA-transferase and subunits ( gctAB , Acfer_1819 and 1818). The glutaconyl-CoA decarboxylase , and -subunits: gcdB , gcdC and gcdD (Acfer_1834, Acfer_1835 and Acfer_1836) are encoded nearly 15kb upstream...”
- “...Acfer_1814 2-hydroxyglutaryl-CoA dehydratase ( subunit) Acfer_1815 2-hydroxyglutaryl-CoA dehydratase (subunit ) Acfer_1816 2-hydroxyglutaryl-CoA dehydratase activator protein Acfer_1817 glutaconyl-CoA decarboxylase subunit Acfer_1834 glutaconyl-CoA decarboxylase subunit Acfer_1835 glutaconyl-CoA decarboxylase subunit r Acfer_1836 glutaconyl-CoA decarboxylase sodium pump, subunit r Acfer_1477 acyl-CoA dehydrogenase domain protein Acfer_1575 acyl-CoA dehydrogenase domain protein Acfer_1583...”

WP_055469546 acyl-CoA carboxylase subunit beta from Streptomyces sp. NBRC 110030
29% identity, 86% coverage

Biosynthetic origin of butyrolactol A, an antifungal polyketide produced by a marine-derived Streptomyces
Harunari, Beilstein journal of organic chemistry 2017
- “...KOX41173 100/100 11 b WP_055469545 6,065 PKS FscE, Streptomyces cattleya , AEW99638 76/82 12 b WP_055469546 473 propionyl-CoA carboxylase subunit beta propionyl-CoA carboxylase subunit beta, Streptomyces sp. NRRL F-7442, KOX41172 99/99 13 WP_055469547 676 helix-turn-helix transcriptional regulator regulator, Streptomyces sp. NRRL F-7442, KOX41171 99/99 14 WP_055469666...”

HMPREF0389_01471 acyl-CoA carboxylase subunit beta from Filifactor alocis ATCC 35896
25% identity, 80% coverage

Proteome variation among Filifactor alocis strains
Aruni, Proteomics 2012
- “...N-domain protein 30.5 43/0.13 6 Unknown Precursor signal domain 1.96 N terminal signal sequence 37. HMPREF0389_01471 Glutaconyl coA decarboxylase 29.4 313/0.18 16 CM Acetyl CoA CT- N and C terminal domains Nonsecretory 38. HMPREF0389_ Glutamate racemase 29.4 42/0.12 6 EC-0.75 C-3.45 Aspartate glutamate racemase signature Nonsecretory...”
- “...Nonsecretory 50. HMPREF0389_00100 Glutamate racemase 29.4 47/0.06 10 EC-0.75 C-3.45 Aspartate glutamate racemase signature 51. HMPREF0389_01471 Glutaconyl coA decarboxylase 29.4 383/0.22 18 CM Acetyl CoA CT- N and C terminal domains 52. HMPREF0389_00119 Pyrroline-5-carboxylate reductase 28.8 10/0.07 2 C-9.95 P5CR domain Nonsecretory 53. HMPREF0389_00743 Electron transfer...”

A1DF70 Propionyl-CoA carboxylase beta chain, mitochondrial from Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
26% identity, 83% coverage

Molecular evolution of urea amidolyase and urea carboxylase in fungi
Strope, BMC evolutionary biology 2011
- “...Acc1 (Q00955) and Pyc (P11154), A. nidulans MccA (Q6T5L7), and Aspergillus related Neosartorya fischeri PccA (A1DF70) were used as query sequences. The urease sequence from A. fumigatus (Q6A3P9) was used as a query sequence to search for urease. We performed these searches against 56 bacterial genomes,...”

FN0204 Glutaconyl-CoA decarboxylase A subunit from Fusobacterium nucleatum subsp. nucleatum ATCC 25586
D5RC23 Glutaconyl-CoA decarboxylase subunit alpha from Fusobacterium nucleatum subsp. nucleatum (strain ATCC 23726 / VPI 4351)
24% identity, 83% coverage

Proteomics of Fusobacterium nucleatum within a model developing oral microbial community
Hendrickson, MicrobiologyOpen 2014
- “...pH 7.4. These differences included increased levels of the metabolic proteins gluaconyl-CoA decarboxylase A subunit (FN0204 in ATCC 25586) and phosphate acetyltransferase (FN1172), the important adhesion FomA (FN1859), RecA (FN0547), and the stress protein GroEL (FN0675). While we saw no changes in GroEL levels we saw...”
Quantitative Proteomic Analysis of Outer Membrane Vesicles from Fusobacterium nucleatum Cultivated in the Mimic Cancer Environment
Zhang, Microbiology spectrum 2023
- “...glutaconate CoA transferase subunit B (D5RC24), oxaloacetate decarboxylase gamma chain (D5RC28), glutaconyl-CoA decarboxylase subunit alpha (D5RC23), and putative glutaconyl-CoA decarboxylase subunit gamma (D5RC27), were significantly downregulated. Only 4-hydroxybutyrate coenzyme A transferase (D5RAM8) was downregulated in the 4-aminobutyric acid pathway. Furthermore, the synthesis of crotonyl-CoA was inhibited...”

Gbem_1453 carboxyl transferase from Geobacter bemidjiensis Bem
24% identity, 83% coverage

The genome of Geobacter bemidjiensis, exemplar for the subsurface clade of Geobacter species that predominate in Fe(III)-reducing subsurface environments
Aklujkar, BMC genomics 2010
- “...decarboxylation of glutaconyl-CoA may take place through the product of the adjacent gene ( gcdA Gbem_1453), which is 52% identical to the catalytic subunit of sodium-translocating glutaconyl-CoA decarboxylase of Acidaminococcus fermentans [ 44 ]. No homologs of the other three subunits were found in the G....”

MAP2873c hypothetical protein from Mycobacterium avium subsp. paratuberculosis str. k10
26% identity, 45% coverage

Key role for the alternative sigma factor, SigH, in the intracellular life of Mycobacterium avium subsp. paratuberculosis during macrophage stress
Ghosh, Infection and immunity 2013
- “...MAP2642 MAP3763c MAP2174c MAP2178 MAP3740 MAP3764c MAP2004 MAP2873c MAP1555c Rv0215c Rv3504 Rv1193 Rv2486 Rv1136 Rv3556c Rv1346 Rv1345 Rv2382c Rv1665 Rv3820c...”

An15g02830 uncharacterized protein from Aspergillus niger
26% identity, 84% coverage

The capacity of Aspergillus niger to sense and respond to cell wall stress requires at least three transcription factors: RlmA, MsnA and CrzA
Fiedler, Fungal biology and biotechnology 2014
- “...(An08g05400, An17g01150, An15g01280, An08g07520, An16g04520, An14g00990), (iii) genes involved in fatty acid biosynthesis (An16g05340, An07g03290, An15g02830) and (iv) genes predicted to function in lipid transport across the peroxisomal, mitochondrial and plasma membrane (An18g01590, An04g00740, An01g12380). Hence, remodeling plasma membranes via lipid degradation and de novo synthesis...”

B7Q9C9 Propionyl-CoA carboxylase beta chain, mitochondrial (Fragment) from Ixodes scapularis
33% identity, 41% coverage

Ixodes scapularis Tick Cells Control Anaplasma phagocytophilum Infection by Increasing the Synthesis of Phosphoenolpyruvate from Tyrosine
Cabezas-Cruz, Frontiers in cellular and infection microbiology 2017
- “...LYSINE -aminoadipic semialdehyde synthase AASS ISCW008489 B7PT93 METHIONINE Propionyl-CoA carboxylase beta chain PCCB [VOMIT] ISCW010503 B7Q9C9 Methylmalonyl-CoA epimerase MCEE [VOMIT] ISCW003889 B7PF37 Methylmalonyl-CoA mutase MUT [VOMIT] ISCW020522 B7Q1G1 Methionine synthase MS ISCW020738 B7Q2S9 ASPARAGINE Asparagine synthetase AsnRS ISCW004505 B7PH83 PROLINE Delta-1-pyrroline-5-carboxylate synthetase P5CS ISCW005278 B7PPZ5 Proline...”

jk1662 acyl-CoA carboxylase, beta subunit from Corynebacterium jeikeium K411
27% identity, 72% coverage

Complete genome sequence and analysis of the multiresistant nosocomial pathogen Corynebacterium jeikeium K411, a lipid-requiring bacterium of the human skin flora
Tauch, Journal of bacteriology 2005
- “...coding for subunits of this enzyme (jk1551 [accD1], jk1662 [accD2]), and jk0139 [accD3]). In addition, 11 fadD genes encoding fatty acyl-CoA synthetases were...”

D6RD67 methylcrotonoyl-CoA carboxylase (Fragment) from Homo sapiens
44% identity, 21% coverage

FOXA2-Interacting FOXP2 Prevents Epithelial-Mesenchymal Transition of Breast Cancer Cells by Stimulating E-Cadherin and PHF2 Transcription.
Liu, Frontiers in oncology 2021
- “...of Nuclear receptor coactivator 3 Gene name=NCOA3 E7EUY0 DNA-dependent protein kinase catalytic subunit Gene name=PRKDC D6RD67 Methylcrotonoyl-CoA carboxylase beta chain, mitochondrial (Fragment) Gene name=MCCC2 Q6UUV7-3 Isoform 3 of CREB-regulated transcription coactivator 3 Gene name=CRTC3 P61962 DDB1- and CUL4-associated factor 7 Gene name=DCAF7 P52594-2 Isoform 2 of...”

A4I399 Putative propionyl-coa carboxylase beta chain from Leishmania infantum
27% identity, 31% coverage

A Computational Approach Using Bioinformatics to Screening Drug Targets for Leishmania infantum Species
Chávez-Fumagalli, Evidence-based complementary and alternative medicine : eCAM 2018
- “...A4I7A2 Putative acetyl-CoA carboxylase 0,946 0 E + 00 37 0 E + 00 36 A4I399 Putative propionyl-CoA carboxylase beta chain 0,867 6 E 80 68 4 E 77 68 A4I398 Putative propionyl-CoA carboxylase beta chain 0,867 2 E 34 54 7 E 33 54 A4HUX0...”

SCO2445 acetyl CoA carboxylase (alpha and beta subunits) from Streptomyces coelicolor A3(2)
26% identity, 70% coverage

AccR, a TetR Family Transcriptional Repressor, Coordinates Short-Chain Acyl Coenzyme A Homeostasis in Streptomyces avermitilis
Lyu, Applied and environmental microbiology 2020 (secret)
De Novo Biosynthesis of Apigenin, Luteolin, and Eriodictyol in the Actinomycete Streptomyces albus and Production Improvement by Feeding and Spore Conditioning
Marín, Frontiers in microbiology 2017
- “...matB (membrane malonate carrier protein) and matC (malonyl-CoA synthetase) from S. coelicolor counterparts ( sco2443, sco2445 ) ( Park et al., 2011 ), actually do carry out other enzymatic functions in S. albus , and therefore this bacterium cannot incorporate extracellular sodium malonate toward flavonoids biosynthesis....”
Changes in activity of metabolic and regulatory pathways during germination of S. coelicolor
Bobek, BMC genomics 2014
- “...at t6-t7. 3060 Protein export Lipid metabolism and membrane transport Acetyl CoA carboxylase and acetyltransferase (SCO2445, 5399) activation at (t1-t2) 561 Glycerolipid metabolism 61 and 71 Fatty acid biosynthesis pathways 564 Glycerophospholipid metabolism Deactivation at t7-t8 - ABC transporters,membrane transport system. ABC transporters genes of the...”
- “...carboxylase complex (SCO6731, 6788). Curiously, there are two exceptions - acetyl CoA carboxylase and acetyltransferase (SCO2445, 5399) that were down regulated at t1-t2. Our previous work highlighted the crucial role of the chaperones DnaK, GroEL and Trigger factor in the refolding of aggregated proteins during the...”

Tfu_1530 similar to Acetyl/propionyl-CoA carboxylase alpha subunit from Thermobifida fusca YX
27% identity, 10% coverage

The Effects of Carbon Source and Growth Temperature on the Fatty Acid Profiles of Thermobifida fusca
Winkelman, Frontiers in molecular biosciences 2022
- “...ACCase B Additional ACCase CT subunit Tfu_1228, Tfu_1215 BCCP Biotin Carboxyl-Carrier Protein Tfu_1513 LCCase LCCase Tfu_1530 AcpP Acyl-carrier protein (ACP) Tfu_1975 MCAT Malonyl-CoA:ACP transacylase Tfu_1231, Tfu_1973 FabH 3-ketoacyl-ACP synthase III Tfu_1229, Tfu_1974 FabF 3-ketoacyl-ACP synthase III isozyme Tfu_1976 FabG 3-ketoacyl-ACP reductase Tfu_1841, Tfu_1843, Tfu_2308 FabA 3-hydroxyacyl-ACP...”
- “...genes that encode homologs of biotin-containing carboxylase proteins, namely Tfu_0947, Tfu_0948, Tfu_1215, Tfu_1228, Tfu_1513, and Tfu_1530. The adjacent Tfu_0947 and Tfu_0948 genes suggest that they are on a single operon, with Tfu_0947 encoding a subunit with the BC and BCCP domains, and Tfu_0948 encoding a subunit...”
Proteomics-based metabolic modeling and characterization of the cellulolytic bacterium Thermobifida fusca
Vanee, BMC systems biology 2014
- “...Tfu_v2 version whereas the proteomics version clearly shows its presence (EC 6.4.1.1, Gene ID: Tfu_2557, Tfu_1530, Tfu_0947, Tfu_1228). In addition, most of the amino acid pathways were fully or partially incomplete in Tfu_v2. Thus, the Tfu_v2 model had artificially high fluxes through transport reactions to uptake...”

G2YUC1 Similar to acetyl-CoA carboxylase from Botryotinia fuckeliana (strain T4)
24% identity, 12% coverage

Proteomic study of the membrane components of signalling cascades of Botrytis cinerea controlled by phosphorylation.
Escobar-Niño, Scientific reports 2019
- “...glycolytic process, acetyl-CoA biosynthetic process from pyruvate/Biosynthesis of secondary metabolites EDN32877 Similar to acetyl-CoA carboxylase G2YUC1 acetyl-CoA carboxylase activity, fatty acid biosynthetic process *The information presented in the column GO/KEGG function is obtained from GO and KEGG analysis. Table 2 Components of the 7 protein clusters...”

PP_1996 acetyl-CoA carboxylase, carboxyltransferase subunit beta from Pseudomonas putida KT2440
PP1996 acetyl-CoA carboxylase, carboxyl transferase, beta subunit from Pseudomonas putida KT2440
26% identity, 35% coverage

Adaptive laboratory evolution of Pseudomonas putida KT2440 improves p-coumaric and ferulic acid catabolism and tolerance
Mohamed, Metabolic engineering communications 2020
- “...CA+FA ttgB (PP_1385) SNP (6) efflux pump membrane protein TtgB p CA, p CA+FA accD (PP_1996) SNP (3) acetyl-CoA carboxylase carboxyltransferase subunit beta p CA, FA, p CA+FA accA (PP_1607) SNP (2) acetyl-CoA carboxylase carboxyltransferase subunit alpha p CA PP_5245 , kefB -III ( PP_5246 )...”
Transcriptome dynamics of Pseudomonas putida KT2440 under water stress
Gülez, Applied and environmental microbiology 2012
- “...PP_3255 PP_3260 PP_3268 PP_3967 PP_4010 cspD PP_0368 PP_1996 accD Fatty acid and phospholipid metabolism DNA metabolism (other) a PP_0975 glgA hupN...”
Functional analysis of aromatic biosynthetic pathways in Pseudomonas putida KT2440
Molina-Henares, Microbial biotechnology 2009
- “...PP1994, was 61 nucleotides away from PP1995, and the ATG of the following ORF (encoding PP1996) was 222 nucleotides away from the PP1995 stop codon. This suggested that these three genes belonged to independent transcriptional units; nonetheless, we tested by RTPCR whether the genes were part...”

CD1937 acetyl-coenzyme A carboxylase carboxyl transferase subunit beta from Clostridium difficile 630
21% identity, 36% coverage

In-Depth Characterization of the Clostridioides difficile Phosphoproteome to Identify Ser/Thr Kinase Substrates
Garcia-Garcia, Molecular & cellular proteomics : MCP 2022
- “...translocase KVDIAKPNLNIEK T (1)QPMSIVAEPVNEDYSNYK T 318 CD1639 Tellurite-associated resistance protein ALDDK T (1)NELLLR T 303 CD1937 accD Acetyl-coenzyme A carboxylase carboxyl transferase -subunit VIEQ T (1)INQK T 241 CD2525 recX Regulatory protein RecX IVN T (1)NVNLNK T 118 CD2578 prkC Serine/threonine protein kinase NIDLDFIKEYDDFA T (1)KK...”

SACE_4237 probable acetyl/propionyl-CoA carboxylase alpha subunit from Saccharopolyspora erythraea NRRL 2338
26% identity, 11% coverage

Polyketide Starter and Extender Units Serve as Regulatory Ligands to Coordinate the Biosynthesis of Antibiotics in Actinomycetes
Wu, mBio 2021
- “...SACE_0026-0028 and SACE_3856 genes encode ACC enzymes; SACE_3398-3399 , SACE_7038-7039 , SACE_3241-3242 , SACE_3400 , SACE_4237 , and SACE_6509 genes encode ACC and/or PCC enzymes; SACE_0632 , SACE_0633 , and SACE_0649 genes encode CS enzymes. Mean values of 3 measurements are shown with SDs. *, P<...”
- “...ACC and/or PCC genes ( SACE_0026-0028 , SACE_3241-3242 , SACE_3398-3399 , SACE_3400 , SACE_3856 , SACE_4237 , SACE_6509 , and SACE_7038-7039 ) and three citrate synthase (CS) genes ( SACE_0632 , SACE_0633 , and SACE_0649 ) between A226 and A226 acrT ( 28 , 29 )....”
A novel multidomain acyl-CoA carboxylase in Saccharopolyspora erythraea provides malonyl-CoA for de novo fatty acid biosynthesis
Livieri, Scientific reports 2019
- “...Here, we show that a putative multidomain ACC in Saccharopolyspora erythraea is encoded by the sace_4237 gene, representing the first prokaryotic ACC homodimeric multidomain complex described. The SACE_4237 complex has both acetyl-CoA and propionyl-CoA carboxylase activities. Importantly, we demonstrate that sace_4237 is essential for S. erythraea...”
- “..., epsilon subunit; AC, ACC central; BT, domain that mediates BCCT interactions. Here, we characterised SACE_4237 from S. erythraea , previously annotated as a putative multidomain carboxylase, using biochemical assays and by constructing a conditional knockout strain. We show that SACE_4237 is an essential multidomain acyl-CoA...”
TetR Family Transcriptional Regulator PccD Negatively Controls Propionyl Coenzyme A Assimilation in Saccharopolyspora erythraea
Xu, Journal of bacteriology 2017
- “...including SACE_0026-0028, SACE_3241-3242, SACE_3398-3400, 100 SACE_7038-7039, SACE_4237, and SACE_3856/6509-6510 [17]. Here, we show that 101 only the genetic...”
- “...acetyl-CoA/propionyl-CoA carboxylases are 118 annotated, 119 SACE_7038-7039, SACE_4237, and SACE_6509 (Fig. S1). The co-transcription of 120 genes in each locus...”
Temporal dynamics of the Saccharopolyspora erythraea phosphoproteome
Licona-Cassani, Molecular & cellular proteomics : MCP 2014
- “...SACE_0821-2 SACE_6324 SACE_4140-1 Hypothetical proteins SACE_4061 SACE_4237 2% Profile A Signalling and Cellular processes SACE_5439 SACE_4206 SACE_7119...”
- “...PA 30 14 log PA 10 12 0.2 16 log PA 12 0.4 o 14 SACE_4237 18 log PA 0.8 0.7 0.6 0.5 0.4 0.3 0.2 0.1 0 -0.1 20 -0.2 -0.3 16 log PA o o SACE_1449 3.5 3 2.5 2 1.5...”
Systems perspectives on erythromycin biosynthesis by comparative genomic and transcriptomic analyses of S. erythraea E3 and NRRL23338 strains
Li, BMC genomics 2013
- “...S. erythraea . In S. erythraea at least five genetic loci (SACE_0026-0028; SACE_3241-3242; SACE_3398-3400; SACE_3856/6509; SACE_4237) might encode biotin-dependent carboxylases catalyzing carboxylation of propionyl-CoA to methylmalonyl-CoA. So far, it is still unclear which gene set makes a contribution to erythromycin biosynthesis. Comparative transcriptome analysis found that...”

HMPREF1120_06163 uncharacterized protein from Exophiala dermatitidis NIH/UT8656
23% identity, 11% coverage

Transcriptome Study of an Exophiala dermatitidis PKS1 Mutant on an ex Vivo Skin Model: Is Melanin Important for Infection?
Poyntner, Frontiers in microbiology 2018
- “...HMPREF1120_06787 2.96 2.17 2.81 Malate dehydrogenase Aco1 HMPREF1120_03751 5.74 15.71 Aconitate hydratase Gluconeogenesis Pyc1 -2 HMPREF1120_06163 5.11 7.83 Pyruvate carboxylase HMPREF1120_00351 21.31 4.77 8.00 Pyruvate carboxylase GPM3 HMPREF1120_06520 3.97 7.93 11.87 Phosphoglycerate mutase TDH1-3 HMPREF1120_04315 5.89 Glyceraldehyde-3-phosphate dehydrogenase FBA1 HMPREF1120_07847 5.39 Fructose-biphosphate aldolase class I FBA2...”

New Search

For advice on how to use these tools together, see Interactive tools for functional annotation of bacterial genomes.

Statistics

The PaperBLAST database links 793,807 different protein sequences to 1,259,118 scientific articles. Searches against EuropePMC were last performed on March 13 2025.

How It Works

PaperBLAST builds a database of protein sequences that are linked to scientific articles. These links come from automated text searches against the articles in EuropePMC and from manually-curated information from GeneRIF, UniProtKB/Swiss-Prot, BRENDA, CAZy (as made available by dbCAN), BioLiP, CharProtDB, MetaCyc, EcoCyc, TCDB, REBASE, the Fitness Browser, and a subset of the European Nucleotide Archive with the /experiment tag. Given this database and a protein sequence query, PaperBLAST uses protein-protein BLAST to find similar sequences with E < 0.001.

To build the database, we query EuropePMC with locus tags, with RefSeq protein identifiers, and with UniProt accessions. We obtain the locus tags from RefSeq or from MicrobesOnline. We use queries of the form "locus_tag AND genus_name" to try to ensure that the paper is actually discussing that gene. Because EuropePMC indexes most recent biomedical papers, even if they are not open access, some of the links may be to papers that you cannot read or that our computers cannot read. We query each of these identifiers that appears in the open access part of EuropePMC, as well as every locus tag that appears in the 500 most-referenced genomes, so that a gene may appear in the PaperBLAST results even though none of the papers that mention it are open access. We also incorporate text-mined links from EuropePMC that link open access articles to UniProt or RefSeq identifiers. (This yields some additional links because EuropePMC uses different heuristics for their text mining than we do.)

For every article that mentions a locus tag, a RefSeq protein identifier, or a UniProt accession, we try to select one or two snippets of text that refer to the protein. If we cannot get access to the full text, we try to select a snippet from the abstract, but unfortunately, unique identifiers such as locus tags are rarely provided in abstracts.

PaperBLAST also incorporates manually-curated protein functions:

Proteins from NCBI's RefSeq are included if a GeneRIF entry links the gene to an article in PubMed^®. GeneRIF also provides a short summary of the article's claim about the protein, which is shown instead of a snippet.
Proteins from Swiss-Prot (the curated part of UniProt) are included if the curators identified experimental evidence for the protein's function (evidence code ECO:0000269). For these proteins, the fields of the Swiss-Prot entry that describe the protein's function are shown (with bold headings).
Proteins from BRENDA, a curated database of enzymes, are included if they are linked to a paper in PubMed and their full sequence is known.
Every protein from the non-redundant subset of BioLiP, a database of ligand-binding sites and catalytic residues in protein structures, is included. Since BioLiP itself does not include descriptions of the proteins, those are taken from the Protein Data Bank. Descriptions from PDB rely on the original submitter of the structure and cannot be updated by others, so they may be less reliable. (For SitesBLAST and Sites on a Tree, we use a larger subset of BioLiP so that every ligand is represented among a group of structures with similar sequences, but for PaperBLAST, we use the non-redundant set provided by BioLiP.)
Every protein from EcoCyc, a curated database of the proteins in Escherichia coli K-12, is included, regardless of whether they are characterized or not.
Proteins from the MetaCyc metabolic pathway database are included if they are linked to a paper in PubMed and their full sequence is known.
Proteins from the Transport Classification Database (TCDB) are included if they have known substrate(s), have reference(s), and are not described as uncharacterized or putative. (Some of the references are not visible on the PaperBLAST web site.)
Every protein from CharProtDB, a database of experimentally characterized protein annotations, is included.
Proteins from the CAZy database of carbohydrate-active enzymes are included if they are associated with an Enzyme Classification number. Even though CAZy does not provide links from individual protein sequences to papers, these should all be experimentally-characterized proteins.
Proteins from the REBASE database of restriction enzymes are included if they have known specificity.
Every protein with an evidence-based reannotation (based on mutant phenotypes) in the Fitness Browser is included.
Sequence-specific transcription factors (including sigma factors and DNA-binding response regulators) with experimentally-determined DNA binding sites from the PRODORIC database of gene regulation in prokaryotes.
Putative transcription factors from RegPrecise that have manually-curated predictions for their binding sites. These predictions are based on conserved putative regulatory sites across genomes that contain similar transcription factors, so PaperBLAST clusters the TFs at 70% identity and retains just one member of each cluster.
Coding sequence (CDS) features from the European Nucleotide Archive (ENA) are included if the /experiment tag is set (implying that there is experimental evidence for the annotation), the nucleotide entry links to paper(s) in PubMed, and the nucleotide entry is from the STD data class (implying that these are targeted annotated sequences, not from shotgun sequencing). Also, to filter out genes whose transcription or translation was detected, but whose function was not studied, nucleotide entries or papers with more than 25 such proteins are excluded. Descriptions from ENA rely on the original submitter of the sequence and cannot be updated by others, so they may be less reliable.

Except for GeneRIF and ENA, the curated entries include a short curated description of the protein's function. For entries from BioLiP, the protein's function may not be known beyond binding to the ligand. Many of these entries also link to articles in PubMed.

For more information see the PaperBLAST paper (mSystems 2017) or the code. You can download PaperBLAST's database here.

Changes to PaperBLAST since the paper was written:

November 2023: incorporated PRODORIC and RegPrecise. Many PRODORIC entries were not linked to a protein sequence (no UniProt identifier), so we added this information.
February 2023: BioLiP changed their download format. PaperBLAST now includes their non-redundant subset. SitesBLAST and Sites on a Tree use a larger non-redundant subset that ensures that every ligand is represented within each cluster. This should ensure that every binding site is represented.
June 2022: incorporated some coding sequences from ENA with the /experiment tag.
March 2022: incorporated BioLiP.
April 2020: incorporated TCDB.
April 2019: EuropePMC now returns table entries in their search results. This has expanded PaperBLAST's database, but most of the new entries are of low relevance, and the resulting snippets are often just lists of locus tags with annotations.
February 2018: the alignment page reports the conservation of the hit's functional sites (if available from from Swiss-Prot or UniProt)
January 2018: incorporated BRENDA.
December 2017: incorporated MetaCyc, CharProtDB, CAZy, REBASE, and the reannotations from the Fitness Browser.
September 2017: EuropePMC no longer returns some table entries in their search results. This has shrunk PaperBLAST's database, but has also reduced the number of low-relevance hits.

Many of these changes are described in Interactive tools for functional annotation of bacterial genomes.

Secrets

PaperBLAST cannot provide snippets for many of the papers that are published in non-open-access journals. This limitation applies even if the paper is marked as "free" on the publisher's web site and is available in PubmedCentral or EuropePMC. If a journal that you publish in is marked as "secret," please consider publishing elsewhere.

Omissions from the PaperBLAST Database

Many important articles are missing from PaperBLAST, either because the article's full text is not in EuropePMC (as for many older articles), or because the paper does not mention a protein identifier such as a locus tag, or because of PaperBLAST's heuristics. If you notice an article that characterizes a protein's function but is missing from PaperBLAST, please notify the curators at UniProt or add an entry to GeneRIF. Entries in either of these databases will eventually be incorporated into PaperBLAST. Note that to add an entry to UniProt, you will need to find the UniProt identifier for the protein. If the protein is not already in UniProt, you can ask them to create an entry. To add an entry to GeneRIF, you will need an NCBI Gene identifier, but unfortunately many prokaryotic proteins in RefSeq do not have corresponding Gene identifers.

References

PaperBLAST: Text-mining papers for information about homologs.
M. N. Price and A. P. Arkin (2017). mSystems, 10.1128/mSystems.00039-17.

Europe PMC in 2017.
M. Levchenko et al (2017). Nucleic Acids Research, 10.1093/nar/gkx1005.

Gene indexing: characterization and analysis of NLM's GeneRIFs.
J. A. Mitchell et al (2003). AMIA Annu Symp Proc 2003:460-464.

UniProt: the universal protein knowledgebase.
The UniProt Consortium (2016). Nucleic Acids Research, 10.1093/nar/gkw1099.

BRENDA in 2017: new perspectives and new tools in BRENDA.
S. Placzek et al (2017). Nucleic Acids Research, 10.1093/nar/gkw952.

The EcoCyc database: reflecting new knowledge about Escherichia coli K-12.
I. M. Keeseler et al (2016). Nucleic Acids Research, 10.1093/nar/gkw1003.

The MetaCyc database of metabolic pathways and enzymes.
R. Caspi et al (2018). Nucleic Acids Research, 10.1093/nar/gkx935.

CharProtDB: a database of experimentally characterized protein annotations.
R. Madupu et al (2012). Nucleic Acids Research, 10.1093/nar/gkr1133.

The carbohydrate-active enzymes database (CAZy) in 2013.
V. Lombard et al (2014). Nucleic Acids Research, 10.1093/nar/gkt1178.

The Transporter Classification Database (TCDB): recent advances
M. H. Saier, Jr. et al (2016). Nucleic Acids Research, 10.1093/nar/gkv1103.

REBASE - a database for DNA restriction and modification: enzymes, genes and genomes.
R. J. Roberts et al (2015). Nucleic Acids Research, 10.1093/nar/gku1046.

Deep annotation of protein function across diverse bacteria from mutant phenotypes.
M. N. Price et al (2016). bioRxiv, 10.1101/072470.

by Morgan Price, Arkin group
Lawrence Berkeley National Laboratory