PaperBLAST

PaperBLAST – Find papers about a protein or its homologs

PaperBLAST

PaperBLAST Hits for sp|Q9HYC7|SYM_PSEAE Methionine--tRNA ligase OS=Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1) OX=208964 GN=metG PE=1 SV=1 (677 a.a., MSEPRKILVT...)

Other sequence analysis tools:

Find functional residues: SitesBLAST

Search for conserved domains

Find the best match in UniProt

Compare to protein structures

Predict transmenbrane helices: Phobius

Predict protein localization: PSORTb

Find homologs in fast.genomics

Fitness BLAST: loading...

Show query sequence

Found 247 similar proteins in the literature:

PA3482 methionyl-tRNA synthetase from Pseudomonas aeruginosa PAO1
NP_252172 methionine--tRNA ligase from Pseudomonas aeruginosa PAO1
Q9HYC7 Methionine--tRNA ligase from Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
100% identity, 100% coverage

Comparative Molecular docking analysis of DNA Gyrase subunit A in Pseudomonas aeruginosaPAO1
Gupta, Bioinformation 2013
- “...against DNA Gyrase A PA PAO1. Recently, several drug targets viz . PA0004gyrB, PA3168 gyrA, PA3482 metG, PA3834valS, PA3987 leuS, PA4238 rpoA, PA4268 rpsL, PA4269 rpoC, and PA4967 parE have been reported on the basis of network biology approch. We have selected PA0004 gyrB, PA3168 gyrA...”
Prediction and analysis of the protein interactome in Pseudomonas aeruginosa to enable network-based drug target selection
Zhang, PloS one 2012
- “...functions. Notably, nine of 20 known drug targets in the network (PA0004 gyrB, PA3168 gyrA, PA3482 metG, PA3834 valS, PA3987 leuS, PA4238 rpoA, PA4268 rpsL, PA4269 rpoC, and PA4967 parE) were involved in identified modules. Eight of them, PA3987 leuS being the sole exception, were in...”
Proteomic, microarray, and signature-tagged mutagenesis analyses of anaerobic Pseudomonas aeruginosa at pH 6.5, likely representing chronic, late-stage cystic fibrosis airway conditions
Platt, Journal of bacteriology 2008
- “...PA1155 PA2097 PA1156 PA3392 PA4246 PA1800 PA4265 PA2639 PA3482 PA1092 PA5171 PA5172 PA1562 PA4236 PA0519 PA4266 PA3392 PA0519 PA4273 PA1596 PA3914 PA0520 PA0519...”
- “...PA2846 PA2851 (efp) PA2945 PA3392 (nosZ) PA3418 (ldh) PA3482 (metG) PA3515 PA3529 PA3635 (eno) PA3655 (tsf) PA3735 (thrC) PA3814 (iscS) PA3874 (narH ) PA3875...”
Toxicogenomic response of Pseudomonas aeruginosa to ortho-phenylphenol
Nde, BMC genomics 2008
- “...metabolism PA5067_hisE_at PA5067 2.212 0.00214 phosphoribosyl-ATP pyrophosphohydrolase his E Amino acid biosynthesis and metabolism PA3482_metG_at PA3482 2.043 0.0312 methionyl-tRNA synthetase met G Amino acid biosynthesis and metabolism PA5119_glnA_at PA5119 2.038 0.0442 glutamine synthetase gln A Amino acid biosynthesis and metabolism PA4439_trpS_at PA4439 2.002 0.0155 tryptophanyl-tRNA synthetase...”
Identification and Characterization of a Chemical Compound that Inhibits Methionyl-tRNA Synthetase from Pseudomonas aeruginosa
Robles, Current drug discovery technologies 2017
- “...MetRS protein sequences of E. coli , P. aeruginosa , and T. thermophiles are P00959, NP_252172 and P23395, respectively. Sequence alignments were performed using Vector NTI Advance (TM) 11.0 (Invitrogen). Identical amino acid residues are white on black and similar residues are black on grey. The...”
Exploring Proteus mirabilis Methionine tRNA Synthetase Active Site: Homology Model Construction, Molecular Dynamics, Pharmacophore and Docking Validation
Elbaramawi, Pharmaceuticals (Basel, Switzerland) 2023
- “...this group of species was the Gram-negative bacteria E. coli (P00959) followed by Pseudomonas aeruginosa (Q9HYC7). A lower homology was observed with the Gram-positive Enterococcus faecalis and Streptococcus pyogenes , with a clear difference observed for the non-bacterial organisms. A percent identity matrix ( Supplementary Figure...”
- “...zebra mbuna (A0A3P9BIE1); African clawed frog (Q6PF21); Mycobacterium tuberculosis (P9WFU5); Thermus thermophilus (P23395); Pseudomonas aeruginosa (Q9HYC7); Enterococcus faecalis (Q837B3); Streptococcus pyogenes (Q9A178); Escherichia coli (P00959); Acinetobacter baumannii (A0A0D5YKJ7); Pyrococcus abyssi (Q9V011), Staphylococcus aureus (P67578). Figure 3 Sequence alignment of MetRS enzymes of Aquifex aeolicus , Pyrococcus...”

PP1097 methionyl-tRNA synthetase from Pseudomonas putida KT2440
85% identity, 100% coverage

UEG Week 2024 Poster Presentations
, United European gastroenterology journal 2024
UEG Week 2023 Poster Presentations
, United European gastroenterology journal 2023

PSPPH_1378 Methionyl-tRNA synthetase (Methionine--tRNA ligase)(MetRS) from Pseudomonas syringae pv. phaseolicola 1448A
84% identity, 99% coverage

Transcriptional profile of P. syringae pv. phaseolicola NPS3121 at low temperature: physiology of phytopathogenic bacteria
Arvizu-Gómez, BMC microbiology 2013
- “...1.54 PSPPH_1244 transcriptional regulator, AsnC family 1.89 PSPPH_1306 RNA methyltransferase, TrmH family, group 1 1.545 PSPPH_1378 Methionyl-tRNA synthetase (Methionine--tRNA ligase)(MetRS) 2.56 PSPPH_1406 ATP-dependent helicase, DinG family 1.77 PSPPH_1468 nucleic acid binding protein 1.58 PSPPH_1595 transcriptional regulator, GntR family 2.58 PSPPH_1661 cvpA family protein 1.66 PSPPH_1746 oxidoreductase,...”

7ulzA / Q9HYC7 Crystal structure of methionine-tRNA ligase / methionyl-tRNA synthetase (metrs) from pseudomonas aeruginosa pao1
95% identity, 81% coverage

Ligand: methionine (7ulzA)

ECs2920 methionine tRNA synthetase from Escherichia coli O157:H7 str. Sakai
66% identity, 99% coverage

Global transcriptional response of Escherichia coli O157:H7 to growth transitions in glucose minimal medium
Bergholz, BMC microbiology 2007
- “...yegS 3.38 2 ECs3522 gabD 2.53 2 ECs2900 fbaB 2.45 2 ECs3523 gabT 3.14 2 ECs2920 metG -2.59 1 ECs3533 ygaM 3.32 2 ECs3022 yohC 6.12 2 ECs3554 alaS -2.20 1 ECs3029 O157 4.04 2 ECs3605 cysN -3.19 1 ECs3030 O157 3.38 2 ECs3617 cysH -2.76...”

MetG / b2114 methionine—tRNA ligase (EC 6.1.1.10) from Escherichia coli K-12 substr. MG1655 (see 186 papers)
metG / P00959 methionine—tRNA ligase (EC 6.1.1.10) from Escherichia coli (strain K12) (see 182 papers)
SYM_ECOLI / P00959 Methionine--tRNA ligase; Methionyl-tRNA synthetase; MetRS; EC 6.1.1.10 from Escherichia coli (strain K12) (see paper)
P00959 methionine-tRNA ligase (EC 6.1.1.10) from Escherichia coli (see 4 papers)
metG methionyl-tRNA synthetase; EC 6.1.1.10 from Escherichia coli K12 (see 14 papers)
NP_416617 methionine--tRNA ligase from Escherichia coli str. K-12 substr. MG1655
b2114 methionyl-tRNA synthetase from Escherichia coli str. K-12 substr. MG1655
66% identity, 99% coverage

function: Is required not only for elongation of protein synthesis but also for the initiation of all mRNA translation through initiator tRNA(fMet) aminoacylation
catalytic activity: tRNA(Met) + L-methionine + ATP = L-methionyl-tRNA(Met) + AMP + diphosphate (RHEA:13481)
cofactor: Zn(2+) Note=Binds 1 zinc ion per subunit
subunit: Homodimer.
The consequences of genetic drift for bacterial genome complexity
Kuo, Genome research 2009
- “...(GenBank accession nos. NP_414726, NP_418300, NP_418414, NP_416390, and NP_416617) to find the best BLASTP (Altschul et al. 1990) hit from each of the other...”
Selectivity and specificity of substrate binding in methionyl-tRNA synthetase.
Datta, Protein science : a publication of the Protein Society 2004
- GeneRIF: Apo-MetRS structure shows a preference for binding methionine compared with the 19 other natural amino acids.
Methionyl-tRNA synthetase from Escherichia coli. Primary structure of the active crystallised tryptic fragment.
Barker, European journal of biochemistry 1982 (PubMed)
- GeneRIF: N-terminus verified by Edman degradation on mature peptide
RNA-dependent proteome solubility maintenance in Escherichia coli lysates analysed by quantitative mass spectrometry: Proteomic characterization in terms of isoelectric point, structural disorder, functional hub, and chaperone network
Park, RNA biology 2024
- “...104.17 5.87 3.33 6.27 0.164 n.s P21889 AspRS 2 65.91 5.36 2.66 9.58 0 *** P00959 MetRS 1 76.12 5.65 0.19 7.63 0 *** P07395 PheRS, subunit 2 87.38 4.95 0.47 7.38 0.215 n.s P16659 ProRS 2 63.69 4.87 3.76 8.45 0.226 n.s Average 65.33 5.41...”
Exploring Proteus mirabilis Methionine tRNA Synthetase Active Site: Homology Model Construction, Molecular Dynamics, Pharmacophore and Docking Validation
Elbaramawi, Pharmaceuticals (Basel, Switzerland) 2023
- “...homologies to P. mirabilis in this group of species was the Gram-negative bacteria E. coli (P00959) followed by Pseudomonas aeruginosa (Q9HYC7). A lower homology was observed with the Gram-positive Enterococcus faecalis and Streptococcus pyogenes , with a clear difference observed for the non-bacterial organisms. A percent...”
- “...Omega 1.2.4 [ 26 ] was used to align the possible template sequences: E. coli (P00959), A. baumannii (A0A0D5YKJ7), P. abyssi (Q9V011), and A. aeolicus (O67298) MetRSs with the amino acid sequence of P. mirabilis MetRS ( Figure 3 ). The input set of query and...”
Biodistribution of ⁸⁹Zr-DFO-labeled avian pathogenic Escherichia coli outer membrane vesicles by PET imaging in chickens
Li, Poultry science 2023
- “...DNAA Replication, recombination and repair Cytoplasm 216 P27247 PLSX Lipid transport and metabolism Cytoplasm 217 P00959 SYM Translation, ribosomal structure and biogenesis Cytoplasm 218 P0A9L3 FKBB Posttranslational modification, protein turnover, chaperones Cytoplasm 219 P0ACF8 HNS Function unknown Cytoplasm 220 P07118 SYV Translation, ribosomal structure and biogenesis...”
Autonomous aggregation suppression by acidic residues explains why chaperones favour basic residues
Houben, The EMBO journal 2020 (secret)
MPLs-Pred: Predicting Membrane Protein-Ligand Binding Sites Using Hybrid Sequence-Based Features and Ligand-Specific Models
Lu, International journal of molecular sciences 2019
- “...MPLs predictor on the universal model and ligand-specific models, we took a metal-binding (UniProt ID: P00959, PDB ID: 1pfu) protein and a drug-binding protein (UniProt ID: Q43133, PDB ID: 2j1p) in the testing dataset for case studies. P00959 is a cytoplasm membrane protein in Escherichia Coli...”
Exposure to microwave irradiation at constant culture temperature slows the growth of Escherichia coli DE3 cells, leading to modified proteomic profiles
Mazinani, RSC advances 2019
- “...S1 P0AG67 6 4 61.1/5.0 4.98 Polyribonucleotide nucleotidyltransferase P05055 3 2 77.1/5.2 5.21 Methionine-tRNA ligase P00959 3 2 76.2/5.9 5.86 6 1.5 (<0.001) d -Tagatose-1,6-bisphosphate aldolase subunit GatZ P0C8J8 18 7 47.1/5.8 53.7/5.2 5.77 Periplasmic pH-dependent serine endoprotease DegQ P39099 8 3 47.2/6.0 5.95 Dihydrofolate synthase/folylpolyglutamate...”
Identification and Characterization of a Chemical Compound that Inhibits Methionyl-tRNA Synthetase from Pseudomonas aeruginosa.
Robles, Current drug discovery technologies 2017
- “...for MetRS protein sequences of E. coli , P. aeruginosa , and T. thermophiles are P00959, NP_252172 and P23395, respectively. Sequence alignments were performed using Vector NTI Advance (TM) 11.0 (Invitrogen). Identical amino acid residues are white on black and similar residues are black on grey....”
Exposure of E. coli to DNA-Methylating Agents Impairs Biofilm Formation and Invasion of Eukaryotic Cells via Down Regulation of the N-Acetylneuraminate Lyase NanA
Di, Frontiers in microbiology 2016
- “...dusA P32695 1.17 2425 0.005 HistidinetRNA ligase hisS P60906 +1.20 1571 0.0017 MethioninetRNA ligase metG P00959 MICROBIAL METABOLISM IN DIVERSE ENVIRONMENTS 2.76 1545 0.0018 Transketolase 2 tktB P33570 1.85 761 0.0062 Formate dehydrogenase, nitrate-inducible, major subunit fdnG P24183 1.56 2314 0.0039 Aldehyde dehydrogenase A, NAD-linked aldA...”
More
Essentiality Assessment of Cysteinyl and Lysyl-tRNA Synthetases of Mycobacterium smegmatis
Ravishankar, PloS one 2016
- “...HI1610 SA1550 SP2100 PheRS MSMEG_3777,MSMEG_3778 Rv1649,Rv1650 ML1401,ML1402 b1713,b1714 HI1311,HI1312 SA0985,SA0986 SP0579,SP0581 MetRS MSMEG_5441 Rv1007c ML0238 b2114 HI1276 SA0448 SP0788 CysRS MSMEG_4189,MSMEG_6074 Rv3580c,Rv2130c ML0323,ML1302 b0526 HI0078 SA0488 SP0591 AspRS MSMEG_3003 Rv2572c ML0501 b1866 HI0317 SA1456 SP2114 GluRS MSMEG_2383,MSMEG_6306 Rv2992c ML1688 b0144,b2400 HI0274 SA0486 SP2069 AsnRS - -...”
Improved Metabolic Models for E. coli and Mycoplasma genitalium from GlobalFit, an Algorithm That Simultaneously Matches Growth and Non-Growth Data Sets
Hartleb, PLoS computational biology 2016
- “...Phosphatidylglycerophosphate (dihexadecanoyl, n-C16:0) or Phosphatidylglycerophosphate (dihexadec-9-enoyl, n-C16:1) or Phosphatidylglycerophosphate (dioctadecanoyl, n-C18:0) or Phosphatidylglycerophosphate (dioctadec-11-enoyl, n-C18:1) b2114 METTRS TRNA(Met) b2514 HISTRS L-Histidyl-tRNA(His) TRNA(His) b2551 GHMT2r, THFAT 5-Formyltetrahydrofolate b2913 PGCD 3-Phosphohydroxypyruvate b3288 FMETTRS N-Formylmethionyl-tRNA b3384 TRPTRS L-Tryptophanyl-tRNA(Trp) TRNA(Trp) b4258 VALTRS L-Valyl-tRNA(Val) TRNA(Val) Solving FPp: Removing reactions 25 FPp...”
Gap-filling analysis of the iJO1366 Escherichia coli metabolic network reconstruction for discovery of metabolic functions
Orth, BMC systems biology 2012
- “...(b1713) L-phenylalanine pheS (b1714) L-phenylalanine thrS (b1719) L-threonine aspS (b1866) L-aspartate argS (b1876) L-arginine metG (b2114) L-methionine hisS (b2514) L-histidine alaS (b2697) L-alanine fmt (b3288) N-formyl-L-methionine trpS (b3384) L-tryptophan glyS (b3559) glycine glyQ (b3560) glycine valS (b4258) L-valine False negative model predictions All genes with false...”

A6TBK7 Methionine--tRNA ligase from Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
66% identity, 99% coverage

Lavender essential oil induces oxidative stress which modifies the bacterial membrane permeability of carbapenemase producing Klebsiella pneumoniae
Yang, Scientific reports 2020
- “...3.27497 9 Elongation factor Ts tsf A6T4X2 Protein biosynthesis Cytoplasm 3.19873 10 MethioninetRNA ligase metG A6TBK7 Protein biosynthesis Cytoplasm 2.92754 11 Carbapenem-hydrolyzing beta-lactamase KPC bla Q9F663 Stress response Cytoplasm 2.90361 12 Adenylate kinase adk A6T5N7 Nucleotide metabolism Cytoplasm 2.87125 13 DNA protection during starvation protein dps...”

V7IMS7 Methionine--tRNA ligase from Salmonella enterica subsp. enterica serovar Cubana str. 76814
65% identity, 96% coverage

The mechanism of discriminative aminoacylation by isoleucyl-tRNA synthetase based on wobble nucleotide recognition.
Chen, Nature communications 2024
- “...the same manner as the wild-type protein. The DNA sequence encoding Sa MetRS (Uniprot ID: V7IMS7) was inserted into pET15b, and full-length Sa MetRS protein was overexpressed in BL21(DE3) and purified by Ni-NTA column (Qiagen) and HiLoad 16/60 Superdex 200pg column (GE Healthcare). The detailed methods...”

STY2384 methionyl-tRNA synthetase from Salmonella enterica subsp. enterica serovar Typhi str. CT18
Q8Z5C3 Methionine--tRNA ligase from Salmonella typhi
65% identity, 99% coverage

Characterization of anti-Salmonella enterica serotype Typhi antibody responses in bacteremic Bangladeshi patients by an immunoaffinity proteomics-based technology
Charles, Clinical and vaccine immunology : CVI 2010
- “...binding Q8Z1Y0 Bfr STY4355 Bacterioferritin Unclassified Q8Z5C3 MetG STY2384 Methionyl-tRNA synthetase a X X X C X X ID, identifier; A, bound by immunoglobulin...”
Characterization of anti-Salmonella enterica serotype Typhi antibody responses in bacteremic Bangladeshi patients by an immunoaffinity proteomics-based technology
Charles, Clinical and vaccine immunology : CVI 2010
- “...X Transport and binding Q8Z1Y0 Bfr STY4355 Bacterioferritin Unclassified Q8Z5C3 MetG STY2384 Methionyl-tRNA synthetase a X X X C X X ID, identifier; A, bound by...”

y2648 methionine tRNA synthetase from Yersinia pestis KIM
65% identity, 99% coverage

The role of relA and spoT in Yersinia pestis KIM5 pathogenicity
Sun, PloS one 2009
- “...catalyzes the hydrolysis of S-ribosylhomocysteine to homocysteine and autoinducer-2 MALDI 8.6 4 MetG (methionyl-tRNA synthetase) y2648 aminoacyl tRNA synthetases, tRNA modification MALDI 2.7 5 PyrE (orotate phosphoribosyltransferase) y0096 pyrimidine ribonucleotide biosynthesis MALDI 2.5 6 PyrB (aspartate carbamoyltransferase catalytic Subunit) y0161 pyrimidine ribonucleotide biosynthesis MALDI 3.6 10.1371/journal.pone.0006720.t003...”

STM14_2658 methionine--tRNA ligase from Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S
STM2155 methionine tRNA synthetase from Salmonella typhimurium LT2
65% identity, 99% coverage

Inorganic Polyphosphate Is Essential for Salmonella Typhimurium Virulence and Survival in Dictyostelium discoideum
Varas, Frontiers in cellular and infection microbiology 2018
- “...amyA Cytoplasmic alpha-amylase STM14_2395 STM1974 fliK Flagellar hook-length control protein STM14_2515 STM2027 cbiH Precorrin-3B C17-methyltransferase STM14_2658 STM2155 metG Methionyl-tRNA synthetase STM14_2864 STM2323 nuoG NADH dehydrogenase subunit G STM14_2938 STM2389 fadI 3-ketoacyl-CoA thiolase STM14_2999 STM2441 cysA Sulfate/thiosulfate transporter subunit STM14_3031 STM2472 maeB Malic enzyme STM14_3058 Hypothetical protein...”
Inorganic Polyphosphate Is Essential for Salmonella Typhimurium Virulence and Survival in Dictyostelium discoideum
Varas, Frontiers in cellular and infection microbiology 2018
- “...Cytoplasmic alpha-amylase STM14_2395 STM1974 fliK Flagellar hook-length control protein STM14_2515 STM2027 cbiH Precorrin-3B C17-methyltransferase STM14_2658 STM2155 metG Methionyl-tRNA synthetase STM14_2864 STM2323 nuoG NADH dehydrogenase subunit G STM14_2938 STM2389 fadI 3-ketoacyl-CoA thiolase STM14_2999 STM2441 cysA Sulfate/thiosulfate transporter subunit STM14_3031 STM2472 maeB Malic enzyme STM14_3058 Hypothetical protein STM14_3368...”
Subtyping of Salmonella enterica Subspecies I Using Single-Nucleotide Polymorphisms in Adenylate Cyclase
Guard, Foodborne pathogens and disease 2016
- “...0.500 31-Aug Aspartate 13 thrS STM1333 1928 433 38 15 0.395 31-Aug Threonine 14 metG STM2155 2034 398 43 24 0.558 17-Aug Methionine 15 glyS STM3655 2069 377 39 21 0.538 18-Aug Glycine (beta subunit) 16 pheT STM1338 2388 404 45 30 0.667 17-Aug Phenylalanine (beta...”

Q3JCG5 Methionine--tRNA ligase from Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
65% identity, 100% coverage

The InterPro protein families database: the classification resource after 15 years
Mitchell, Nucleic acids research 2015
- “...the 3D structure database PDB ( 19 ). Figure 1. InterPro matches for UniProtKB entry Q3JCG5 showing predicted protein family membership, domains and sites. InterPro signature matches to UniProtKB and to the UniParc protein sequence archive are regularly calculated using the InterProScan software package ( 20...”
- “...systems that add annotation to UniProtKB/TrEMBL. Figure 1 summarizes the InterPro matches for UniProtKB entry Q3JCG5, a methioninetRNA ligase from Nitrosococcus oceani , highlighting the value of the signature-integration process. According to a number of hierarchically-related InterPro entries, the protein can be classified into the methioninetRNA...”

SO_2619 methionyl-tRNA synthetase from Shewanella oneidensis MR-1
64% identity, 99% coverage

Network-Based Methods for Identifying Key Active Proteins in the Extracellular Electron Transfer Process in Shewanella oneidensis MR-1
Ding, Genes 2018
- “...6 SO_1126 SO_0435 SO_0435 SO_1126 SO_3292 SO_1207 7 SO_3471 SO_3471 SO_3440 SO_0435 SO_1926 SO_2912 8 SO_2619 SO_2619 SO_2619 SO_2491 SO_3430 SO_3292 9 SO_3432 SO_3432 SO_1207 SO_1926 SO_2406 SO_0610 10 SO_4749 SO_4749 SO_3209 SO_3440 SO_1126 SO_1677 11 SO_1197 SO_1926 SO_1926 SO_4747 SO_0236 SO_3471 12 SO_0603 SO_4215 SO_4747...”
- “...SO_3209 SO_4428 15 SO_4215 SO_0226 SO_3441 SO_1207 SO_0435 SO_3209 16 SO_3441 SO_3209 SO_4586 SO_3432 SO_2780 SO_2619 17 SO_1207 SO_0009 SO_0770 SO_2619 SO_0237 SO_1629 18 SO_4586 SO_1197 SO_0009 SO_4586 SO_4747 SO_3210 19 SO_4747 SO_1207 SO_4215 SO_0009 SO_0608 SO_0247 20 SO_3639 SO_3441 SO_0226 SO_0228 SO_0425 SO_3639 21 SO_0226...”

VP2069 methionyl-tRNA synthetase from Vibrio parahaemolyticus RIMD 2210633
63% identity, 98% coverage

Insights into Vibrio parahaemolyticus CHN25 response to artificial gastric fluid stress by transcriptomic analysis
Sun, International journal of molecular sciences 2014
- “...( ileS ) Chn25_0484 2.3183 Isoleucyl-tRNA synthetase VP0727 ( leuS ) Chn25_0685 2.1816 Leucyl-tRNA synthetase VP2069 ( metG ) Chn25_1955 2.2087 Methionyl-tRNA synthetase VP1291 ( pheT ) Chn25_1298 5.4809 Phenylalanyl-tRNA synthetase subunit beta VP2646 ( valS ) Chn25_2575 2.077 Valyl-tRNA synthetase Pyruvate metabolism VPA1567 Chn25A_1456 2.1699...”

VC1036 methionyl-tRNA synthetase from Vibrio cholerae O1 biovar eltor str. N16961
63% identity, 99% coverage

Both chemotaxis and net motility greatly influence the infectivity of Vibrio cholerae
Butler, Proceedings of the National Academy of Sciences of the United States of America 2004
- “...a CCW- We thank S. H. Lee for constructing VC1036. This work was supported by National Institutes of Health Grants AI045746 and AI055058. 1. Herrington, D. A.,...”

B4ESY6 Methionine--tRNA ligase from Proteus mirabilis (strain HI4320)
63% identity, 99% coverage

Exploring Proteus mirabilis Methionine tRNA Synthetase Active Site: Homology Model Construction, Molecular Dynamics, Pharmacophore and Docking Validation
Elbaramawi, Pharmaceuticals (Basel, Switzerland) 2023
- “...Swiss Bioinformatics Institute [ 23 ]. The sequence of the enzyme has the Uniprot identifier B4ESY6 (SYM_PROMH) and is formed of 675 residues [ 71 ]. A homology search was performed using SIB BLAST service [ 22 , 72 ] accessible through the ExPASy server, which...”
- “...of which have some reported resistance. Figure 2 The phylogenetic tree of Proteus mirabilus MetRS (B4ESY6) in relation to other MetRS enzymes from: Saccharomyces cerevisiae (yeast) (A6ZUS2); human (P56192); mouse (Q68FL6); zebra mbuna (A0A3P9BIE1); African clawed frog (Q6PF21); Mycobacterium tuberculosis (P9WFU5); Thermus thermophilus (P23395); Pseudomonas aeruginosa...”

HI1276 methionyl-tRNA synthetase (metG) from Haemophilus influenzae Rd KW20
61% identity, 99% coverage

Essentiality Assessment of Cysteinyl and Lysyl-tRNA Synthetases of Mycobacterium smegmatis
Ravishankar, PloS one 2016
- “...SA1550 SP2100 PheRS MSMEG_3777,MSMEG_3778 Rv1649,Rv1650 ML1401,ML1402 b1713,b1714 HI1311,HI1312 SA0985,SA0986 SP0579,SP0581 MetRS MSMEG_5441 Rv1007c ML0238 b2114 HI1276 SA0448 SP0788 CysRS MSMEG_4189,MSMEG_6074 Rv3580c,Rv2130c ML0323,ML1302 b0526 HI0078 SA0488 SP0591 AspRS MSMEG_3003 Rv2572c ML0501 b1866 HI0317 SA1456 SP2114 GluRS MSMEG_2383,MSMEG_6306 Rv2992c ML1688 b0144,b2400 HI0274 SA0486 SP2069 AsnRS - - -...”
Identification and characterization of genomic loci unique to the Brazilian purpuric fever clonal group of H. influenzae biogroup aegyptius: functionality explored using meningococcal homology
Li, Molecular microbiology 2003 (PubMed)
- “...the BPF clonal group were identified between homologues of HI1276 and HI1277 in a complex locus close to H. influenzae genetic island 1, recently identified in...”
- “...Sequence immediately upstream of bpf001 was identical to HI1276 of Rd (the Met-tRNA gene metG) (Fleischman et al., 1995), whereas downstream of bpf002 were...”

A1S_0778 methionyl-tRNA synthetase from Acinetobacter baumannii ATCC 17978
60% identity, 97% coverage

Novel Genes Required for Surface-Associated Motility in Acinetobacter baumannii
Blaschke, Current microbiology 2021
- “...modification/ regulation A1S_0447 rpmG 50S ribosomal protein L33 +++ Y N.s. N.s. N.s. S* S** A1S_0778 metG Methionyl-tRNA synthetase +++ Y **** **** N.s. N.s. S*** A1S_2182 gidA Glucose-inhibited division protein A, FAD-binding protein ++ Y N.s. **** R* N.s. N.s. Oxidative stress A1S_0530 Rhodanese domain-containing...”
- “...106.6 32.0 0.23 0.25 1.6 2.0 A1S_1624 32 0.125 2.1 A1S_0447 rpmG 29.3 0.16 1.0 A1S_0778 metG 32 0.23 0.46 A1S_0530 24 0.19 2.0 A1S_3366 gshA 85.3 26.6 0.29 0.23 1.6 2.0 A1S_1970 64 32.0 0.16 0.25 2.5 1.8 A1S_2840 ompA 29.3 13.3 0.46 0.13 1.5...”
Genome-wide identification of Acinetobacter baumannii genes necessary for persistence in the lung
Wang, mBio 2014
- “...compartment ( 26 ). Insertions in genes involved in the synthesis of methionine (A1S_0471, A1S_0737, A1S_0778, A1S_1683, A1S_2122, and A1S_2324) and arginine (A1S_0259, A1S_0610, A1S_1980, A1S_2686, A1S_2687, and A1S_3129) caused significantly decreased persistence, ranging from 2- to 6-fold, in the mouse pneumonia model of A.baumannii ....”

RSPO_c01066 methionine--tRNA ligase from Ralstonia solanacearum Po82
59% identity, 98% coverage

A genome-wide scan for genes under balancing selection in the plant pathogen Ralstonia solanacearum
Castillo, BMC evolutionary biology 2019
- “...1 0,0338** 2.0162** 1.6180** Fused 3-hydroxybutyryl-CoA epimerase IIB/chromosome RSPO_c00909 1 0.0620** 3.0207** 1.5774** Lipoprotein IIB/chromosome RSPO_c01066 metG1 1 0.0254** 2.2792** 1.5602** Methionyl-tRNA synthetase IIB/chromosome RSPO_c01082 spec 1 0.0338** 2.5566** 1.3908** Biodegradative ornithine decarboxylase protein IIB/chromosome RSPO_c03170 1 0.0354** 2.0256** 1.5602** Chromate transport protein IIB/chromosome RSPO_c03029 1...”

lpp2941 methionyl-tRNA synthetase from Legionella pneumophila str. Paris
59% identity, 100% coverage

Comparative analyses of Legionella species identifies genetic features of strains causing Legionnaires' disease
Gomez-Valero, Genome biology 2014
- “...( ftsZ ), lpp2698 ( uvrC ), lpp2802 ( dnaX ), lpp2877 ( recN ), lpp2941 ( metG ), lpp3002 ( rho ), lpp3053 ( atpD ), lpp3055 ( atpA ), lpp3073 ( thdF )) and another one based on all ortholgous genes among the studied...”
Extensive recombination events and horizontal gene transfer shaped the Legionella pneumophila genomes
Gomez-Valero, BMC genomics 2011
- “...recN DNA repair protein lpp2877 DNA replication, recombination, and repair 1668 metG Methionyl tRNA synthetase lpp2941 tRNA aminoacylation 2013 rho Transcription terminator factor lpp3002 Translation 1262 atpD ATP synthase F1, subunit beta lpp3053 ATP-proton motive force interconversion 1377 atpA ATP synthase, subunit alpha lpp3055 ATP-proton motive...”

azo3203 MetG protein from Azoarcus sp. BH72
57% identity, 93% coverage

Elucidation of Essential Genes and Mutant Fitness during Adaptation toward Nitrogen Fixation Conditions in the Endophyte Azoarcus olearius BH72 Revealed by Tn-Seq
Harten, Microbiology spectrum 2022
- “...prfA ) genes. All but one aminoacyl-tRNA synthetase gene were found to be essential. Intriguingly, azo3203 , coding for methionyl-tRNA synthetase, was defined as nonessential. Manual inspection revealed multiple 3-located insertion sites while its putative promoter and 5 region remained undisrupted (Fig. S4A). We hypothesized that...”
- “...53 ), while the appended domain contributes to dimerization and tRNA affinity ( 54 ). Azo3203 displays 54% identity to MetRS and possesses all annotated domains. Thus, provided regional high insertion densities, Tn-Seq enables dissection of polypeptide chains into essential and nonessential domains. We also identified...”

1pfuA / P00959 Methionyl-tRNA synthetase from escherichia coli complexed with methionine phosphinate (see paper)
65% identity, 81% coverage

Ligands: zinc ion; (1-amino-3-methylsulfanyl-propyl)-phosphinic acid (1pfuA)

Q2T087 methionine-tRNA ligase (EC 6.1.1.10) from Burkholderia thailandensis (see paper)
55% identity, 94% coverage

BCAL2646 methionyl-tRNA synthetase from Burkholderia cenocepacia J2315
56% identity, 94% coverage

Comparative Genomics and Evolutionary Analysis of RNA-Binding Proteins of Burkholderia cenocepacia J2315 and Other Members of the B. cepacia Complex
Feliciano, Genes 2020
- “...of this gene seems to be encoded only in 2% of the sequenced genomes. The BCAL2646 and BCAS0045 gene products from B. cenocepacia J2315 were identified as MetG-like proteins, containing a methionyl/leucyl-tRNA synthetase domain, and a Rossmann-like alpha/beta/alpha sandwich fold. These two proteins only share 27.72%...”
- “...identity in their first 200 N-terminus amino acid residues. In addition, the B. cenocepacia J2315 BCAL2646 is the ortholog of the E. coli MetG protein, sharing an identity of 52.7%. It has been described that contrasting with most of other aminoacyl-tRNA synthetases, MetG shows structural diversity...”

PD1590 methionyl-tRNA synthetase from Xylella fastidiosa Temecula1
54% identity, 97% coverage

The Exometabolome of Xylella fastidiosa in Contact with Paraburkholderia phytofirmans Supernatant Reveals Changes in Nicotinamide, Amino Acids, Biotin, and Plant Hormones
Feitosa-Junior, Metabolites 2024
- “...PD1514 2.00 69.38 RXN-1961 78.45 RXN-1961 4.86 PD2000 2.00 55.90 RHEA:15944 53.31 RHEA:15944 1.14 Methionine PD1590 2.00 200.00 METHIONINE--TRNA-LIGASE-RXN 200.00 METHIONINE--TRNA-LIGASE-RXN 6.33 2.00 200.00 RXN-16165 200.00 RXN-16165 6.33 Phenylalanine PD1911 2.00 200.00 PHENYLALANINE--TRNA-LIGASE-RXN 200.00 PHENYLALANINE--TRNA-LIGASE-RXN 6.33 PD0665 2.00 200.00 RXN-15898 200.00 RXN-15898 1.58 Proline PD1635 2.00...”

5urbA / A0A0D5YKJ7 Crystal structure of methionyl-tRNA synthetase (metrs) from acinetobacter baumannii with bound l-methionine
64% identity, 80% coverage

Ligands: zinc ion; methionine (5urbA)

XF0549 methionyl-tRNA synthetase from Xylella fastidiosa 9a5c
54% identity, 97% coverage

Xylella fastidiosa gene expression analysis by DNA microarrays
Travensolo, Genetics and molecular biology 2009
- “...-1.10 XF0354 recG ATP-dependent DNA helicase -0.89 XF0676 holB DNA polymerase III, delta subunit -0.66 XF0549 metG Methionyl-tRNA synthetase -0.62 XF1297 SCF 11.04 Gluconolactonase precursor -0.60 Biosynthesis of amino acids and proteins XF2465 metA Homoserine O-acetyltransferase 0.71 XF1427 argM Succinylornithine aminotransferase 0.69 XF1944 dcp Peptidyl-dipeptidase 0.64...”

1pg0A / P00959 Methionyl-tRNA synthetase from escherichia coli complexed with methioninyl adenylate (see paper)
57% identity, 81% coverage

Ligand: l-methionyl adenylate (1pg0A)

6wq6A / Q8PMP0 Xanthomonas citri methionyl-tRNA synthetase in complex with methionine (see paper)
58% identity, 80% coverage

Ligands: zinc ion; methionine (6wq6A)

A6LFP0 Methionine--tRNA ligase from Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
34% identity, 99% coverage

Pre-existing antibodies targeting a linear epitope on SARS-CoV-2 S2 cross-reacted with commensal gut bacteria and shaped vaccine induced immunity
Jia, 2021

BT2933 Methionyl-tRNA synthetase from Bacteroides thetaiotaomicron VPI-5482
34% identity, 99% coverage

Competitive metagenomic DNA hybridization identifies host-specific microbial genetic markers in cow fecal samples
Shanks, Applied and environmental microbiology 2006
- “...protein homologous to BT2686, a methionyl-tRNA synthetase (BT2933), a preprotein translocase (SecA subunit, BT4362), a reticulocyte binding protein (BT0749),...”

PGN_0281 methionyl-tRNA synthetase from Porphyromonas gingivalis ATCC 33277
33% identity, 99% coverage

Pathway analysis for intracellular Porphyromonas gingivalis using a strain ATCC 33277 specific database
Hendrickson, BMC microbiology 2009
- “...Increased (16) Unchanged (8) Decreased Levels (3) PGN_0209 PGN_0360 PGN_0137 PGN_0278 PGN_0266 PGN_0278 PGN_0365 PGN_0517 PGN_0281 PGN_0366 PGN_1157 PGN_0543 PGN_0570 PGN_0569 PGN_0981 PGN_0819 PGN_0962 PGN_1711 PGN_1883 PGN_0987 PGN_1218 PGN_1229 PGN_1381 PGN_1805 PGN_1969 PGN_2045 PGN_2060 Proteins are listed by ORF number in the same manner as in...”

PG0170 methionyl-tRNA synthetase from Porphyromonas gingivalis W83
33% identity, 99% coverage

VimA-dependent modulation of the secretome in Porphyromonas gingivalis
Osbourne, Molecular oral microbiology 2012
- “...(PG0212, fc 28), Peptidylarginine deiminase (PG1249, fc 12.1), Hemagglutinin (PG1602, fc 22.3), TonB-dependent OM receptor (PG0170, fc 285), and a hypothetical protein (PG0554, fc 50.7). VimA alters the secretome of P. gingivalis and could be involved in protein sorting In silico analysis of the missing protein...”
Role of vimA in cell surface biogenesis in Porphyromonas gingivalis
Osbourne, Microbiology (Reading, England) 2010
- “...Probable integral outer-membrane protein PG1562 Cell envelope 32 1.6 11 17 TonB-dependent outer membrane receptor PG0170 Transport 112 1.5 452 674 Receptor antigen B PG0171 Cell envelope 56 1.4 455 316 TonB-linked receptor tlr PG0582 Transport 51 1.4 14 10 TonB-linked outer membrane receptor PG1752 Transport...”

Q9V011 Methionine--tRNA ligase from Pyrococcus abyssi (strain GE5 / Orsay)
31% identity, 93% coverage

Exploring Proteus mirabilis Methionine tRNA Synthetase Active Site: Homology Model Construction, Molecular Dynamics, Pharmacophore and Docking Validation
Elbaramawi, Pharmaceuticals (Basel, Switzerland) 2023
- “...used to align the possible template sequences: E. coli (P00959), A. baumannii (A0A0D5YKJ7), P. abyssi (Q9V011), and A. aeolicus (O67298) MetRSs with the amino acid sequence of P. mirabilis MetRS ( Figure 3 ). The input set of query and template sequences have an evolutionary relationship...”
- “...(Q9HYC7); Enterococcus faecalis (Q837B3); Streptococcus pyogenes (Q9A178); Escherichia coli (P00959); Acinetobacter baumannii (A0A0D5YKJ7); Pyrococcus abyssi (Q9V011), Staphylococcus aureus (P67578). Figure 3 Sequence alignment of MetRS enzymes of Aquifex aeolicus , Pyrococcus abyssi, Acinetobacter baumannii, Proteus mirabilus and Escherichia coli using Clustal O in which * means...”

TK1049 methionyl-tRNA synthetase from Thermococcus kodakaraensis KOD1
31% identity, 73% coverage

Association of a multi-synthetase complex with translating ribosomes in the archaeon Thermococcus kodakarensis
Raina, FEBS letters 2012
- “...TK0568 tyrosyl-tRNA synthetase TK0978 glycyl-tRNA synthetase TK0550 prolyl-tRNA synthetase TK1461 leucyl-tRNA synthetase TK0444 cysteinyl-tRNA synthetase TK1049 methionyl-tRNA synthetase TK0308 elongation factor 1A TK0556 translation initiation factor 2B subunit beta TK1305 translation initiation factor 2 TK0309 elongation factor 2 TK0506 translation-associated GTPase TK1254 30S ribosomal protein S3Ae...”
Archaeal aIF2B interacts with eukaryotic translation initiation factors eIF2alpha and eIF2Balpha: Implications for aIF2B function and eIF2B regulation
Dev, Journal of molecular biology 2009
- “...plasmid pH-1. A 2034 bp DNA fragment containing TK1047, TK1048 and the 5 terminus of TK1049 was amplified with primers D and E ( Table S2 ), digested with PstI and HindIII, and ligated into PstI-and HindIII-digested pH-1 upstream of trpE to produce pH-2. QuikChange XL...”

1rqgA / Q9V011 Methionyl-tRNA synthetase from pyrococcus abyssi (see paper)
32% identity, 78% coverage

Ligand: zinc ion (1rqgA)

CAB622 methionyl-tRNA synthetase from Chlamydophila abortus S26/3
34% identity, 73% coverage

Genomic analysis of an attenuated Chlamydia abortus live vaccine strain reveals defects in central metabolism and surface proteins
Burall, Infection and immunity 2009
- “...CAB227 CAB273 CAB281 CAB283 NA CAB308 CAB373 CAB394 CAB469 CAB622 CAB636 NA CAB648 CAB772 CAB842 CAB887 NAh NA NA NA CAB185/CAB186 NA NA NA NA NA CAB287/CAB288...”
- “...754284 P S CAB175 CAB220 CAB273 CAB283 CAB308 CAB622 CAB636 CAB648 a Common/annotated denomination. SNP position on the reference genome. Original amino acid...”

AT4G13780 methionine--tRNA ligase, putative / methionyl-tRNA synthetase, putative / MetRS, putative from Arabidopsis thaliana
Q9SVN5 Methionine--tRNA ligase, cytoplasmic from Arabidopsis thaliana
29% identity, 84% coverage

PsGSTF3, an Anthocyanin-Related Glutathione S-Transferase Gene, Is Essential for Petal Coloration in Tree Peony
Han, International journal of molecular sciences 2022
- “...steps Unigene0078134 UF3GT 6 AT4G14090 AT4G14090.1 Encodes an anthocyanidin 5- O -glucosyltransferase Unigene0008084 UGT 7 AT4G13780 AT4G13780.1 Its function is described as methionine-tRNA ligase activity Unigene0007649 MetRS 8 AT5MAT AT3G29590.1 Involved in the malonylation of the 5- O -glucose residue of anthocyanin Unigene0095892 3AT 9 AT1G03495...”
Plant-Specific Domains and Fragmented Sequences Imply Non-Canonical Functions in Plant Aminoacyl-tRNA Synthetases
Saga, Genes 2020
- “...cytosol LeuRS At4g04350 cp GlyRS At3g48110 mt, cp At1g09620 cytosol, mt At1g29880 cytosol, mt MetRS At4g13780 cytosol At3g44740 N, C truncated At3g55400 mt, cp At1g29870 C truncated At5g02680 N, C truncated HisRS At3g02760 cytosol TrpRS At3g04600 cytosol At3g46100 mt, cp At2g25840 mt, cp At5g03406 C truncated...”
Differential expression of miRNAs and their targets in wax-deficient rapeseed
Liu, Scientific reports 2019
- “...180 SPX (SYG1/Pho81/XPR1) domain-containing protein Bna-novel-miR2 BnaC07g31010D AT5G61120 91 113 Zinc ion-binding protein Bna-novel-miR3 BnaC08g08850D AT4G13780 15 38 MethioninetRNA ligase BnaC04g33280D AT2G21720 2720 2743 Protein of unknown function BnaC04g08980D 462 485 Protein of unknown function a Nucleotides to the 5 end. Experimental validation of predicted targets...”
Proteomic analysis of endoplasmic reticulum stress responses in rice seeds
Qian, Scientific reports 2015
- “...class II core domain containing protein LOC_Os05g05840 gi|218184221 2.516 AT1G50200 alanyl-tRNA synthetase LOC_Os10g10244 gi|109940177 2.058 AT4G13780 methionyl-tRNA synthetase LOC_Os06g31210 gi|115462445 2.088 AT1G25350 glutaminyl-tRNA synthetase LOC_Os05g08990 gi|218197256 2.454 AT1G72550 phenylalanyl-tRNA synthetase beta chain LOC_Os05g48510 gi|222637260 2.004 AT3G60240 eukaryotic translation initiation factor 4G LOC_Os07g36940 gi|83306210 2.806 AT2G40290 Translation...”
In vivo protein tyrosine nitration in Arabidopsis thaliana
Lozano-Juste, Journal of experimental botany 2011
- “...TMK1_ARATH At1g66150 Putative receptor protein kinase TMK1 precursor 42 4 K.GNDPCTNWIGIACSNGNITVISLEK.M (18) K.VVNLTNNHLQGPVPVFK.S (12) SYM_ARATH At4g13780 Probable methionyl-tRNA synthetase 42 3 R.LVEGSCPFEGCNYDSAR.G (26) K.CKVCQNTPR.I (12) WEE1_ARATH At1g02970 Wee1-like protein kinase 41 3 R.AMPPPCLK.N (19) K.LPLLPGHSLQLQQLLK.T (15) ARR12_ARATH At2g25180 Two-component response regulator 41 5 .MTVEQNLEALDQFPVGMR.V (17) R.HCQYHVTTTNQAQK.A...”
AtPIN: Arabidopsis thaliana protein interaction network
Brandão, BMC bioinformatics 2009
- “...60S ribosomal protein L37a (RPL37aC) AT4G08500 MEKK1 (MYTOGEN ACTIVATED PROTEIN KINASE KINASE); DNA binding/kinase/kinase binding AT4G13780 Methionine--tRNA ligase, putative/methionyl-tRNA synthetase, putative/MetRS, putative AT4G13820 Disease resistance family protein/LRR family protein AT5G04430 KH domain-containing protein NOVA, putative AT5G12370 SEC10 (EXOCYST COMPLEX COMPONENT SEC10) AT5G13520 Peptidase M1 family protein...”
Ecological genomics of Boechera stricta: identification of a QTL controlling the allocation of methionine- vs branched-chain amino acid-derived glucosinolates and levels of insect herbivory
Schranz, Heredity 2009
- “...AtLeuC1; AT4G13430) is near the QTL peak. Alternatively, a gene such as a methionine-tRNA ligase (AT4G13780) could be involved in altering the available pools of Met, or Selenium binding proteins (AT4G14030) might regulate sulfur availability ( Van Hoewyk et al , 2008 ). Ultimately, the identification...”
Dual targeting is the rule for organellar aminoacyl-tRNA synthetases in Arabidopsis thaliana
Duchêne, Proceedings of the National Academy of Sciences of the United States of America 2005
- “...At4g10320 At3g11710 At3g13490 At4g04350 At1g09620 At4g13780 At3g55400 At2g40660 At5g56680 At4g17300 At1g70980 At3g07420 At1g68420 At5g38750 At5g52520 At3g62120...”
Proteome-Wide Analysis of Heat-Stress in Pinus radiata Somatic Embryos Reveals a Combined Response of Sugar Metabolism and Translational Regulation Mechanisms.
Castander-Olarieta, Frontiers in plant science 2021
- “...2.43 Small heat shock protein, chloroplastic Q95661 2.68 1.94 0.72 0.007 1.38 MethioninetRNA ligase, cytoplasmic Q9SVN5 0.35 0.12 0.34 0.009 2.22 Outer plastidial membrane protein porin P42054 1.1 1.58 1.43 0.01 2.25 Mitochondrial outer membrane protein porin 2 Q6L5I5 0.91 1.38 1.51 0.011 1.9 DnaJ protein...”

CTL0287 methionyl-tRNA synthetase from Chlamydia trachomatis 434/Bu
32% identity, 73% coverage

Robust Heat Shock Response in Chlamydia Lacking a Typical Heat Shock Sigma Factor
Huang, Frontiers in microbiology 2021
- “...na gidA CTL0760 tRNA uridine 5-carboxymethylaminomethyl modification protein GidA 1.59 nd na tRNA biogenesis metG CTL0287 Methionine--tRNA ligase 2.19 (1.750.36) 1.15E-02 valS CTL0554 Valine--tRNA ligase 2.19 nd na gltX CTL0705 Glutamate--tRNA ligase 1.57 nd na argS CTL0714 Arginine--tRNA ligase 2.46 (2.240.50) 1.58E-02 Initiation infC CTL0205 Translation...”

CT032 Methionyl-tRNA Synthetase from Chlamydia trachomatis D/UW-3/CX
32% identity, 73% coverage

Ab initio structural modeling of and experimental validation for Chlamydia trachomatis protein CT296 reveal structural similarity to Fe(II) 2-oxoglutarate-dependent enzymes
Kemege, Journal of bacteriology 2011
- “...of DNA between the two converging genes CT032 and CT033 was amplified using the IR800-labeled primers (5-ACATTCCTTAGATCTAGGTTC CC-3 and...”
- “...bp from the region of DNA between the two converging genes CT032 and CT033 was used. No shifts in DNA were detected with any of the promoter regions analyzed at...”

TP0798 methionyl-tRNA synthetase (metG) from Treponema pallidum subsp. pallidum str. Nichols
29% identity, 83% coverage

Transcriptional and immunological analysis of the putative outer membrane protein and vaccine candidate TprL of Treponema pallidum
Haynes, PLoS neglected tropical diseases 2021
- “...tp0381 HEX-CCAGCTCACATACATCCCCT GTTTCTTAAAAGACCCGTATCCGCCA 176 -7 tp0479 HEX-TGGCATACTCCTCTTCGCAA CAGCGAGCAAAGAACCTACG 180 +95 tp0617 HEX-TGATGTTCCGTGGTCAGTGT GTTTCTTAACGTACCACCCTCCATGTT 184 -1 tp0798 NED-TGACTGAAGGTTGGCTACGT GATCAAGCCACCAAGACTGC 234 +826 tp0969 FAM-CAGTGGTAGGGACGTTCAGA CCGCGTACACCAAGACTTTC 246 +56 tp0986 HEX-TGTACACGTCTAGGGGCATC ACCAGGTTACGCGTAAATGC 202 -7 1 Forward primer is labelled with either NED HEX or FAM 2 Location indicates the position...”
Transcription of TP0126, Treponema pallidum putative OmpW homolog, is regulated by the length of a homopolymeric guanosine repeat
Giacani, Infection and immunity 2015
- “...synthetase Hypothetical protein TP0279 TP0347 TP0379 TP0479 TP0497 TP0697 TP0798 TP0860 Poly(G) locationb 100 31 153 24 48 307 341 532 9 60 942 29 7 99...”
Length of guanosine homopolymeric repeats modulates promoter activity of subfamily II tpr genes of Treponema pallidum ssp. pallidum
Giacani, FEMS immunology and medical microbiology 2007
- “...TP0257 TP0279 TP0347 TP0379 TP0381 TP0479 TP0697 TP0798 TP0859 TP0860 TP0969 Flagellar motor switch protein (fliG-1) (Treponema denticola) Methyl-accepting...”
Genome differences between Treponema pallidum subsp. pallidum strain Nichols and T. paraluiscuniculi strain Cuniculi A
Strouhal, Infection and immunity 2007
- “...(5,289 bp; 0.46% of the genome), comprising genes TP0798 to TP0800 (accession number EF419251), TP0933 and TP0934 (accession number EF419252), and TP0961 and...”

LOC108992747 methionine--tRNA ligase, cytoplasmic from Juglans regia
27% identity, 83% coverage

Metabolomics and Transcriptomics Analyses Reveals the Molecular Regulatory Mechanisms of Walnut (Juglans regia L.) Embryos in Response to Shade Treatment
Liang, International journal of molecular sciences 2023
- “...( Figure S1E,F ). The results indicate that glycine-rich protein DOT1 (LOC109004676) and methionine-tRNA ligase (LOC108992747) are the core genes evident in the brown- and turquoise-colored modules, respectively. These two core genes may play an important regulatory role in fatty acid and amino acid synthesis. 2.9....”

BB0587 methionyl-tRNA synthetase (metG) from Borrelia burgdorferi B31
27% identity, 91% coverage

Borrelia host adaptation Regulator (BadR) regulates rpoS to modulate host adaptation and virulence factors in Borrelia burgdorferi
Miller, Molecular microbiology 2013
- “...3.17 1.33 4.83E-02 1.69E-01 BB0080 ABC transporter, ATP-binding protein chromosome 2.05 2.82 1.49 1.29E-02 7.48E-02 BB0587 methionyl-tRNA synthetase chromosome 2.05 2.86 1.47 1.58E-02 8.41E-02 BB0078 hypothetical protein chromosome 2.04 3.12 1.33 4.54E-02 1.62E-01 BB0749 hypothetical protein chromosome 2.03 2.73 1.52 8.88E-03 5.91E-02 BB0009 hypothetical protein chromosome...”
Rrp1, a cyclic-di-GMP-producing response regulator, is an important regulator of Borrelia burgdorferi core cellular functions
Rogers, Molecular microbiology 2009
- “...integral membrane protein CE 7.78 0.0173 BB0586 femA protein ( femA ) X 6.43 0.0153 BB0587 methionyl-tRNA synthetase ( metG ) ARS 19.5 0.0125 BB0588 5-methylthioadenosine/ S -adenosylhomocysteine nucleosidase, putative ( pfs-2 ) NM 14.2 0.0104 Caimano et al . (2007) BB0589 phosphate acetyltransferase ( pta...”

Igni_1155 methionyl-tRNA synthetase from Ignicoccus hospitalis KIN4/I
30% identity, 73% coverage

Multi-omics analysis provides insight to the Ignicoccus hospitalis-Nanoarchaeum equitans association
Rawle, Biochimica et biophysica acta. General subjects 2017
- “...Igni_0586 Undecaprenyl pyrophosphate synthetase p Igni_0362 Prolyl-tRNA synthetase p L-Proline m Igni_0928 Arginyl-tRNA synthetase t Igni_1155 Methionyl-tRNA synthetase L-Methionine m Igni_0220 Valyl-tRNA synthetase L-Valine m Igni_0347 Tyrosyl-tRNA synthetase L-Tyrosine m Cluster 2 Igni_0843 Phosphoribosylaminoimidazole-succinocarboxamide synthase T L-Aspartate m Igni_1091 Serine hydroxymethyltransferase Glycine m Igni_0165 Phosphoribosylamine--glycine ligase...”
- “...Aspartate kinase L-Aspartyl-4-Phosphate m Igni_1227 Phenylalanyl-tRNA synthetase, alpha subunit L-Phenylalanine m Igni_0396 Ser-tRNA(Thr) hydrolase p Igni_1155 Methionyl-tRNA synthetase t,p Igni_0480 S-layer-like domain-containing protein p Igni_0479 Hypothetical protein p Igni_0441 Hypothetical protein t Igni_0440 Glycosyl transferase family protein p Igni_0155 SNO glutamine amidotransferase p Note: Gene/proteins are...”

TC0301 methionyl-tRNA synthetase from Chlamydia muridarum Nigg
31% identity, 73% coverage

Mutational Analysis of the Chlamydia muridarum Plasticity Zone
Rajaram, Infection and immunity 2015
- “...binding protein ABC transporter, permease protein tc0168 tc0301 tc0338 tc0341 tc0342 ABC transporter, permease protein tc0343 tc0359 tc0408 tc0412 tc0437 tc0493...”

Q9ZTS1 methionine-tRNA ligase (EC 6.1.1.10) from Oryza sativa (see paper)
28% identity, 84% coverage

Q74MZ1 methionine-tRNA ligase (EC 6.1.1.10) from Nanoarchaeum equitans (see paper)
NEQ457 NEQ457 from Nanoarchaeum equitans Kin4-M
27% identity, 87% coverage

A dictionary based informational genome analysis
Castellini, BMC genomics 2012
- “...we may notice on the right, the gene NEQ475 is linked with the NEQ186 and NEQ457. It contains at least two occurrences of each of three different repeats, has 8 distinct repeats in common with NEQ186 and only one with NEQ 457. Figure 4 Repeat sharing...”

BAS4903 methionyl-tRNA synthetase, putative from Bacillus anthracis str. Sterne
BA5278 methionyl-tRNA synthetase, putative from Bacillus anthracis str. Ames
29% identity, 79% coverage

Changes in Bacillus anthracis CodY regulation under host-specific environmental factor deprived conditions
Kim, BMC genomics 2016
- “...a large number of hypothetical proteins, their relationships were largely ambiguous. One under-expressed gene is BAS4903, the gene product of which covalently links methionine to its cognate tRNA. In addition, several genes that had previously not been identified in a microarray approach were revealed by RNA-sequencing....”
- “...; BAS0385 ) gene. From DN cluster 4, we chose the methionyl-tRNA synthetase gene ( BAS4903 ). From cluster 6, we chose a putative ArsR family transcriptional regulator ( BAS0563 ). From UP cluster 7, we chose the phosphopyruvate hydratase gene ( eno ; BAS4985 )....”
Evaluation of the metS and murB loci for antibiotic discovery using targeted antisense RNA expression analysis in Bacillus anthracis
Kedar, Antimicrobial agents and chemotherapy 2007
- “...sequence information of B. anthracis metS1 (BA0036), metS2 (BA5278), murB1 (BA4048), and murB2 (BA5315) genes was derived from the GenBank entry for the...”
- “...AATAATGTCGACCCTTATTGTAACATCTACTCATTCAATC CGATGCAAGAAGTATTAGGAAATAG ATAGAATGTCCAAAACTTTGTTCTC metS2 BA5278 MS2-1 MS2-2 MS2-3 MS2-4 MS2-5 MS2-6...”

SYMC_YEAST / P00958 Methionine--tRNA ligase, cytoplasmic; Methionyl-tRNA synthetase; MetRS; EC 6.1.1.10 from Saccharomyces cerevisiae (strain ATCC 204508 / S288c) (Baker's yeast) (see 7 papers)
P00958 methionine-tRNA ligase (EC 6.1.1.10) from Saccharomyces cerevisiae (see paper)
NP_011780 methionine--tRNA ligase MES1 from Saccharomyces cerevisiae S288C
YGR264C Mes1p from Saccharomyces cerevisiae
30% identity, 71% coverage

function: Catalyzes the attachment of methionine to tRNA(Met) in a two- step reaction: methionine is first activated by ATP to form Met-AMP and then transferred to the acceptor end of tRNA(Met).
catalytic activity: tRNA(Met) + L-methionine + ATP = L-methionyl-tRNA(Met) + AMP + diphosphate (RHEA:13481)
subunit: Component of a yeast aminoacyl-tRNA synthase (aaRS) complex formed by methionyl-tRNA synthase MES1, glutamyl-tRNA synthase GUS1 and the tRNA aminoacylation cofactor ARC1 in a stoichiometric complex. Interacts (via N-ter) with ARC1 (via N-ter). Can also form a stable binary complex with ARC1 that is functional in terms of aminoacylation. ARC1 increases the affinity for cognate tRNAs due to the presence of a tRNA binding domain in the middle and C-terminal part of ARC1.
Molecular determinants of the yeast Arc1p-aminoacyl-tRNA synthetase complex assembly.
Karanasios, Journal of molecular biology 2007 (PubMed)
- GeneRIF: mutations that abolish the interaction of methionyl-tRNA synthetase with Arc1p cause entry of the enzyme into the nucleus, proving that complex association regulates its subcellular distribution.
Protein-protein interaction analysis for functional characterization of helicases.
Zybailov, Methods (San Diego, Calif.) 2016
- “...7.9E-06 P53305 Mitochondrial 37S ribosomal protein S27 1 6 21 3.8E-04 0.1 6 208 3.8E-05 P00958 Methionine--tRNA ligase, cytoplasmic 0.1 19 651 1.0E-13 1 7 24 8.6E-05 P25626 54S ribosomal protein IMG1 3 9 10 1.2E-04 0.1 5 173 1.8E-04 Columns named S and I show...”
Biallelic Mutations of Methionyl-tRNA Synthetase Cause a Specific Type of Pulmonary Alveolar Proteinosis Prevalent on Réunion Island.
Hadchouel, American journal of human genetics 2015
Analysis of Protein-protein Interaction Interface between Yeast Mitochondrial Proteins Rim1 and Pif1 Using Chemical Cross-linking Mass Spectrometry.
Zybailov, Journal of proteomics & bioinformatics 2015
- “...7.9E-06 P53305 Mitochondrial 37S ribosomal protein S27 1 6 21 3.8E-04 0.1 6 208 3.8E-05 P00958 Methionine--tRNA ligase, cytoplasmic 0.1 19 651 1.0E-13 1 7 24 8.6E-05 P25626 54S ribosomal protein IMG1 3 9 10 1.2E-04 0.1 5 173 1.8E-04 Columns named S and I show...”
Structural basis of yeast aminoacyl-tRNA synthetase complex formation revealed by crystal structures of two binary sub-complexes
Simader, Nucleic acids research 2006
- “...MetRS: XP_451421.1; A.gossypii Arc1p: NP_985516.1, GluRS: NP_985811.1, MetRS: NP_986998.1; S.cerevisiae Arc1p: X95481, GluRS: P46655, MetRS: P00958. Figure 6 The GluRS-NArc1p-N interface. Stereo-view of the GluRS-N (red)Arc1p-N (yellow) complex interface with helix labels as in Figure 3C . Selected contacting residues are shown in stick mode and...”
Comprehensive characterization of mRNAs associated with yeast cytosolic aminoacyl-tRNA synthetases
Garin, RNA biology 2021 (secret)
Meta-analytic framework for liquid association
Wang, Bioinformatics (Oxford, England) 2017
- “...false positive. On the other hand, the LA triplet (YGR264C, YOR197W and YDR519W) in Figure 1B is obtained from the combined meta-analysis of the first three...”
Methods for causal inference from gene perturbation experiments and validation
Meinshausen, Proceedings of the National Academy of Sciences of the United States of America 2016
- “...YMR103C YMR321C YCL042W YLL020C YPL240C YBR126C YMR173W-A YGR264C YJL077C YLR170C YDR011W YLR345W YBL005W YNR007C YPL211W YKL098W YDR339C YGR130C YML100W...”
Translate to divide: сontrol of the cell cycle by protein synthesis
Polymenis, Microbial cell (Graz, Austria) 2015
- “...eIF3b G1 47 48 Translation Elongation Factors YLR249W YEF3 eEF1B G2/M, other 52 tRNA synthetases YGR264C MES1 MetRS G1 51 YLL018C DPS1 AspRS G1 52 YOR335C ALA1/CDC64 AlaRS G1 50 YPL160W CDC60 LeuRS G1 50 tRNA tQ(CUG)M CDC65 tRNA-Gln G1 137 Ribosome biogenesis and assembly YBL004W...”
Transcriptional profiling of cross pathway control in Neurospora crassa and comparative analysis of the Gcn4 and CPC1 regulons
Tian, Eukaryotic cell 2007
- “...YHR020W YFL022C YNL247W YHR019C YOL097C YPR033C YGR264C YGR185C YOR168W YDR341C YGL245W YPL160W taTGATTCAtg aaTGCGTCAta atCGAGTCAaa agTGAGACAat ttTGCGTCAgc...”
Substrate specificity analysis of protein kinase complex Dbf2-Mob1 by peptide library and proteome array screening
Mah, BMC biochemistry 2005
- “...YJR142W 0.2005 YGR220C MRPL9 0.1976 YLR177W 0.1626 YJL211C 0.1594 YML035C AMD1 0.1384 YGL105W ARC1 0.1332 YGR264C MES1 0.1328 YPL257WA 0.1302 YBL024W NCL1 0.1294 YJR094WA 0.1141 YLR007W NSE1 0.0988 YLR303W MET17 0.0985 YGR223C 0.0837 YKR022C 0.0806 YLL008W DRS1 0.0702 YFR033C QCR6 0.042 YLR004C 0.0228 Activated FHH Dbf2-...”

gbs1611 methionyl-tRNA synthetase from Streptococcus agalactiae NEM316
28% identity, 100% coverage

Remodeling of the Streptococcus agalactiae transcriptome in response to growth temperature
Mereghetti, PloS one 2008
- “...- groEL , and genes encoding other chaperone proteins (gbs0422, gbs1383, gbs1634 ( clpX ), gbs1611, gbs1634 ( clpP ), and gbs1865) were transcribed at high levels at both temperatures but there was no significant difference between 30C and 40C at any growth point. Such results...”

stu0451 methionyl-tRNA synthetase from Streptococcus thermophilus LMG 18311
27% identity, 99% coverage

Transcriptome analysis of adaptive heat shock response of Streptococcus thermophilus
Li, PloS one 2011
- “...rpsI 4.2 2.3 30S ribosomal protein S9 stu0074 J tsf 3.6 3.1 elongation factor Ts stu0451 J metG 3.2 4.3 methionyl-tRNA synthetase stu1808 J rpmH 3.1 2.8 50S ribosomal protein L34 stu1932 J rplW 2.6 3.6 50S ribosomal protein L23 stu1926 J rpmC 3.3 3.6 50S...”

SACE_0799 methionyl-tRNA synthetase from Saccharopolyspora erythraea NRRL 2338
31% identity, 74% coverage

Comparative genomics and transcriptional profiles of Saccharopolyspora erythraea NRRL 2338 and a classically improved erythromycin over-producing strain
Peano, Microbial cell factories 2012
- “...Missense (A222T) Two-component system sensor kinase Translation machinery SACE_0443 464 cysS Missense (G198S) Cysteinyl-tRNA synthetase SACE_0799 593 metS Missense (P569S) Methionyl-tRNA synthetase SACE_2075 188 efp Frameshift (+C 504) Elongation factor P SACE_3403 474 gatA Missense (A243E) Asp-tRNAAsn/Glu-tRNAGln amidotransferase A subunit SACE_5926 1027 infB Missense (A278V) Translation...”
- “...including missense mutations affecting SACE_5926 ( infB ) coding for the translation initiation factor 2, (SACE_0799) ( metS ) coding form methionyl-tRNA synthetase, SACE_0443 ( cysS paralog) encoding a cysteinyl-tRNA synthatase, SACE_3403 ( gatA ) coding for A subunit of Asp-tRNA Asn/Glu-tRNA Gln amidotransferase, and a...”

SYMC_SCHPO / Q9UUF2 Probable methionine--tRNA ligase, cytoplasmic; Methionyl-tRNA synthetase; MetRS; EC 6.1.1.10 from Schizosaccharomyces pombe (strain 972 / ATCC 24843) (Fission yeast) (see paper)
30% identity, 71% coverage

catalytic activity: tRNA(Met) + L-methionine + ATP = L-methionyl-tRNA(Met) + AMP + diphosphate (RHEA:13481)

SpyM3_0300 putative methionyl-tRNA synthetase from Streptococcus pyogenes MGAS315
27% identity, 99% coverage

Novel regulatory small RNAs in Streptococcus pyogenes
Tesorero, PloS one 2013
- “...SPyM3_0298 putative cell envelope proteinase >>> SPyM3_0299 hypothetical protein >>> Q, Z, P SSRC 9 SPyM3_0300 methionyl-tRNA synthetase >>> SPyM3_0301 ribonucleotide-diphosphate reductase subunit beta >>> Q, Z SSRC10 SPyM3_0439 hypothetical protein >>> SPyM3_0440 putative calcium transporter >>> Q, P SSRC11 SPyM3_0455 putative cell-division protein >>> SPyM3_0457...”

STH3252 methionyl-tRNA synthetase from Symbiobacterium thermophilum IAM 14863
28% identity, 99% coverage

Unique Evolution of Symbiobacterium thermophilum Suggested from Gene Content and Orthologous Protein Sequence Comparisons
Oshima, International journal of evolutionary biology 2010
- “...0.0034 0.0397 10.1363 ftsE (cell division ATP-binding protein, STH0139) 0.0027 0.0407 5.6285 metG (methionyl-tRNA synthetase, STH3252) 0.0027 0.0470 4.1885 rplC (50S ribosomal protein L3, STH3075) 0.0023 0.0920 4.3304 rplB (50S ribosomal protein L2, STH3072) 0.0020 0.0617 3.9836 rpsH (30S ribosomal protein S8, STH3061) 0.0018 0.1047 4.5829...”
Genome sequence of Symbiobacterium thermophilum, an uncultivable bacterium that depends on microbial commensalism
Ueda, Nucleic acids research 2004
- “...(STH1231), proline(STH1502), alanine (STH2000) and methionine (STH3252). S.thermophilum possesses a complete set of ribosomal proteins and each component...”

SYMC_HUMAN / P56192 Methionine--tRNA ligase, cytoplasmic; Methionyl-tRNA synthetase; MetRS; EC 6.1.1.10 from Homo sapiens (Human) (see 11 papers)
P56192 methionine-tRNA ligase (EC 6.1.1.10) from Homo sapiens (see 2 papers)
NP_004981 methionine--tRNA ligase, cytoplasmic from Homo sapiens
29% identity, 60% coverage

function: Catalyzes the specific attachment of an amino acid to its cognate tRNA in a 2 step reaction: the amino acid (AA) is first activated by ATP to form AA-AMP and then transferred to the acceptor end of the tRNA (PubMed:11714285). Plays a role in the synthesis of ribosomal RNA in the nucleolus (PubMed:10791971).
catalytic activity: tRNA(Met) + L-methionine + ATP = L-methionyl-tRNA(Met) + AMP + diphosphate (RHEA:13481)
subunit: Monomer (PubMed:11714285). Part of a multisubunit complex that groups tRNA ligases for Arg (RARS1), Asp (DARS1), Gln (QARS1), Ile (IARS1), Leu (LARS1), Lys (KARS1), Met (MARS1) the bifunctional ligase for Glu and Pro (EPRS1) and the auxiliary subunits AIMP1/p43, AIMP2/p38 and EEF1E1/p18 (PubMed:19131329, PubMed:19289464, PubMed:26472928, Ref.26). Forms a linear complex that contains MARS1, EEF1E1, EPRS1 and AIMP2 that is at the core of the multisubunit complex (PubMed:26472928).
Protein instability associated with AARS1 and MARS1 mutations causes trichothiodystrophy.
Botta, Human molecular genetics 2021
- GeneRIF: Protein instability associated with AARS1 and MARS1 mutations causes trichothiodystrophy.
Structural basis for the dynamics of human methionyl-tRNA synthetase in multi-tRNA synthetase complexes.
Kim, Nucleic acids research 2021
- GeneRIF: Structural basis for the dynamics of human methionyl-tRNA synthetase in multi-tRNA synthetase complexes.
Deep phenotyping of MARS1 (interstitial lung and liver disease) and LARS1 (infantile liver failure syndrome 1) recessive multisystemic disease using Human Phenotype Ontology annotation: Overlap and differences. Case report and review of literature.
La, European journal of medical genetics 2021 (PubMed)
- GeneRIF: Deep phenotyping of MARS1 (interstitial lung and liver disease) and LARS1 (infantile liver failure syndrome 1) recessive multisystemic disease using Human Phenotype Ontology annotation: Overlap and differences. Case report and review of literature.
Methionyl-tRNA Synthetase is a Useful Diagnostic Marker for Lymph Node Metastasis in Non-Small Cell Lung Cancer.
Lee, Yonsei medical journal 2019
- GeneRIF: MRS/CD45 dual IF staining showed good diagnostic performance and may be a good tool complementing conventional cytology test for determining lymph node metastasis of non-small cell lung cancer.
MARS variant associated with both recessive interstitial lung and liver disease and dominant Charcot-Marie-Tooth disease.
Rips, European journal of medical genetics 2018
- GeneRIF: Compound Arg618Cys and Tyr307Cys variants were identified in an infant with syndromic interstitial lung and liver disease. Arg618Cys associated with Charcot-Marie-Tooth disease was inherited from an unaffected father.
Mutations in MARS identified in a specific type of pulmonary alveolar proteinosis alter methionyl-tRNA synthetase activity.
Comisso, The FEBS journal 2018 (PubMed)
- GeneRIF: The results establish that the pulmonary alveolar proteinosis-related substitutions in MARS impact the tRNAMet-aminoacylation reaction especially at the level of methionine recognition.
Mutations in methionyl-tRNA synthetase gene in a Chinese family with interstitial lung and liver disease, postnatal growth failure and anemia.
Sun, Journal of human genetics 2017 (PubMed)
- GeneRIF: Genotype-phenotype correlation analysis suggests most of the interstitial lung and liver disease (ILLD), mutations locate in the catalytic domain of MARS. ILLD and Charcot-Marie-Tooth disease, axonal, type 2U might have different disease mechanism.
Methionyl-tRNA synthetase overexpression is associated with poor clinical outcomes in non-small cell lung cancer.
Kim, BMC cancer 2017
- GeneRIF: MRS is frequently overexpressed in NSCLC. Moreover, MRS is related to mTORC1 activity and its overexpression is associated with poor clinical outcomes, indicating that it has potential as a putative therapeutic target.
More
Mechanistic insight into human milk extracellular vesicle-intestinal barrier interactions.
Luo, Journal of extracellular biology 2025
- “...P62979 Ubiquitin40S ribosomal protein S27a RPS27A 1.697 0.031 Q02809 Procollagenlysine,2oxoglutarate 5dioxygenase 1 PLOD1 4.403 0.035 P56192 MethioninetRNA ligase, cytoplasmic MARS1 7.030 0.036 P01024 Complement C3c alpha' chain fragment 1 C3 1.416 0.040 O95678 Keratin, type II cytoskeletal 75 KRT75 1.320 0.042 P49189 4trimethylaminobutyraldehyde dehydrogenase ALDH9A1 2.747...”
Differential Proteomic Analysis of Human Sperm: A Systematic Review to Identify Candidate Targets to Monitor Sperm Quality.
Corda, The world journal of men's health 2024
- “...26 54 ]; Hyperthermia [ 52 ]; Severe OAT [ 38 ] - - - P56192 MARS1 Methionine--tRNA ligase, cytoplasmic 4 AZS [ 26 54 ]; GZS [ 53 ]; LM [ 34 ] - - - P62820 RAB1A Ras-related protein Rab-1A 4 AZS [ 26...”
SRCAP is involved in porcine reproductive and respiratory syndrome virus activated Notch signaling pathway.
Ding, Journal of virology 2024
- “...Heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37 kDa), isoform CRA e P56192 MARS 10 13.3 101.11 3.21 0.017 Methionyl-tRNA synthetase P05455 SSB 17 31.9 46.84 3.19 0.031 Sjogren syndrome antigen B (autoantigen La); binds to the 3 poly (U) termini of nascent...”
Identification and characterization of hADSC-derived exosome proteins from different isolation methods
Huang, Journal of cellular and molecular medicine 2021
- “...20.5 1.18 1.18 Q9Y5P6 Mannose1phosphate guanyltransferase beta 0 21 6 9 6 39.8 0.683 0.844 P56192 MethioninetRNA ligase, cytoplasmic 0.001 1 1 1 1 101.1 0.752 1.013 P46821 Microtubuleassociated protein 1B 0 2 4 4 4 270.5 0.777 0.875 P28482 Mitogenactivated protein kinase 1 0 19...”
The Effect of Cannabidiol on UV-Induced Changes in Intracellular Signaling of 3D-Cultured Skin Keratinocytes
Gęgotek, International journal of molecular sciences 2021
- “...P07814, glutamate/proline-tRNA ligase; P14868, aspartate-tRNA ligase; P41252, isoleucine-tRNA ligase; P47897, glutamine-tRNA ligase; P54136, arginine-tRNA ligase; P56192, methionine-tRNA ligase; Q15046, lysine-tRNA ligase; Q9P2J5, leucine-tRNA ligase; P62081, P46781, P25398, P60866, 40S ribosomal proteins S7, S9, S12, S20; P39023, P27635, P30050, P35268, P46779, 60S ribosomal protein L3, L10, L12,...”
Secretory Carrier Membrane Protein 3 Interacts with 3A Viral Protein of Enterovirus and Participates in Viral Replication.
Lu, Microbiology spectrum 2021
- “...Q02750 MAP2K1 Dual specificity mitogen-activated protein kinase kinase 1 43.4 88.5 2 2 3 5.09 P56192 MARS Methionyl-tRNA synthetase, cytoplasmic 101.1 207.0 5 5 6 6.33 P49736 MCM2 DNA replication licensing factor MCM2 101.8 59.1 2 2 2 2.54 Q96HR3 MED30 Mediator of RNA polymerase II...”
Altered Ca2+ Homeostasis in Red Blood Cells of Polycythemia Vera Patients Following Disturbed Organelle Sorting during Terminal Erythropoiesis.
Buks, Cells 2021
- “...60 kDa heat shock protein, mitochondrial HSPD1 P10809 0.0212 3.9 M MethioninetRNA ligase, cytoplasmic MARS P56192 0.0100 3.8 C Prohibitin PHB P35232 0.0253 3.3 C Pm M N Myosin-9 MYH9 P35579 0.0221 3.1 C N S Stress-70 protein, mitochondrial HSPA9 P38646 0.0151 2.7 M Isocitrate dehydrogenase...”
Alendronate-induced Perturbation of the Bone Proteome and Microenvironmental Pathophysiology.
Kim, International journal of medical sciences 2021
- “...protein, mitochondrial 0.8848 0.1071 0.1049 0.0388 Q9UJW2 TINAG Tubulointerstitial nephritis antigen 0.8833 0.0976 0.1428 0.0474 P56192 MARS1 Methionine--tRNA ligase, cytoplasmic 0.8772 0.0039 0.1283 0.0037 P08579 SNRPB2 U2 small nuclear ribonucleoprotein B 0.8721 0.0322 0.2438 0.0361 Q9H4B7 TUBB1 Tubulin beta-1 chain 0.8644 0.0467 0.0944 0.0172 Q9H2H8 PPIL3...”
More

5goyA / P56192 The crystal structure of human cytosolic methionyl-tRNA synthetase in complex with methionine
29% identity, 79% coverage

Ligands: zinc ion; methionine (5goyA)

BC0043 Methionyl-tRNA synthetase from Bacillus cereus ATCC 14579
28% identity, 100% coverage

Multi-locus sequence typing and virulence profile in Bacillus cereus sensu lato strains isolated from dairy products
Bianco, Italian journal of food safety 2020
- “...- BC0042 Caciocavallo 2062* - - + - + + - + - + + BC0043 Caciocavallo 1986* + + + + + + + + - + - BC0044 Caciocavallo 262 + + + + + + + + + + - BC0045 Caciocavallo 1986*...”

Q9A178 Methionine--tRNA ligase from Streptococcus pyogenes serotype M1
27% identity, 99% coverage

Exploring Proteus mirabilis Methionine tRNA Synthetase Active Site: Homology Model Construction, Molecular Dynamics, Pharmacophore and Docking Validation
Elbaramawi, Pharmaceuticals (Basel, Switzerland) 2023
- “...(Q6PF21); Mycobacterium tuberculosis (P9WFU5); Thermus thermophilus (P23395); Pseudomonas aeruginosa (Q9HYC7); Enterococcus faecalis (Q837B3); Streptococcus pyogenes (Q9A178); Escherichia coli (P00959); Acinetobacter baumannii (A0A0D5YKJ7); Pyrococcus abyssi (Q9V011), Staphylococcus aureus (P67578). Figure 3 Sequence alignment of MetRS enzymes of Aquifex aeolicus , Pyrococcus abyssi, Acinetobacter baumannii, Proteus mirabilus and...”

Tsac_0653 methionine--tRNA ligase from Thermoanaerobacterium saccharolyticum JW/SL-YS485
27% identity, 99% coverage

Strain and bioprocess improvement of a thermophilic anaerobe for the production of ethanol from wood
Herring, Biotechnology for biofuels 2016
- “...S-layer domain-containing protein 4 adhE Tsac_0416 Bifunctional alcohol/aldehyde dehydrogenase 4 Yes Tsac_0644 Hypothetical protein 2 Tsac_0653 Methionyl-tRNA synthetase 2 Tsac_0825 Inorganic diphosphatase 2 Tsac_0838 Protein of unknown function DUF324 3 Yes Tsac_1263 PTS system transcriptional activator 3 Tsac_1419 ATPase, F0 complex, subunit A 2 Yes Tsac_1520...”

W8YK96 Methionine--tRNA ligase from Bacillus thuringiensis DB27
28% identity, 100% coverage

Role of hsp20 in the Production of Spores and Insecticidal Crystal Proteins in Bacillus thuringiensis
Xie, Frontiers in microbiology 2019
- “...W8Y9G2 0.46 icd Isocitrate dehydrogenase [NADP] W8Y7A6 0.46 sucD Succinate CoA ligase [ADP-forming] subunit alpha W8YK96 0.45 metG Methionine tRNA ligase W8Y8A7 0.45 ndk Nucleoside diphosphate kinase W8Z497 0.44 pdhC Dihydrolipoyllysine-residue acetyltransferase W8YKA7 0.44 mfd Transcription-repair-coupling factor W8YSS4 0.43 purN Phosphoribosylglycinamide formyltransferase W8Y8Z7 0.43 argD Acetylornithine...”

B4DF61 Methionine--tRNA ligase, cytoplasmic from Homo sapiens
29% identity, 79% coverage

Quantitative proteomic analysis for high-throughput screening of differential glycoproteins in hepatocellular carcinoma serum
Gao, Cancer biology & medicine 2015
- “...(Fragment) OS=Homo sapiens GN=NBL1 PE=4 SV=1 - [A3KFI1_HUMAN] 7.81 1 1 1 128 14.0 6.48 B4DF61 cDNA FLJ53309, highly similar to Methionyl-tRNA synthetase (EC 6.1.1.10) OS=Homo sapiens PE=2 SV=1 - [B4DF61_HUMAN] 2.05 3 1 1 635 71.8 7.14 Q9NSI4 PRED42 protein (Fragment) OS=Homo sapiens GN=PRED42 PE=4...”

NP_611382 Methionyl-tRNA synthetase from Drosophila melanogaster
A1ZBE9 Methionine--tRNA ligase, cytoplasmic from Drosophila melanogaster
28% identity, 58% coverage

let-65 is cytoplasmic methionyl tRNA synthetase in C. elegans
Alriyami, Meta gene 2014
- “...MARS-1 alignment with its human (GenBank accession no. NP_004981 ), D. melanogaster (GenBank accession no. NP_611382 ), and S. cerevisiae (GenBank accession no. CAA97293 ) orthologs showing conserved amino acids and identified let-65 mutations. MARS-1 is evolutionarily well conserved with 58% identity and 71% similarity to...”
New functions of aminoacyl-tRNA synthetases beyond translation
Guo, Nature reviews. Molecular cell biology 2010
- “...in non synthetase proteins. D. melanogaster MetRS has 3 WHEP domains at the C-terminus (InterPro: A1ZBE9), which were not found in the previous reports S. cerevisiae C. elegans D. melanogaster D. rerio H. sapiens Position in Human tRNA Synthetases CysRS + UNE-C 1,2 + GST 201297/664831,...”

I3LCC2 Methionine--tRNA ligase, cytoplasmic from Sus scrofa
29% identity, 56% coverage

Normothermic Ex-vivo Kidney Perfusion in a Porcine Auto-Transplantation Model Preserves the Expression of Key Mitochondrial Proteins: An Unbiased Proteomics Analysis
McEvoy, Molecular & cellular proteomics : MCP 2021
- “...0.024332153 F1RU12 LACTB2 LACTB2 17 POD3 NEVKP 0.012593529 NP_001116606.1 LIPA LIPA 8 POD3 SCS 0.003820522 I3LCC2 MARS MARS 14 POD3 SCS 0.002446129 K7GM47 MECP2 MECP2 13 POD3 NEVKP 0.012373323 Q2EN77 MGST3 MGST3 5 POD3 NEVKP 0.031301414 F1SD56 MISP3 MISP3 11 POD3 NEVKP 0.03029979 K7GMJ2 MME MME...”

Q181D9 methionine-tRNA ligase (EC 6.1.1.10) from Clostridioides difficile (see paper)
CD3540 methionyl-tRNA synthetase from Clostridium difficile 630
26% identity, 100% coverage

The current riboswitch landscape in Clostridioides difficile
Badilla, Microbiology (Reading, England) 2024
- “...CD1521 Tyrosine-tRNA ligase CD2245 Asparagine-tRNA ligase CD2521 Leucine-tRNA ligase CD2618 Isoleucine-tRNA ligase CD3256 Valine-tRNA ligase CD3540 Methionine-tRNA ligase Amino acid metabolism CD0989 2-Isopropylmalate synthase CD1580 Homoserine dehydrogenase CD1580* Homoserine dehydrogenase CD1785 Argininosuccinate synthase CD2034 N -Acetyl-gamma-glutamyl-phosphate reductase CD2118 Threonine synthase CD2500 Argininosuccinate lyase CD2611 Bifunctional 5-methylthioadenosine/S-adenosylhomocysteine...”
Investigation of the Cross-talk Mechanism in Caco-2 Cells during Clostridium difficile Infection through Genetic-and-Epigenetic Interspecies Networks: Big Data Mining and Genome-Wide Identification
Li, Frontiers in immunology 2017
- “...for C. difficile growth ( 20 ). Thirteen C. difficile proteins (CD2664, CD2335, CD0067, CD3550, CD3540, CD0198, CD1255, CD2714, CD3256, CD1316, CD0095, CD2739, and CD0123) in the HPN of the early stage of CDI (Figure S3 in Supplementary Material) and 15 C. difficile proteins (CD3170, CD2588,...”

PFREUD_06960 methionine--tRNA ligase from Propionibacterium freudenreichii subsp. shermanii CIRM-BIA1
30% identity, 73% coverage

A temporal-omic study of Propionibacterium freudenreichii CIRM-BIA1 adaptation strategies in conditions mimicking cheese ripening in the cold
Dalmasso, PloS one 2012
- “...Tu P 0.1 2.3 2.4 2.3 0.001 1.9 0.066 1.7 1.4 1.3 4.70E-05 3 metG PFREUD_06960 Methionyl-tRNA synthetase P 0.1 1.4 1.2 1.2 0.011 0.9 0.3 0.9 0.034 20 alaS PFREUD_11560 Alanyl-tRNA synthetase P 0.6 1.3 1 1.1 0.013 0.4 0.4 0.9 0.035 10 a Spot...”

BSU00380 methionyl-tRNA synthetase from Bacillus subtilis subsp. subtilis str. 168
26% identity, 100% coverage

The Blueprint of a Minimal Cell: MiniBacillus
Reuß, Microbiology and molecular biology reviews : MMBR 2016
- “...no. Organismd Function(s) leuS lysS metS pheT BSU30320 BSU00820 BSU00380 BSU28630 Yes Yes Yes Yes Yes Yes Yes Yes 6.1.1.4 6.1.1.6 6.1.1.10 6.1.1.20 1OBH 3E9H...”
Secondary structural entropy in RNA switch (Riboswitch) identification
Manzourolajdad, BMC bioinformatics 2015
- “...nt 45433 45632 forward BSU00360 yabC -535 -42.70 - 0.3000 124.7969971 - 0.4200 102 metS BSU00380 0.8666248322 200 nt 2531951 2532150 forward BSU24210 yqiG -14294 -62.90 - 0.5050 123.5699997 - 0.3450 9002 yqhQ BSU24490 0.8666005135 200 nt 2531951 2532150 forward BSU24210 yqiG -14294 -62.90 - 0.5050...”

SYMC_MOUSE / Q68FL6 Methionine--tRNA ligase, cytoplasmic; Methionyl-tRNA synthetase; MetRS; EC 6.1.1.10 from Mus musculus (Mouse) (see paper)
28% identity, 64% coverage

function: Catalyzes the specific attachment of an amino acid to its cognate tRNA in a 2 step reaction: the amino acid (AA) is first activated by ATP to form AA-AMP and then transferred to the acceptor end of the tRNA. Plays a role in the synthesis of ribosomal RNA in the nucleolus.
catalytic activity: tRNA(Met) + L-methionine + ATP = L-methionyl-tRNA(Met) + AMP + diphosphate (RHEA:13481)
subunit: Monomer. Part of a multisubunit complex that groups tRNA ligases for Arg (RARS1), Asp (DARS1), Gln (QARS1), Ile (IARS1), Leu (LARS1), Lys (KARS1), Met (MARS1) the bifunctional ligase for Glu and Pro (EPRS1) and the auxiliary subunits AIMP1/p43, AIMP2/p38 and EEF1E1/p18. Forms a linear complex that contains MARS1, EEF1E1, EPRS1 and AIMP2 that is at the core of the multisubunit complex.
Quantitative proteomic profiling reveals sexual dimorphism in the retina and RPE of C57BL6 mice
Jang, Biology of sex differences 2024
- “...39S ribosomal protein L44, mitochondrial 1 . 209 0.043 2.54E-02 7 0.858 0.038 2.31E-02 7 Q68FL6 Mars1 Chromosome 10 Methionine--tRNA ligase, cytoplasmic 1 . 199 0.047 2.92E-02 10 0.939 0.025 1.02E-01 10 Q9QWL7 Krt17 Chromosome 11 Keratin, type I cytoskeletal 17 1 . 198 0.065 8.63E-02...”
Functional, proteomic and bioinformatic analyses of Nrf2- and Keap1- null skeletal muscle
Gao, The Journal of physiology 2020
- “...Phenylalanine--tRNA ligase beta subunit 0.05 2.86 Ak2 Q9WTP6 Adenylate kinase 2, mitochondrial 0.05 2.26 Mars Q68FL6 Methionine--tRNA ligase, cytoplasmic 0.05 86.53 Ptges3l Q9D9A7 Putative protein PTGES3L 0.05 6.28 Sirt5 Q8K2C6 NAD-dependent protein deacylase sirtuin-5, mitochondrial 0.05 3.68 Ephx1 Q9D379 Epoxide hydrolase 1 0.04 1.71 Fermt2 Q8CIB5...”
Analysis of the Effect of Intestinal Ischemia and Reperfusion on the Rat Neutrophils Proteome.
Tahir, Frontiers in molecular biosciences 2018
- “...EC 6.3.4.21 Q6XQN1 Naprt1 4 0.091298572 0.136451197 0.227749769 MethioninetRNA ligase, cytoplasmic isoform 2 EC 6.1.1.10 Q68FL6 Mars 5 0.056877927 0.129932982 0.186810909 Major functional classes of the neutrophil proteome regulated by IR For the functional classification of the significantly regulated identified proteins, KEGG and Wiki pathways analyses...”

X956_RS01795 methionine--tRNA ligase from Trueperella pyogenes TP8
30% identity, 75% coverage

TatD DNases Contribute to Biofilm Formation and Virulence in Trueperella pyogenes
Zhang, Frontiers in microbiology 2021
- “...TP8 (accession No.: CP007003 ), and they are collectively referred to as tatD960 (locus tag: X956_RS01795 ) and tatD825 (locus tag: X956_RS00220 ) according to the length of their nucleotide sequences ( Supplementary Figure 3 ). The predicted molecular weights of TatD DNase 960 and TatD...”

D3Z941 Methionine--tRNA ligase, cytoplasmic from Rattus norvegicus
28% identity, 64% coverage

Gephyrin Interacts with the K-Cl Cotransporter KCC2 to Regulate Its Surface Expression and Function in Cortical Neurons
Al, The Journal of neuroscience : the official journal of the Society for Neuroscience 2022 (secret)

BPUM_0022 methionine--tRNA ligase from Bacillus pumilus SAFR-032
26% identity, 100% coverage

Bacillus pumilus SAFR-032 Genome Revisited: Sequence Update and Re-Annotation
Stepanov, PloS one 2016 (no snippet)

Bm1_12165 methionyl-tRNA synthetase, putative from Brugia malayi
30% identity, 60% coverage

Identification of attractive drug targets in neglected-disease pathogens using an in silico approach
Crowther, PLoS neglected tropical diseases 2010
- “...A, osteoclast isoform, putative 168 23 Bm1_52850 mannose-6-phosphate isomerase, class I family protein 168 23 Bm1_12165 methionyl-tRNA synthetase, putative 168 23 Bm1_48165 Adenosylhomocysteinase, putative 168 23 Bm1_32455 mannose-6-phosphate isomerase, class I family protein 168 23 Bm1_22825 Protein prenyltransferase alpha subunit repeat containing protein 168 23 Bm1_14125...”

BA0036 methionyl-tRNA synthetase from Bacillus anthracis str. Ames
27% identity, 100% coverage

Evaluation of the metS and murB loci for antibiotic discovery using targeted antisense RNA expression analysis in Bacillus anthracis
Kedar, Antimicrobial agents and chemotherapy 2007
- “...construction. The sequence information of B. anthracis metS1 (BA0036), metS2 (BA5278), murB1 (BA4048), and murB2 (BA5315) genes was derived from the GenBank...”
- “...AATAATGTCGACCTTACGAATTAAATCTAAACCACTC GCTACAGAAGAAGTGTTAGCAAG GCTGATTTACCAAACTTTGTACC metS1 BA0036 MS1-1 MS1-2 MS1-3 MS1-4 MS1-5 MS1-6...”

WP_088008409 methionine--tRNA ligase from Indiicoccus explosivorum
26% identity, 100% coverage

Robust Demarcation of the Family Caryophanaceae (Planococcaceae) and Its Different Genera Including Three Novel Genera Based on Phylogenomics and Highly Specific Molecular Signatures
Gupta, Frontiers in microbiology 2019
- “...WP_088008171 Figure 8B and Supplementary Figure 79 3 aa ins 72111 Flavidum clade MethioninetRNA ligase WP_088008409 Supplementary Figure 80 1 aa ins 125165 MetQ/NlpA family ABC transporter substrate-binding protein WP_088008611 Supplementary Figure 81 1 aa ins 70129 ABC transporter permease WP_088005980 Supplementary Figure 82 5 aa...”

LGG_02584 methionine--tRNA ligase from Lacticaseibacillus rhamnosus GG
LGG_02584 methionyl-tRNA synthetase / protein secretion chaperonin, CsaA from Lactobacillus rhamnosus GG
26% identity, 100% coverage

Growth phase-associated changes in the proteome and transcriptome of Lactobacillus rhamnosus GG in industrial-type whey medium
Laakso, Microbial biotechnology 2011
- “...0.427 LGG_01786 argS ArginyltRNA synthetase 107 1.8 0.827 LGG_02332 gltX GlutamyltRNA synthetase 108 1.6 1.553 LGG_02584 metG MethionyltRNA synthetase/protein secretion chaperonin, CsaA 109,110 2 0.586 Miscellaneous LGG_00226 Pyridoxine 5phosphate oxidase V related favinnucleotidebinding protein 111 3.4 3.048 LGG_00491 NADH peroxidase 112 4.1 0.197 LGG_00615 yeaE Aldo/keto...”

SPD_0689 methionyl-tRNA synthetase from Streptococcus pneumoniae D39
SP_0788 methionyl-tRNA synthetase from Streptococcus pneumoniae TIGR4
spr0696 methionyl-tRNA synthetase from Streptococcus pneumoniae R6
27% identity, 100% coverage

CcpA ensures optimal metabolic fitness of Streptococcus pneumoniae
Carvalho, PloS one 2011
- “...listed in Table 1 . The qRT-PCR data were normalized to the level of metG (spd_0689) cDNA using the 2 C T method [54] . The data are averages of four repeats. Quantification of fermentation products during growth Strains were grown as described above. Culture samples...”
- “...Materials and Methods . The qRT-PCR data were normalized to the level of metG ( spd_0689 ) cDNA and the data are averages of four repeats. (XLS) Click here for additional data file. Table S3 Subtable abstracted from Table S1 , giving only the genes in...”
Biofilm and planktonic pneumococci demonstrate disparate immunoreactivity to human convalescent sera
Sanchez, BMC microbiology 2011
- “...alpha subunit glyQ (SP_1475) 0 4 Methionyl-tRNA formyltransferase fmt (SP_1735) 0 2 Methionyl-tRNA synthetase metG (SP_0788) 0 2 Phenylalanyl-tRNA synthetase beta chain pheT (SP_0581) 0 2 Prolyl-tRNA synthetase proS (SP_0264) 0 12 10 kDa chaperonin groES (SP_1907) 3 8 60 kDa chaperonin groEL (SP_1906) 24 57...”
Comparative transcriptomic analysis of streptococcus pseudopneumoniae with viridans group streptococci
Park, BMC microbiology 2012
- “...1 spr0358 Mannitol-specific enzyme IIA component - - 1 spr0647 Mannose-6-phosphate isomerase 1 - - spr0696 Methionine--tRNA ligase 1 - - spr1714 MSM (multiple sugar metabolism) operon regulatory protein - 1 - spr1323 NADH oxidase 1 - - spr1899 Negative regulator of pho regulon for phosphate...”

EF0930 methionyl-tRNA synthetase from Enterococcus faecalis V583
27% identity, 97% coverage

Genes Contributing to the Unique Biology and Intrinsic Antibiotic Resistance of Enterococcus faecalis
Gilmore, mBio 2020
- “...SAW_00817 EF0838 Potentially Critical C Se UE l -Seryl-tRNA(Ser) selenium transferase 0.000 75 J SAW_00902 EF0930 Important ABC Se Methionine-tRNA ligase 0.015 100 J SAW_00975 EF1005 Important ABC Fe Iron-dependent repressor 0.014 100 K SAW_01087 EF1108 Potentially Critical C Redox UE Oxidoreductase 0.000 33 C SAW_01313...”

LOC100786507 probable methionine--tRNA ligase from Glycine max
29% identity, 74% coverage

Illumina RNA and SMRT Sequencing Reveals the Mechanism of Uptake and Transformation of Selenium Nanoparticles in Soybean Seedlings
Xiong, Plants (Basel, Switzerland) 2023
- “...network (with weight > 0.9) ( Figure 5 c). The results showed that SYM ( LOC100786507 ), APR3 ( LOC100799978 ), and CNIF3 ( LOC100796732 ) coexpressed closely with twelve genes (including the top six genes) in different regulation models. For example, SYM was regulated by...”

BBA_04543 methionyl-tRNA synthetase from Beauveria bassiana ARSEF 2860
29% identity, 80% coverage

Unveiling a Novel Role of Cdc42 in Pyruvate Metabolism Pathway to Mediate Insecticidal Activity of Beauveria bassiana
Guan, Journal of fungi (Basel, Switzerland) 2022
- “...pyruvate biosynthesis through the routes of glycine, serine, and threonine metabolism (BBA_00790 and BBA_04664), glycolysis/gluconeogenesis (BBA_04543 and BBA_08227), and ascorbate and aldarate metabolism (BBA_04538 and BBA_08261). Among those DEGs, five were upregulated while only one was downregulated (BBA_04664), implying that pyruvate biosynthesis could be induced in...”

FN1268 Methionyl-tRNA synthetase from Fusobacterium nucleatum subsp. nucleatum ATCC 25586
26% identity, 96% coverage

Proteomics of Fusobacterium nucleatum within a model developing oral microbial community
Hendrickson, MicrobiologyOpen 2014
- “...FN0054, FN0067, FN0069, FN0070, FN0110, FN0298, FN0299, FN0405, FN0466, FN0506, FN0611, FN0697, FN0753, FN0754, FN0755, FN1268, FN1340, FN1489, FN1517, FN1579, FN1597, FN1658, FN1977, FN2011, FN2122, FN2123. Ribosomal proteins are noted to correlate with growth rates (Nomura etal. 1984 ). However, the cells were not given exogenous...”

Q8DSW8 Methionine--tRNA ligase from Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
25% identity, 100% coverage

S-glutathionylation proteome profiling reveals a crucial role of a thioredoxin-like protein in interspecies competition and cariogenecity of Streptococcus mutans
Li, PLoS pathogens 2020
- “...fbaA 235 Fructose-1,6-biphosphate aldolase Q59931 gapN 360 NADP-dependent glyceraldehyde-3-phosphate dehydrogenase Q8DTX6 pfk 35 ATP-dependent 6-phosphofructokinase Q8DSW8 Aminoacyl-tRNA biosynthesis metS 31 MethioninetRNA ligase Q8DSL1 valS (syv) 501 ValinetRNA ligase Q8DWG1 Pyrimidine metabolism pyrG 438 CTP synthase Q8DTV1 pyrF 155 Orotidine 5'-phosphate decarboxylase Q8DTV0 pyrDB 24 Dihydroorotate dehydrogenase...”
Network analysis of circular permutations in multidomain proteins reveals functional linkages for uncharacterized proteins.
Adjeroh, Cancer informatics 2014
- “...0 0 U * 2 Q7SYD8 xpnpep2 Zgc:63528 1.958 19.849 4 No 0 1 3 Q8DSW8 mets MethioninetRNA ligase 1.915 19.407 1 Yes 48 340 * 4 Q4TMZ8 Deleted (obsolete) 1.906 19.321 1 No 0 0 5 Q3QD47 Deleted (obsolete) 1.839 18.628 1 No 0 0...”

SLINC_4366 methionine--tRNA ligase from Streptomyces lincolnensis
31% identity, 73% coverage

Three new LmbU targets outside lmb cluster inhibit lincomycin biosynthesis in Streptomyces lincolnensis
Mao, Microbial cell factories 2024
- “..., 201 aa RNA polymerase sigma factor 549540 SLINC_1077 WP_067427571.1 , 256 aa methyltransferase 492483 SLINC_4366 WP_067436406.1, 574 aa methioninetRNA ligase 215206 SLINC_6271 WP_067441084.1, 194 aa PaaI family thioesterase 281272 a TRSS translational start site The positive target genes confirmed by EMSA were indicated by bold...”

AFUA_1G09010 methionyl-tRNA synthetase from Aspergillus fumigatus Af293
30% identity, 80% coverage

RNAseq analysis of Aspergillus fumigatus in blood reveals a just wait and see resting stage behavior
Irmer, BMC genomics 2015
- “...(Mkk2), putative mitogen-activated protein kinase kinase (MAPKK); essential for cell wall integrity signaling; calcium induced AFUA_1G09010 methionyl-tRNA synthetase, ortholog(s) have cytosol localization AFUA_1G10310 RNase L inhibitor of the ABC superfamily, ATPase, Rnase L inhibitor, orthologs involved in ribosome protection AFUA_1G10630 S-adenosylmethionine synthetase, putative S-adenosylmethionine synthetase; involved...”

Cj0838c methionyl-tRNA synthetase from Campylobacter jejuni subsp. jejuni NCTC 11168
26% identity, 99% coverage

Application of TraDIS to define the core essential genome of Campylobacter jejuni and Campylobacter coli
Stoakes, BMC microbiology 2023
- “...were identified across five methods in the C. jejuni core essential network these were MetG (Cj0838c) and GuaB (Cj1058c). In C. coli , only one protein was identified, this was Adk (N149_0609). Interestingly, proteins within the purine pathway were identified as potential hub proteins for both...”
Culture of Campylobacter jejuni with sodium deoxycholate induces virulence gene expression
Malik-Kale, Journal of bacteriology 2008
- “...by guest Cj0787 Cj0788 Cj0789 Cj0793 Cj0798c Cj0837c Cj0838c Cj0842 Cj0843c Cj0848c Cj0852c Cj0862c Cj0863c Cj0881c Cj0884 Cj0914c Cj0926 Cj0960c Cj0962 Cj0963...”

B7PAR2 Methionine--tRNA ligase, cytoplasmic (Fragment) from Ixodes scapularis
29% identity, 79% coverage

Integrated Metabolomics, Transcriptomics and Proteomics Identifies Metabolic Pathways Affected by Anaplasma phagocytophilum Infection in Tick Cells
Villar, Molecular & cellular proteomics : MCP 2015
- “...B7PHA0 ISCW016161 B7P4U1 ISCW020699 B7PXW4 ISCW017452 B7PAR2 ISCW001113 B7P346 ISCW010101 B7Q1Y2 ISCW008555 B7Q054 ISCW013122 B7QEL2 ISCW016252 B7P0R8...”

FVEG_02055 methionyl-tRNA synthetase from Fusarium verticillioides 7600
28% identity, 80% coverage

Conservation and divergence of the cyclic adenosine monophosphate-protein kinase A (cAMP-PKA) pathway in two plant-pathogenic fungi: Fusarium graminearum and F. verticillioides
Guo, Molecular plant pathology 2016
- “...of cell cycles. Two orthologues encoding a tRNA ligase (FGSG_07436, FVEG_07820) and tRNA synthetase (FGSG_08614, FVEG_02055) were present in both the Fg and Fv pathways, suggesting that cAMPmediated regulation of protein synthesis is conserved in these two species. Orthologues involved in the stress response, such as...”

SACOL0533 methionyl-tRNA synthetase from Staphylococcus aureus subsp. aureus COL
SAOUHSC_00461 methionyl-tRNA synthetase, putative from Staphylococcus aureus subsp. aureus NCTC 8325
25% identity, 96% coverage

Novel determinants of antibiotic resistance: identification of mutated loci in highly methicillin-resistant subpopulations of methicillin-resistant Staphylococcus aureus
Dordel, mBio 2014
- “...Deletion after Ser27 a C464191T Pro142Leu 6 SACOL0495 Hypothetical protein 2 G497663T Asp777Stop f 7 SACOL0533 Methionyl-tRNA synthetase ( metS ) G542898T Leu285Phe c 8 SACOL0544 Ribose-phosphate pyrophosphokinase ( prsA ) C552272T Pro291Leu a 9 SACOL0554 Hypoxanthine phosphoribosyltransferase ( hpt ) G562925A Met1Ile a 10 SACOL0555...”
- “...in S.aureus COL Gene H*R strain Functional category 5 SACOL0461 guaA A3, BB9 a 7 SACOL0533 metS DD8 c 8 SACOL0544 prsA B5 a 9 SACOL0554 hpt DD3 a 11 SACOL0562 lysS AA9 c 13 SACOL0576 cysS CC3 c 15 SACOL0588 rpoB DD9 b 16 SACOL0589...”
Proteomic and Metabolomic Analyses of a Tea-Tree Oil-Selected Staphylococcus aureus Small Colony Variant
Torres, Antibiotics (Basel, Switzerland) 2019
- “...SAOUHSC_00442 DnaX DNA polymerase III subunits gamma and tau DNA replication, recombination and repair 1.6 SAOUHSC_00461 MetG methionyl-tRNA synthetase protein synthesis 1.3 SAOUHSC_00474 RplY 50S ribosomal protein L25/general stress protein Ctc protein synthesis 1.5 SAOUHSC_00483 133 aa protein uncharacterized 1.5 SAOUHSC_00513 23S rRNA (guanosine(2251)-2-O)-methyltransferase RlmB protein...”

Pc16g02040 uncharacterized protein from Penicillium rubens
28% identity, 80% coverage

Studying the Gene Expression of Penicillium rubens Under the Effect of Eight Essential Oils
Kisová, Antibiotics (Basel, Switzerland) 2020
- “...the cytoplasm of the cell. Among these enzymes, tryptophanyl (Pc12g04630), lysyl (Pc12g09250), asparaginyl (Pc12g15910), methionyl (Pc16g02040), prolyl (Pc16g07440) and histidyl (Pc22g02880) were overexpressed compared to valyl (Pc20g09480), which had decreased expression. In many pathways, like in -lactam antibiotic production, analysis revealed changes on the transcriptional level...”

RSAU_000427 methionine--tRNA ligase from Staphylococcus aureus subsp. aureus 6850
25% identity, 96% coverage

Identification of a Novel LysR-Type Transcriptional Regulator in Staphylococcus aureus That Is Crucial for Secondary Tissue Colonization during Metastatic Bloodstream Infection
Groma, mBio 2020
- “...5.98 6.89E04 yqiG RSAU_002020 6.21 2.02E04 htsB RSAU_000696 6.23 5.21E04 ptsH RSAU_000631 6.32 1.24E04 lipA RSAU_000427 6.50 2.40E04 metG RSAU_002217 6.51 9.28E09 rsp RSAU_002432 6.60 3.09E04 Adenine nucleotide alpha hydrolases superfamily protein RSAU_001217 6.78 9.15E04 rpmG RSAU_002292 7.11 3.22E07 rimM RSAU_000505 7.24 6.55E05 capD a Enrichment...”

FGSG_08614 methionyl-tRNA synthetase from Fusarium graminearum PH-1
28% identity, 80% coverage

Conservation and divergence of the cyclic adenosine monophosphate-protein kinase A (cAMP-PKA) pathway in two plant-pathogenic fungi: Fusarium graminearum and F. verticillioides
Guo, Molecular plant pathology 2016
- “...regulation of cell cycles. Two orthologues encoding a tRNA ligase (FGSG_07436, FVEG_07820) and tRNA synthetase (FGSG_08614, FVEG_02055) were present in both the Fg and Fv pathways, suggesting that cAMPmediated regulation of protein synthesis is conserved in these two species. Orthologues involved in the stress response, such...”

P67578 Methionine--tRNA ligase from Staphylococcus aureus (strain Mu50 / ATCC 700699)
SA0448 methionyl-tRNA synthetase from Staphylococcus aureus subsp. aureus N315
25% identity, 96% coverage

Exploring Proteus mirabilis Methionine tRNA Synthetase Active Site: Homology Model Construction, Molecular Dynamics, Pharmacophore and Docking Validation
Elbaramawi, Pharmaceuticals (Basel, Switzerland) 2023
- “...(Q837B3); Streptococcus pyogenes (Q9A178); Escherichia coli (P00959); Acinetobacter baumannii (A0A0D5YKJ7); Pyrococcus abyssi (Q9V011), Staphylococcus aureus (P67578). Figure 3 Sequence alignment of MetRS enzymes of Aquifex aeolicus , Pyrococcus abyssi, Acinetobacter baumannii, Proteus mirabilus and Escherichia coli using Clustal O in which * means that the residues...”
Essentiality Assessment of Cysteinyl and Lysyl-tRNA Synthetases of Mycobacterium smegmatis
Ravishankar, PloS one 2016
- “...SP2100 PheRS MSMEG_3777,MSMEG_3778 Rv1649,Rv1650 ML1401,ML1402 b1713,b1714 HI1311,HI1312 SA0985,SA0986 SP0579,SP0581 MetRS MSMEG_5441 Rv1007c ML0238 b2114 HI1276 SA0448 SP0788 CysRS MSMEG_4189,MSMEG_6074 Rv3580c,Rv2130c ML0323,ML1302 b0526 HI0078 SA0488 SP0591 AspRS MSMEG_3003 Rv2572c ML0501 b1866 HI0317 SA1456 SP2114 GluRS MSMEG_2383,MSMEG_6306 Rv2992c ML1688 b0144,b2400 HI0274 SA0486 SP2069 AsnRS - - - b0930...”
walK and clpP mutations confer reduced vancomycin susceptibility in Staphylococcus aureus
Shoji, Antimicrobial agents and chemotherapy 2011
- “...0.42 0.39 0.49 0.40 0.47 Aminoacyl-tRNA biosynthesis SA0009 SA0448 SA0475 SA0486 SA0488 SA0564 SA0855 SA0985 SA0986 SA1036 SA1106 SA1287 SA1446 SA1456 SA1457...”
Characterization of the Staphylococcus aureus heat shock, cold shock, stringent, and SOS responses and their effects on log-phase mRNA turnover
Anderson, Journal of bacteriology 2006
- “...N315-SA0413 N315-SA0751 N315-SA1186 N315-SA2496 SA0161 SA0299 SA0436 SA0448 SA0497 SA0537 SA0692 SA1033 SA1372 SA1375 SA1438 SA1524 SA1526 SA1664 SA1777 SA2162...”

UH47_11775 methionine--tRNA ligase from Staphylococcus pseudintermedius
25% identity, 95% coverage

Carprofen-induced depletion of proton motive force reverses TetK-mediated doxycycline resistance in methicillin-resistant Staphylococcus pseudintermedius
Magnowska, Scientific reports 2019
- “...0.6 0.7 translation UH47_04780 alaninetRNA ligase alaS 1.1 translation UH47_04960 valinetRNA ligase valS 1 translation UH47_11775 methioninetRNA ligase 0.6 0.9 translation Other proteins UH47_09860 phosphoribosylformylglycinamidine synthase 1 purine metabolism UH47_13130 tetracycline resistance protein tetK 1.0 1.1 resistance UH47_08515 TetR family transcriptional regulator 1.1 1.2 resistance UH47_00970...”
- “...values. We also found three interactively upregulated tRNA ligase genes ( valS , alaS , UH47_11775). CPF and DOX in combination interactively increased expression of tetK and interestingly also the TetR family transcriptional regulator (UH47_08515), whereas sub-inhibitory concentration of DOX alone did not affect expression of...”

SERP0128 methionyl-tRNA synthetase from Staphylococcus epidermidis RP62A
25% identity, 96% coverage

Concentration-Dependent Global Quantitative Proteome Response of Staphylococcus epidermidis RP62A Biofilms to Subinhibitory Tigecycline
Sung, Cells 2022
- “...L27 5.89 4.72 1.09 SERP1211 rplU fig|176279.9.peg.1180 J 50S ribosomal protein L21 10.30 16.59 19.34 SERP0128 metG fig|176279.9.peg.120 J Methionine--tRNA ligase 0.00 1000.00 1000.00 SERP1242 rplT fig|176279.9.peg.1209 J 50S ribosomal protein L20 1000.00 1000.00 1000.00 SERP1246 thrS fig|176279.9.peg.1213 J Threonine--tRNA ligase 0.00 0.00 1000.00 SERP1252 coaE...”

CNBD2070 hypothetical protein from Cryptococcus neoformans var. neoformans B-3501A
28% identity, 69% coverage

Novel and unique domains in aminoacyl-tRNA synthetases from human fungal pathogens Aspergillus niger, Candida albicans and Cryptococcus neoformans
Datt, BMC genomics 2014
- “...0 51 IleRS CNBN1610 Mito 1032 0 36 LeuRS CNBM1150 Cyto 1114 0 46 MetRS CNBD2070 Cyto 724 0 46 TrpRS CNBJ3070 Mito 641 5.5e-221 55 TyrRS CNBA1270 Cyto 819 3.3e-218 47 TyrRS CNBJ0260 Mito 478 1.2e-169 47 ValRS CNBB3840 Mito 1109 0 47 Class II...”

SYM_MIMIV / Q5UR82 Methionine--tRNA ligase; Methionyl-tRNA synthetase; MetRS; EC 6.1.1.10 from Acanthamoeba polyphaga mimivirus (APMV) (see paper)
28% identity, 73% coverage

catalytic activity: tRNA(Met) + L-methionine + ATP = L-methionyl-tRNA(Met) + AMP + diphosphate (RHEA:13481)

lmo0177 methionyl-tRNA synthetase from Listeria monocytogenes EGD-e
24% identity, 100% coverage

Transcriptional and phenotypic responses of Listeria monocytogenes to chlorine dioxide
Pleitner, Applied and environmental microbiology 2014
- “...lmo0970 lmo1806 lmo1807 lmo2202 lmo2450 Protein synthesis lmo0177 lmo0244 lmo0695 lmo1294 lmo1658 lmo1755 lmo2047 lmo2597 lmo2633 lmo2811 lmo2856 Purines,...”

NCU07451 methionyl-tRNA synthetase from Neurospora crassa OR74A
27% identity, 80% coverage

Circadian clock control of tRNA synthetases in Neurospora crassa
Castillo, F1000Research 2022
- “...Furthermore, ChIP-seq data showed that ADV-1 binds to the promoter of TrpRS (NCU06722) and MetRS (NCU07451), both of which are clock-controlled, and to the promoter of LysRS ( Dekhang et al. , 2017 ), which was not rhythmic in our ribo-seq data ( Figure 1 )....”

OEOE_RS08425 methionine--tRNA ligase from Oenococcus oeni PSU-1
26% identity, 97% coverage

Transcriptomic and Proteomic Analysis of Oenococcus oeni Adaptation to Wine Stress Conditions
Margalef-Català, Frontiers in microbiology 2016
- “...0.8 1.9 104.6 50S ribosomal protein L7/L12 (rplL) OEOE_RS06825 ND 1.99 12.2 4.20 Methionyl-tRNA synthetase OEOE_RS08425 0.7 1.1 77.0 Stress response Glutathione reductase OEOE_RS05740 2 1 48.6 Cold-shock protein OEOE_RS06620 1.28 ND 7.4 4.7 Molecular chaperone GroEL OEOE_RS06725 1.1 1.35 (2) 57.5 5.02 Co-chaperonin GroES (HSP10)...”

Q92PX0 Methionine--tRNA ligase from Rhizobium meliloti (strain 1021)
SMc01192 PROBABLE METHIONYL-TRNA SYNTHETASE (METHIONINE--TRNA LIGASE) PROTEIN from Sinorhizobium meliloti 1021
27% identity, 74% coverage

A consolidated analysis of the physiologic and molecular responses induced under acid stress in the legume-symbiont model-soil bacterium Sinorhizobium meliloti
Draghi, Scientific reports 2016
- “...SMc00641 SerA Q92MA3 25 86 SVNA 0.71 D-3-phosphoglycerate dehydrogenase (EC 1.1.1.95) (PGDH). E SMc01192 MetS Q92PX0 28 109 SVNA 0.26 Methionyl-tRNAsynthetase (EC 6.1.1.10). J SMc04461 TolB Q926C2 42 162 SVNA 0.75 TolB protein precursor. U SMc02686 PrsA Q92N73 24 55 SVNA NA Probable ribose-phosphate pyrophosphokinase. F...”
A consolidated analysis of the physiologic and molecular responses induced under acid stress in the legume-symbiont model-soil bacterium Sinorhizobium meliloti
Draghi, Scientific reports 2016
- “...6.1.1.11). J SMc00641 SerA Q92MA3 25 86 SVNA 0.71 D-3-phosphoglycerate dehydrogenase (EC 1.1.1.95) (PGDH). E SMc01192 MetS Q92PX0 28 109 SVNA 0.26 Methionyl-tRNAsynthetase (EC 6.1.1.10). J SMc04461 TolB Q926C2 42 162 SVNA 0.75 TolB protein precursor. U SMc02686 PrsA Q92N73 24 55 SVNA NA Probable ribose-phosphate...”

Smp_040770 putative methionine-tRNA synthetase from Schistosoma mansoni
25% identity, 82% coverage

Gene expression patterns in larval Schistosoma mansoni associated with infection of the mammalian host
Parker-Manuel, PLoS neglected tropical diseases 2011
- “...Smp_095290 2.48 1.05 1.00 eukaryotic translation initiation factor 3 Smp_191990 2.48 1.00 - methionine-tRNA synthetase Smp_040770 2.42 1.00 - elongation factor 1-gamma Smp_083410 2.40 1.00 1.78 aspartyl-tRNA synthetase Smp_041450 2.33 1.00 1.96 DNA polymerase theta Smp_155500 2.31 1.21 1.00 60S acidic ribosomal protein P0 Smp_009690 2.30...”

P23395 Methionine--tRNA ligase from Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
TTHA1298 methionyl-tRNA synthetase from Thermus thermophilus HB8
26% identity, 99% coverage

Exploring Proteus mirabilis Methionine tRNA Synthetase Active Site: Homology Model Construction, Molecular Dynamics, Pharmacophore and Docking Validation
Elbaramawi, Pharmaceuticals (Basel, Switzerland) 2023
- “...(P56192); mouse (Q68FL6); zebra mbuna (A0A3P9BIE1); African clawed frog (Q6PF21); Mycobacterium tuberculosis (P9WFU5); Thermus thermophilus (P23395); Pseudomonas aeruginosa (Q9HYC7); Enterococcus faecalis (Q837B3); Streptococcus pyogenes (Q9A178); Escherichia coli (P00959); Acinetobacter baumannii (A0A0D5YKJ7); Pyrococcus abyssi (Q9V011), Staphylococcus aureus (P67578). Figure 3 Sequence alignment of MetRS enzymes of Aquifex...”
A Transfer Learning-Based Approach for Lysine Propionylation Prediction
Li, Frontiers in physiology 2021
- “...synthetase (TTHA0875) P56881 Threonyl-tRNA synthetase (thrS) P56206 Glycyl-tRNA synthetase (TTHA0543) P56690 Isoleucyl-tRNA synthetase (ileS) 2.5835 P23395 Methionyl-tRNA synthetase (TTHA1298) P56194 Histidyl-tRNA synthetase (hisS) Q5SLY2 Leucyl-tRNA synthetase (leuS) Q5SJ45 Valyl-tRNA synthetase (valS) Q5SIH0 Tyrosyl-tRNA synthetase (TTHA1399) P80380 30S ribosomal protein S20 (rpsT) 1.8414 Q5SHQ2 30S ribosomal protein...”
Identification and Characterization of a Chemical Compound that Inhibits Methionyl-tRNA Synthetase from Pseudomonas aeruginosa
Robles, Current drug discovery technologies 2017
- “...sequences of E. coli , P. aeruginosa , and T. thermophiles are P00959, NP_252172 and P23395, respectively. Sequence alignments were performed using Vector NTI Advance (TM) 11.0 (Invitrogen). Identical amino acid residues are white on black and similar residues are black on grey. The positions of...”
Space-related pharma-motifs for fast search of protein binding motifs and polypharmacological targets
Chiu, BMC genomics 2012
- “...a.27.1.1, b.51.1.1, c.26.1.1 1.10.730.10, 3.40.50.620, 3.90.740.10 Thermus thermophilus ileS Isoleucyl-tRNA synthetase 1.4 1 31.8 2d5bA P23395 6.1.1.10 ZN a.27.1.1, c.26.1.1 1.10.730.10, 3.40.50.620 Thermus thermophilus metG Methionyl-tRNA synthetase 1.7 1 26.8 2d54A P23395 6.1.1.10 ZN a.27.1.1, c.26.1.1 1.10.730.10, 3.40.50.620 Thermus thermophilus metG Methionyl-tRNA synthetase 1.7 1 26.8...”
- “...ZN a.27.1.1, c.26.1.1 1.10.730.10, 2.170.220.10, 3.40.50.620 Thermus thermophilus metG Methionyl-tRNA synthetase 1.7 1 26.8 1woyA P23395 6.1.1.10 ZN a.27.1.1, c.26.1.1 1.10.730.10, 2.170.220.10, 3.40.50.620 Thermus thermophilus metG Methionyl-tRNA synthetase 1.8 1 26.8 1li5A P21888 6.1.1.16 ZN a.27.1.1, c.26.1.1 3.40.50.620 Escherichia coli cysS Cysteinyl-tRNA synthetase 1.9 0.99 30.5...”
A Transfer Learning-Based Approach for Lysine Propionylation Prediction
Li, Frontiers in physiology 2021
- “...Threonyl-tRNA synthetase (thrS) P56206 Glycyl-tRNA synthetase (TTHA0543) P56690 Isoleucyl-tRNA synthetase (ileS) 2.5835 P23395 Methionyl-tRNA synthetase (TTHA1298) P56194 Histidyl-tRNA synthetase (hisS) Q5SLY2 Leucyl-tRNA synthetase (leuS) Q5SJ45 Valyl-tRNA synthetase (valS) Q5SIH0 Tyrosyl-tRNA synthetase (TTHA1399) P80380 30S ribosomal protein S20 (rpsT) 1.8414 Q5SHQ2 30S ribosomal protein S8 (rpsH) Q5SHP6...”
Lysine propionylation is a prevalent post-translational modification in Thermus thermophilus
Okanishi, Molecular & cellular proteomics : MCP 2014
- “...TTHA0248 TTHA0701 TTHA1664 TTHA1812 TTHA1169 TTHA1294 TTHA1298 TTHA1397 TTHA1399 TTHA1485 TTHA1663 TTHA1667 TTHA1675 TTHA1678 TTHA1680 TTHA1684 TTHA1695...”

CKC_02965 methionine--tRNA ligase from Candidatus Liberibacter solanacearum CLso-ZC1
26% identity, 75% coverage

Assessment of Multilocus Sequence Analysis (MLSA) for Identification of Candidatus Liberibacter Solanacearum from Different Host Plants in Spain
Ruiz-Padilla, Microorganisms 2020
- “...12 ] CKC_043 65 GGAAATCCCCTAACGGAACCATTCG MetG TCGTACGATGATTTTATTCGCACAACGG methionyl-tRNA synthetase ( metG ) [ 12 ] CKC_02965 GGATCGTTAGGAATTTTTATTCCCCAATC MutS CCAACAGATTCTAATTATCTCATGG DNA mismatch repair protein ( mutS ) [ 12 ] CKC_008 15 TCTAAATTGGAACGAGCGGCGGA PurA TGTAGTTGTGGTCGGCTTACAATGG adenylosuccinate synthetase ( purA ) [ 12 ] CKC_003 15 TATCTTCATAAGCTGGGCCAATACC RecA...”

RHECIAT_CH0002242 methionyl-tRNA synthetase protein from Rhizobium etli CIAT 652
27% identity, 73% coverage

Genomic studies of nitrogen-fixing rhizobial strains from Phaseolus vulgaris seeds and nodules
Peralta, BMC genomics 2016
- “...65 RHECIAT_CH0000980 GlyS Glycyl-tRNA synthetase subunit beta J 192 38 23/37 71.6 - - 66 RHECIAT_CH0002242 MetS Methionyl-tRNA synthetase J 105 26 10/22 72.1 - - 57 RHECIAT_CH0001733 - Nucleoside-diphosphate-sugar epimerase M 57 19 5/22 26.4 - - 74 RHECIAT_CH0003488 NoeJ Mannose-1-phosphate guanylyltransferase (GDP) protein M...”

Q0S4U4 Methionine--tRNA ligase from Rhodococcus jostii (strain RHA1)
28% identity, 74% coverage

Differential protein profiling of soil diazotroph Rhodococcus qingshengii S10107 towards low-temperature and nitrogen deficiency
Suyal, Scientific reports 2019
- “...O-acyltransferase, A8I491); GltX2 (Glutamate- tRNA ligase, A0A1F2PR92); Rnc (Ribonuclease 3, Q0S2E1); MetS1 (Methionine tRNA ligase, Q0S4U4) , and RplT (50S ribosomal protein L20, Q0SI47) were only hubs; while , FusA (Elongation factor G, Q0SFF3); CobB (Hydrogenobyrinate a,c-diamide synthase, Q98KP1); MurE1 (UDP-N-acetylmuramoyl-L-alanyl-D-glutamate2,6-diaminopimelate ligase, Q89FU2); HbdA (3-hydroxybutyryl-CoA dehydrogenase,...”

CPE2524 probable methionine-tRNA ligase from Clostridium perfringens str. 13
23% identity, 78% coverage

Use of an EZ-Tn5-based random mutagenesis system to identify a novel toxin regulatory locus in Clostridium perfringens strain 13
Vidal, PloS one 2009
- “...CPE1892, 50S ribosomal protein L20 S13Tn5-09 CPE1736, ribulose phosphate 3-epimerase S13Tn5-10 CPE0027, hypothetical protein S13Tn5-11 CPE2524, methionyl-tRNA synthetase S13Tn5-12 CPE0643, hypothetical protein S13Tn5-13 CPE2348, phosphate butyryltransferase Disruption of the C. perfringens agr B gene using EZ-Tn 5 transposon mutagenesis To demonstrate the usefulness of the new...”

A0R3E2 methionine-tRNA ligase (EC 6.1.1.10) from Mycolicibacterium smegmatis (see paper)
MSMEG_5441 methionyl-tRNA synthetase from Mycobacterium smegmatis str. MC2 155
28% identity, 74% coverage

Essentiality Assessment of Cysteinyl and Lysyl-tRNA Synthetases of Mycobacterium smegmatis
Ravishankar, PloS one 2016
- “...Rv1689 ML1352 b1637 HI1610 SA1550 SP2100 PheRS MSMEG_3777,MSMEG_3778 Rv1649,Rv1650 ML1401,ML1402 b1713,b1714 HI1311,HI1312 SA0985,SA0986 SP0579,SP0581 MetRS MSMEG_5441 Rv1007c ML0238 b2114 HI1276 SA0448 SP0788 CysRS MSMEG_4189,MSMEG_6074 Rv3580c,Rv2130c ML0323,ML1302 b0526 HI0078 SA0488 SP0591 AspRS MSMEG_3003 Rv2572c ML0501 b1866 HI0317 SA1456 SP2114 GluRS MSMEG_2383,MSMEG_6306 Rv2992c ML1688 b0144,b2400 HI0274 SA0486 SP2069...”
Crystallization of Mycobacterium smegmatis methionyl-tRNA synthetase in the presence of methionine and adenosine
Ingvarsson, Acta crystallographica. Section F, Structural biology and crystallization communications 2009
- “...and methods 2.1. Cloning and expression The gene metG (MSMEG_5441 locus) from Ms MC2 155 coding for MetRS was isolated by PCR. The primers 50...”

slr0649 methionyl-tRNA synthetase from Synechocystis sp. PCC 6803
27% identity, 78% coverage

Regulatory Diversity and Functional Analysis of Two-Component Systems in Cyanobacterium Synechocystis sp. PCC 6803 by GC-MS Based Metabolomics
Shi, Frontiers in microbiology 2020
- “...the expression of genes involved photosystem I and II (Li and Sherman, 2000 ), Slr0115, Slr0649, Sll1708, and Slr1783 involved in salt and hyperosmotic stress (Shoumskaya et al., 2005 ), RpaA involved in adaption to changes in light conditions (Iijima et al., 2015 ), RpaB repressing...”
Adaptive laboratory evolution of cadmium tolerance in Synechocystis sp. PCC 6803
Xu, Biotechnology for biofuels 2018
- “...the better tolerant or survival [ 37 ]. For Cd 2+ tolerance, some genes including slr0649 , slr0946 , slr1738, and sll1598 were also demonstrated to be related to Cd 2+ tolerance in the previous studies [ 8 ]. However, these genes were not found to...”
An orphan response regulator Sll0649 involved in cadmium tolerance and metal homeostasis in photosynthetic Synechocystis sp. PCC 6803
Chen, Journal of proteomics 2014 (PubMed)
- “...change to Cd2+ stress, we identified the orphan RR, Slr0649, involved in Cd2+ tolerance in Synechocystis. The sll0649 mutant was also found to be more sensitive...”
- “...change to Cd 2 + stress, we identified the orphan RR, Slr0649, involved in Cd 2 + tolerance in Synechocystis . The sll0649 mutant was also found to be more...”
A transcriptional regulator Sll0794 regulates tolerance to biofuel ethanol in photosynthetic Synechocystis sp. PCC 6803
Song, Molecular & cellular proteomics : MCP 2014
- “...Sll1871 Sll1980 Slr0064 Slr0080 Slr0115 Slr0288 Slr0646 Slr0649 Slr0783 Slr0809 Slr0889 Slr0984 Slr1490 Slr1718 Slr1829 Ssl2296 Ssr2061 Mutant_r1 vs. Control_r1...”
Eukaryotic-like Ser/Thr protein kinases SpkC/F/K are involved in phosphorylation of GroES in the Cyanobacterium synechocystis
Zorina, DNA research : an international journal for rapid publication of reports on genes and genomes 2011
- “...MW (kDa) Dt/Calc p I Dt/Calc No. of peptides Coverage, % 1 MetS, methionyl-tRNA synthetase slr0649 58.7/61.442 5.0/5.0 10 26 2 RbcL, large subunit of RuBisCO slr0009 58.7/52.490 5.2/5.73 11 23 3a 6-phosphogluconate dehydrogenase sll0329 47.3/52.873 5.0/4.93 18 55 3b TufA, elongation factor Tu sll1099 47.3/43.733...”

Q9F2I9 Methionine--tRNA ligase from Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
SCO3792 methionyl tRNA synthetase from Streptomyces coelicolor A3(2)
27% identity, 72% coverage

Cochlin in the eye: functional implications
Picciani, Progress in retinal and eye research 2007
- “...+ + P0A679 2 Histidinol-phosphate aminotransferaseE + + Q9F2I9 2 Methionyl-tRNA synthetaseF + + O07853 2 Signal recognition 54 kDa proteinG + + Q97CQ3...”
Changes in the extracellular proteome caused by the absence of the bldA gene product, a developmentally significant tRNA, reveal a new target for the pleiotropic regulator AdpA in Streptomyces coelicolor
Kim, Journal of bacteriology 2005
- “...partial cell lysis, others are not. The tRNA synthetases SCO3792 and SCO3961 appear as fairly faint spots on analysis of total cellular protein extracts, as do...”

2x1lA / A0R3E2 Crystal structure of mycobacterium smegmatis methionyl-tRNA synthetase in complex with methionine and adenosine (see paper)
27% identity, 74% coverage

Ligands: methionine; adenosine; dihydrogenphosphate ion (2x1lA)

PMT0743 putative methionyl-tRNA synthetase from Prochlorococcus marinus str. MIT 9313
25% identity, 78% coverage

A suppression subtractive hybridization approach reveals niche-specific genes that may be involved in predator avoidance in marine Synechococcus isolates
Jones, Applied and environmental microbiology 2006
- “...organism SYNW0122 PMT1757 PMT0727 SYNW0550 SYNW2128 SYNW1259 PMT1158 PMT0743 S. elongatus PCC7942 SYNW1286 PMT1514 PMT0258 Pro0928 a For B002, B009, B011, B014,...”

ML0238 putative methionyl-tRNA synthase from Mycobacterium leprae TN
25% identity, 73% coverage

Essentiality Assessment of Cysteinyl and Lysyl-tRNA Synthetases of Mycobacterium smegmatis
Ravishankar, PloS one 2016
- “...b1637 HI1610 SA1550 SP2100 PheRS MSMEG_3777,MSMEG_3778 Rv1649,Rv1650 ML1401,ML1402 b1713,b1714 HI1311,HI1312 SA0985,SA0986 SP0579,SP0581 MetRS MSMEG_5441 Rv1007c ML0238 b2114 HI1276 SA0448 SP0788 CysRS MSMEG_4189,MSMEG_6074 Rv3580c,Rv2130c ML0323,ML1302 b0526 HI0078 SA0488 SP0591 AspRS MSMEG_3003 Rv2572c ML0501 b1866 HI0317 SA1456 SP2114 GluRS MSMEG_2383,MSMEG_6306 Rv2992c ML1688 b0144,b2400 HI0274 SA0486 SP2069 AsnRS -...”

HP0417 methionyl-tRNA synthetase (metS) from Helicobacter pylori 26695
P56127 Methionine--tRNA ligase from Helicobacter pylori (strain ATCC 700392 / 26695)
25% identity, 98% coverage

Identification of genes with fast-evolving regions in microbial genomes
Zheng, Nucleic acids research 2004
- “...HP0669 HP0392 HP0583 HP0747 HP1363 HP1521 HP0203 HP0417 HP0717 HP0805 2313919 2313566 2314275 2314258 2314648 2313477 2314608 2313149 2314061 2313145 2313421...”
Global analysis of Helicobacter pylori gene expression in human gastric mucosa
Graham, Gastroenterology 2002
- “...( serA ) HP1257 Phosphoribosyltransferase ( pyrE ) HP0417 Methionyl-tRNA synthetase ( metS ) HP1329 Cation efflux system protein ( czcA ) HP0440 DNA...”
Outer Membrane Vesicles Secreted by Helicobacter pylori Transmitting Gastric Pathogenic Virulence Factors
Wei, ACS omega 2022
- “...P56028 rpsU 412 O25430 HP_0730 413 O25696 HP_1056 414 O25122 lepA 415 O25390 WbpB 416 P56127 metG 417 O25348 HydA 418 P56142 trpB 419 O25902 Gap 420 P56122 aroC 421 O25849 cobB 422 O24956 FixO 423 O25308 HP_0586 424 O25484 ribB 425 O25594 YckK 426 O25817...”
- “...P56109 fba 194 P56460 metK 195 O25134 HP_0370 196 O25213 HP_0466 197 Q48248 cdh 198 P56127 metG 199 P64655 HP_0135 200 P56052 rpmC 201 O26091 rlpA 202 P56031 rplC 203 Q09066 ureG 204 O25018 HP_0232 205 O25902 Gap 206 P56457 leuS 207 O24929 TlpB 208 O25009...”

H375_8490 methionine--tRNA ligase from Rickettsia prowazekii str. Breinl
26% identity, 72% coverage

Identification and Characterization of Novel Small RNAs in Rickettsia prowazekii
Schroeder, Frontiers in microbiology 2016
- “...protein related to CcmF H375_8880 LSU ribosomal protein L6p (L9e) Rp_ sR67 30 37 7 H375_8490 MethioninetRNA ligase H375_6610 AlaninetRNA ligase H375_4810 Hypothetical protein H375 H375_2550 Reductase H375_1110 tRNA pseudouridine synthase B H375 H375_3730 Uncharacterized protein RP244 of Rickettsia H375_6090 ATP synthase subunit c H375 Listed...”

SYMM_ARATH / Q9M2T9 Methionine--tRNA ligase, chloroplastic/mitochondrial; Methionyl-tRNA synthetase; AtcpMetRS; MetRS; Protein OVULE ABORTION 1; EC 6.1.1.10 from Arabidopsis thaliana (Mouse-ear cress) (see 3 papers)
Q9M2T9 methionine-tRNA ligase (EC 6.1.1.10) from Arabidopsis thaliana (see paper)
AT3G55400 OVA1 (OVULE ABORTION 1); ATP binding / aminoacyl-tRNA ligase/ methionine-tRNA ligase/ nucleotide binding from Arabidopsis thaliana
24% identity, 79% coverage

catalytic activity: tRNA(Met) + L-methionine + ATP = L-methionyl-tRNA(Met) + AMP + diphosphate (RHEA:13481)
disruption phenotype: Lethal. In heterozygous plants, aborted ovules.
Genomic view of heavy-ion-induced deletions associated with distribution of essential genes in Arabidopsis thaliana
Ishii, Frontiers in plant science 2024
- “...25 genes (AT1G24340, AT1G30610, AT1G62340, AT2G03870, AT2G15820, AT2G18510, AT2G24840, AT2G28880, AT2G32590, AT2G33160, AT3G05770, AT3G23110, AT3G24560, AT3G55400, AT4G04790, AT4G13750, AT4G16144, AT4G19490, AT4G21100, AT4G27010, AT4G28590, AT5G08080, AT5G24670, AT5G37630, and AT5G39750) included in the essential genes. We defined the consequent 1,740 genes as mutable genes. 2.8 Correlation analysis The...”
Plant-Specific Domains and Fragmented Sequences Imply Non-Canonical Functions in Plant Aminoacyl-tRNA Synthetases
Saga, Genes 2020
- “...mt, cp At1g09620 cytosol, mt At1g29880 cytosol, mt MetRS At4g13780 cytosol At3g44740 N, C truncated At3g55400 mt, cp At1g29870 C truncated At5g02680 N, C truncated HisRS At3g02760 cytosol TrpRS At3g04600 cytosol At3g46100 mt, cp At2g25840 mt, cp At5g03406 C truncated TyrRS At3g02660 mt, cp LysRS At3g11710...”
Investigation of Splicing Quantitative Trait Loci in Arabidopsis thaliana
Yoo, Genomics & informatics 2016
- “...in chr3:20,536,243, which shows the association between its genotype and an expression ratio of the AT3G55400 ninth exon. The sQTLs and trait-associated SNPs Here, we interpreted the molecular mechanism of previously published trait-associated SNPs into sQTLs. The published trait-associated SNPs were downloaded from the 107 phenotypes...”
- “...in Fig. 2 . The SNP, which resides in chr3:20,536,243, affects the ninth exon of AT3G55400, OVA1 . That is, the expression ratio of the exon with the alternative 3 splice site is higher in the heterozygote (AG) than in the homozygote (GG). OVA1 encodes a...”
Widespread dual targeting of proteins in land plants: when, where, how and why
Carrie, Plant signaling & behavior 2013
- “...At3g25660 Arabidopsis thaliana Arabidopsis thaliana At3g55400 At3g23830 Arabidopsis thaliana Arabidopsis thaliana At3g20540 Arabidopsis thaliana Arabidopsis...”
Dual targeting is the rule for organellar aminoacyl-tRNA synthetases in Arabidopsis thaliana
Duchêne, Proceedings of the National Academy of Sciences of the United States of America 2005
- “...At3g11710 At3g13490 At4g04350 At1g09620 At4g13780 At3g55400 At2g40660 At5g56680 At4g17300 At1g70980 At3g07420 At1g68420 At5g38750 At5g52520 At3g62120 At1g25350...”
- “...Mit Chloro Ref. and remarks At2g31170 At3g55400 At4g17300 At3g46100 At5g64050 At3g13490 At5g52520 At3g02660 At1g11870 At4g33760 At1g50200 At5g22800 At3g58140...”

YP_003432408 methionyl-tRNA synthetase from Hydrogenobacter thermophilus TK-6
25% identity, 74% coverage

Phylogenetic position of aquificales based on the whole genome sequences of six aquificales species
Oshima, International journal of evolutionary biology 2012
- “...YP_003432232 DNA polymerase III beta subunit YP_003432262 UDP-N-acetylglucosamine-N-acetylmuramyl- (pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase YP_003432385 methionine aminopeptidase YP_003432408 methionyl-tRNA synthetase YP_003432463 fatty acid/phospholipid synthesis protein YP_003433015 carboxyl-terminal protease YP_003433058 rRNA methylase YP_003433377 3-phosphoshikimate 1-carboxyvinyltransferase YP_003433542 arginyl-tRNA synthetase YP_003431843 F0F1-type ATP synthase gamma subunit YP_003431889 signal recognition particle GTPase...”

jhp0967 METHIONYL-TRNA SYNTHETASE from Helicobacter pylori J99
26% identity, 98% coverage

Identification of genes with fast-evolving regions in microbial genomes
Zheng, Nucleic acids research 2004
- “...jhp0613 jhp0989 jhp0530 jhp0684 jhp1281 jhp1410 jhp0189 jhp0967 jhp0655 jhp0741 4155286 4154940 4155633 4155618 4155976 4155594 4155937 4154566 4155426 4154552...”

AMF_762 methionyl-tRNA synthetase (metS) from Anaplasma marginale str. Florida
25% identity, 73% coverage

Comparative genomics and transcriptomics of trait-gene association
Pierlé, BMC genomics 2012
- “...AMF_703 AM919 Hypothetical protein 1 1 Gene AP, ER, ECh, ECa, RB, RC, RR TM AMF_762 AM1001 methionyl-tRNA synthetase 23 1 Gene AP, ER, ECh, ECa, RB, RC, RR TM/DS AMF_764 AM1005 aspartokinase 13 1 Gene AP, ER, ECh, ECa TM/DS AMF_824 AM1091 D-Ala-D-Ala carboxypeptidase 33...”
- “...the candidate genes are annotated as hypothetical proteins (Table 4 ). Genes AMF_474, AMF_553, AMF_480, AMF_762, AMF_764, AMF_824, AMF_893 and AMF_878 are orthologs of genes with known functions. Genes downstream from promoter SNPs included one translation inhibitor (AMF_474) and one gene involved in energy consuming processes,...”

A1G_05810 methionyl-tRNA synthetase from Rickettsia rickettsii str. 'Sheila Smith'
24% identity, 72% coverage

Transcriptional Analysis of the Conjugal Transfer Genes of Rickettsia bellii RML 369-C
Heu, PloS one 2015
- “..., gltA , and 16S rRNA. The order from left to right is of metG (A1G_05810), nrdF (A1G_03685), gyrA (A1G_01555), gltA (A1G_07170), and 16s rRNA gene (A1G_r07597). Each vertical black bar represents the hybridization level of mRNA from one probe on the array. The orientation and...”

7wpiA / Q5HII6 Methionyl-tRNA synthetase from staphylococcus aureus complexed with a phenylbenzimidazole inhibitor (see paper)
24% identity, 72% coverage

Ligand: 2-(4-bromanyl-3-oxidanyl-phenyl)-1-[(1r)-2-[2-(2-tert-butylphenoxy)ethanoylamino]-1-(3,4-dimethoxyphenyl)ethyl]-n-methyl-benzimidazole-5-carboxamide (7wpiA)

MC1_RS05365 methionine--tRNA ligase from Rickettsia parkeri str. Portsmouth
24% identity, 72% coverage

Cell-selective proteomics reveal novel effectors secreted by an obligate intracellular bacterial pathogen
Sanderlin, Nature communications 2024
- “...this gene in R. parkeri , a 368bp fragment upstream of the R. parkeri metG (MC1_RS05365) start codon and a 99bp fragment downstream of the R. parkeri metG stop codon were also added. pRL0368374 were made by cloning the R. parkeri ompA promoter, an N-terminal MSGRPRTTSFAES...”

Mb1034c PROBABLE METHIONYL-TRNA SYNTHETASE METS (MetRS) (Methionine--tRNA ligase) from Mycobacterium bovis AF2122/97
25% identity, 74% coverage

Identification of B cell antigenome in Mycobacterium bovis by immunoproteomic analysis
Cho, Acta veterinaria Hungarica 2020 (PubMed)
- “...antigens, including 13 new proteins, i.e. Mb3751, Mb2006c, Mb3276c, Mb2244, Mb1164c, Mb2553c, Mb2946c, Mb1849c, Mb1511c, Mb1034c, Mb2616c, Mb0854c and Mb2267. These new proteins identified by 2-DE and immunoblotting were the B cell antigens used in developing serological diagnostic methods based on HI to bTB....”

MYPE9380 methionyl-tRNA synthetase from Mycoplasma penetrans HF-2
23% identity, 49% coverage

A Novel Aminoacyl-tRNA Synthetase Appended Domain Can Supply the Core Synthetase with Its Amino Acid Substrate
Muraski, Genes 2020
- “...necessary for survival in its environmental niche of the human urogenital and respiratory tracts. The MYPE9380 open reading frame (ORF) was annotated as metS , encoding the M. penetrans MetRS homolog (MpMetRS) [ 10 ]. However, metS contains a large insertion upstream of the canonical MetRS-encoding...”

P59078 Methionine--tRNA ligase from Brucella suis biovar 1 (strain 1330)
27% identity, 74% coverage

Identifying potential natural inhibitors of Brucella melitensis Methionyl-tRNA synthetase through an in-silico approach
Rowaiye, PLoS neglected tropical diseases 2022
- “...of this research. The FASTA format of the amino acid sequences of the target protein (P59078) was obtained from the UniProtKB database [ 52 ]. Sequences were placed on the BLAST tool of the NCBI server and the settings were, PDB protein for database, Homo sapiens...”

SYNW1222 putative methionyl-tRNA synthetase from Synechococcus sp. WH 8102
25% identity, 69% coverage

Computational inference and experimental validation of the nitrogen assimilation regulatory network in cyanobacterium Synechococcus sp. WH 8102
Su, Nucleic acids research 2006
- “...CCTTGCCCACCTCTGTACACTT TCGGGT AGC 56 12.168 18 synw1427 - GTGgccttggcTAC AACACAAGTGTTGATTTCAAAC AAGGAT TAG 56 12.160 19 synw1222 synw1221 metG - GTCccaggtcaTAC GGGCAACAAAACAGAAAAG TGCGGT CGTTAG 72 12.098 20 synw2492 - GTAtcaaccacTAC TTTCATGGGGTCCGGCAC TCCTGA ACACTTC 53 11.997 21 synw2524 synw2525 synw2526 - - thrC GTGgtgatgccGAC CGTAGCGACGGCTCGCGTCGTT TAGAAG GGG 32...”

Q2YQ76 methionine-tRNA ligase (EC 6.1.1.10) from Brucella melitensis (see paper)
BAB1_1014 Aminoacyl-tRNA synthetase, class I:Aminoacyl-tRNA synthetase, class Ia:Methionyl-tRNA synthetase, class Ia from Brucella melitensis biovar Abortus 2308
26% identity, 74% coverage

BrabA.11339.a: anomalous diffraction and ligand binding guide towards the elucidation of the function of a 'putative β-lactamase-like protein' from Brucella melitensis
Abendroth, Acta crystallographica. Section F, Structural biology and crystallization communications 2011
- “...processing. Its genetic neighbors are BAB1_1012, DNA polymerase II subunit ; BAB1_1013, a hypothetical protein; BAB1_1014, metG, a methionyl-tRNA synthetase; BAB_1015, a TatD-related deoxyribonuclease; BAB1_1016, BrabA.11339.a; BAB1-1017, a cyclic -1,2-glucan ABC transporter; BAB1_1018, a hypothetical protein; and BAB1_1019, an RNA-binding S4:pseudouridine synthase. The structure of BrabA.11339.a...”
Proteomics-based confirmation of protein expression and correction of annotation errors in the Brucella abortus genome
Lamontagne, BMC genomics 2010
- “...PAS domain BAB2_0198 Pseudouridine BAB1_0216 ThiG BAB1_0960 Trs heavy metal BAB1_1671 TcaR synthase BAB1_0242 ManR BAB1_1014 MetG BAB1_1687 Dut BAB2_0216 3-hydroxybutyryl-CoA BAB1_0285 HisD BAB1_1030 Gor BAB1_1695 PurA dehydrogenase BAB1_0317 Trs arginine/ornithine BAB1_1037 Mandelate racemase; BAB1_1702 Phosphoglucosamine BAB2_0246 P47K BAB1_0331 ArgD muconate lactonizing mutase BAB2_0293 Gal BAB1_0344...”

6ax8A / P9WFU5 Mycobacterium tuberculosis methionyl-tRNA synthetase in complex with methionyl-adenylate (see paper)
25% identity, 74% coverage

Ligand: [[(2r,3s,4r,5r)-5-(6-aminopurin-9-yl)-3,4-dihydroxy-oxolan-2-yl]methoxy-hydroxy-phosphoryl](2s)-2-azanyl-4-methylsulfanyl-butanoate (6ax8A)

SYM_MYCTU / P9WFU5 Methionine--tRNA ligase; Methionyl-tRNA synthetase; MetRS; EC 6.1.1.10 from Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv) (see paper)
Rv1007c methionine--tRNA ligase from Mycobacterium tuberculosis H37Rv
25% identity, 74% coverage

function: Is required not only for elongation of protein synthesis but also for the initiation of all mRNA translation through initiator tRNA(fMet) aminoacylation.
catalytic activity: tRNA(Met) + L-methionine + ATP = L-methionyl-tRNA(Met) + AMP + diphosphate (RHEA:13481)
subunit: Monomer.
A genome-wide structure-based survey of nucleotide binding proteins in M. tuberculosis
Bhagavat, Scientific reports 2017
- “...Probable acyl-CoA dehydrogenase FadE8 ATP GTP Rv0859 Possible acyl-CoA thiolase FadA AMP ADP ATP GTP Rv1007c Methionyl-tRNA synthetase MetS (MetRS) (methionine-tRNA ligase) AMP ATP GTP Rv1017c Probable ribose-phosphate pyrophosphokinase PrsA (phosphoribosyl pyrophosphate synthetase) (PRPP synthetase) AMP ADP ATP GTP Rv1023 Probable enolase Eno ATP Rv1133c Probable...”
Essentiality Assessment of Cysteinyl and Lysyl-tRNA Synthetases of Mycobacterium smegmatis
Ravishankar, PloS one 2016
- “...ML1352 b1637 HI1610 SA1550 SP2100 PheRS MSMEG_3777,MSMEG_3778 Rv1649,Rv1650 ML1401,ML1402 b1713,b1714 HI1311,HI1312 SA0985,SA0986 SP0579,SP0581 MetRS MSMEG_5441 Rv1007c ML0238 b2114 HI1276 SA0448 SP0788 CysRS MSMEG_4189,MSMEG_6074 Rv3580c,Rv2130c ML0323,ML1302 b0526 HI0078 SA0488 SP0591 AspRS MSMEG_3003 Rv2572c ML0501 b1866 HI0317 SA1456 SP2114 GluRS MSMEG_2383,MSMEG_6306 Rv2992c ML1688 b0144,b2400 HI0274 SA0486 SP2069 AsnRS...”
Cyclic AMP-dependent protein lysine acylation in mycobacteria regulates fatty acid and propionate metabolism
Nambi, The Journal of biological chemistry 2013
- “...Rv3089 (FadD13), and Rv0166 (FadD5) are acyl CoA synthetases, Rv1007c is predicted to be a methionyl tRNA synthetase, Rv1633 is an enzyme involved in nucleotide...”
- “...were acetylated in a cAMP-dependent manner, Rv1633 and Rv1007c were not acetylated by KATmt. Therefore, we were able to identify KATmt substrates through...”
Adenylating enzymes in Mycobacterium tuberculosis as drug targets
Duckworth, Current topics in medicinal chemistry 2012
- “...trpS, tyrS, valS Rv2555c, Rv1658, Rv1292, Rv2572c, Rv3580c, Rv2992, Rv2357c, Rv2580c, Rv1536, Rv0041, Rv3598c, Rv1640c, Rv1007c, Rv1649, Rv1650, Rv2845c, Rv3834c, Rv2614c, Rv3336c, Rv1689, Rv2448c Aminoacyl tRNA synthetase (Protein biosynthesis) yes (E) 2 acs Rv3667 Acetyl coenzyme synthetase (glycolysis) no 3 menE Rv0542c O -Succinylbenzoic acid CoA...”
Identification of attractive drug targets in neglected-disease pathogens using an in silico approach
Crowther, PLoS neglected tropical diseases 2010
- “...3-oxoacyl-[acyl-carrier protein] reductase fabg1 (3-ketoacyl-acyl carrier protein reductase) (mycolic acid biosynthesis a protei 386 20 Rv1007c probable methionyl-trna synthetase mets (metrs) (methioninetrna ligase) 386 20 Rv0014c transmembrane serine/threonine-protein kinase b pknb (protein kinase b) (stpk b) 386 23 Rv2428 alkyl hydroperoxide reductase c protein ahpc (alkyl...”

O67298 Methionine--tRNA ligase from Aquifex aeolicus (strain VF5)
24% identity, 73% coverage

Exploring Proteus mirabilis Methionine tRNA Synthetase Active Site: Homology Model Construction, Molecular Dynamics, Pharmacophore and Docking Validation
Elbaramawi, Pharmaceuticals (Basel, Switzerland) 2023
- “...possible template sequences: E. coli (P00959), A. baumannii (A0A0D5YKJ7), P. abyssi (Q9V011), and A. aeolicus (O67298) MetRSs with the amino acid sequence of P. mirabilis MetRS ( Figure 3 ). The input set of query and template sequences have an evolutionary relationship as they are Gram-negative...”
Space-related pharma-motifs for fast search of protein binding motifs and polypharmacological targets
Chiu, BMC genomics 2012
- “...6.1.1.4 - - 1.10.730.10, 3.40.50.620, 3.90.740.10 Pyrococcus horikoshii leuS Leucyl-tRNA synthetase 2 0.99 21.7 2ct8A O67298 6.1.1.10 MSP - 3.40.50.620 Aquifex aeolicus metG Methionyl-tRNA synthetase 2 0.99 25.2 2ct8B O67298 6.1.1.10 MSP - 3.40.50.620 Aquifex aeolicus metG Methionyl-tRNA synthetase 2 0.99 25.2 2csxA O67298 6.1.1.10 -...”

NP_001303507 Methionyl-tRNA synthetase, mitochondrial, isoform C from Drosophila melanogaster
26% identity, 72% coverage

Mutations in the mitochondrial methionyl-tRNA synthetase cause a neurodegenerative phenotype in flies and a recessive ataxia (ARSAL) in humans.
Bayat, PLoS biology 2012
- GeneRIF: Loss of Aats-met in the eye results in retinal degeneration.

2x1lC / A0R3E2 Crystal structure of mycobacterium smegmatis methionyl-tRNA synthetase in complex with methionine and adenosine (see paper)
27% identity, 74% coverage

Ligands: methionine; adenosine; dihydrogenphosphate ion (2x1lC)

SYMM_HUMAN / Q96GW9 Methionine--tRNA ligase, mitochondrial; Methionyl-tRNA synthetase 2; Mitochondrial methionyl-tRNA synthetase; MtMetRS; EC 6.1.1.10 from Homo sapiens (Human) (see 3 papers)
NP_612404 methionine--tRNA ligase, mitochondrial precursor from Homo sapiens
25% identity, 74% coverage

catalytic activity: tRNA(Met) + L-methionine + ATP = L-methionyl-tRNA(Met) + AMP + diphosphate (RHEA:13481)
Increased Mars2 expression upon microRNA-4661-5p-mediated KDM5D downregulation is correlated with malignant degree of gastric cancer cells.
Gu, Cell biology international 2021 (PubMed)
- GeneRIF: Increased Mars2 expression upon microRNA-4661-5p-mediated KDM5D downregulation is correlated with malignant degree of gastric cancer cells.
Novel, compound heterozygous, single-nucleotide variants in MARS2 associated with developmental delay, poor growth, and sensorineural hearing loss.
Webb, Human mutation 2015
- GeneRIF: Novel, compound heterozygous, single-nucleotide variants in MARS2 associated with developmental delay, poor growth, and sensorineural hearing loss
Mutations in the mitochondrial methionyl-tRNA synthetase cause a neurodegenerative phenotype in flies and a recessive ataxia (ARSAL) in humans.
Bayat, PLoS biology 2012
- GeneRIF: MARS2 is mutated in Autosomal Recessive Spastic Ataxia with Leukoencephalopathy patients.
Genetic variants in nuclear-encoded mitochondrial genes influence AIDS progression.
Hendrickson, PloS one 2010
- GeneRIF: Observational study of gene-disease association. (HuGE Navigator)
Characterization of the human mitochondrial methionyl-tRNA synthetase.
Spencer, Biochemistry 2004 (PubMed)
- GeneRIF: Sequence analysis of mitochondrial MetRS indicates that this protein contains consensus motifs characteristic of class I aminoacyl-tRNA synthetase but lacks Zn2+ binding motif and C-terminal dimerization region found in MetRSs from various organisms.
Understanding the molecular mechanisms of human diseases: the benefits of fission yeasts.
Acs-Szabo, Microbial cell (Graz, Austria) 2024
Human amygdala involvement in Alzheimer's disease revealed by stereological and dia-PASEF analysis.
Gonzalez-Rodriguez, Brain pathology (Zurich, Switzerland) 2023
- “...CARNS1 Carnosine synthase 1 0.44 0.0063 Q9UDY2 ZO2_HUMAN TJP2 Tight junction protein ZO2 0.43 0.0382 Q96GW9 SYMM_HUMAN MARS2 MethioninetRNA ligase, mitochondrial 0.42 0.0091 P20916 MAG_HUMAN MAG Myelinassociated glycoprotein 0.42 0.0025 Q96FJ2 DYL2_HUMAN DYNLL2 Dynein light chain 2, cytoplasmic 0.41 0.0078 O94967 WDR47_HUMAN WDR47 WD repeatcontaining protein...”
Proteomic Characterization of Synaptosomes from Human Substantia Nigra Indicates Altered Mitochondrial Translation in Parkinson's Disease.
Plum, Cells 2020
- “...PDHX PDX1 Mitochondrion matrix. P31930 Cytochrome b-c1 complex subunit 1, mitochondrial UQCRC1 Mitochondrion inner membrane Q96GW9 Methionine--tRNA ligase, mitochondrial MARS2 Mitochondrion matrix O14744 Protein arginine N-methyltransferase 5 PRMT5 HRMT1L5 IBP72 JBP1 SKB1 Cytoplasm * bold: overrepresented in PD....”
Optimization of Methionyl tRNA-Synthetase Inhibitors for Treatment of Cryptosporidium Infection
Buckner, Antimicrobial agents and chemotherapy 2019
- “...Q5CVN0; C. hominis, UPI0000452AB0; H. sapiens (mitochondrial), Q96GW9; H. sapiens (cytoplasmic), P56192. are expressed as follows: l, linker zone; b, benzyl...”
Probing the prostate tumour microenvironment II: Impact of hypoxia on a cell model of prostate cancer progression
Tonry, Oncotarget 2017
- “...regulator GUK1 guanylate kinase 1 Q16774 +1.324 3 Cytoplasm kinase MARS2 methionyl-tRNA synthetase 2, mitochondrial Q96GW9 +1.266 5 Cytoplasm enzyme NUP85 nucleoporin 85kDa Q9BW27 +1.283 9 Cytoplasm other PDSS2 prenyl (decaprenyl) diphosphate synthase, subunit 2 Q86YH6 +1.370 Cytoplasm enzyme RPL13 ribosomal protein L13 P26373 +1.223 1...”
Inhibitors of methionyl-tRNA synthetase have potent activity against Giardia intestinalis trophozoites
Ranade, Antimicrobial agents and chemotherapy 2015
- “...numbers are Q38C91 for T. brucei, A8BY75 for Giardia, Q96GW9 for H. sapiens mitochondrial, and P56192 for H. sapiens cytoplasmic. Sequence numbers refer to the...”

7wptA / Q5HII6 Methionyl-tRNA synthetase from staphylococcus aureus complexed with a fragment m2-80 and atp (see paper)
24% identity, 72% coverage

Ligands: adenosine-5'-triphosphate; indan-2-amine (7wptA)

2ct8A / O67298 Crystal structure of aquifex aeolicus methionyl-tRNA synthetase complexed with tRNA(met) and methionyl-adenylate anologue (see paper)
23% identity, 73% coverage

Ligands: rna; 5'-o-[(l-methionyl)-sulphamoyl]adenosine (2ct8A)

4eg7B / Q38C91 Trypanosoma brucei methionyl-tRNA synthetase in complex with inhibitor chem 1331 (see paper)
23% identity, 81% coverage

Ligand: n-(1h-benzimidazol-2-yl)-n'-(3,5-dichlorobenzyl)propane-1,3-diamine (4eg7B)

Q38C91 methionine-tRNA ligase (EC 6.1.1.10) from Trypanosoma brucei (see 3 papers)
XP_822407 methionyl-tRNA synthetase, putative from Trypanosoma brucei brucei TREU927
23% identity, 70% coverage

Optimization of Methionyl tRNA-Synthetase Inhibitors for Treatment of Cryptosporidium Infection
Buckner, Antimicrobial agents and chemotherapy 2019
- “...brucei sequence. UniProt accession codes: T. brucei, Q38C91; C. parvum, Q5CVN0; C. hominis, UPI0000452AB0; H. sapiens (mitochondrial), Q96GW9; H. sapiens...”
Inhibitors of methionyl-tRNA synthetase have potent activity against Giardia intestinalis trophozoites
Ranade, Antimicrobial agents and chemotherapy 2015
- “...Tyr Asn Phe His a UniProt accession numbers are Q38C91 for T. brucei, A8BY75 for Giardia, Q96GW9 for H. sapiens mitochondrial, and P56192 for H. sapiens...”
Distinct states of methionyl-tRNA synthetase indicate inhibitor binding by conformational selection.
Koh, Structure (London, England : 1993) 2012
- GeneRIF: Crystal structure of Trypanosoma brucei MetRS in complex with its substrate methionine and its intermediate product methionyl-adenylate.

BBOV_I001970 putative methionyl-tRNA synthetase from Babesia bovis T2Bo
26% identity, 62% coverage

Novel Babesia bovis exported proteins that modify properties of infected red blood cells
Hakimi, PLoS pathogens 2020
- “...WT, BS-resistant lines and BS-sensitive revertants. Transcript levels are normalized against methionyl-tRNA synthetase (Gene ID: BBOV_I001970). (TIF) Click here for additional data file. S5 Fig Overexpression of Bb60-mtm in WT line did not affect the BS resistance. Growth inhibition curves of two Bb60-overexpressing parasite lines in...”

Q5CVN0 methionine--tRNA ligase (Fragment) from Cryptosporidium parvum (strain Iowa II)
24% identity, 69% coverage

Spontaneous Selection of Cryptosporidium Drug Resistance in a Calf Model of Infection
Hasan, Antimicrobial agents and chemotherapy 2021 (secret)
Optimization of Methionyl tRNA-Synthetase Inhibitors for Treatment of Cryptosporidium Infection
Buckner, Antimicrobial agents and chemotherapy 2019
- “...Amino acid sequence alignment. Cryptosporidium parvum (UniProt Q5CVN0) and Cryptosporidium hominis (UPI0000452AB0) have a single MetRS gene in their respective...”
- “...accession codes: T. brucei, Q38C91; C. parvum, Q5CVN0; C. hominis, UPI0000452AB0; H. sapiens (mitochondrial), Q96GW9; H. sapiens (cytoplasmic), P56192. are...”

1a8hA / P23395 Methionyl-tRNA synthetase from thermus thermophilus (see paper)
25% identity, 72% coverage

Ligand: zinc ion (1a8hA)

5k0sC / P59078 Crystal structure of methionyl-tRNA synthetase metrs from brucella melitensis in complex with inhibitor chem 1312 (see paper)
25% identity, 74% coverage

Ligand: 2-({3-[(3,5-dichlorobenzyl)amino]propyl}amino)quinolin-4(1h)-one (5k0sC)

4eg6B / Q38C91 Trypanosoma brucei methionyl-tRNA synthetase in complex with inhibitor chem 1325 (see paper)
23% identity, 81% coverage

Ligand: 4-{4-[(1h-benzimidazol-2-ylmethyl)amino]-6-(2-chloro-4-methoxyphenoxy)pyrimidin-2-yl}piperazin-2-one (4eg6B)

5k0tB / P59078 Crystal structure of methionyl-tRNA synthetase metrs from brucella melitensis in complex with inhibitor chem 1415 (see paper)
25% identity, 74% coverage

Ligand: 1-{3-[(3-chloro-5-methoxybenzyl)amino]propyl}-3-phenylurea (5k0tB)

A4HZ82 methionine--tRNA ligase from Leishmania infantum
25% identity, 66% coverage

Proteomic examination of Leishmania chagasi plasma membrane proteins: Contrast between avirulent and virulent (metacyclic) parasite forms
Yao, Proteomics. Clinical applications 2010
- “...3 Long chain fatty Acyl CoA synthetase A4HRT4 78855.60 7.63 3 3.84 2 Methionyl-tRNA synthetase A4HZ82 84145.70 5.63 1 3.61 2 n-Acyl-L-amino acid amidohydrolase A4HZ04 42737.60 5.02 2 7.34 2 Phosphogluconate dehydrogenase Q18L02 51912.10 5.74 4 6.89 2 Poly(a)-binding protein A4HDV5 62023.60 9.42 0 3.62 2...”

AM1001 methionyl-tRNA synthetase from Anaplasma marginale str. St. Maries
30% identity, 49% coverage

Comparative genomics and transcriptomics of trait-gene association
Pierlé, BMC genomics 2012
- “...AM919 Hypothetical protein 1 1 Gene AP, ER, ECh, ECa, RB, RC, RR TM AMF_762 AM1001 methionyl-tRNA synthetase 23 1 Gene AP, ER, ECh, ECa, RB, RC, RR TM/DS AMF_764 AM1005 aspartokinase 13 1 Gene AP, ER, ECh, ECa TM/DS AMF_824 AM1091 D-Ala-D-Ala carboxypeptidase 33 6...”

E9BF75 methionine--tRNA ligase from Leishmania donovani
25% identity, 66% coverage

Prediction of Antileishmanial Compounds: General Model, Preparation, and Evaluation of 2-Acylpyrrole Derivatives
Santiago, Journal of chemical information and modeling 2022
- “...i (nM) Q01782 MD L. major 1.52 0.06 1.86 0.27 1.81 46 0.01 Inh. (%) E9BF75 MD L. donovani 1.32 0.05 1.62 0.24 1.58 68,577 0.01 a Act.(%) = activity (%), Inh. (%) = inhibition (%), GI (%) = growth inhibition (%), Cyt. (%) = cytotoxicity...”
- “...reductase (P39050), 62 pyruvate kinase (Q27686), 63 pteridine reductase 1 (Q01782), 64 and methionine-tRNA ligase (E9BF75). 65 After a detailed inspection of all compounds active vs these proteins in our ChEMBL database, no significant similarity was found between the previously reported compounds and the 2-acylpyrrole derivatives...”

PY17X_0519800 methionine--tRNA ligase, putative from Plasmodium yoelii
23% identity, 63% coverage

Validation of Plasmodium vivax centromere and promoter activities using Plasmodium yoelii
Thawnashom, PloS one 2019
- “...(targeting GFP gene with primers GFP.rtF1 and GFP.rtR1) and parasite genome (targeting met-tRNA ligase gene (PY17X_0519800) with primers PyMet-tRNA.rtF1 and PyMet-tRNA.rtR1) with Power SYBR Green PCR Master Mix (Thermo Fisher Scientific) using the 7500 Real-Time PCR system (Applied Biosystems, Foster City, CA). Copy number was estimated...”

Q4D6H2 methionine--tRNA ligase from Trypanosoma cruzi (strain CL Brener)
23% identity, 66% coverage

Discovery of an Allosteric Binding Site in Kinetoplastid Methionyl-tRNA Synthetase
Torrie, ACS infectious diseases 2020
- “...the different potencies observed between the Ld MetRS and Tc MetRS enzymes, Tc MetRS (Uniprot: Q4D6H2) was modeled on the basis of the in-house Lm MetRS X-ray structure cocrystallized with compound 27 ( Figure 8 ). The sequences were 67% identical (with 81% of residue changes...”
- “...(PDB) with accession code 6SWX. Tc MetRS Homology Model The Tc MetRS sequence (UniProt ID: Q4D6H2) was homology modeled on the basis of the Lm MetRS crystal structure with compound 27 bound using Prime Homology Modeling tools implemented in Schrdinger software (Schrdinger, LLC). Sequences were aligned...”

3kflA / Q4QCD2 Leishmania major methionyl-tRNA synthetase in complex with methionyladenylate and pyrophosphate (see paper)
25% identity, 72% coverage

Ligands: [[(2r,3s,4r,5r)-5-(6-aminopurin-9-yl)-3,4-dihydroxy-oxolan-2-yl]methoxy-hydroxy-phosphoryl](2s)-2-azanyl-4-methylsulfanyl-butanoate; pyrophosphate 2-; zinc ion (3kflA)

MPN023 methionyl-tRNA synthetase from Mycoplasma pneumoniae M129
23% identity, 68% coverage

Development of a Multilocus Sequence Typing Scheme for Molecular Typing of Mycoplasma pneumoniae
Brown, Journal of clinical microbiology 2015
- “...29342) MPN135 FH (ATCC 15531) MPN007 MPN021 MPN022 MPN023 MPN101 MPN102 MPN107 MPN114 MPN117 MPN119 MPN121 MPN123 MPN125 MPN126 MPN128 MPN132 MPN133 MPN134...”

PBANKA_051870, PBANKA_0518700 methionine--tRNA ligase, putative from Plasmodium berghei ANKA
22% identity, 63% coverage

Solution X-ray scattering highlights discrepancies in Plasmodium multi-aminoacyl-tRNA synthetase complexes
Jaramillo, Protein science : a publication of the Protein Society 2023
- “...4.1 Bioinformatic analysis Sequences of Plasmodium berghei tRip (PBANKA_1306200), ERS (PBANKA_1362000), QRS (PBANKA_1346600), and MRS (PBANKA_0518700) were used for reference. Multiple sequence alignments were performed using TCoffee. (Magis et al., 2014 ) Detection of structural and functional domains was carried out with HHpred (Soding et al.,...”
Changes in the transcriptome of the malaria parasite Plasmodium falciparum during the initial phase of transmission from the human to the mosquito
Ngwa, BMC genomics 2013
- “...expr. 101.2 21 31 0 49 80 6 0 6 3 0 3 9 89 PBANKA_051870 PF3D7_1103800 cell cycle & gene expr. 392.0 7 12 0 23 35 0 0 0 0 0 0 0 35 PBANKA_094310 PF3D7_1105500 cell cycle & gene expr. 20.1 1 0...”

GL50803_22204 Methionyl-tRNA synthetase from Giardia intestinalis
A8BY75 methionine--tRNA ligase from Giardia intestinalis (strain ATCC 50803 / WB clone C6)
26% identity, 58% coverage

A Detailed Gene Expression Map of Giardia Encystation
Rojas-López, Genes 2021
- “...GL50803_101501, phenylalanyl-tRNA synthetase alpha chain, GL50803_12162, lysyl-tRNA synthetase, GL50803_16766, histidyl-tRNA synthetase, GL50803_22808, and methionyl-tRNA synthetase, GL50803_22204). The effect is also seen on translation initiation factors ( Figure 5 A) and ribosomal proteins ( Figure S5 ). At the same time as protein synthesis is down-regulated, proteolytic...”
Inhibitors of methionyl-tRNA synthetase have potent activity against Giardia intestinalis trophozoites
Ranade, Antimicrobial agents and chemotherapy 2015
- “...(PDB accession number 4EG5) (15). The Giardia MetRS (GL50803_22204 from strain WB) has high sequence conserva- 7128 aac.asm.org tion with the T. brucei MetRS...”
- “...full-length open reading frame for Giardia MetRS (GL50803_22204) was cloned into the bacterial expression plasmid AVA0421, incorporating a 6-histidine tag onto...”
Inhibitors of methionyl-tRNA synthetase have potent activity against Giardia intestinalis trophozoites
Ranade, Antimicrobial agents and chemotherapy 2015
- “...UniProt accession numbers are Q38C91 for T. brucei, A8BY75 for Giardia, Q96GW9 for H. sapiens mitochondrial, and P56192 for H. sapiens cytoplasmic. Sequence...”

WP_126912625 methionine--tRNA ligase from Streptomyces luteoverticillatus
26% identity, 66% coverage

Recent Developments and Challenges in the Enzymatic Formation of Nitrogen-Nitrogen Bonds
Angeli, ACS catalysis 2025
- “...malaysiensis QDL68185/ATL88544 A0A2B9TI29 Bacillus cereus PGO71607 Q8KGM6 Mesorhizobium japonicum R7A CAD31310 Dpn5-Dpn6 Streptomyces luteoverticillatus CGMCC15060 WP_126912625 ( 82 ) Bac1-Bac2 Bacillus paranthracis AM04S-42 WP_076855484 Col1-Col2 Colwellia sp. MBL4898055 Kit1-Kit2 Kitasatospora gansuensis DSM44786 WP_184911086 Cor1-Cor2 Corallococcus llansteffanensis CA051B WP_120641657 Ral1-Ral2 Ralstonia solanacearum CFBP2957 WP_013209038 Furthermore, an analysis...”

PVX_110980 methionine- tRNA ligase, putative from Plasmodium vivax
23% identity, 58% coverage

Gene Models, Expression Repertoire, and Immune Response of Plasmodium vivax Reticulocyte Binding Proteins
Hietanen, Infection and immunity 2015
- “...Pvrbp2b ; open diamonds, Pvrbp2c ; green diamonds, a housekeeping gene encoding methionine tRNA ligase (PVX_110980). Each time course was baseline subtracted with the average log 2 (expression) during the first 30 h. (C) Distribution of Pvama1 -normalized transcript copy numbers of Pvdbp and Pvrbp genes....”
Improving N-terminal protein annotation of Plasmodium species based on signal peptide prediction of orthologous proteins
Neto, Malaria journal 2012
- “...PVX_002940 - Methionine tRNA synthetase OG4_47490 PF10_0053 + Apicoplast PVX_094445 + OG4_10161 PF10_0340 - Cytosol PVX_110980 - Leucine tRNA synthetase OG4_11105 PF08_0011 + Apicoplast PVX_088945 + OG4_10828 PFF1095w - Cytosol PVX_114255 - Glutamate tRNA amidotransferase subunit A OG4_10803 PFD0780w + Apicoplast PVX_089895 + Initiation Factor-1 OG4_12019...”

blr2135 blr2135 from Bradyrhizobium japonicum USDA 110
25% identity, 73% coverage

Metabolomic Profiling of Bradyrhizobium diazoefficiens-Induced Root Nodules Reveals Both Host Plant-Specific and Developmental Signatures
Lardi, International journal of molecular sciences 2016
- “...putative aminotransferase protein 6.0 blr1852 similar to pantoate-alanine ligase 4.3 Translation, ribosomal structure and biogenesis blr2135 hypothetical protein 5.0 Transcription bll1906 N -acetyltransferase NrgA homolog 5.0 blr1880 transcriptional regulatory protein LuxR family 5.0 Replication and repair blr8234 unknown protein 4.7 Cell wall/membrane/envelop biogenesis bll1872 hypothetical protein...”

O74634 methionine-tRNA ligase (EC 6.1.1.10) from Candida albicans (see paper)
22% identity, 76% coverage

Network analysis of circular permutations in multidomain proteins reveals functional linkages for uncharacterized proteins.
Adjeroh, Cancer informatics 2014
- “...1 No 0 0 5 Q3QD47 Deleted (obsolete) 1.839 18.628 1 No 0 0 6 O74634 MSM1 MethioninetRNA ligase, mitochondrial 1.802 18.252 1 No 0 0 * 7 Q9HMN5 srp54 Signal recognition particle 54 kDa protein 1.792 18.154 1 Yes 0 3 * 8 Q62ZT7 cysK...”

PF3D7_1034900 methionine--tRNA ligase from Plasmodium falciparum 3D7
Q8IJ60 methionine--tRNA ligase from Plasmodium falciparum (isolate 3D7)
22% identity, 58% coverage

Exploring anti-malarial potential of FDA approved drugs: an in silico approach
Ramakrishnan, Malaria journal 2017
- “...0.97 DB00410: Mupirocin PF3D7_1015200 Cysteine-tRNA ligase P41972 Isoleucine-tRNA ligase Staphylococcus aureus 22 0.80 DB00410: Mupirocin PF3D7_1034900 Methionine-tRNA ligase P41972 Isoleucine-tRNA ligase Staphylococcus aureus 24 0.77 DB00410: Mupirocin PF3D7_1225100 Isoleucine-tRNA ligase P41972 Isoleucine-tRNA ligase Staphylococcus aureus 29 0.97 DB00410: Mupirocin PF3D7_1332900 Isoleucine-tRNA ligase P41972 Isoleucine-tRNA ligase Staphylococcus...”
Recent advances in the biology and drug targeting of malaria parasite aminoacyl-tRNA synthetases
Khan, Malaria journal 2016
- “...PF3D7_1331700 Isoleucyl-tRNA synthetase PF3D7_1225100 a PF3D7_1332900 a Leucyl-tRNA synthetase PF3D7_0828200 a PF3D7_0622800 Methionyl-tRNA synthetase PF3D7_1005000 PF3D7_1034900 Tryptophanyl-tRNA synthetase PF3D7_1251700 a PF3D7_1336900 Tyrosyl-tRNA synthetase PF3D7_1117500 PF3D7_0807900 Valyl-tRNA synthetase PF3D7_0311200 a PF3D7_1461900 Class II Alanyl-tRNA synthetase PF3D7_1367700 a PF3D7_1367700 a Asparaginyl-tRNA synthetase PF3D7_0509600 PF3D7_0211800 Aspartyl-tRNA synthetase PF3D7_0514300 PF3D7_0102900...”
- “...Apicoplast copy of TyrRS is the hypothesized target [ 45 ] REP3123 REP8839 C1C8 MetRS PF3D7_1034900 Known bacterial MetRS inhibitors REP3123 and REP8839 inhibit P. falciparum and block translation with IC 50 values near 150nM. C1C8 identified from in silico screening and inhibit parasite growth with...”
Imputation-based population genetics analysis of Plasmodium falciparum malaria parasites
Samad, PLoS genetics 2015
- “...PF3D7_0931300 2.35 - - - 10 10 PF3D7_1002200 PArt - - 1.55 1.25 13 10 PF3D7_1034900 1.51 - - 13 10 PF3D7_1035000 1.60 - - 35 10 PF3D7_1035700 DBLMSP 1.82 2.11 1.20 - 22 11 PF3D7_1110200 PRPF6 - - 2.18 1.92 11 11 PF3D7_1126100 ATG7 1.49...”
Changes in the transcriptome of the malaria parasite Plasmodium falciparum during the initial phase of transmission from the human to the mosquito
Ngwa, BMC genomics 2013
- “...PF3D7_0420300 ApiAP2 protein Transcription factor 400.2 PF3D7_0615400 ribonuclease 323.2 PF3D7_0811300 CCR4-associated factor 1, CAF1 200.2 PF3D7_1034900 methionine-tRNA ligase 101.2 PF3D7_1469700 conserved Plasmodium protein Homology to the transcriptional mediator subunit Med6 24.6 PF3D7_0513600 deoxyribodipyrimidine photolyase 129.2 PF3D7_1105500 centrin-4 (CEN4) 20.1 PF3D7_1018500 PHF5-like protein mRNA splicing factor RDS3...”
- “...280.8 7 0 0 0 0 0 0 0 0 0 0 0 0 PBANKA_050320 PF3D7_1034900 cell cycle & gene expr. 101.2 21 31 0 49 80 6 0 6 3 0 3 9 89 PBANKA_051870 PF3D7_1103800 cell cycle & gene expr. 392.0 7 12 0...”
Human Polo-like Kinase Inhibitors as Antiplasmodials
Bohmer, ACS infectious diseases 2023
- “...replicates. (C) Missense mutation is located at the conserved residue in MRS api (UniProt ID: Q8IJ60). Predicted structure derived from AlphaFold ( www.alphafold.ebi.ac.uk ). Figure 6. Differentially expressed phosphosites upon exposure to compound 1 (A) and compound 12 (B) of the top-ranked most downregulated (log 2(...”

SYMM_YEAST / P22438 Methionine--tRNA ligase, mitochondrial; Methionyl-tRNA synthetase; MetRS; EC 6.1.1.10 from Saccharomyces cerevisiae (strain ATCC 204508 / S288c) (Baker's yeast) (see 2 papers)
NP_011687 methionine--tRNA ligase MSM1 from Saccharomyces cerevisiae S288C
YGR171C Mitochondrial methionyl-tRNA synthetase (MetRS), functions as a monomer in mitochondrial protein synthesis; functions similarly to cytoplasmic MetRS although the cytoplasmic form contains a zinc-binding domain not found in Msm1p from Saccharomyces cerevisiae
23% identity, 73% coverage

function: Catalyzes the attachment of methionine to tRNA(Met) in the mitochondrion.
catalytic activity: tRNA(Met) + L-methionine + ATP = L-methionyl-tRNA(Met) + AMP + diphosphate (RHEA:13481)
Incorporation of the Arc1p tRNA-binding domain to the catalytic core of MetRS can functionally replace the yeast Arc1p-MetRS complex.
Karanasios, Journal of molecular biology 2008 (PubMed)
- GeneRIF: the sole role of the N-terminal appended domain of yeast MetRS is to mediate the indirect association with the TRBD, which, nevertheless, can also function effectively in vivo when directly fused to the catalytic MetRS core.
Arc1p is required for cytoplasmic confinement of synthetases and tRNA.
Golinelli-Cohen, Molecular and cellular biochemistry 2007 (PubMed)
- GeneRIF: These results are consistent with a model according to which Arc1p is a bifunctional protein involved in the subcellular localization of ScMetRS and ScGluRS via its N-terminal domain and of tRNA via its C-terminal domain.
Systematic analysis of nuclear gene function in respiratory growth and expression of the mitochondrial genome in S. cerevisiae
Stenger, Microbial cell (Graz, Austria) 2020
- “...translation and RNA maturation AEP1 YMR064W MRPL15 YLR312W-A MSK1 YNL073W AEP2 YMR282C MRPL16 YBL038W MSM1 YGR171C AEP3 YPL005W MRPL17 YNL252C MSR1 YHR091C AIM10 YER087W MRPL19 YNL185C MSS51 YLR203C ATP22 YDR350C MRPL20 YKR085C MST1 YKL194C ATP25 YMR098C MRPL22 YNL177C MSW1 YDR268W CBP1 YJL209W MRPL23 YOR150W MSY1 YPL097W...”
Localization and RNA Binding of Mitochondrial Aminoacyl tRNA Synthetases
Garin, Genes 2020
- “...(48.5) Yes Partial No No LysRS YNL073W (MSK1) Yes (36.7) Yes Partial No No MetRS YGR171C (MSM1) Yes (63.4) Yes Partial No NA PheRS YPR047W (MSF1) Yes (93.4) Yes Partial No Yes ProRS YER087W (AIM10) Yes (63.2) Yes Partial No NA SerRS YHR011W (DIA4) Yes (99.1)...”
RSC Chromatin-Remodeling Complex Is Important for Mitochondrial Function in Saccharomyces cerevisiae
Imamura, PloS one 2015
- “...aminotrans(X)ferase YGL059W PKP2 -1.169211802 Protein Kinase of PDH YGR102C GTF1 -3.704929047 Glutaminyl Transamidase subunit F YGR171C MSM1 -1.09387038 Mitochondrial aminoacyl-tRNA Synthetase, Methionine YJL005W CYR1 -1.436163151 CYclic AMP Requirement YJL130C URA2 -1.171207794 URAcil requiring YJR051W OSM1 -1.664915789 OSMotic sensitivity YKL094W YJU3 -1.339639536 Monoglyceride lipase (MGL) YLL027W ISA1...”
Genome-wide deletion mutant analysis reveals genes required for respiratory growth, mitochondrial genome maintenance and mitochondrial protein synthesis in Saccharomyces cerevisiae
Merz, Genome biology 2009
- “...genes involved in iron uptake and cell size YGL143c MRF1 Mitochondrial peptide chain release factor YGR171c MSM1 Met-tRNA synthetase, mitochondrial YHL038c CBP2 Mitochondrial splicing factor YHR011w DIA4 tRNA synthetase, may be involved in mitochondrial function YHR038w RRF1 Mitochondrial ribosome recycling factor *YHR051w COX6 Cytochrome c oxidase...”
Cophenetic correlation analysis as a strategy to select phylogenetically informative proteins: an example from the fungal kingdom
Kuramae, BMC evolutionary biology 2007
- “...YML021c viable XIII 0.82 KOG3103 YGR172c inviable VII 0.82 KOG1598 YGR246c inviable VII 0.82 KOG0436 YGR171c viable VII 0.81 KOG2326 YMR106C viable XIII 0.81 KOG1355 YNL220w viable XIV 0.81 KOG1741 YPR166c viable XVI 0.80 KOG3381 YHR122w inviable VIII 0.79 KOG3244 YDR204w viable IV 0.79 KOG1534 YLR243w...”
Efficient Tor signaling requires a functional class C Vps protein complex in Saccharomyces cerevisiae
Zurita-Martinez, Genetics 2007
- “...YFL016C YPL118W YMR193W YPL013C YJL063C YCR046C YLR426W YGR171C YPR100W YNL284C YNL073W YMR158W YOR150W YHR091C YKL170W YBR146W YNR037C YIL093C YBR268W YGR220C...”

MSM1 mitochondrial tRNA methionyl-tRNA synthetase from Candida albicans (see paper)
22% identity, 74% coverage

CharProtDB CGD description: Mitochondrial methionyl-tRNA synthetase (MetRS); functionally complements methionine auxotrophy of an E. coli MetRS mutant; transcription is regulated by Nrg1p

SYMM_SCHPO / O14000 Probable methionine--tRNA ligase, mitochondrial; Mitochondrial methionyl-tRNA synthetase; MtMetRS; EC 6.1.1.10 from Schizosaccharomyces pombe (strain 972 / ATCC 24843) (Fission yeast) (see paper)
SPAC27E2.06c methionine-tRNA ligase from Schizosaccharomyces pombe
23% identity, 73% coverage

catalytic activity: tRNA(Met) + L-methionine + ATP = L-methionyl-tRNA(Met) + AMP + diphosphate (RHEA:13481)
Checkpoint independence of most DNA replication origins in fission yeast
Mickle, BMC molecular biology 2007
- “...strong 4003300 4005680 SPAC27E2.01 SPAC27E2.02 medium 4007292 4010577 SPAC27E2.03c SPAC27E2.11c 1150 0 weak 4017870 4021600 SPAC27E2.06c pvg2 AT1130 strong strong strong Ori1130 31 1151 1 strong This table displays a small subset (only the information relevant to Fig. 2) of the information contained in Additional File...”

SCO6436 tRNA synthetase from Streptomyces coelicolor A3(2)
26% identity, 61% coverage

Cytosolic copper is a major modulator of germination, development and secondary metabolism in Streptomyces coelicolor
González-Quiñónez, Scientific reports 2019
- “...21.1 SCO6288 3.1 8.7 SCO6430 Dipeptide biosynthesis 1.2 2.3 SCO6431 1 2 SCO6432 0.9 1.8 SCO6436 0.8 1.7 SCO6767 Hopene biosynthesis 1 2 SCO6927 Lantibiotic biosynthesis 0.8 1.8 SCO6932 b SCO7700 2-Methylisoborneol biosynthesis b SCO7701 b The abundance of the transcripts described in results is indicated;...”
The ROK family regulator Rok7B7 pleiotropically affects xylose utilization, carbon catabolite repression, and antibiotic production in streptomyces coelicolor
Świątek, Journal of bacteriology 2013
- “...and an uncharacterized nonribosomal peptide (SCO6431 and SCO6436) all demonstrated increased expression levels in the rok7B7 mutant. In particular, the...”

WP_184911086 class I tRNA ligase family protein from Kitasatospora gansuensis
26% identity, 53% coverage

Recent Developments and Challenges in the Enzymatic Formation of Nitrogen-Nitrogen Bonds
Angeli, ACS catalysis 2025
- “...82 ) Bac1-Bac2 Bacillus paranthracis AM04S-42 WP_076855484 Col1-Col2 Colwellia sp. MBL4898055 Kit1-Kit2 Kitasatospora gansuensis DSM44786 WP_184911086 Cor1-Cor2 Corallococcus llansteffanensis CA051B WP_120641657 Ral1-Ral2 Ralstonia solanacearum CFBP2957 WP_013209038 Furthermore, an analysis of the amino acid specificity within the hydrazine synthetase enzyme family revealed a wide substrate selectivity for...”

I2MZC8 Methionyl-tRNA synthetase from Streptomyces tsukubensis (strain DSM 42081 / NBRC 108919 / NRRL 18488 / 9993)
26% identity, 56% coverage

Recent Developments and Challenges in the Enzymatic Formation of Nitrogen-Nitrogen Bonds
Angeli, ACS catalysis 2025
- “...) Streptomyces sp.SoC090715LN-17 Hydrazine BGC0001764 Confirmed ( in vivo ) ( 66 ) Tri28 UniprotID: I2MZC8 , UniProtID: A0A4P8XS63 triacsins( 17 ) Streptomyces tsukubensis Kitasatospora aureofaciens Hydrazine BGC0001983 ( Kitasatospora aureofaciens ) Confirmed ( in vitro ) ( 68 ) Aza12/AzaE UniProtID: A0A1G6ZJC9 azaserine( 18 )...”

WP_076855484 methionine--tRNA ligase from Bacillus cereus group sp. Bc032
22% identity, 56% coverage

Recent Developments and Challenges in the Enzymatic Formation of Nitrogen-Nitrogen Bonds
Angeli, ACS catalysis 2025
- “...japonicum R7A CAD31310 Dpn5-Dpn6 Streptomyces luteoverticillatus CGMCC15060 WP_126912625 ( 82 ) Bac1-Bac2 Bacillus paranthracis AM04S-42 WP_076855484 Col1-Col2 Colwellia sp. MBL4898055 Kit1-Kit2 Kitasatospora gansuensis DSM44786 WP_184911086 Cor1-Cor2 Corallococcus llansteffanensis CA051B WP_120641657 Ral1-Ral2 Ralstonia solanacearum CFBP2957 WP_013209038 Furthermore, an analysis of the amino acid specificity within the hydrazine...”

BCAS0045 putative methionyl-tRNA synthetase from Burkholderia cenocepacia J2315
26% identity, 49% coverage

Comparative Genomics and Evolutionary Analysis of RNA-Binding Proteins of Burkholderia cenocepacia J2315 and Other Members of the B. cepacia Complex
Feliciano, Genes 2020
- “...gene seems to be encoded only in 2% of the sequenced genomes. The BCAL2646 and BCAS0045 gene products from B. cenocepacia J2315 were identified as MetG-like proteins, containing a methionyl/leucyl-tRNA synthetase domain, and a Rossmann-like alpha/beta/alpha sandwich fold. These two proteins only share 27.72% identity in...”

7d8tA / O66738,O75030 Mitf bhlhlz complex with m-box DNA (see paper)
44% identity, 16% coverage

Ligand: dna (7d8tA)

SSO0627 Methionyl-tRNA synthetase N-term homolog (metS-like) from Sulfolobus solfataricus P2
31% identity, 16% coverage

Parallel evolution of transcriptome architecture during genome reorganization
Yoon, Genome research 2011
- “...al. 2008). For example, while the N terminus of SSO0627 was originally annotated as overlapping with the N terminus of purC, this annotation had to be revised...”
- “...revised annotation, our TA analysis mapped the TSS of SSO0627 near a putative start codon that is 145 nt downstream from the originally misassigned start codon...”

PF3D7_1005000 methionine--tRNA ligase, putative from Plasmodium falciparum 3D7
21% identity, 31% coverage

Human Polo-like Kinase Inhibitors as Antiplasmodials
Bohmer, ACS infectious diseases 2023
- “...In both AE9 and AG8, there were mutations in the methionyl-tRNA synthetase Pf MRS api (PF3D7_1005000), the autophagy-related E1 activating enzyme Pf ATG7 (PF3D7_1126100), and an eIF2 kinase, Pf PK4 (PF3D7_0628200). BE11 possessed a mutation in Pf VPS15 (PF3D7_0823000), a kinase that assists in early autophagosome...”
Exploring anti-malarial potential of FDA approved drugs: an in silico approach
Ramakrishnan, Malaria journal 2017
- “...0.64 DB00410: Mupirocin PF3D7_0828200 Leucine-tRNA ligase P41972 Isoleucine-tRNA ligase Staphylococcus aureus 20 0.68 DB00410: Mupirocin PF3D7_1005000 Methionine-tRNA ligase P41972 Isoleucine-tRNA ligase Staphylococcus aureus 22 0.97 DB00410: Mupirocin PF3D7_1015200 Cysteine-tRNA ligase P41972 Isoleucine-tRNA ligase Staphylococcus aureus 22 0.80 DB00410: Mupirocin PF3D7_1034900 Methionine-tRNA ligase P41972 Isoleucine-tRNA ligase Staphylococcus...”
Selective inhibition of apicoplast tryptophanyl-tRNA synthetase causes delayed death in Plasmodium falciparum
Pasaje, Scientific reports 2016
- “...TrpRS api 1811683 _pColdIV, TrpRS cyt _AVA04521, P. falciparum apicoplast methionyl-tRNA synthetase (MetRS api _pColdIV, PF3D7_1005000), and empty pColdIV vector. Cells were plated on M9 minimal agar plates with (permissive) and without (repressive) tryptophan supplementation (0.05 g/L) and incubated at 37C. Drug susceptibility assays Inhibitors of...”
Recent advances in the biology and drug targeting of malaria parasite aminoacyl-tRNA synthetases
Khan, Malaria journal 2016
- “...synthetase PF3D7_1331700 Isoleucyl-tRNA synthetase PF3D7_1225100 a PF3D7_1332900 a Leucyl-tRNA synthetase PF3D7_0828200 a PF3D7_0622800 Methionyl-tRNA synthetase PF3D7_1005000 PF3D7_1034900 Tryptophanyl-tRNA synthetase PF3D7_1251700 a PF3D7_1336900 Tyrosyl-tRNA synthetase PF3D7_1117500 PF3D7_0807900 Valyl-tRNA synthetase PF3D7_0311200 a PF3D7_1461900 Class II Alanyl-tRNA synthetase PF3D7_1367700 a PF3D7_1367700 a Asparaginyl-tRNA synthetase PF3D7_0509600 PF3D7_0211800 Aspartyl-tRNA synthetase PF3D7_0514300...”

O66680 leucine-tRNA ligase (subunit 2/2) (EC 6.1.1.4) from Aquifex aeolicus (see paper)
aq_351 leucyl-tRNA synthetase alpha subunit from Aquifex aeolicus VF5
29% identity, 22% coverage

Horizontal Gene Transfers in prokaryotes show differential preferences for metabolic and translational genes
Kanhere, BMC evolutionary biology 2009
- “...Extra predictions (Protein IDs) Leucyl-tRNA sythetase Bacteria to Halobacterium COG0495 Y 17 MJ0633, SSO0589, aq_1770, aq_351 Phenylanalyl-tRNA sythetase Archaea to Spirochaetes COG0016 Y 18 MA0171 Prolyl-tRNA sythetase Archaea to Deinococcus, Borrelia and Mycoplasma COG0442 Y 16,18 ML1553 Valyl-tRNA sythetase Archaea to Rickettsia COG0525 Y 13 RSp0782...”

PVX_094445 tRNA ligase, putative from Plasmodium vivax
21% identity, 32% coverage

Improving N-terminal protein annotation of Plasmodium species based on signal peptide prediction of orthologous proteins
Neto, Malaria journal 2012
- “...PVX_098040 + OG4_10251 PFB0525w - Cytosol PVX_002940 - Methionine tRNA synthetase OG4_47490 PF10_0053 + Apicoplast PVX_094445 + OG4_10161 PF10_0340 - Cytosol PVX_110980 - Leucine tRNA synthetase OG4_11105 PF08_0011 + Apicoplast PVX_088945 + OG4_10828 PFF1095w - Cytosol PVX_114255 - Glutamate tRNA amidotransferase subunit A OG4_10803 PFD0780w +...”

A0A072V122 Putative methionine--tRNA ligase from Medicago truncatula
38% identity, 15% coverage

Profiling of Seed Proteome in Pea (Pisum sativum L.) Lines Characterized with High and Low Responsivity to Combined Inoculation with Nodule Bacteria and Arbuscular Mycorrhizal Fungi
Mamontova, Molecules (Basel, Switzerland) 2019
- “...the CHCH group of donors c Nucleotide metabolism NS 0.7 1.5 2.6 0.001 0.013 39 A0A072V122 tRNA-binding region domain protein Protein biosynthesis NS NS 2.4 1.9 0.024 0.044 40 V7AUC2 Uncharacterized; RNA 3-end processing, RNA polyadenylation c RNA processing NS NS 0.6 NS 0.013 0.032 41...”

XP_013631509 tRNA-aminoacylation cofactor arc1 from Brassica oleracea var. oleracea
35% identity, 15% coverage

N-terminal domains of ARC1 are essential for interaction with the N-terminal region of Exo70A1 in transducing self-incompatibility of Brassica oleracea.
Shi, Acta biochimica et biophysica Sinica 2016 (PubMed)
- GeneRIF: Both the leucine zipper with coiled-coil structure of ARC1116-236, and the hypervariable region and SUMO modification motif of Exo70A1172-275 are the core interaction domains between ARC1 and Exo70A1. Any factors affecting these core domains would be the regulators of ARC1 mediating ubiquitin degradation in self-incompatible system.

TM0168 leucyl-tRNA synthetase from Thermotoga maritima MSB8
Q9WY15 Leucine--tRNA ligase from Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
26% identity, 18% coverage

Recombination in Thermotoga: implications for species concepts and biogeography
Nesbø, Genetics 2006
- “...remaining 46 are found in TM0166, TM0167, and TM0168 (covering ,20% of the alignment). Recombination between maritima and neapolitana clusters: In the rRNA...”
Gene discovery within the planctomycete division of the domain Bacteria using sequence tags from genomic DNA libraries
Jenkins, Genome biology 2002
- “...Schizosaccharomyces pombe (Q09811) E Translation B2 BH001160 Leucyl-tRNA synthetase (leucine tRNA ligase) 1.00E-25 Thermotoga maritima (Q9WY15) B pl2-A10 BH001161 Alanyl tRNA synthetase 6.00E-14 Bacillus subtilis (O34526) B Miscellaneous F3 BH001162 Ribonuclease E (RNase E) 1.00E-38 Haemophilus influenzae (P44443) B H6 BH001163 Inter-alpha-trypsin inhibitor heavy chain H2...”

NP_001030190 aminoacyl tRNA synthase complex-interacting multifunctional protein 1 from Bos taurus
Q3ZBX5 Aminoacyl tRNA synthetase complex interacting multifunctional protein 1 from Bos taurus
32% identity, 17% coverage

Structural separation of different extracellular activities in aminoacyl-tRNA synthetase-interacting multi-functional protein, p43/AIMP1.
Han, Biochemical and biophysical research communications 2006 (PubMed)
- GeneRIF: AIMP1 uses different regions for its diverse extracellular activities.
Profiling of proteins secreted in the bovine oviduct reveals diverse functions of this luminal microenvironment
Pillai, PloS one 2017
- “...P80177 Myeloid derived growth factor P62248 Osteopontin P31096 Small inducible cytokine subfamily E, member 1 Q3ZBX5 Tumor necrosis factor ligand 1B E1BF06 * Exceptions: Proteins identified with only one unique peptide 10.1371/journal.pone.0188105.t002 Table 2 Proteases and protease inhibitors in the oviductal cell secretions. Protein name Accession...”

Q4KM49 Tyrosine--tRNA ligase, cytoplasmic from Rattus norvegicus
35% identity, 15% coverage

Space Radiation-Induced Alterations in the Hippocampal Ubiquitin-Proteome System
Tidmore, International journal of molecular sciences 2021
- “...Table 3 Spatial Memory Impairment (SMI) signature proteins. UniProt Accession Numbers B0BN85 * P15178 P60901 Q4KM49 Q6P7Q4 B0BNF1 P15865 P61203 Q4V8I7 Q6QIX3 D4AE41 * P18163 P61227 Q505J8 Q7TQ94 F1LNJ2 * P20171 * P62024 Q569C2 Q80W89 F1M386 * P21272 * P62250 Q5HZA6 Q8VHW5 O35179 P29101 P62914 Q5U216...”
Identification of Aortic Proteins Involved in Arterial Stiffness in Spontaneously Hypertensive Rats Treated With Perindopril:A Proteomic Approach
Miotto, Frontiers in physiology 2021
- “...protein S3 (P62909), Prohibitin (P67779), Heterogeneous nuclear ribonucleoprotein A1 (P04256), Septin-11 (B3GNI6), TyrosinetRNA ligase cytoplasmic (Q4KM49), 28 kDa heat- and acid-stable phosphoprotein (Q62785), Transcription elongation factor A protein 1 (Q4KLL0), Cytochrome c somatic (P62898), and Rho GDP-dissociation inhibitor 1 (Q5XI73). In (B) , light green indicates...”
Proteomic analysis of cortical neuronal cultures treated with poly-arginine peptide-18 (R18) and exposed to glutamic acid excitotoxicity
MacDougall, Molecular brain 2019
- “...1.854 5.754 14.06 b Rps27 Q71TY3 40S ribosomal protein S27 1.102 18.18 b 5.058 Yars Q4KM49 Tyrosine--tRNA ligase, cytoplasmic 1.225 4.656 3.342 Calcium transport and signalling Vdac1 Q9Z2L0 Voltage-dependent anion-selective channel protein 1 1.419 2.466 2.938 Cacna2d1 P54290 Voltage-dependent calcium channel subunit alpha-2/delta-1 1.306 4.207 4.018...”
The Proteome Profiles of the Cerebellum of Juvenile, Adult and Aged Rats--An Ontogenetic Study
Wille, International journal of molecular sciences 2015
- “...kinase receptor-associated protein Cp, Nc up 0.0163 up 0.0163 0.38 6 141 15 38,717 4.99 Q4KM49 SYYC_RAT Yars TyrosinetRNA ligase, cytoplasmic Cp up 0.0285 up 0.0547 0.57 5 141 18 59,420 6.57 P62961 YBOX1_RAT Ybx1 Nuclease-sensitive element-binding protein 1 Cp, Nc, Cpg up 0.0446 - -...”
The proteome of the differentiating mesencephalic progenitor cell line CSM14.1 in vitro.
Weiss, BioMed research international 2014
- “...6.02 6 19 Q9JMJ4 PRP19_RAT Pre-mRNA-processing factor 19 Down 129 55661 6.14 13 28 Translation Q4KM49 SYYC_RAT Tyrosyl-tRNA synthetase Down 175 59420 6.57 16 29 P38983 RSSA_RAT 40S ribosomal protein SA, laminin receptor 1, LRP/LR; laminin-binding protein precursor p40 Down 51 32917 4.8 4 17 P05197...”
Phosphoproteomics and bioinformatics analyses of spinal cord proteins in rats with morphine tolerance.
Liaw, PloS one 2014
- “...Ywhaz 14-3-3 protein zeta/delta 27.771/4.7 51.4 6 39333 P67779 Phb Prohibitin 29.82/5.6 37.5 7 204 Q4KM49 Yars Tyrosyl-tRNA synthetase 59.116/6.6 20.1 8 16777 P07323 Eno2 Gamma-enolase 47.141/5.0 27.9 9 1253 P09117 Aldoc Fructose-bisphosphate aldolase C 39.284/6.7 40.5 10 45.3 D4A7F6 Colec10 Collectin sub-family member 10 30.628/7.5...”
Preliminary quantitative profile of differential protein expression between rat L6 myoblasts and myotubes by stable isotope labeling with amino acids in cell culture.
Cui, Proteomics 2009
- “...498407 Transitional endoplasmic reticulum ATPase IPI00212014.2 1.500.13 13 P46462 116643 Tyrosyl-tRNA synthetase IPI00366785.2 1.66NA 1 Q4KM49 313047 WD repeat domain 77 IPI00368916.1 1.59NA 1 Q4QR85 310769 Proteolysis 26S protease regulatory subunit 4 IPI00211733.1 1.88NA 1 P62193 117263 26S protease regulatory subunit 7 IPI00421600.7 1.78 0.10 4...”

Q5R8T5 Tyrosine--tRNA ligase, cytoplasmic from Pongo abelii
35% identity, 15% coverage

Proteomic identification of non-Gal antibody targets after pig-to-primate cardiac xenotransplantation.
Byrne, Xenotransplantation 2008
- “...P26038 Moesin a 68 Cytoskeletal Q32LP2 Radixin b 68 Cytoskeletal P14866 hnRNP-L a 60 Biosynthesis Q5R8T5 Tyrosyl-tRNA synthase a , b 59 Biosynthesis P14618 Pyruvate kinase a 58 Metabolism P38657 Protein disulfide isomerase a 57 Biosynthesis P20000 aldehyde dehydrogenase b 56 Metabolism P00829 ATP synthase b-chain...”

SYYC_MOUSE / Q91WQ3 Tyrosine--tRNA ligase, cytoplasmic; Tyrosyl-tRNA synthetase; TyrRS; EC 6.1.1.1 from Mus musculus (Mouse) (see paper)
NP_598912 tyrosine--tRNA ligase, cytoplasmic from Mus musculus
35% identity, 15% coverage

function: Tyrosine--tRNA ligase that catalyzes the attachment of tyrosine to tRNA(Tyr) in a two-step reaction: tyrosine is first activated by ATP to form Tyr-AMP and then transferred to the acceptor end of tRNA(Tyr) (By similarity). Also acts as a positive regulator of poly-ADP-ribosylation in the nucleus, independently of its tyrosine-- tRNA ligase activity (By similarity). Activity is switched upon resveratrol-binding: resveratrol strongly inhibits the tyrosine--tRNA ligase activity and promotes relocalization to the nucleus, where YARS1 specifically stimulates the poly-ADP-ribosyltransferase activity of PARP1 (PubMed:25533949).
catalytic activity: tRNA(Tyr) + L-tyrosine + ATP = L-tyrosyl-tRNA(Tyr) + AMP + diphosphate + H(+) (RHEA:10220)
subunit: Homodimer. Interacts (when binding to resveratrol) with PARP1; interaction stimulates the poly-ADP-ribosyltransferase activity of PARP1.
Ion Mobility-Based Enrichment-Free N-Terminomics Analysis Reveals Novel Legumain Substrates in Murine Spleen
Ziegler, Molecular & cellular proteomics : MCP 2024
- “...Tmpo ( Q61029 ) N 58 S 59 KGPPDFSSDEEREPTPVL GSGASVGR Nucleus 4.2837 3.0954 Yars1 ( Q91WQ3 ) N 357 S 358 EPEEVIPSR Cytoplasm 4.5893 5.3599 Fig.6 Validating putative legumain substrates identified by FAIMS-facilitated N-terminomics. A , D , and G , schematic of murine lysosomal -mannosidase...”
FAIMS-enabled N-terminomics analysis reveals novel legumain substrates in murine spleen
Ziegler, 2023
Comparative proteomic analysis of exosomes derived from endothelial cells and Schwann cells.
Wang, PloS one 2023
- “...with vascular function. EC-Exo enriched proteins Protein ID Gene name Protein name P15116 CDH2 Cadherin-2 Q91WQ3 YARS1 TyrosinetRNA ligase, cytoplasmic Q8VCC6 CCM2 Cerebral cavernous malformations protein 2 P48678 LMNA Prelamin-A Q9JI71 DLL4 Delta-like protein 4 Q60805 MERTK Tyrosine-protein kinase Mer Q62181 SEMA3C Semaphorin-3C P52795 EFNB2 Ephrin-B2...”
Glycerophosphoinositol Promotes Apoptosis of Chronic Lymphocytic Leukemia Cells by Enhancing Bax Expression and Activation.
Boncompagni, Frontiers in oncology 2022
- “...(Shp1) P80316 T-complex protein 1 subunit epsilon Q8BMF4 Dihydrolipoamide acetyltransferase PDH-E2 Q8BP47 AsparaginetRNA ligase, cytoplasmic Q91WQ3 TyrosinetRNA ligase, cytoplasmic Q9DBG6 Dolichyl-diphosphooligosaccharideprotein glycosyltransferase subunit 2 Q61024 Asparagine synthetase P09405 Nucleolin Q61656 Probable ATP-dependent RNA helicase DDX5 P30416 Peptidyl-prolyl cis-trans isomerase FKBP4 Q99K87 Serine hydroxymethyltransferase, mitochondrial P47738 Aldehyde...”
Identification of the MuRF1 Skeletal Muscle Ubiquitylome Through Quantitative Proteomics.
Baehr, Function (Oxford, England) 2021
- “...230 A0A140LIF8 Immunity-related GTPase family M member 2 Irgm2 328 Q2EMV9 Protein mono-ADP-ribosyltransferase Parp14 1532 Q91WQ3 Tyrosine-tRNA ligase Yars 513 Q01514 Interferon-induced guanylate-binding protein 1 Gbp1 532 Q9D8C4 Interferon-induced 35kDa protein homolog Ifi35 57 a Previously identified as a MuRF1 substrate using in vitro methods. Table...”
Functional, proteomic and bioinformatic analyses of Nrf2- and Keap1- null skeletal muscle
Gao, The Journal of physiology 2020
- “...H2A type 1-B 0.01 2.31 Higd2a Q9CQJ1 HIG1 domain family member 2A 0.05 1.96 Yars Q91WQ3 Tyrosine--tRNA ligase, cytoplasmic 0.05 2.36 Table2. Differentially expressed proteins in Keap1-deficient skeletal muscle. Keap1 KO-upregulated 108 Proteins Gene ID Protein ID Protein Name P val. Fold Nqo1 Q64669 NAD(P)H dehydrogenase...”
Suppression of the Peripheral Immune System Limits the Central Immune Response Following Cuprizone-Feeding: Relevance to Modelling Multiple Sclerosis
Sen, Cells 2019
- “...dehydrogenase Ivd 650/39 17 46.3/8.5 79.4/6.2 0.42(0.2PT) 1.80(PT) S [ 49 ] - - 5G5/SP Q91WQ3 Tyrosine-tRNA ligase Yars 333/28 17 59/6.57 124.9/6.4 0.32(0.2PT) 1.97(PT) S - - - A22/MP P26443 Glutamate dehydrogenase 1 Glud1 324/12 7 61.3/8 106.8/6.8 2.24(0.2PT) M - [ 94 ] [...”
Tyrosyl-tRNA synthetase: A potential kyotorphin synthetase in mammals.
Tsukahara, Peptides 2018 (PubMed)
- GeneRIF: conclusion is further supported by a positive correlation across brain regions between TyrRS expression and arginine-accelerated KTP production.

L0350 isoleucyl-tRNA synthetase (EC 6.1.1.5) from Lactococcus lactis subsp. lactis Il1403
30% identity, 13% coverage

Genome-wide molecular clock and horizontal gene transfer in bacterial evolution
Novichkov, Journal of bacteriology 2004
- “...subtilis, BH2545 of B. halodurans, lin2127 of L. innocua, L0350 of L. lactis, SPy1513 of S. pyogenes, SP1659 of S. pneumoniae, FN0067 of F. nucleatum, TM1361 of...”

NP_001020867 tyrosine--tRNA ligase, cytoplasmic from Rattus norvegicus
35% identity, 15% coverage

Tyrosyl-tRNA synthetase: A potential kyotorphin synthetase in mammals.
Tsukahara, Peptides 2018 (PubMed)
- GeneRIF: conclusion is further supported by a positive correlation across brain regions between TyrRS expression and arginine-accelerated KTP production.

Q5ZKA2 Isoleucine--tRNA ligase, mitochondrial from Gallus gallus
30% identity, 12% coverage

HSC70 is required for infectious bursal disease virus (IBDV) infection in DF-1 cells
Chen, Virology journal 2020
- “...5 GMP reductase tr | F1NWY8 | 4.70% 1 6 Isoleucine-tRNA ligase, mitochondrial sp | Q5ZKA2 | 1.70% 1 7 Phosphatidylinositol 4-phosphate 5-kinase type-1 sp | Q5ZJ58 | 1.85% 1 8 Protein phosphatase 1 regulatory subunit 21 sp | Q5ZL12 | 1.16% 1 9 Nonspecific serine/threonine...”

G3H935 tyrosine-tRNA ligase (EC 6.1.1.1) from Cricetulus griseus (see paper)
35% identity, 15% coverage

AT2G40660 tRNA-binding region domain-containing protein from Arabidopsis thaliana
34% identity, 15% coverage

The genetic architecture ofArabidopsis thalianain response to native non-pathogenic leaf bacterial species revealed by GWA mapping in field conditions
Ramírez-Sánchez, 2022
Telomerase Interaction Partners-Insight from Plants
Fulnečková, International journal of molecular sciences 2021
- “...not detect any further positive interactions with putative DNA binding proteins, e.g., the OB-fold-like protein AT2G40660 in Y2H and BiFC ( Figure S6A ), the dsDNA-binding family protein AT1G29850, putative DNA helicase AT2G03270, and various transcription factors in Y2H assays ( Table S1 ). 2.7. Connections...”
- “...not affected. These results suggest that the mutations in mtssb , at2g04520 , at4g17950 , at2g40660 , at4g23540 , at5g12410, and at2g42270 lines were not effective in influencing the maintenance of telomere length. As well, the three lines that produced only heterozygous progeny ( ssb1-3 ,...”
A Label-free Mass Spectrometry Method to Predict Endogenous Protein Complex Composition
McBride, Molecular & cellular proteomics : MCP 2019
- “...experiment with biological replicates was conducted using the preparation of soluble proteins from the aim1pl (AT2G40660) knock out and wild-type (Col-0). The methods were as described above but were analyzed using the Thermo Q Exactive with improved sensitivity and reproducibility compared with the AB Sciex 5600....”
- “...220E08 line was confirmed by PCR to contain a T-DNA insertion in exon 2 of AT2G40660 using PCR ( 44 ). The elution profiles of the predicted AIMP1L-associated proteins were compared in duplicate samples from wild-type and mutant extracts. As a negative control, all cytosolic tRNA...”
DYn-2 Based Identification of Arabidopsis Sulfenomes
Akter, Molecular & cellular proteomics : MCP 2015
- “...INITIATION FACTOR 3B-2 GTP-BINDING PROTEIN-RELATED Description AT2G40660 AT3G04840 AT3G57290 AT4G26870 AT4G31120 AT4G39520 AT5G25780 AT1G09620 AGI code Cytosol,...”
Regulation of leaf maturation by chromatin-mediated modulation of cytokinin responses
Efroni, Developmental cell 2013
- “...retrotransposon TA3 ( Han et al., 2012 ) and NC2 (genomic region 3 of ARR16 (AT2G40660)). Primer sequences can be found in Supplemental Experimental Methods . Bimolecular fluorescence complementation Bimolecular fluorescent complementation (BiFC) plasmids were introduced into onion epidermal cells using particle bombardment with BioRad PDS-1000/He....”
Dual targeting is the rule for organellar aminoacyl-tRNA synthetases in Arabidopsis thaliana
Duchêne, Proceedings of the National Academy of Sciences of the United States of America 2005
- “...At3g13490 At4g04350 At1g09620 At4g13780 At3g55400 At2g40660 At5g56680 At4g17300 At1g70980 At3g07420 At1g68420 At5g38750 At5g52520 At3g62120 At1g25350 At5g19720...”

NP_031952 aminoacyl tRNA synthase complex-interacting multifunctional protein 1 isoform 1 from Mus musculus
33% identity, 14% coverage

The Role of the AIMP1 Pathway in Diabetic Retinopathy: AIMP1-Targeted Intervention Study in Diabetic Retinopathy.
Zou, Ophthalmic research 2020 (PubMed)
- GeneRIF: The Role of the AIMP1 Pathway in Diabetic Retinopathy: AIMP1-Targeted Intervention Study in Diabetic Retinopathy.
Influence of aminoacyl-tRNA synthetase complex-interacting multifunctional protein 1 on epithelial differentiation and organization during lung development.
Lee, American journal of physiology. Lung cellular and molecular physiology 2020
- GeneRIF: Influence of aminoacyl-tRNA synthetase complex-interacting multifunctional protein 1 on epithelial differentiation and organization during lung development.
Mechanistic regulation of SPHK1 expression and translocation by EMAP II in pulmonary smooth muscle cells.
Ranasinghe, Biochimica et biophysica acta. Molecular and cell biology of lipids 2020
- GeneRIF: Mechanistic regulation of SPHK1 expression and translocation by EMAP II in pulmonary smooth muscle cells.
Transient Changes of Metabolism at the Pronuclear Stage in Mice Influences Skeletal Muscle Phenotype in Adulthood.
Bertrand-Gaday, International journal of molecular sciences 2020
- GeneRIF: Transient Changes of Metabolism at the Pronuclear Stage in Mice Influences Skeletal Muscle Phenotype in Adulthood.
AIMP1 regulates TCR signaling and induces differentiation of regulatory T cells by interfering with lipid raft association.
Kim, Biochemical and biophysical research communications 2019 (PubMed)
- GeneRIF: AIMP1 regulates TCR signaling and induces differentiation of regulatory T cells by interfering with lipid raft association.
Aminoacyl tRNA Synthetase--Interacting Multifunctional Protein 1 Activates NK Cells via Macrophages In Vitro and In Vivo.
Kim, Journal of immunology (Baltimore, Md. : 1950) 2017 (PubMed)
- GeneRIF: results show that AIMP1 induces antitumor responses by NK cell activation mainly via macrophages
The expression of aminoacyl-tRNA-synthetase-interacting multifunctional protein-1 (Aimp1) is regulated by estrogen in the mouse uterus.
Jeong, Molecular and cellular endocrinology 2015 (PubMed)
- GeneRIF: findings indicate that Aimp1 might act as an important regulator to remodel the uterine endometrium and its expression might be regulated by estrogen during the estrous cycle.
Blockade of EMAP II protects cardiac function after chronic myocardial infarction by inducing angiogenesis.
Yuan, Journal of molecular and cellular cardiology 2015
- GeneRIF: Blockade of EMAP II induces angiogenesis and improves cardiac function following chronic myocardial infarction.
More

AIMP1_MOUSE / P31230 Aminoacyl tRNA synthase complex-interacting multifunctional protein 1; Multisynthase complex auxiliary component p43 from Mus musculus (Mouse) (see 10 papers)
33% identity, 14% coverage

function: Non-catalytic component of the multisynthase complex (PubMed:12060739). Stimulates the catalytic activity of cytoplasmic arginyl-tRNA synthase (By similarity). Binds tRNA. Possesses inflammatory cytokine activity (PubMed:1400342, PubMed:7545917). Negatively regulates TGF-beta signaling through stabilization of SMURF2 by binding to SMURF2 and inhibiting its SMAD7-mediated degradation (PubMed:18448069). Involved in glucose homeostasis through induction of glucagon secretion at low glucose levels (PubMed:17001013). Promotes dermal fibroblast proliferation and wound repair (PubMed:15681823). Regulates KDELR1-mediated retention of HSP90B1/gp96 in the endoplasmic reticulum (PubMed:17525271). Plays a role in angiogenesis by inducing endothelial cell migration at low concentrations and endothelian cell apoptosis at high concentrations (By similarity). Induces maturation of dendritic cells and monocyte cell adhesion (PubMed:18292511). Modulates endothelial cell responses by degrading HIF-1A through interaction with PSMA7 (By similarity).
subunit: Homodimer. Part of the multisynthetase complex (MSC), a multisubunit complex that groups tRNA ligases for Arg (RARS1), Asp (DARS1), Gln (QARS1), Ile (IARS1), Leu (LARS1), Lys (KARS1), Met (MARS1) the bifunctional ligase for Glu and Pro (EPRS1) and the auxiliary subunits AIMP1/p43, AIMP2/p38 and EEF1E1/p18 (PubMed:12060739). Interacts (via N-terminus) with RARS1 (via N- terminus). Part of a complex composed of RARS1, QARS1 and AIMP1. Interacts (via C-terminus) with SMURF2 (PubMed:18448069). Interacts (via N-terminus) with HSP90B1/gp96 (via C-terminus) (PubMed:17525271). Interacts with PSMA7 (By similarity). Interacts with TARS3.
disruption phenotype: Increased Hsp90b1 surface expression, dendritic cell hyperactivation and development of lupus-like autoimmune phenotypes (PubMed:17525271). Retarded growth after birth, reduced food intake, reduced plasma levels of glucose, free fatty acid, glucagon and insulin, increased glycogen content in the liver, and rapid decrease in blood glucose concentration upon fasting (PubMed:17001013).
Comparative proteomic analysis of exosomes derived from endothelial cells and Schwann cells.
Wang, PloS one 2023
- “...phosphodiesterase beta-1 Q8R3B1 PLCD1 1-phosphatidylinositol 4,5-bisphosphate phosphodiesterase delta-1 Q9QUH0 GLRX Glutaredoxin-1 Q62443 NPTX1 Neuronal pentraxin-1 P31230 AIMP1 Aminoacyl tRNA synthase complex-interacting multifunctional protein 1 Q64455 PTPRJ Receptor-type tyrosine-protein phosphatase eta Q8VE98 CD276 CD276 antigen P11103 PARP1 Poly [ADP-ribose] polymerase 1 P58022 LOXL2 Lysyl oxidase homolog 2...”
Effects of Hyperoxia and Hyperoxic Oscillations on the Proteome of Murine Lung Microvascular Endothelium
Tiboldi, Antioxidants (Basel, Switzerland) 2022
- “...MOUSE CTTNBP2 N-terminal-like protein Q64521 Gpd2 0.00564 1 . 009 80,954.5 MOUSE Glycerol-3-phosphate dehydrogenase, mitochondrial P31230 Aimp1 0.00542 1 . 036 33,997.6 MOUSE Aminoacyl tRNA synthase complex-interacting multifunctional protein 1 Q05816 Fabp5 0.00502 1 . 064 15,137.6 MOUSE Fatty acid-binding protein, epidermal P97314 Csrp2 0.02217 1...”
Host proteome correlates of vaccine-mediated enhanced disease in a mouse model of respiratory syncytial virus infection.
van, Journal of virology 2015
Tandem mass spectrometry identifies many mouse brain O-GlcNAcylated proteins including EGF domain-specific O-GlcNAc transferase targets.
Alfaro, Proceedings of the National Academy of Sciences of the United States of America 2012
Comparative analyses of differentially induced T-cell receptor-mediated phosphorylation pathways in T lymphoma cells.
Ortiz, Experimental biology and medicine (Maywood, N.J.) 2010
- “...than Z/ZAP cells after phosphotyrosine immunoprecipitation. * Symbol UniProtKB/Swiss-Prot Entrez Gene Name Activity p-value AIMP1 P31230 aminoacyl tRNA synthetase complex-interacting multifunctional signal transduction <1.00E-14 ARAP1 Q4LDD4 ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1 vesicle/trafficking <1.00E-14 ARHGEF2 Q60875 rho/rac guanine nucleotide exchange factor (GEF)...”
A statistics-based platform for quantitative N-terminome analysis and identification of protease cleavage products.
auf, Molecular & cellular proteomics : MCP 2010
- “...initiator methionine ( Fig. 5 , A and B ). Although the corresponding Swiss-Prot entry (P31230) lacks this information, it was also predicted by the TermiNator algorithm ( 58 ) with 83% confidence. Importantly, the TAILS negative selection strategy allows the identification of acetylated N-termini that...”

NP_446209 aminoacyl tRNA synthase complex-interacting multifunctional protein 1 from Rattus norvegicus
33% identity, 14% coverage

Endothelial-monocyte-activating polypeptide II induces rat C6 glioma cell apoptosis via the mitochondrial pathway.
Liu, Biochemical and biophysical research communications 2015 (PubMed)
- GeneRIF: EMAP2 decreases cell viability of rat C6 glioma cells. EMAP2 induces rat C6 glioma cells apoptosis via the mitochondrial pathway.
Mechanisms for endothelial monocyte-activating polypeptide-II-induced opening of the blood-tumor barrier.
Li, Journal of molecular neuroscience : MN 2012 (PubMed)
- GeneRIF: EMAP-II increases permeability through alpha-ATP synthase on the surface of brain microvascular endothelial cells.
Endothelial-monocyte activating polypeptide II disrupts alveolar epithelial type II to type I cell transdifferentiation.
Chen, Respiratory research 2012
- GeneRIF: The findings demonstrate that small inducible cytokine subfamily E member 1 interferes with alveolar cell transdifferentiation resulting in a proliferating non-myofibroblast cell.
Signal mechanisms underlying low-dose endothelial monocyte-activating polypeptide-II-induced opening of the blood-tumor barrier.
Li, Journal of molecular neuroscience : MN 2012 (PubMed)
- GeneRIF: EMAP-II induces blood tumor barrier opening via the RhoA/Rho kinase/PKC-alpha/beta signaling pathways, however, PKC-zeta is involved in this process by other mechanisms.
Endothelial-monocyte-activating polypeptide II increases blood-tumor barrier permeability by down-regulating the expression levels of tight junction associated proteins.
Xie, Brain research 2010 (PubMed)
- GeneRIF: This study demonstrates for the first time that EMAP II increases the permeability of blood-tumor barrier selectively, and the possible mechanism is associated with the down-regulation of ZO-1, occludin and claudin-5.
Expression of endothelial monocyte-activating polypeptide II in the rat dental follicle and its potential role in tooth eruption.
Liu, European journal of oral sciences 2008
- GeneRIF: chemotactic molecule in the dental follicle involved in the recruitment of mononuclear cells directly and indirectly by enhancing the expression of other chemotactic molecules (colony-stimulating factor-1 and monocyte chemoattractant protein-1).
Expression and function of endothelial monocyte-activating polypeptide-II in acute lung inflammation.
Journeay, Inflammation research : official journal of the European Histamine Research Society ... [et al.] 2007 (PubMed)
- GeneRIF: EMAP-II expression is increased in LPS-induced acute lung inflammation, and that intra-tracheal instillation of mature EMAP-II induces recruitment of monocytes/macrophages and granulocytes into the lungs without stimulating IL-1beta or MIP-2 expression.
Potential role for antiangiogenic proteins in the myocardial infarction repair process.
Thompson, The Journal of surgical research 2004 (PubMed)
- GeneRIF: Temporospatial distribution of antiangiogenic protein EMAP II. Negative vascular modulators may have function in revascularization process following acute myocardial infarction.
More

AIMP1_HUMAN / Q12904 Aminoacyl tRNA synthase complex-interacting multifunctional protein 1; Multisynthase complex auxiliary component p43 from Homo sapiens (Human) (see 14 papers)
NP_001135887 aminoacyl tRNA synthase complex-interacting multifunctional protein 1 precursor from Homo sapiens
33% identity, 15% coverage

function: Non-catalytic component of the multisynthase complex. Stimulates the catalytic activity of cytoplasmic arginyl-tRNA synthase (PubMed:10358004). Binds tRNA. Possesses inflammatory cytokine activity (PubMed:11306575). Negatively regulates TGF-beta signaling through stabilization of SMURF2 by binding to SMURF2 and inhibiting its SMAD7- mediated degradation (By similarity). Involved in glucose homeostasis through induction of glucagon secretion at low glucose levels (By similarity). Promotes dermal fibroblast proliferation and wound repair (PubMed:16472771). Regulates KDELR1-mediated retention of HSP90B1/gp96 in the endoplasmic reticulum (By similarity). Plays a role in angiogenesis by inducing endothelial cell migration at low concentrations and endothelian cell apoptosis at high concentrations (PubMed:12237313). Induces maturation of dendritic cells and monocyte cell adhesion (PubMed:11818442). Modulates endothelial cell responses by degrading HIF-1A through interaction with PSMA7 (PubMed:19362550).
subunit: Homodimer. Part of the multisynthetase complex (MSC), a multisubunit complex that groups tRNA ligases for Arg (RARS1), Asp (DARS1), Gln (QARS1), Ile (IARS1), Leu (LARS1), Lys (KARS1), Met (MARS1) the bifunctional ligase for Glu and Pro (EPRS1) and the auxiliary subunits AIMP1/p43, AIMP2/p38 and EEF1E1/p18 (PubMed:19131329, PubMed:19289464, PubMed:24312579). Interacts (via N- terminus) with RARS1 (via N-terminus) (PubMed:10358004, PubMed:17443684). Part of a complex composed of RARS1, QARS1 and AIMP1 (PubMed:25288775). Interacts (via C-terminus) with SMURF2. Interacts (via N-terminus) with HSP90B1/gp96 (via C-terminus) (By similarity). Interacts with PSMA7 (PubMed:19362550). Interacts with TARS3 (PubMed:24312579).
Investigating the Antifibrotic Effects of β-Citronellol on a TGF-β1-Stimulated LX-2 Hepatic Stellate Cell Model
Buakaew, Biomolecules 2024
- “...3.05 2.29 Q16537 PPP2R5E Serine/threonine-protein phosphatase 2A 56 kDa regulatory subunit epsilon isoform 3.04 1.57 Q12904 AIMP1 Aminoacyl tRNA synthase complex-interacting multifunctional protein 1 2.87 2.98 O00139 KIF2A Kinesin-like protein KIF2A 2.85 2.80 Q16186 ADRM1 Proteasomal ubiquitin receptor ADRM1 2.80 2.24 P24844 MYL9 Myosin regulatory light...”
In Vitro Investigation of the Anti-Fibrotic Effects of 1-Phenyl-2-Pentanol, Identified from Moringa oleifera Lam., on Hepatic Stellate Cells
Buakaew, International journal of molecular sciences 2024
- “...Fold Change log10 p -Value Top 10 upregulated proteins O15355 PPM1G Protein phosphatase 4.30 4.29 Q12904 AIMP1 Aminoacyl tRNA synthase complex-interacting multifunctional protein 1 2.95 3.16 Q16537 PPP2R5E Serine/threonine-protein phosphatase 2A 56 kDa regulatory subunit epsilon isoform 2.86 1.42 Q16186 ADRM1 Proteasomal ubiquitin receptor ADRM1 2.84...”
Generation of a new therapeutic D-peptide that induces the differentiation of acute myeloid leukemia cells through A TLR-2 signaling pathway
Yu, Cell death discovery 2024
- “...U OS=Homo sapiens GN=HNRNPU PE=1 SV=6 Q12846 374 34273 Syntaxin-4 OS=Homo sapiens GN=STX4 PE=1 SV=2 Q12904 712 34616 Aminoacyl tRNA synthase complex-interacting multifunctional protein 1 OS=Homo sapiens GN=AIMP1 PE=1 SV=2 Q12907 793 40545 Vesicular integral-membrane protein VIP36 OS=Homo sapiens GN=LMAN2 PE=1 SV=1 Q13641 161 46573 Trophoblast...”
Comparative transcriptome of normal and cancer-associated fibroblasts.
Abikar, BMC cancer 2024
- “...Q9NZI8 protein NONHSAG006038 LINC01515 A1CF Q9NQ94 protein NONHSAG006038 LINC01515 A1CF Q9NQ94 protein NONHSAG006038 LINC01515 AIMP1 Q12904 protein NONHSAG006038 LINC01515 EXOSC10 Q01780 protein NONHSAG006038 LINC01515 FUBP1 Q96AE4 protein NONHSAG006038 LINC01515 FUBP1 Q96AE4 protein NONHSAG006038 LINC01515 KHDRBS2 Q5VWX1 protein NONHSAG006038 LINC01515 KHDRBS2 Q5VWX1 protein NONHSAG006038 LINC01515 METTL1 Q9UBP6...”
N-terminal proteoforms may engage in different protein complexes
Bogaert, Life science alliance 2023
- “...that were selected for interactome analysis. Protein Gene Proteoform Lost or gained domains and motifs Q12904 Aminoacyl-tRNA synthetase complexinteracting multifunctional protein 1 Length: 312 AA AIMP1 Known UniProt isoform Q12904-2; N-terminal extension of 24 AA Gain of three linear motifs according to ELM: binding motif for...”
In-depth proteomics characterization of ∆Np73 effectors identifies key proteins with diagnostic potential implicated in lymphangiogenesis, vasculogenesis and metastasis in colorectal cancer.
Garranzo-Asensio, Molecular oncology 2022
- “...type 4 P61073 0.59 Exosome Y EMAPII (AIMP1) Aminoacyl tRNA synthase complexinteracting multifunctional protein 1 Q12904 0.43 Extracellular space Y AR Amphiregulin P15514 0.37 Extracellular space Y S1PR1 (EDG1) Sphingosine 1phosphate receptor 1 P21453 0.41 N IL36R (IL1Rrp2) Interleukin1 receptorlike 2 Q9HB29 0.34 N Secretome SILAC...”
Extracellular Vesicles Secreted by Corneal Epithelial Cells Promote Myofibroblast Differentiation.
McKay, Cells 2020
- “...Alanine-tRNA ligase P49588 1.0 10 5 ( 2.0 10 4 ) Aminoacyl tRNA synthase complex Q12904 2.2 10 4 ( 3.4 10 3 ) Asparagine-tRNA ligase O43776 1.6 10 4 ( 4.1 10 3 ) Aspartate-tRNA ligase P14868 5.9 10 3 ( 8.8 10 2 )...”
Inverse changes in plasma tetranectin and titin levels in patients with type 2 diabetes mellitus: a potential predictor of acute myocardial infarction?
Rahim, Acta pharmacologica Sinica 2018
- “...45.37 530 31 19 22 1060 45 40 23 * Aa tRNA synthase P1 ** Q12904 8.61 34.62 37 4 18 24 * Caspase-6 P55212 6.46 33.86 34 6 15 25 Serotransferrin P02787 6.81 79.28 188 21 9 26 Tetranectin P05452 5.52 22.95 70 7 28...”
More
Endothelin-1 gene polymorphism (G8002A) and endothelial monocyte-activating polypeptide II: Role in vascular dysfunction in pediatric patients with β-thalassemia major.
Tantawy, Cytokine 2023 (PubMed)
- GeneRIF: Endothelin-1 gene polymorphism (G8002A) and endothelial monocyte-activating polypeptide II: Role in vascular dysfunction in pediatric patients with beta-thalassemia major.
Secreted aminoacyl-tRNA synthetase-interacting multifunctional protein-1 (AIMP1) is a promising predictor for the severity of acute AQP4-IgG positive neuromyelitis optica spectrum disorder.
Yuan, Multiple sclerosis and related disorders 2023 (PubMed)
- GeneRIF: Secreted aminoacyl-tRNA synthetase-interacting multifunctional protein-1 (AIMP1) is a promising predictor for the severity of acute AQP4-IgG positive neuromyelitis optica spectrum disorder.
Clinical powers of Aminoacyl tRNA Synthetase Complex Interacting Multifunctional Protein 1 (AIMP1) for head-neck squamous cell carcinoma.
Li, Cancer biomarkers : section A of Disease markers 2022 (PubMed)
- GeneRIF: Clinical powers of Aminoacyl tRNA Synthetase Complex Interacting Multifunctional Protein 1 (AIMP1) for head-neck squamous cell carcinoma.
Discovery of two distinct aminoacyl-tRNA synthetase complexes anchored to the Plasmodium surface tRNA import protein.
Jaramillo, The Journal of biological chemistry 2022
- GeneRIF: Discovery of two distinct aminoacyl-tRNA synthetase complexes anchored to the Plasmodium surface tRNA import protein.
AIMP1 promotes multiple myeloma malignancy through interacting with ANP32A to mediate histone H3 acetylation.
Wei, Cancer communications (London, England) 2022
- GeneRIF: AIMP1 promotes multiple myeloma malignancy through interacting with ANP32A to mediate histone H3 acetylation.
EMAP II Expression Is Increased on Peripheral Blood Cells from Non-Hodgkin Lymphoma.
Saber, Journal of immunology research 2022
- GeneRIF: EMAP II Expression Is Increased on Peripheral Blood Cells from Non-Hodgkin Lymphoma.
Novel Homozygous Mutation of the AIMP1 Gene: A Milder Neuroimaging Phenotype With Preservation of the Deep White Matter.
BoAli, Pediatric neurology 2019 (PubMed)
- GeneRIF: This novel homozygous mutation of the AIMP1 gene is characterized by preserved development of the periventricular and deep white matter structures as demonstrated by MRI and MR spectroscopy correlation.
Serum Aminoacyl-tRNA Synthetase-Interacting Multifunctional Protein-1 Can Predict Severe Antineutrophil Cytoplasmic Antibody-Associated Vasculitis: A Pilot Monocentric Study.
Ahn, BioMed research international 2019
- GeneRIF: The results from our study suggest that serum AIMP1 can be used to estimate the cross-sectional severe antineutrophil cytoplasmic antibody (ANCA)-associated vasculitis (AAV) population based on the Birmingham vasculitis activity score.
More

PBANKA_1306200 tRNA import protein tRIP from Plasmodium berghei ANKA
30% identity, 15% coverage

Solution X-ray scattering highlights discrepancies in Plasmodium multi-aminoacyl-tRNA synthetase complexes
Jaramillo, Protein science : a publication of the Protein Society 2023
- “...in Plasmodium homeostasis. 4 MATERIALS AND METHODS 4.1 Bioinformatic analysis Sequences of Plasmodium berghei tRip (PBANKA_1306200), ERS (PBANKA_1362000), QRS (PBANKA_1346600), and MRS (PBANKA_0518700) were used for reference. Multiple sequence alignments were performed using TCoffee. (Magis et al., 2014 ) Detection of structural and functional domains was...”

LSEI_1280 Isoleucyl-tRNA synthetase from Lactobacillus casei ATCC 334
39% identity, 6% coverage

Physiological and transcriptional response of Lactobacillus casei ATCC 334 to acid stress
Broadbent, Journal of bacteriology 2010
- “...LSEI_0977 LSEI_1057 LSEI_1058 LSEI_1292 LSEI_1579 LSEI_1280 LSEI_1485 LSEI_1703 LSEI_0883 LSEI_2569 LSEI_1697 LSEI_1642 LSEI_1641 LSEI_1640 LSEI_1644 LSEI_1645...”

D0R4S3 Isoleucine--tRNA ligase from Lactobacillus johnsonii (strain FI9785)
37% identity, 8% coverage

Identification of Genes Required for Glucan Exopolysaccharide Production in Lactobacillus johnsonii Suggests a Novel Biosynthesis Mechanism
Mayer, Applied and environmental microbiology 2020
- “...44 0.89 1.85 0.54 X DNA repair; DNA recombination; cellular response to DNA damage stimulus D0R4S3 Isoleucine-tRNA ligase ileS 16 107 100 0.81 1.75 0.57 X Translation; tRNA aminoacylation for protein translation; isoleucyl tRNA aminoacylation; aminoacyl-tRNA metabolism involved in translational fidelity D0R1L4 30S ribosomal protein S5...”

T285_RS05640 isoleucine--tRNA ligase from Lactobacillus johnsonii N6.2
37% identity, 8% coverage

Identification of Biomarkers for Systemic Distribution of Nanovesicles From Lactobacillus johnsonii N6.2
Harrison, Frontiers in immunology 2021
- “...protein 15.67 3.26 5.10 1.31 0.009 T285_RS05565 GTP-binding protein TypA 26.82 0.66 10.97 7.87 0.036 T285_RS05640 IsoleucinetRNA ligase 17.34 5.89 0.75 0.0004 0.020 T285_RS05935 Glucose-6-phosphate isomerase 25.94 12.35 1.12 0.53 0.037 T285_RS06185 Triosephosphate isomerase 18.36 8.51 3.36 0.53 0.046 T285_RS06195 Glyceraldehyde-3-phosphate dehydrogenase 98.35 15.73 15.67 2.69...”

lp_2187 isoleucine--tRNA ligase from Lactobacillus plantarum WCFS1
41% identity, 7% coverage

Spatial and temporal expression of Lactobacillus plantarum genes in the gastrointestinal tracts of mice
Marco, Applied and environmental microbiology 2007
- “...lp_3662 lp_0006 lp_0537 lp_0727 lp_1021 lp_1027 lp_1144 lp_1898 lp_2187 lp_2301 General Locus taga TABLE 1. Gene targets and primers 126 APPL. ENVIRON....”

SYLM_YEAST / P11325 Leucine--tRNA ligase, mitochondrial; Leucyl-tRNA synthetase; LeuRS; EC 6.1.1.4 from Saccharomyces cerevisiae (strain ATCC 204508 / S288c) (Baker's yeast) (see 2 papers)
YLR382C Mitochondrial leucyl-tRNA synthetase, also has a direct role in splicing of several mitochondrial group I introns; indirectly required for mitochondrial genome maintenance from Saccharomyces cerevisiae
NP_013486 leucine--tRNA ligase NAM2 from Saccharomyces cerevisiae S288C
24% identity, 22% coverage

function: Catalyzes the attachment of leucine to tRNA(Leu) in the mitochondrion.
catalytic activity: tRNA(Leu) + L-leucine + ATP = L-leucyl-tRNA(Leu) + AMP + diphosphate (RHEA:11688)
Systematic analysis of nuclear gene function in respiratory growth and expression of the mitochondrial genome in S. cerevisiae
Stenger, Microbial cell (Graz, Austria) 2020
- “...MRPL24 YMR193W MTG1 YMR097C CBS1 YDL069C MRPL25 YGR076C MTG2 YHR168W CBS2 YDR197W MRPL27 YBR282W NAM2 YLR382C CCM1 YGR150C MRPL31 YKL138C PET111 YMR257C DIA4 YHR011W MRPL32 YCR003W PET112 YBL080C GEP3 YOR205C MRPL33 YMR286W PET122 YER153C GEP5 YLR091W MRPL36 YBR122C PET123 YOR158W HER2 YMR293C MRPL37 YBR268W PET309 YLR067C...”
Localization and RNA Binding of Mitochondrial Aminoacyl tRNA Synthetases
Garin, Genes 2020
- “...(59) Yes Partial No No IleRS YPL040C (ISM1) Yes (66) Yes Partial No NA LeuRS YLR382C (NAM2) Yes (48.5) Yes Partial No No LysRS YNL073W (MSK1) Yes (36.7) Yes Partial No No MetRS YGR171C (MSM1) Yes (63.4) Yes Partial No NA PheRS YPR047W (MSF1) Yes (93.4)...”
The role of PCNA as a scaffold protein in cellular signaling is functionally conserved between yeast and humans
Olaisen, FEBS open bio 2018
- “...YHL030W Ecm29 Proteasome component Ecm9 14, 16, 42 YLR045C Stu2 Protein Stu2 10, 16, 42 YLR382C Nam2 LeucinetRNA ligase 11, 12, 16 YOL008W Coq10 Coenzyme Qbinding protein Coq10 2, 14, 16 YPR119W Clb2 G2/mitoticspecific cyclin2 10, 18, 43 YBL004W Utp20 U3 small nucleolar RNAassociated protein 20...”
The protein transportation pathway from Golgi to vacuoles via endosomes plays a role in enhancement of methylmercury toxicity
Hwang, Scientific reports 2014
- “...1.33 Transcription ACE2 YLR131C Transcription factor 1.44 MET31 YPL038W Sulphur amino acid metabolism 1.18 NAM2 YLR382C Leucyl-tRNA synthetase 1.42 RPD3 YNL330C Histone deacetylase 1.14 RRP8 YDR083W rRNA processing 1.17 TRM1 YDR120C tRNA methyltransferase 1.16 Vacuoles and SNF8 YPL002C Component of the ESCRT-II complex 1.31 vesicular transport...”
Identification of gold nanoparticle-resistant mutants of Saccharomyces cerevisiae suggests a role for respiratory metabolism in mediating toxicity
Smith, Applied and environmental microbiology 2013
- “...YGR207c CIR1 (4) YHR006w STP2 (6) YJL129c TRK1 (1) YLR382c NAM2 (6) YLR439w MRPL4 (1) YMR072w ABF2 (1) YMR155w YMR173w (1) DDR48 (1) YMR192w GYL1 (1) YMR223w...”
- “...238 genes (5.0) 3.83 105 YBR268w, YCR046c, YGR150c, YLR382c, YLR439w, YMR072w, YPL183w-A, YPR100w 6 genes (35.3) 254 genes (5.3) 0.00248 5 genes (29.4) 177...”
The thioredoxin system protects ribosomes against stress-induced aggregation
Rand, Molecular biology of the cell 2006
- “...YPL254W YBR112C YPL127C YER068W YPR072W YBL093C YDR392W YLR382C YHL038C YKR024C YGL136C YGR006W YGL246C YNL236W YDR138W YGL025C DNA-directed RNA polymerase II...”
Ascospore formation in the yeast Saccharomyces cerevisiae
Neiman, Microbiology and molecular biology reviews : MMBR 2005
- “...YLL009c YLL041c YLR069c YLR087c YLR203c YLR368w YLR377c YLR382c YML061c YML081c-a YML120c YMR030w YMR257c YMR267w YMR280c YMR282c YMR286w YMR287c YNL052w AUT7...”
Self-protective responses to norvaline-induced stress in a leucyl-tRNA synthetase editing-deficient yeast strain.
Ji, Nucleic acids research 2017
- GeneRIF: Self-protective responses to norvaline-induced stress in a leucyl-tRNA synthetase editing-deficient yeast strain has been reported.
Leucyl-tRNA synthetase-dependent and -independent activation of a group I intron.
Boniecki, The Journal of biological chemistry 2009
- GeneRIF: Data show that the activity of the minimized bI4 intron was enhanced in vitro by the presence of the bI4 maturase or LeuRS.
A viable amino acid editing activity in the leucyl-tRNA synthetase CP1-splicing domain is not required in the yeast mitochondria.
Karkhanis, The Journal of biological chemistry 2006 (PubMed)
- GeneRIF: yeast mitochondria have evolved to tolerate lower levels of fidelity in protein synthesis or have developed alternate mechanisms to enhance discrimination of leucine from non-cognate amino acids that can be misactivated by leucyl-tRNA synthetase

SERP0758 isoleucyl-tRNA synthetase from Staphylococcus epidermidis RP62A
28% identity, 18% coverage

Concentration-Dependent Global Quantitative Proteome Response of Staphylococcus epidermidis RP62A Biofilms to Subinhibitory Tigecycline
Sung, Cells 2022
- “...protein 3 0.00 1000.00 1000.00 SERP0311 SERP0311 fig|176279.9.peg.295 GM Antimicrobial peptide sensor 1000.00 1000.00 1.15 SERP0758 ileS fig|176279.9.peg.737 J Isoleucine--tRNA ligase 0.00 0.00 1000.00 SERP0518 dltA fig|176279.9.peg.496 Q D-alanine--D-alanyl carrier protein ligase 0.00 1000.00 0.00 SERP0520 dltC fig|176279.9.peg.498 IQ D-alanyl carrier protein 1000.00 106.80 1.94 SERP1194...”
- “...synthase 0.00 1000.00 1000.00 SERP0721 pheS fig|176279.9.peg.700 J Phenylalanine--tRNA ligase alpha subunit 1000.00 1000.00 13.26 SERP0758 ileS fig|176279.9.peg.737 J Isoleucine--tRNA ligase 0.00 0.00 1000.00 SERP0776 gmk fig|176279.9.peg.754 F Guanylate kinase 0.00 0.00 1000.00 SERP0796 fabD fig|176279.9.peg.774 I Malonyl CoA-acyl carrier protein transacylase 1000.00 1.14 3.27 SERP0804...”

SYYC_HUMAN / P54577 Tyrosine--tRNA ligase, cytoplasmic; Tyrosyl-tRNA synthetase; TyrRS; EC 6.1.1.1 from Homo sapiens (Human) (see 10 papers)
34% identity, 15% coverage

function: Tyrosine--tRNA ligase that catalyzes the attachment of tyrosine to tRNA(Tyr) in a two-step reaction: tyrosine is first activated by ATP to form Tyr-AMP and then transferred to the acceptor end of tRNA(Tyr) (Probable) (PubMed:25533949). Also acts as a positive regulator of poly-ADP-ribosylation in the nucleus, independently of its tyrosine--tRNA ligase activity (PubMed:25533949). Activity is switched upon resveratrol-binding: resveratrol strongly inhibits the tyrosine-- tRNA ligase activity and promotes relocalization to the nucleus, where YARS1 specifically stimulates the poly-ADP-ribosyltransferase activity of PARP1 (PubMed:25533949).
catalytic activity: tRNA(Tyr) + L-tyrosine + ATP = L-tyrosyl-tRNA(Tyr) + AMP + diphosphate + H(+) (RHEA:10220)
subunit: Homodimer (PubMed:12427973, PubMed:14671330, PubMed:30304524). Interacts (when binding to resveratrol) with PARP1; interaction stimulates the poly-ADP-ribosyltransferase activity of PARP1 (PubMed:25533949).
Effective Components of Panax notoginseng-Salvia miltiorrhiza in the Treatment of Melasma and Its Experimental Study
Wei, ACS omega 2025
- “...UniProt ID 160254 Cryptotanshinone PGR 10.3 1A28 P06401 6451084 Salvianolic acid B TYR 9.992 4QBT P54577 14609851 4-Methylenemiltirone ESR1 9.817 1X7R P03372 80970 Methylrosmarinate ESR1 9.761 5TMU P03372 44425166 Isotanshinone II ESR1 9.735 5DTV P03372 5320066 Neocryptotanshinone ii ESR1 9.679 4IV2 P03372 5319836 Miltionone II PGR...”
Proteomic Analysis Reveals Cadherin, Actin, and Focal Adhesion Molecule-Mediated Formation of Cervical Cancer Spheroids
Molika, Cells 2024
- “...FC > 1 and p < 0.05. No. Protein_Name Protein_Id logFC p -Value 1 SYYC P54577 3.051 0.007 2 CDK5 Q00535 2.831 0.021 3 PTMA P06454 2.730 0.042 4 MGST1 P10620 2.692 0.008 5 1433S P31947 2.685 0.004 6 NQO1 P15559 2.567 0.016 7 PZP P20742...”
Ion Mobility-Based Enrichment-Free N-Terminomics Analysis Reveals Novel Legumain Substrates in Murine Spleen.
Ziegler, Molecular & cellular proteomics : MCP 2024
- “...accession: O00754 ), lamina-associated polypeptide 2 (Uniprot accession: P42167 ), and tyrosyl-tRNA synthetase (Uniprot accession: P54577 ) with common contaminants and a reverse decoy database added by MSFragger (Fragpipe v.18.0) (242 entries including 121 decoys). Identification and quantification of peptides occurred as described above. Invitro cleavage...”
In Silico Exploration of Metabolically Active Peptides as Potential Therapeutic Agents against Amyotrophic Lateral Sclerosis
Fatoki, International journal of molecular sciences 2023
- “...(by homology) (FPR2, P25090). O: NAD-dependent deacetylase sirtuin 1 (SIRT1/SIRT2, Q96EB6/Q8IXJ6). P: tyrosyl-tRNA synthetase (YARS, P54577). Q: endothelin receptor ET-A/ET-B (EDNRA/EDNRB, P25101/P24530). R : neurokinin 1 receptor (TACR1, P25103). S: cholecystokinin B receptor (CCKBR, P32239). T: HMG-CoA reductase (HMGCR, P04035). U: calcitonin gene-related peptide type 1...”
The Proteome Profile of Olfactory Ecto-Mesenchymal Stem Cells-Derived from Patients with Familial Alzheimer's Disease Reveals New Insights for AD Study
Rochín-Hernández, International journal of molecular sciences 2023
- “...FCHO1 F-BAR domain only protein 1 1.5595 10 5 Q8IWT3 CUL9 Cullin-9 2.1129 10 5 P54577 YARS Tyrosine--tRNA ligase_ cytoplasmic 3.6024 10 5 Q9Y5L4 TIMM13 Mitochondrial import inner membrane translocase subunit Tim13 0.0020643 Q9Y2E4 DIP2C Disco-interacting protein 2 homolog C 0.00959067 ijms-24-12606-t002_Table 2 Table 2 Top...”
Licorice extract inhibits growth of non-small cell lung cancer by down-regulating CDK4-Cyclin D1 complex and increasing CD8⁺ T cell infiltration
Zhu, Cancer cell international 2021
- “...P31639 Sodium/glucose cotransporter 2 SLC5A2 1 Homo sapiens P53396 ATP-citrate synthase ACLY 1 Homo sapiens P54577 TyrosinetRNA ligase, cytoplasmic YARS 1 Homo sapiens O75907 Diacylglycerol O-acyltransferase 1 DGAT1 3 Homo sapiens P14222 Perforin-1 PRF1 1 Homo sapiens P51684 CC chemokine receptor type 6 CCR6 2 Homo...”
Identification of Proteins Deregulated by Platinum-Based Chemotherapy as Novel Biomarkers and Therapeutic Targets in Non-Small Cell Lung Cancer.
Ryan, Frontiers in oncology 2021
- “...with 230 interactors RPL27A P46776 N/A 0.999986776 N/A N/A 517 interactions with 259 interactors YARS P54577 1N3L 4Q93 4QBT 5THL 5THH 1NTG 0.99745549 Glutamic acid esters wherein the alcohol moiety is ribose, prolinol or substituted piperidines (see Supplemental Table 3 ) N/A 90 interactions with 53...”
Characterization of Aminobenzylphenols as Protein Disulfide Isomerase Inhibitors in Glioblastoma Cell Lines.
Shergalis, Journal of medicinal chemistry 2020
- “...50.9 P50990 Tcomplex protein 1 subunit theta (CCT8) 10 cytoplasm 56 28 45 28 59.6 P54577 TyrosinetRNA ligase, cytoplasmic (YARS) 6 cytoplasm 60 28 38 28 59.1 O43242 26S proteasome nonATPase regulatory subunit 3 (PSMD3) 2 extracellular, nucleus, cytoplasm 51 24 36 24 60.9 O75083 WD...”
More

NP_776645 tyrosine--tRNA ligase, cytoplasmic from Bos taurus
33% identity, 15% coverage

Conformational flexibility of cytokine-like C-module of tyrosyl-tRNA synthetase monitored by Trp144 intrinsic fluorescence.
Kordysh, Journal of fluorescence 2006 (PubMed)
- GeneRIF: conformational transition of Trp144 from buried native state into highly relaxing polar solvent environment

alr1073 isoleucyl-tRNA synthetase from Nostoc sp. PCC 7120
29% identity, 13% coverage

Proteomic Insights into Starvation of Nitrogen-Replete Cells of Nostoc sp. PCC 7120 under β-N-Methylamino-L-Alanine (BMAA) Treatment
Koksharova, Toxins 2020
- “...RNA polymerase subunit omega [EC:2.7.7.6] asr4648 Promotes RNA polymerase assembly 1.61 0.0073 41 isoleucyl-tRNAsynthetase [EC:6.1.1.5] alr1073 Aminoacyl-tRNA biosynthesis 1.47 0.0313 42 protein S13 all4193 * small subunit ribosomal 0.46 0.0255 43 protein S10 all4336 small subunit ribosomal 0.68 0.0201 Amino Acid Synthesis and Metabolism (10 Proteins)...”

SPy1513 putative isoleucyl-tRNA synthetase from Streptococcus pyogenes M1 GAS
44% identity, 6% coverage

Genome-wide identification of genes required for fitness of group A Streptococcus in human blood
Le, Infection and immunity 2013
- “...University of California, Berkeley Spy1477 Spy1481 Spy1495 Spy1513 Spy1543 Spy1565 Spy1572 Spy1609 Spy1694 Spy1715 Spy1716 Spy1720 Spy1723 Spy1730 Spy1742...”
- “...and biosynthesis (bcaT, artP, pepF, glyA, Spy0596, Spy0829, Spy1513). Individual GAS 5448 mutants with mutations in guaB, acoB, citF, and fruA confirmed the...”
Genome-wide molecular clock and horizontal gene transfer in bacterial evolution
Novichkov, Journal of bacteriology 2004
- “...halodurans, lin2127 of L. innocua, L0350 of L. lactis, SPy1513 of S. pyogenes, SP1659 of S. pneumoniae, FN0067 of F. nucleatum, TM1361 of Thermotoga maritima,...”

SA1036 Ile-tRNA synthetase from Staphylococcus aureus subsp. aureus N315
A6QG93 Isoleucine--tRNA ligase from Staphylococcus aureus (strain Newman)
Q2FHP4 Isoleucine--tRNA ligase from Staphylococcus aureus (strain USA300)
Q2FZ82 Isoleucine--tRNA ligase from Staphylococcus aureus (strain NCTC 8325 / PS 47)
NP_371717 Ile-tRNA synthetase from Staphylococcus aureus subsp. aureus Mu50
SAOUHSC_01159 isoleucyl-tRNA synthetase from Staphylococcus aureus subsp. aureus NCTC 8325
SAUSA300_1087 isoleucyl-tRNA synthetase from Staphylococcus aureus subsp. aureus USA300_FPR3757
USA300HOU_1130 isoleucine--tRNA ligase from Staphylococcus aureus subsp. aureus USA300_TCH1516
SACOL1206 isoleucyl-tRNA synthetase from Staphylococcus aureus subsp. aureus COL
EKM74_RS15105, SAFDA_1063 isoleucine--tRNA ligase from Staphylococcus aureus
28% identity, 18% coverage

Essentiality Assessment of Cysteinyl and Lysyl-tRNA Synthetases of Mycobacterium smegmatis
Ravishankar, PloS one 2016
- “...SP0568 LeuRS MSMEG_6917 Rv0041 ML0032 b0642 HI0921 SA1579 SP0254 IleRS MSMEG_3169 Rv1536 ML1195 b0026 HI1586 SA1036 SP1659 TilS MSMEG_6111 - - b0188 - - - SerRS MSMEG_6413 Rv3834c ML0082 b0893 NI0110 SA0009 SP0411 ThrRS MSMEG_2931 Rv2614c ML0456 b1719 HI1367 SA1506 SP1631 ProRS MSMEG_2621MSMEG_5671 Rv2845c ML1553 b0194...”
The effect of skin fatty acids on Staphylococcus aureus
Neumann, Archives of microbiology 2015
- “...SA1007 Hla Alpha-haemolysin 5.04 539 SA1007 Hla Alpha-haemolysin 4.60 541 SA1007 Hla Alpha-haemolysin 1.92 651 SA1036 IleS Isoleucyl-tRNA synthetase 0.41 132 SA1098 CodY Transcriptional repressor CodY 2.87 617 SA1099 RpsB 30S ribosomal protein S2 0.55 514 SA1100 Tsf Elongation factor Ts 2.23 459 SA1100 Tsf Elongation...”
walK and clpP mutations confer reduced vancomycin susceptibility in Staphylococcus aureus
Shoji, Antimicrobial agents and chemotherapy 2011
- “...SA0448 SA0475 SA0486 SA0488 SA0564 SA0855 SA0985 SA0986 SA1036 SA1106 SA1287 SA1446 SA1456 SA1457 SA1488 SA1506 SA1550 SA1563 SA1579 SA1715 SA1716 SA1717 serS...”
Staphylococcal major autolysin (Atl) is involved in excretion of cytoplasmic proteins
Pasztor, The Journal of biological chemistry 2010
- “...SA1409 SA0505 SA0506 SA0731 SA1927 SA0727 SA1142 SA1836 SA1036 SA1579 SA2400 SA1245 SA0944 SA0945 00505 01683 00529 00530 00799 02366 00795 01278 02254 01159...”
Characterizing the effects of inorganic acid and alkaline shock on the Staphylococcus aureus transcriptome and messenger RNA turnover
Anderson, FEMS immunology and medical microbiology 2010
- “...HAD superfamily hydrolase sa_c368s210_a_at 2.2 2.5 ND SA1000 oligopeptide ABC transporter, sa_c9067s7955_a_at 2.9 2.5 5 SA1036 putative protease sa_c10308s8994_a_at 2.5 2.5 2.5 SA1051 isochorismate synthase family sa_c5349s4625_a_at * 28.6 2.5 ND SA1108 spermidine/putrescine ABC transporter sa_c9028s7925_a_at * 15.0 2.5 ND SA1109 spermidine/putrescine ABC transporter sa_c795s596_a_at *...”
Genome-wide molecular clock and horizontal gene transfer in bacterial evolution
Novichkov, Journal of bacteriology 2004
- “...meliloti, mlr8250 of M. loti, CAC3038 of C. acetobutylicum, SA1036 of S. aureus, BS_ileS of B. subtilis, BH2545 of B. halodurans, lin2127 of L. innocua, L0350...”
Trapping and identification of cellular substrates of the Staphylococcus aureus ClpC chaperone
Graham, Journal of bacteriology 2013
- “...4.0/11.3 0.041 4.5 48 48 22 27 A6QHR2 A6QG93 A6QF61 A6QG38 2.0/1.7 1.0/3.5 31.0/26.6 3.0/3.5 0.0/0.5 0.0/0.0 15.0/13.7 0.0/1.0 0.014 0.106 0.012 0.019 7.6...”
sarA-mediated repression of protease production plays a key role in the pathogenesis of Staphylococcus aureus USA300 isolates
Zielinska, Molecular microbiology 2012
- “...B 15 63 62 Q2FKN3 19 kDa isaB Immunodominant staphylococcal antigen B 6 28 39 Q2FHP4 37 kDa lukD Leukotoxin LukD 3 17 32 Surface Q2FDM1 19 kDa isaB Immunodominant staphylococcal antigen B 24 33 52 Q2FHS2 36 kDa hla Alpha-hemolysin 6 24 48 Q2FGU9 35...”
Isotopically Labeled Desthiobiotin Azide (isoDTB) Tags Enable Global Profiling of the Bacterial Cysteinome
Zanon, Angewandte Chemie (International ed. in English) 2020
- “...4,5dichloro1,2dithiol3one and cerulenin. 21 Furthermore, the residue C323 in the isoleucinetRNA ligase IleS (UniProt code Q2FZ82) is only targeted by another set of three compounds ( EN012 , EN077 and EN201 , Figure 5 b), which could open up the possibility of inhibiting bacterial translation through...”
Blood Serum Affects Polysaccharide Production and Surface Protein Expression in S. Aureus
Islam, Advances in biotechnology & microbiology (Newbury, Calif.) 2017
- “...NP_371067 2.Pyruvate carboxylase (pycA) Carbohydrate metabolism 5_0/128 NP_371638 3.1soleucyl-tRNA synthetase (ileS) Aminio Acid biosynthesis 5.2/104 NP_371717 b6 1. Alanyl-tRNA synthetase RNA synthesis 4.9/93 NP_372142 2. Hypothetical protein (SAV0219) Not known 4.6/37 NP_370743 3.Collagen adhesin precursor (MW2612) Surface Adhesin 5.81132 NP_647429 b7 1 Alpha-keto acid dehydrogenase (pdhc)...”
Designing Single-Atom Active Sites on sp² -Carbon Linked Covalent Organic Frameworks to Induce Bacterial Ferroptosis-Like for Robust Anti-Infection Therapy
Sun, Advanced science (Weinheim, Baden-Wurttemberg, Germany) 2023
- “...Beyond these physiological activities, the expressions of genes associated with oxidoreductase activity (SAOUHSC_00382), protein lipoylation (SAOUHSC_01159), and response to oxidative stress (SAOUHSC_00831) were all upregulated, which is consistent with our previous observations that Ir and Ru SACs will enhance ferroptosislike derived bacterial death through the accumulation...”
Insights into the global effect on Staphylococcus aureus growth arrest by induction of the endoribonuclease MazF toxin
Sierra, Nucleic acids research 2020
- “...of translational Termination [GO:0006449] pheS SAOUHSC_01092 Phenylalanyl-tRNA synthetase subunit alpha [100/UACUUA] Phenylalanyl-tRNA aminoacylation [GO:0006432] ileS SAOUHSC_01159 Isoleucyl-tRNA synthetase [188/UACAUA] n/a rpsP SAOUHSC_01208 30S ribosomal protein S16 [114/UACUUA] Ribosome [GO:0005840] Gid SAOUHSC_01223 tRNA (uracil-5-)-methyltransferase Gid [526/UACUUA] tRNA wobble uridine modification [GO:0002098] infB SAOUHSC_01246 Translation initiation factor IF-2...”
Toward an understanding of the evolution of Staphylococcus aureus strain USA300 during colonization in community households
Uhlemann, Genome biology and evolution 2012
- “...Samples and Mutations in Household 1000 Sample ID Timepoint (months) Person Source SdrC, SAUSA300_0546 IleS, SAUSA300_1087 Zn prot, SAUSA300_1172 Nicotinate PT, SAUSA300_1894 1001 0 4 Clinical Wt I473 P52 G340A 1010 2 4 Buttocks Wt I473 P52 G340 1011 2 5 Nasal Wt I473 P52 G340...”
Protein S-Bacillithiolation Functions in Thiol Protection and Redox Regulation of the Glyceraldehyde-3-Phosphate Dehydrogenase Gap in Staphylococcus aureus Under Hypochlorite Stress
Imber, Antioxidants & redox signaling 2018
- “...0.25 53.99 0.10 USA300HOU_1629 hisS Histidine-tRNA ligase Cys194 B 4.3 24.59 29.40 0.25 53.99 0.10 USA300HOU_1130 ileS Isoleucine-tRNA ligase Cys124 a B 0.9 10.77 23.74 0.18 34.51 0.03 USA300HOU_1732 pheT2 Phenylalanine-tRNA ligase beta subunit Cys126 a B 4.0 18.48 11.13 0.74 29.61 0.01 USA300HOU_1732 pheT2 Phenylalanine-tRNA...”
Global analysis of the Staphylococcus aureus response to mupirocin
Reiss, Antimicrobial agents and chemotherapy 2012
- “...SACOL0742 SACOL0815 SACOL0907 seb SACOL1118 typA SACOL1136 SACOL1206 ileS SACOL1272 codY SACOL1759 SACOL2042 ilvD SACOL2054 sigB SACOL2058 SACOL2131 SACOL2379...”
- “...AhpC AhpC-1 0.21 0.78 1.24 0.17 1.06 SACOL2173 SACOL1206 Asp23 IleS SACOL2050 SACOL2043 IlvA2 IlvB SACOL2045 IlvC SACOL2042 IlvD SACOL2049 LeuD Asp23-4 IleS-2...”
Transcriptomic Analysis Revealed Antimicrobial Mechanisms of Lactobacillus rhamnosus SCB0119 against Escherichia coli and Staphylococcus aureus
Peng, International journal of molecular sciences 2022
- “...; glutamate-tRNA ligase EKM74_RS14775 34.9 14.25 239.53 20.28 2.77887 pheT ; phenylalanine-tRNA ligase subunit beta EKM74_RS15105 30.17 17.78 273.57 29.78 3.180715 ileS ; isoleucine-tRNA ligase Oxidative phosphorylation EKM74_RS04830 170.47 3.15 3033.08 240.81 4.153207183 atpD ; F0-F1 ATP synthase subunit beta EKM74_RS04840 97.18 1.86 1251.21 170.89 3.686521282...”
In Vitro Tolerance of Drug-Naive Staphylococcus aureus Strain FDA209P to Vancomycin
Singh, Antimicrobial agents and chemotherapy 2017
- “...). Two of the three VSV mutants had a single nonsynonymous SNP in the ileS (SAFDA_1063) gene (encoding IleRS). One SNP resulted in a change at residue 196 of IleRS from Ala to Val, and the other resulted in a change at residue 723 from Tyr...”
- “...isoleucyl-tRNA synthetase (IleRS) Y723H into FDA209P by pKOR1 allelic replacement. The replacement of wild-type ileS (SAFDA_1063) in parental strain FDA209P was performed by the pKOR1 allelic replacement method, as described previously ( 46 ). Briefly, a 1.2-kb ileS DNA fragment ( ileS *) from the VSV2...”

Q8NX29 Isoleucine--tRNA ligase from Staphylococcus aureus (strain MW2)
28% identity, 18% coverage

Discovery of Furanoquinone Derivatives as a Novel Class of DNA Polymerase and Gyrase Inhibitors for MRSA Eradication in Cutaneous Infection
Yang, Frontiers in microbiology 2019
- “...(TCA) (acetyl degradation route) and probably the 2-methylcitrate cycle 1 (propionate degradation route). Isoleucyl-tRNA synthetase Q8NX29 97.364 20 94(30%) Catalyzes the attachment of isoleucine to tRNA(lle). 4 Elongation factor G P68791 76.877 25 186(49%) 0.025 0.262 Catalyzes the GTP-dependent ribosomal translocation step during translation elongation. 5...”

SYLM_HUMAN / Q15031 Leucine--tRNA ligase, mitochondrial; Leucyl-tRNA synthetase; LeuRS; EC 6.1.1.4 from Homo sapiens (Human) (see 3 papers)
Q15031 leucine-tRNA ligase (EC 6.1.1.4) from Homo sapiens (see 3 papers)
30% identity, 15% coverage

function: Catalyzes the attachment of leucine to its cognate tRNA.
catalytic activity: tRNA(Leu) + L-leucine + ATP = L-leucyl-tRNA(Leu) + AMP + diphosphate (RHEA:11688)
Mitochondria-derived vesicles and their potential roles in kidney stone disease.
Chaiyarit, Journal of translational medicine 2023
- “...(CysRS) 175 EARS2 Q5JPH6 Probable glutamatetRNA ligase, mitochondrial (EC 6.1.1.17) (Glutamyl-tRNA synthetase) (GluRS) 176 LARS2 Q15031 Probable leucinetRNA ligase, mitochondrial (EC 6.1.1.4) (Leucyl-tRNA synthetase) (LeuRS) 177 PSTPIP2 Q9H939 Proline-serine-threonine phosphatase-interacting protein 2 (PEST phosphatase-interacting protein 2) 178 PSMG4 Q5JS54 Proteasome assembly chaperone 4 (PAC-4) (hPAC4) 179...”
Secretory Carrier Membrane Protein 3 Interacts with 3A Viral Protein of Enterovirus and Participates in Viral Replication.
Lu, Microbiology spectrum 2021
- “...4 4 5 6.48 P52292 KPNA2 Importin subunit alpha-2 57.8 254.1 3 3 6 9.64 Q15031 LARS2 Probable leucyl-tRNA synthetase, mitochondrial 101.9 334.1 9 9 12 11.07 Q9H0V9 LMAN2L VIP36-like protein 39.7 288.4 6 6 11 22.70 Q8NF37 LPCAT1 Lysophosphatidylcholine acyltransferase 1 59.1 209.2 2 2...”
Proteomic Characterization of the Olfactory Molecular Imbalance in Dementia with Lewy Bodies
Lachén-Montes, International journal of molecular sciences 2020
- “...expression-enhancing protein 5 REEP5 Q00765 5 0.7394 8.049 10 9 Probable leucine--tRNA ligase, mitochondrial LARS2 Q15031 2 0.7395 7.1964 10 9 Neutral cholesterol ester hydrolase 1 NCEH1 Q6PIU2 4 0.7407 1.4583 10 9 40S ribosomal protein S2 RPS2 P15880 7 0.7411 1.147 10 8 Glucose 1,6-bisphosphate...”
The G3-U70-independent tRNA recognition by human mitochondrial alanyl-tRNA synthetase.
Zeng, Nucleic acids research 2019
- “...and requirement for editing. Human mitochondrial leucyl-tRNA synthetase (hmtLeuRS, encoded by LARS2 , Uniprot No. Q15031) or phenylalanyl-tRNA synthetase (hmtPheRS, encoded by FARS2 , Uniprot No. O95363)has a degenerate or deleted editing domain, and shows no post-transfer editing activity in vitro ( 3032 ). However, human...”
Pharmacoproteomic analysis reveals that metapristone (RU486 metabolite) intervenes E-cadherin and vimentin to realize cancer metastasis chemoprevention
Yu, Scientific reports 2016
- “...1093 26 F8W930 Insulin-like growth factor 2 mRNA-binding protein 2 13 8.224** 160 169 16 Q15031 Probable leucinetRNA ligase, mitochondrial 5 5.263* 161 2146 44.7 O43175 D-3-phosphoglycerate dehydrogenase 20 5.211* 162 516 22.2 B4E0B1 cDNA FLJ52100 4 3.202* 163 151 20.3 B4DKL4 Lipolysis-stimulated lipoprotein receptor 6...”
First independent replication of the involvement of LARS2 in Perrault syndrome by whole-exome sequencing of an Italian family.
Soldà, Journal of human genetics 2016
- “...using as queries human LARS2 and E. coli LeuRS amino acid sequences (UniProt accession numbers Q15031 and P07813), as described 6 . Briefly, each sequence was aligned by the HHblits algorithm 19 to all possible similar sequences from bacteria, fungi, and protists, producing a consensus sequence...”
Evolutionary and structural annotation of disease-associated mutations in human aminoacyl-tRNA synthetases
Datt, BMC genomics 2014
- “...mutations in human mitochondrial aaRSs aaRS (class) ID (state) Substitution mutation(s) Disease(s)/affected organ LRS (I) Q15031 (Monomer) His324Gln, Thr522Asn, Thr629Met Type-2 Diabetes, premature ovarian failure and hearing loss in Perrault syndrome/ovary and ears ERS (I) Q5JPH6 (Monomer) Arg168Gly, Gly110Ser, Gly204Ser, Glu96Lys, Lys167Tyr, Gly317Cys, Arg55His, Gly224Ser, Arg107His,...”
ERAL1 is associated with mitochondrial ribosome and elimination of ERAL1 leads to mitochondrial dysfunction and growth retardation.
Uchiumi, Nucleic acids research 2010
- “...MW PI Nucleoid type P38646 HSPA9 Stress-70 protein 8 17 73 920 5.87 Class I Q15031 LARS2 Leucyl-tRNA synthetase 4 4 1 02 823 8.46 Q9BW92 TARS2 Threonyl-tRNA synthetase 1 1 81 841 6.9 P31327 CPS1 Carbamoyl-phosphate synthase 8 4 1 65 975 6.30 Class I...”

PAP_09040 valine--tRNA ligase from Palaeococcus pacificus DY20341
23% identity, 16% coverage

Metabolic Adaptation to Sulfur of Hyperthermophilic Palaeococcus pacificus DY20341^T from Deep-Sea Hydrothermal Sediments
Zeng, International journal of molecular sciences 2020
- “...PAP_01540), and the modified EmbdenMeyerhof pathway of Thermococcales archaea including glyceraldehyde-3-phosphate; (2) ferredoxin oxidoreductase (GAPOR, PAP_09040), and non-phosphorylating glyceraldehyde-3-phosphate dehydrogenase (GAPN, PAP_03390). The expression of GAPOR increased under conditions of growth in S 0 (2.11 fold compared to without S 0 ). However, GAPN was evidently...”
- “...(i.e., TRMS medium and TRM medium). Notably, in the second glyceraldehyde-3-phosphate (G3P) metabolism pathway, GAPOR (PAP_09040) was induced by S 0 to generate ferredoxins for membrane hydorgense MBX, which helps in ATP generation. 2.3.2. Utilization of Proteins Thermococcales species can use peptides as their sole carbon...”

1ffyA / P41972 Insights into editing from an ile-tRNA synthetase structure with tRNA(ile) and mupirocin (see paper)
30% identity, 14% coverage

Ligands: rna; zinc ion; mupirocin (1ffyA)

XP_029622221 aminoacyl tRNA synthase complex-interacting multifunctional protein 1-like from Salmo trutta
34% identity, 14% coverage

Influence of Varying Dietary ω6 to ω3 Fatty Acid Ratios on the Hepatic Transcriptome, and Association with Phenotypic Traits (Growth, Somatic Indices, and Tissue Lipid Composition), in Atlantic Salmon (Salmo salar)
Katan, Biology 2021
- “...C103R052 Aminoacyl tRNA synthase complex-interacting multifunctional protein 1 ( p43 ) ( Salmo trutta ) XP_029622221 0 321/326 (98%) BP : inflammatory response, apoptotic process, response to wounding, tRNA aminoacylation for protein translation, defense response to virus, leukocyte migration, angiogenesis, chemotaxis, positive regulation of glucagon secretion....”

LBA0817 isoleucyl-tRNA synthetase from Lactobacillus acidophilus NCFM
32% identity, 10% coverage

Investigating the Effect of Growth Phase on the Surface-Layer Associated Proteome of Lactobacillus acidophilus Using Quantitative Proteomics
Klotz, Frontiers in microbiology 2017
- “...2.53E-06 Other LBA0908 Fumarate reductase flavoprotein 2.74 3.16E-06 Other LBA0233 PyrGCTP synthase 2.76 2.53E-06 Other LBA0817 IleSIsoleucinetRNA ligase 2.78 2.53E-06 Cytoplasm LBA1562 Fhs2Formatetetrahydrofolate ligase 2 2.82 3.57E-06 Other LBA1321 FmtMethionyl-tRNA formyltransferase 2.89 2.76E-05 Other LBA1891 PurBAdenylosuccinate lyase 3.09 2.61E-06 Other LBA0132 TetRPutative transcriptional regulator 3.24 2.53E-06...”
Lactobacillus acidophilus-Rutin Interplay Investigated by Proteomics
Mazzeo, PloS one 2015
- “...transporter ATP-binding protein LBA1045 UP(7.8) multiple sugar-binding ABC-transporter ATPase LBA1645 DOWN(-2.0) TRANSLATION isoleucyl-tRNA synthetase ileS LBA0817 DOWN(-1.8) seryl-tRNA synthetase serS LBA1626 DOWN(-1.8) ribosome recycling factor Rrf LBA1267 UP(2.8) 30S ribosomal protein S1 rpsA LBA0968 UP(2.9) elongation factor G fusA LBA0289 UP(1.6) elongation factor P efp2 LBA1335...”

SYI1_STAAU / P41972 Isoleucine--tRNA ligase; Isoleucyl-tRNA synthetase; IleRS; EC 6.1.1.5 from Staphylococcus aureus (see paper)
30% identity, 14% coverage

function: Catalyzes the attachment of isoleucine to tRNA(Ile). As IleRS can inadvertently accommodate and process structurally similar amino acids such as valine, to avoid such errors it has two additional distinct tRNA(Ile)-dependent editing activities. One activity is designated as 'pretransfer' editing and involves the hydrolysis of activated Val-AMP. The other activity is designated 'posttransfer' editing and involves deacylation of mischarged Val-tRNA(Ile) (By similarity).
catalytic activity: tRNA(Ile) + L-isoleucine + ATP = L-isoleucyl-tRNA(Ile) + AMP + diphosphate (RHEA:11060)
cofactor: Zn(2+) (Binds 1 zinc ion per subunit.)
subunit: Monomer.
Structural Basis for the Antibiotic Resistance of Eukaryotic Isoleucyl-tRNA Synthetase
Chung, Molecules and cells 2020
- “...(P48526), Methanocaldococcus jannaschii (Q58357), Methanothermobacter thermautotrophicus (O27428), Thermus thermophilus (P56690), Escherichia coli (P00956), Staphylococcus aureus (P41972). Strictly conserved and highly conserved residues are highlighted in yellow and pale yellow, respectively. The secondary structure is displayed above the sequence. Every 10th residue is marked with a black...”
Exploring anti-malarial potential of FDA approved drugs: an in silico approach
Ramakrishnan, Malaria journal 2017
- “...similarity, TM-score (cut-off >0.5) Associated drug Sp R T Sc M G PF3D7_0311200 Valine-tRNA ligase P41972 Isoleucine-tRNA ligase Staphylococcus aureus 20 0.82 DB00410: Mupirocin PF3D7_0622800 Leucine-tRNA ligase P41972 Isoleucine-tRNA ligase Staphylococcus aureus 20 0.64 DB00410: Mupirocin PF3D7_0828200 Leucine-tRNA ligase P41972 Isoleucine-tRNA ligase Staphylococcus aureus 20 0.68...”
- “...PF3D7_1005000 Methionine-tRNA ligase P41972 Isoleucine-tRNA ligase Staphylococcus aureus 22 0.97 DB00410: Mupirocin PF3D7_1015200 Cysteine-tRNA ligase P41972 Isoleucine-tRNA ligase Staphylococcus aureus 22 0.80 DB00410: Mupirocin PF3D7_1034900 Methionine-tRNA ligase P41972 Isoleucine-tRNA ligase Staphylococcus aureus 24 0.77 DB00410: Mupirocin PF3D7_1225100 Isoleucine-tRNA ligase P41972 Isoleucine-tRNA ligase Staphylococcus aureus 29 0.97...”
Space-related pharma-motifs for fast search of protein binding motifs and polypharmacological targets
Chiu, BMC genomics 2012
- “...UniProt AC EC number Ligand SCOP CATH Species Gene Name Description RMSD AR SI 1qu3A P41972 6.1.1.5 MRC, ZN a.27.1.1, b.51.1.1, c.26.1.1 1.10.730.10, 3.90.740.10 Staphylococcus aureus ileS Isoleucyl-tRNA synthetase 0 1 100 1ffyA P41972 6.1.1.5 MRC, ZN a.27.1.1, b.51.1.1, c.26.1.1 - Staphylococcus aureus ileS Isoleucyl-tRNA synthetase...”
Generation of dominant selectable markers for resistance to pseudomonic acid by cloning and mutagenesis of the ileS gene from the archaeon Methanosarcina barkeri fusaro
Boccazzi, Journal of bacteriology 2000
- “...(H. sapiens), P09436 (S. cerevisiae), P46213 (T. maritima), P41972 (S. aureus I, genomic copy), P46207 (A. aeolicus), P00956 (E. coli), and P18330 (P....”

I3L804 Tyrosine--tRNA ligase from Sus scrofa
33% identity, 15% coverage

Metabolomics and proteomics insights into hepatic responses of weaned piglets to dietary Spirulina inclusion and lysozyme supplementation
Martins, BMC veterinary research 2024
- “...Reticulon RTN3 1 1 0.0317 -0.3626 F1SPF9 Coatomer subunit gamma COPG1 1 3 0.0159 -0.3604 I3L804 TyrosinetRNA ligase YARS 1 2 0.0212 -0.3574 A0A286ZQ44 Dicarbonyl and L-xylulose reductase DCXR 4 1 0.0361 -0.3556 A0A287AZ17 Hydroxyacylglutathione hydrolase HAGH 1 1 0.0317 -0.3536 Q6RVD5 Fatty acid coenzyme A...”
Label-Free Quantitative Analysis of Pig Liver Proteome after Hepatitis E Virus Infection
Martino, Viruses 2024
- “...LAP3 xaa-Pro dipeptidase 11 48.18 0.0023 2.64 A0A4X1TBE8 GSTM3 glutathione S-transferase 11 49.20 0.0023 1.72 I3L804 YARS1 tyrosine-tRNA ligase, cytoplasmic isoform X1 11 41.54 0.0005 2.35 I3LIM2 UGDH UDP-glucose 6-dehydrogenase 11 45.24 0.0098 1.82 Q02110 HPD 4-hydroxyphenylpyruvate dioxygenase 11 55.49 0.0033 1.65 D2SW95 COPB1 coatomer subunit...”

Q8VDC0 leucine-tRNA ligase (EC 6.1.1.4) from Mus musculus (see paper)
NP_001335096 probable leucine--tRNA ligase, mitochondrial isoform 1 from Mus musculus
28% identity, 15% coverage

Leucine-tRNA-synthase-2-expressing B cells contribute to colorectal cancer immunoevasion.
Wang, Immunity 2022 (PubMed)
- GeneRIF: Leucine-tRNA-synthase-2-expressing B cells contribute to colorectal cancer immunoevasion.

A1S_0020 isoleucyl-tRNA synthetase from Acinetobacter baumannii ATCC 17978
30% identity, 14% coverage

DNA damage response coregulator ddrR affects many cellular pathways and processes in Acinetobacter baumannii 17978
Cook, Frontiers in cellular and infection microbiology 2023
- “...NSD NSD KZA74_18085 A1S_0066 NSD NSD wbpD A1S_0054 NSD NSD murJ A1S_0046 NSD NSD ileS A1S_0020 NSD NSD lspA A1S_0019 NSD NSD KZA74_18340 A1S_0018 upreg NSD KZA74_18375 A1S_r downreg NSD purE A1S_2964 upreg NSD mpl A1S_2966 NSD NSD yidC A1S_2980 upreg NSD yidD A1S_2982 upreg NSD...”

BMMGA3_05760 isoleucine--tRNA ligase from Bacillus methanolicus MGA3
41% identity, 6% coverage

Transcriptome analysis of thermophilic methylotrophic Bacillus methanolicus MGA3 using RNA-sequencing provides detailed insights into its previously uncharted transcriptional landscape
Irla, BMC genomics 2015
- “...aaRS BMMGA3_11920 (T-box)- hisS - aspS Histidine and aspartate aaRS BMMGA3_12305-BMMGA3_12310 (T-box)- ileS Isoleucine aaRS BMMGA3_05760 (T-box)- leuS Leucine aaRS BMMGA3_13510 (T-box)- pheS Phenylalanine aaRS BMMGA3_12925 (PyrR)(T-box)- proI Proline Amino acid biosynthesis BMMGA3_11220 (PyrR)(T-box)- serS Serine aaRS BMMGA3_00090 (T-box)- thrS Threonine aaRS BMMGA3_12975 (T-box)(T-box)- trpE -...”

UMS_00984 isoleucine--tRNA ligase from Enterococcus faecalis EnGen0287
36% identity, 8% coverage

Phage Cocktails Constrain the Growth of Enterococcus
Wandro, mSystems 2022
- “...Bop UDP- N -acetylglucosamine 1-carboxyvinyltransferase 1 UMS_01161 SNP A210T E. faecalis Yi6 Bop Isoleucyl-tRNA synthetase UMS_00984 DEL W31* E. faecalis Yi6 phiV12 30S ribosomal protein S7 UMS_00243 SNP G82D E. faecalis Yi6 phiV12 DNA-directed RNA polymerase subunit alpha UMS_00275 SNP G29V E. faecalis B3286 Bop, phiV12...”

EF1003 isoleucyl-tRNA synthetase from Enterococcus faecalis V583
36% identity, 8% coverage

Integrating highly quantitative proteomics and genome-scale metabolic modeling to study pH adaptation in the human pathogen Enterococcus faecalis
Großeholz, NPJ systems biology and applications 2016
- “...for biosynthesis of particular tRNA molecules, including those for L-alanine (EF1379), glycine (EF2406), L -isoleucine (EF1003) and L -valine (EF2931) and were upregulated ( Figure 4d ). These amino acids are found predominantly in transmembrane segments of membrane proteins. 35 Altogether, this implies a restructuring of...”
Transcriptome analysis of Enterococcus faecalis during mammalian infection shows cells undergo adaptation and exist in a stringent response state
Frank, PloS one 2014
- “...EF0909 oligopeptide ABC superfamily ATP binding cassette transporter, membrane protein EF0988 cell division protein MraZ EF1003 isoleucinetRNA ligase EF1146 DNA-directed RNA polymerase sigma subunit RpoE EF1361 dihydroxyacetone kinase EF1522 RNA polymerase sigma factor rpoD EF1550 DNA-binding protein HU EF1580 hypothetical protein EF1629 ethanolamine ammonia-lyase large subunit...”

Cthe_0787 isoleucyl-tRNA synthetase from Clostridium thermocellum ATCC 27405
27% identity, 20% coverage

Genome-scale metabolic analysis of Clostridium thermocellum for bioethanol production
Roberts, BMC systems biology 2010
- “...hit a E value b 2.7.1.107 diacylglycerol kinase Cthe_3168 hypothetical protein A0R923 7.00E-35 3.2.1.52 Hexosaminidase Cthe_0787 isoleucyl-tRNA synthetase A4N847 0 2.7.7.39 CDP-glycerol pyrophosphorylase Cthe_1276 pantetheine-phosphate adenylyltransferase A1SHB9 3.00E-07 2.7.8.8 phosphatidylserine synthase Cthe_0158 Ribonuclease A9JBA9 1.00E-68 4.1.1.65 phosphatidylserine decarboxylase Cthe_0505 formate acetyltransferase A4NBN7 0 1.3.99.1 succinate dehydrogenase...”

PF3D7_1442300, XP_001348575 tRNA import protein tRIP from Plasmodium falciparum 3D7
30% identity, 15% coverage

Identification of host tRNAs preferentially recognized by the Plasmodium surface protein tRip.
Cela, Nucleic acids research 2021
- GeneRIF: Identification of host tRNAs preferentially recognized by the Plasmodium surface protein tRip.
Apicomplexa-specific tRip facilitates import of exogenous tRNAs into malaria parasites
Bour, Proceedings of the National Academy of Sciences of the United States of America 2016
- “...identified a gene encoding a 402amino-acid Plasmodium protein (PF3D7_1442300 in P. falciparum) with a Trbp111-orthologous domain at its C terminus and an...”
Recent advances in the biology and drug targeting of malaria parasite aminoacyl-tRNA synthetases
Khan, Malaria journal 2016
- “...PF3D7_071770 Threonyl-tRNA synthetase PF3D7_1126000 a PF3D7_1126000 a Other enzymes D tyrosyl-tRNA deacylase PF3D7_1108200 a P43 PF3D7_1442300 Glutamyl-tRNA amidotransferase PF3D7_0416100 (A) PF3D7_0628800 (B) a Indicate genes containing editing activity Fig.2 Cellular distribution of 36 malaria parasite aminoacyl-tRNA synthetases (aaRSs). All 36 aaRSs are encoded by the nuclear...”

F6D7Q0 Leucine--tRNA ligase from Methanobacterium paludis (strain DSM 25820 / JCM 18151 / SWAN1)
25% identity, 16% coverage

An Initial Proteomic Analysis of Biogas-Related Metabolism of Euryarchaeota Consortia in Sediments from the Santiago River, México
Barrera-Rojas, Microorganisms 2023
- “...by orthologs in SRS ( Figure 5 ). The most abundant protein was leucine-tRNA ligase (F6D7Q0, 11.06 ng) of Methanobacterium paludism SWAN-1. This hydrogenotrophic methanogen has been isolated from two different peatlands, in New York and Alaska [ 51 ]. This housekeeping enzyme catalyzes binding (aminoacylation)...”

BH2545 isoleucyl-tRNA synthetase from Bacillus halodurans C-125
41% identity, 6% coverage

Genome-wide molecular clock and horizontal gene transfer in bacterial evolution
Novichkov, Journal of bacteriology 2004
- “...acetobutylicum, SA1036 of S. aureus, BS_ileS of B. subtilis, BH2545 of B. halodurans, lin2127 of L. innocua, L0350 of L. lactis, SPy1513 of S. pyogenes, SP1659...”

Q6TGS6 Tyrosine--tRNA ligase, cytoplasmic from Danio rerio
32% identity, 20% coverage

Early transcriptional changes in the reef-building coral Acropora aspera in response to thermal and nutrient stress
Rosic, BMC genomics 2014
- “...(C) JT002895 NADH-ubiquinone oxidoreductase Metridium senile (O47498) 2.00E-10 Tyr (C) JT013311 Tyrosyl-tRNA synthetase Danio rerio (Q6TGS6) 2.00E-09 Cyt_c (C) JT015689 Cytochrome c oxidase subunit 1 Metridium senile (Q35101) 2.00E-11 Rubisco (A) GAFO01026698 Ribulose bisphosphate carboxylase Symbiodinium sp. (Q41406) 6.00E-13 Peridinin (A) JN602625 Peridinin-chlorophyll a-binding protein Symbiodinium...”

IVR12_00558 isoleucine--tRNA ligase from Limosilactobacillus reuteri
39% identity, 6% coverage

Recombinant Limosilactobacillus (Lactobacillus) delivering nanobodies against Clostridium perfringens NetB and alpha toxin confers potential protection from necrotic enteritis
Gangaiah, MicrobiologyOpen 2022
- “...ribosomal protein S7 IVR12_00781 18 105 50S ribosomal protein L15 IVR12_00759 15 104 IsoleucinetRNA ligase IVR12_00558 109 102 50S ribosomal protein L6 IVR12_00763 20 102 Citrate lyase subunit beta IVR12_00833 33 101 Alcohol dehydrogenase1 IVR12_00790 36 100 Elongation factor Ts IVR12_00463 32 100 50S ribosomal protein...”

BPSL0906 isoleucyl-tRNA synthetase from Burkholderia pseudomallei K96243
42% identity, 6% coverage

Development and validation of a triplex quantitative real-time PCR assay to detect efflux pump-mediated antibiotic resistance in Burkholderia pseudomallei
Webb, Future microbiology 2018
- “...mutation in the isoleucine tRNA synthetase gene, ileS (BPSL0906; IleSH505G ), the product of which catalyzes the aminoacylation of Ile-tRNA. In addition, we...”

DVU1927 isoleucyl-tRNA synthetase from Desulfovibrio vulgaris Hildenborough
46% identity, 6% coverage

Antimicrobial Effects of Free Nitrous Acid on Desulfovibrio vulgaris: Implications for Sulfide-Induced Corrosion of Concrete
Gao, Applied and environmental microbiology 2016
- “...q value DVU3256 DVU2552 DVU0809 DVU1898 DVU1897 DVU1927 DVU2376 DVU0811 DVU1608 DVU1573 DVU2534 DVU2533 DVU2904 DVU1629 DVU0897 DVU1257 DVU2246 DVU0904 DVU2538...”
CO2 exposure at pressure impacts metabolism and stress responses in the model sulfate-reducing bacterium Desulfovibrio vulgaris strain Hildenborough
Wilkins, Frontiers in microbiology 2014
- “...2 conditions; relative to abundances at atmospheric pressure, transcripts for leucyl and isoleucyl-tRNA synthetases (DVU1196; DVU1927) were both up-regulated at 25 bar and 50 bar CO 2 pressures, while expression of a tRNA modification GTPase (TrmE; DVU1079) exhibited a similar pattern. Further evidence for a significant...”

ARC1_YEAST / P46672 tRNA-aminoacylation cofactor ARC1; Acyl-RNA-complex protein 1; GU4 nucleic-binding protein 1; G4p1 protein; P42; tRNA-interacting factor ARC1 from Saccharomyces cerevisiae (strain ATCC 204508 / S288c) (Baker's yeast) (see 8 papers)
YGL105W Arc1p from Saccharomyces cerevisiae
NP_011410 Arc1p from Saccharomyces cerevisiae S288C
31% identity, 15% coverage

function: Binds to tRNA and functions as a cofactor for the methionyl- tRNA synthetase (MetRS) and glutamyl-tRNA synthetase (GluRS). Forms a complex with MetRS and GluRS and increases their affinity for cognate tRNAs due to the presence of a tRNA binding domain in its middle and C- terminal part. Binds specifically G4 quadruplex nucleic acid structures (these are four-stranded right-handed helices, stabilized by guanine base quartets). Also required for cytoplasmic confinement of the synthetases and tRNA.
subunit: Component of a yeast aminoacyl-tRNA synthase (aaRS) complex formed by methionyl-tRNA synthase MES1, glutamyl-tRNA synthase GUS1 and the tRNA aminoacylation cofactor ARC1 in a stoichiometric complex. Interacts (via N-ter) with MES1 (via N-ter) and GUS1 (via N-ter). Can also form a stable binary complex with either MES1 or GUS1 that is functional in terms of aminoacylation.
Synthetic dosage lethal (SDL) interaction data of Hmt1 arginine methyltransferase
Kyriakou, Data in brief 2020
- “...Subunit of the INO80 chromatin remodelling complex; relocalizes to the cytosol in response to hypoxia YGL105W ARC1 tRNA aminoacylation for protein translation(GO:0,006,418) Protein that binds tRNA and methionyl- and glutamyl-tRNA synthetases; involved in tRNA delivery, stimulating catalysis, and ensuring localization; also binds quadruplex nucleic acids; protein...”
Multi-omics analysis reveals regulators of the response to nitrogen limitation in Yarrowia lipolytica
Pomraning, BMC genomics 2016 (no snippet)
A Genome-Wide Screen with Nicotinamide to Identify Sirtuin-Dependent Pathways in Saccharomyces cerevisiae
Choy, G3 (Bethesda, Md.) 2015
- “...YOR035C 0.25 0.40 0.32 TLG2 YOL018C 0.41 0.49 0.45 YPT6 YLR262C 0.22 0.17 0.20 ARC1 YGL105W 0.18 0.29 0.24 COG8 YML071C 0.19 0.20 0.20 + YMR031W-A YMR031W-A 0.13 0.08 0.10 YNL171C YNL171C 0.37 0.21 0.29 YMR166C YMR166C 0.14 0.48 0.31 COG6 YNL041C 0.20 0.30 0.25 SAC1...”
Hierarchical Dirichlet process model for gene expression clustering
Wang, EURASIP journal on bioinformatics & systems biology 2013
- “...YLR055c YML032c YMR078c Protein synthesis YDR091c YGL103w YBR118w YBL057c YBR101c YBR181c YDL083c YDL184c YDR012w YDR172w YGL105w YGL129c YJL041w YJL125c YJR113c YLR185w YPL037c YPL048w YLR009w YHL001w YHL015w YHR011w YHR088w YDR450w YEL034w Protein fate YAL016w YBL009w YBR044c YDL040c Cell fate YAL040c YDL006w YDL134c YIL007c YJL187c YDL029w YDL035c YCR002c...”
Dissecting a complex chemical stress: chemogenomic profiling of plant hydrolysates
Skerker, Molecular systems biology 2013
- “...YLR338W OPI9 Other YDR136C VPS61 Other YLR261C VPS63 Other YNL148C ALF1 Other YML035C AMD1 Other YGL105W ARC1 Other YHR013C ARD1 Other YBR068C BAP2 Other YPL161C BEM4 Other YFL023W BUD27 Other YFR036W CDC26 Other YPL241C CIN2 Other YGR092W DBF2 Other YFL001W DEG1 Other YMR126C DLT1 Other YDL172C...”
Substrate analysis of the Pneumocystis carinii protein kinases PcCbk1 and PcSte20 using yeast proteome microarrays provides a novel method for Pneumocystis signalling biology
Kottom, Yeast (Chichester, England) 2011
- “...genetic studies have implicated in APC/cyclosome regulation ( Jones et al., 2000 ) 3% 4.96 YGL105W Arc1 Protein that binds tRNA and methionyl- and glutamyl-tRNA synthetases (Mes1p and Gus1p), delivering tRNA to them, stimulating catalysis, and ensuring their localization to the cytoplasm; also binds quadruplex nucleic...”
- “...al., 1999 ) 14.5 4.01 YDR034C-C Transposable element 16.2 3.17 YNL054W-A Transposable element 34.0 3.05 YGL105W Arc1 Protein that binds tRNA and methionyl- and glutamyl-tRNA synthetases (Mes1p and Gus1p), delivering tRNA to them, stimulating catalysis, and ensuring their localization to the cytoplasm; also binds quadruplex nucleic...”
Comparative transcriptomic and proteomic profiling of industrial wine yeast strains
Rossouw, Applied and environmental microbiology 2010
- “...BM45 VIN13 YDL014W YDL084W YDR225W YDR432W YEL026W YER165W YGL105W YGR204W YHR193C YOR204W YOR310C YPL037C YPR187W 0.74 1.36 0.47 0.83 1.45 0.90 1.26 0.22 1.41...”
Widespread reorganization of metabolic enzymes into reversible assemblies upon nutrient starvation
Narayanaswamy, Proceedings of the National Academy of Sciences of the United States of America 2009
- “...URA2 VAS1 YNL220W YMR120C YGL234W YMR303C YOR335C YGL105W YAL038W YPL160W YLR216C YGR155W YPR035W YOR168W YMR186W YDR171W YPL240C YPR033C YBL076C YBR140C...”
More
Modulating the Structure and Function of an Aminoacyl-tRNA Synthetase Cofactor by Biotinylation.
Chang, The Journal of biological chemistry 2016
- GeneRIF: study suggests that the structure and function of Arc1p can be modulated via biotinylation in response to temperature changes.
Quaternary structure of the yeast Arc1p-aminoacyl-tRNA synthetase complex in solution and its compaction upon binding of tRNAs.
Koehler, Nucleic acids research 2013
- GeneRIF: An ab initio model of both trimeric and the pentameric complexes containing Arc1,GluRS and MetRS.
Yeast mitochondrial Gln-tRNA(Gln) is generated by a GatFAB-mediated transamidation pathway involving Arc1p-controlled subcellular sorting of cytosolic GluRS.
Frechin, Genes & development 2009
- GeneRIF: dual localization of (c)ERS is controlled by binding to Arc1p
Arc1p is required for cytoplasmic confinement of synthetases and tRNA.
Golinelli-Cohen, Molecular and cellular biochemistry 2007 (PubMed)
- GeneRIF: These results are consistent with a model according to which Arc1p is a bifunctional protein involved in the subcellular localization of ScMetRS and ScGluRS via its N-terminal domain and of tRNA via its C-terminal domain.
Molecular determinants of the yeast Arc1p-aminoacyl-tRNA synthetase complex assembly.
Karanasios, Journal of molecular biology 2007 (PubMed)
- GeneRIF: assembly of the Arc1p-synthetase complex is mediated exclusively by the N-terminal domains of the synthetases and that the two enzymes bind to largely independent sites on Arc1p.
Structures of the interacting domains from yeast glutamyl-tRNA synthetase and tRNA-aminoacylation and nuclear-export cofactor Arc1p reveal a novel function for an old fold.
Simader, Acta crystallographica. Section D, Biological crystallography 2006 (PubMed)
- GeneRIF: The structure of the interacting domain of yeast glutamyl-tRNA synthetase (GluRS) and its accessory protein Arc1p was determined and refined to 1.9 A resolution.
Role of Arc1p in the modulation of yeast glutamyl-tRNA synthetase activity.
Graindorge, Biochemistry 2005 (PubMed)
- GeneRIF: Present study suggests a more complex picture for Arc1p-mediated stimulation of yeast tRNA glutamylation than just a role in increasing the glutamyl-tRNA synthetase binding affinity for tRNAGlu.
The tRNA aminoacylation co-factor Arc1p is excluded from the nucleus by an Xpo1p-dependent mechanism.
Galani, FEBS letters 2005 (PubMed)
- GeneRIF: cytoplasmic location of Arc1p is maintained by Xpo1p-dependent nuclear export

DVU1196 leucyl-tRNA synthetase from Desulfovibrio vulgaris Hildenborough
25% identity, 18% coverage

Effects of Genetic and Physiological Divergence on the Evolution of a Sulfate-Reducing Bacterium under Conditions of Elevated Temperature
Kempher, mBio 2020
- “...a chromate transporter gene ( chrA ; DVU0426), a leucyl-tRNA synthetase gene ( leuS ; DVU1196), and an iron-sulfur cluster-binding protein gene (DVU3028). Only one phage-related tail fiber gene (DVU1486) was mutated in both the EC-T and ES-T populations. The genes that acquired mutations in populations...”
CO2 exposure at pressure impacts metabolism and stress responses in the model sulfate-reducing bacterium Desulfovibrio vulgaris strain Hildenborough
Wilkins, Frontiers in microbiology 2014
- “...CO 2 conditions; relative to abundances at atmospheric pressure, transcripts for leucyl and isoleucyl-tRNA synthetases (DVU1196; DVU1927) were both up-regulated at 25 bar and 50 bar CO 2 pressures, while expression of a tRNA modification GTPase (TrmE; DVU1079) exhibited a similar pattern. Further evidence for a...”

SMU_558, SMU_RS02675 isoleucine--tRNA ligase from Streptococcus mutans UA159
31% identity, 10% coverage

Mass spectrometry and split luciferase complementation assays reveal the MecA protein interactome of Streptococcus mutans
Qin, Microbiology spectrum 2024
- “...ligase, LysS SMU_RS08265 4.7 Ribosome biogenesis GTPase, YqeH SMU_RS00770 4.5 30S ribosomal protein S15, RpsO SMU_RS02675 3.7 Isoleucine-tRNA ligase, IleS SMU_RS07190 3.4 Threonine-tRNA ligase, ThrS SMU_RS08340 3.3 2 Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit, GatB SMU_RS00850 3.3 30S ribosomal protein S9, Rpsl SMU_RS09230 3.1 50S ribosomal protein L22, RplV...”
Mechanistic insights into the inhibitory effect of theaflavins on virulence factors production in Streptococcus mutans
Kong, AMB Express 2021
- “...( if1 and SMU_421 ), and the aminoacyl-tRNA synthesis process (e.g., asnS , syfB , SMU_558 , gatB , SMU_773c , and sygA ) (Fig. 9 ). Furthermore, the expression of genes coding for ATP-dependent protease Clp ( clpX , clpP , and clpB ) and...”

SpyM3_1166 putative isoleucyl-tRNA synthetase from Streptococcus pyogenes MGAS315
32% identity, 10% coverage

Novel regulatory small RNAs in Streptococcus pyogenes
Tesorero, PloS one 2013
- “...Z SSRC25 SPyM3_1093 putative heavy metal/cadmium-transporting ATPase <<< SPyM3_1094 hypothetical protein <<< Q, Z SSRC26 SPyM3_1166 isoleucyl-tRNA synthetase <<< SPyM3_1167 putative cell-division initiation protein <<< Q, Z SSRC27 SPyM3_1176 UDP-N-acetylmuramoyl-L-alanyl-D-glutamate synthetase <<< SPyM3_1177 hypothetical protein <<< Q, P SSRC28 SPyM3_1190 asparagine synthetase AsnA <<< SPyM3_1191 carbamate...”

Q45477 isoleucine-tRNA ligase (EC 6.1.1.5) from Bacillus subtilis (see paper)
BSU15430 isoleucyl-tRNA synthetase from Bacillus subtilis subsp. subtilis str. 168
45% identity, 6% coverage

The catalytic flexibility of tRNAIle-lysidine synthetase can generate alternative tRNA substrates for isoleucyl-tRNA synthetase
Salowe, The Journal of biological chemistry 2009 (secret)
The Blueprint of a Minimal Cell: MiniBacillus
Reuß, Microbiology and molecular biology reviews : MMBR 2016
- “...T. maritima glyS glyQ hisS ileS BSU25260 BSU25270 BSU27560 BSU15430 Yes Yes Yes Yes Yes Yes 6.1.1.14 6.1.1.14 6.1.1.21 6.1.1.5 1J5W 1QE0 1QU2 T. maritima S....”

A4Y4A4 Isoleucine--tRNA ligase from Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
26% identity, 27% coverage

Comparative Proteome Analysis of Shewanella putrefaciens WS13 Mature Biofilm Under Cold Stress
Yan, Frontiers in microbiology 2020
- “...7 ). There were seven proteins that had the most interaction with other proteins, A4Y6G9, A4Y4A4, A4Y938, A4YCC9, E6XLB9, A4Y9 9, A4Y928 as shown in the middle part of Figure 7 (see also Table 2 ). The results indicate that the proteins involved in Aminoacyl-tRNA biosynthesis...”
- “...the interacting protein. Identifier Description Pathway_definition pheT A4Y6G9 Phenylalanine-tRNA ligase beta subunit Aminoacyl-tRNA biosynthesis ileS A4Y4A4 IsoleucinetRNA ligase Aminoacyl-tRNA biosynthesis surE A4Y938 5-Nucleotidase SurE Nicotinate and nicotinamide metabolism, pyrimidine metabolism, purine metabolism polA A4YCC9 DNA polymerase I Base excision repair, DNA replication, homologous recombination, nucleotide excision...”

Q5ZJ08 Tyrosine--tRNA ligase, cytoplasmic from Gallus gallus
30% identity, 18% coverage

A Proteomic View of the Cross-Talk Between Early Intestinal Microbiota and Poultry Immune System
Rodrigues, Frontiers in physiology 2020
- “...GLG1 Golgi glycoprotein 1 4.000 0.028 Q5ZLN0 LRRC40 Leucine rich repeat containing 40 2.200 0.031 Q5ZJ08 YARS Tyrosyl-tRNA synthetase 4.000 0.031 Q02020 FGB Fibrinogen beta chain 1.600 0.032 P26446 PARP1 Poly(ADP-ribose) polymerase 1 3.300 0.036 Q9W6H0 OGN Osteoglycin 1.600 0.037 Q5ZKU5 RAB14 RAB14, member RAS oncogene...”
Embryonic transcriptome and proteome analyses on hepatic lipid metabolism in chickens divergently selected for abdominal fat content.
Na, BMC genomics 2018
- “...1.54 Q9YHT1 Succinate dehydrogenase [ubiquinone] flavoprotein subunit, mitochondrial 74,024.6 6.65 63 94.987 Mitochondrion 10 1.91 Q5ZJ08 Tyrosyl-tRNA synthetase, cytoplasmic 59,703.1 6.24 76 99.743 Cytoplasm 12 a 1.65 gi|326927880 PREDICTED: transketolase-like [ Meleagris gallopavo ] 87,487.4 8.17 125 100 21 a 1.67 gi|326936041 PREDICTED: delta(3,5)-Delta(2,4)-dienoyl-CoA isomerase, mitochondrial-like,...”

WP_060592524 isoleucine--tRNA ligase from Nocardia farcinica
31% identity, 10% coverage

High-affinity recognition of specific tRNAs by an mRNA anticodon-binding groove.
Suddala, Nature structural & molecular biology 2019
- GeneRIF: The 2.8-A cocrystal structure of the Nocardia farcinica ileS T-box in complex with its cognate tRNA(Ile)reveals a perpendicularly arranged ultrashort stem I containing a K-turn and an elongated stem II bearing an S-turn. Both stems rest against a compact pseudoknot, dock via an extended ribose zipper and jointly create a binding groove specific to the anticodon of its cognate tRNA.

Q819R4 Isoleucine--tRNA ligase 1 from Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
39% identity, 7% coverage

Redox proteomic study of Bacillus cereus thiol proteome during fermentative anaerobic growth
Hamitouche, BMC genomics 2021
- “...Cys proteins in EEP,MEP Cofactors and vitamins metabolism Q81J74 60 7,8-dihydroneopterin aldolase NS NS Translation Q819R4 124 IleS1 Isoleucine-tRNA ligase 1 NS NS Q814Q8 153 ArgRS Arginine-tRNA ligase NS NS Amino acid metabolism Q814Q2 159 SpeB Agmatinase NS NS Cys proteins in EEP,LEP Defense mechanisms Q81GN6...”
- “...RedCys residues at EEP and MEP: Cys 170 in PheT1 (Q812N7), Cys 124 in IleS1 (Q819R4) and Cys 153 in ArgS (Q814Q8). The elongation factor FusA (Q814C5) contains a Cys residue (Cys 258 ) that was mainly detected as RedCys at EEP. The elongation factor Tuf...”

mlr8250 isoleucyl-tRNA synthetase from Mesorhizobium loti MAFF303099
40% identity, 6% coverage

Construction of signature-tagged mutant library in Mesorhizobium loti as a powerful tool for functional genomics
Shimoda, DNA research : an international journal for rapid publication of reports on genes and genomes 2008
- “...and mll1090) are highly conserved in the genome of completely sequenced rhizobia and four genes, mlr8250 (isoleucyl-tRNA synthetase), mll0870 (DNA polymerase III alpha subunit), mlr0276 (RNA polymerase beta subunit) and mlr0277 (RNA polymerase, beta prime subunit), showed high similarity to essential genes of E . coli...”
Genome-wide molecular clock and horizontal gene transfer in bacterial evolution
Novichkov, Journal of bacteriology 2004
- “...melitensis, AGc1230 of A. tumefaciens, SMc00908 of S. meliloti, mlr8250 of M. loti, CAC3038 of C. acetobutylicum, SA1036 of S. aureus, BS_ileS of B. subtilis,...”

SO3532 isoleucyl-tRNA synthetase from Shewanella oneidensis MR-1
46% identity, 6% coverage

In vivo identification of the outer membrane protein OmcA-MtrC interaction network in Shewanella oneidensis MR-1 cells using novel hydrophobic chemical cross-linkers
Zhang, Journal of proteome research 2008
- “...SO1142 SO4747 SO2638 SO0314 SO3032 SO1679 SOA0112 SO1521 SO3532 SO0021 SO0256 SO4030 SO1295 SO3440 SO1779 SO3542 C denotes cytoplasmic, and OM denotes outer...”

SSA_0661 Isoleucyl-tRNA synthetase, putative from Streptococcus sanguinis SK36
31% identity, 10% coverage

Analysis of essential gene dynamics under antibiotic stress in Streptococcus sanguinis
El-Rami, Microbiology (Reading, England) 2018
- “...synthetases: alanine-tRNA synthetase (SSA_0756), glycine-tRNA synthetase (SSA_1879), methionine-tRNA synthetase (SSA_1848), prolyl-tRNA synthetase (SSA_2069), isoleucyl-tRNA synthetase (SSA_0661), threonyl-tRNA synthetase (SSA_1571) and valine-tRNA synthetase (SSA_1819). Given the fact that alanine, glycine, methionine and valine have higher abundance in the composition of essential proteins than the non-essential proteins, this...”

BCAL2724 isoleucyl-tRNA synthetase from Burkholderia cenocepacia J2315
40% identity, 6% coverage

Proteomic profiling of Burkholderia cenocepacia clonal isolates with different virulence potential retrieved from a cystic fibrosis patient during chronic lung infection
Madeira, PloS one 2013
- “...0.5 <0.001 186 Q1BRU5 BCAL0231 fusA Elongation factor G1 2.5 1.7 0.7 <0.001 187 A4JH32 BCAL2724 ileS Isoleucine-tRNA ligase 2.5 1.8 0.7 <0.001 190 Q0BE16 BCAL2090 tsf Elongation factor Ts 2.3 1.4 0.6 <0.001 256 Q1BT08 BCAL0630 Putative uncharacterized protein 0.5 0.6 1.4 0.017 Amino acid...”

A4JH32 Isoleucine--tRNA ligase from Burkholderia vietnamiensis (strain G4 / LMG 22486)
40% identity, 6% coverage

Proteomic profiling of Burkholderia cenocepacia clonal isolates with different virulence potential retrieved from a cystic fibrosis patient during chronic lung infection
Madeira, PloS one 2013
- “...2.2 0.5 <0.001 186 Q1BRU5 BCAL0231 fusA Elongation factor G1 2.5 1.7 0.7 <0.001 187 A4JH32 BCAL2724 ileS Isoleucine-tRNA ligase 2.5 1.8 0.7 <0.001 190 Q0BE16 BCAL2090 tsf Elongation factor Ts 2.3 1.4 0.6 <0.001 256 Q1BT08 BCAL0630 Putative uncharacterized protein 0.5 0.6 1.4 0.017 Amino...”

An12g01480 uncharacterized protein from Aspergillus niger
28% identity, 12% coverage

Trancriptional landscape of Aspergillus niger at breaking of conidial dormancy revealed by RNA-sequencing
Novodvorska, BMC genomics 2013
- “...An01g08050 uaY, transcription factor 5.75 57.87 15.15 3.82 An14g03370 allantoinase* 27.48 7.64 16.23 2.12 Mitochondria/respiration An12g01480 Aminoacyl-tRNA biosynthesis 2.85 20.41 36.35 1.78 An08g02450 ATP synthase complex assembly 2.63 4.82 51.51 10.69 An15g01710 atp7 , F1Fo-ATP synthase 2.29 31.59 265.5 8.40 An01g10880 F1Fo-ATP synthase 4.53 13.27 427.48...”

ECs0029 isoleucine tRNA synthetase from Escherichia coli O157:H7 str. Sakai
44% identity, 6% coverage

Global transcriptional response of Escherichia coli O157:H7 to growth transitions in glucose minimal medium
Bergholz, BMC microbiology 2007
- “...rpsT -4.14 1 ECs0540 O157 3.52 2 ECs0028 ribF -2.36 1 ECs0541 O157 4.11 2 ECs0029 ileS -2.81 1 ECs0552 ybbK 3.00 2 ECs0030 lspA -2.38 1 ECs0561 ybbD 2.16 2 ECs0032 lytB -2.20 1 ECs0615 ybdG -2.36 1 ECs0036 carB -3.28 1 ECs0619 ybdK 2.98...”

S0025 isoleucine tRNA synthetase from Shigella flexneri 2a str. 2457T
44% identity, 6% coverage

A multiplex oligonucleotide ligation-PCR as a complementary tool for subtyping of Salmonella Typhimurium
Wuyts, Applied microbiology and biotechnology 2015
- “...template, a single colony of each of five different isolates (i.e., samples S0001, S0002, S0024, S0025 and S0050 in Data set S1) was mixed in one tube with 50l sterile de-ionised water, which was treated as described in the section DNA isolation. Other isolates, separate or...”
- “...may explain the negative results for SAL-10 in the PCR screening for isolates S0007, S0023, S0025 and S0030 while positive results for SAL-10 in the MOL-PCR were seen for these isolates. Indeed, the target-specific sequence of the upstream and downstream probes of marker SAL-10 (SAL-10-U and...”
Complete DNA sequence and analysis of the large virulence plasmid of Shigella flexneri
Venkatesan, Infection and immunity 2001
- “...homologous to all three ISEc8 ORFs are present (S0023 to S0025, S0116 to S0119, and S0216 to S0219). In addition, six partial copies of the third ORF alone are...”
The penicillins
Wright, Mayo Clinic proceedings 1991 (PubMed) (secret)
The penicillins
Wright, Mayo Clinic proceedings 1987 (PubMed) (secret)
Bacillary dysentery: mechanisms and treatment
Levine, The Medical clinics of North America 1982 (PubMed)
Enteropathogenic organisms. New etiologic agents and concepts of disease
DuPont, The Medical clinics of North America 1978 (PubMed)
Patterns and mechanisms of antibiotic resistance
Murray, The Medical clinics of North America 1978 (PubMed)
Salmonellosis and shigellosis: epidemiology and clinical features
O'Neil, The Medical clinics of North America 1967 (PubMed)

IlvS / b0026 isoleucine—tRNA ligase (EC 6.1.1.5) from Escherichia coli K-12 substr. MG1655 (see 69 papers)
ileS / P00956 isoleucine—tRNA ligase (EC 6.1.1.5) from Escherichia coli (strain K12) (see 73 papers)
SYI_ECOLI / P00956 Isoleucine--tRNA ligase; Isoleucyl-tRNA synthetase; IleRS; EC 6.1.1.5 from Escherichia coli (strain K12) (see 8 papers)
P00956 isoleucine-tRNA ligase (EC 6.1.1.5) from Escherichia coli (see 3 papers)
ileS isoleucyl-tRNA synthetase; EC 6.1.1.5 from Escherichia coli K12 (see 16 papers)
b0026 isoleucyl-tRNA synthetase from Escherichia coli str. K-12 substr. MG1655
NP_414567 isoleucine--tRNA ligase from Escherichia coli str. K-12 substr. MG1655
44% identity, 6% coverage

function: Catalyzes the attachment of isoleucine to tRNA(Ile). As IleRS can inadvertently accommodate and process structurally similar amino acids such as valine, to avoid such errors it has two additional distinct tRNA(Ile)-dependent editing activities. One activity is designated as 'pretransfer' editing and involves the hydrolysis of activated Val-AMP. The other activity is designated 'posttransfer' editing and involves deacylation of mischarged Val-tRNA(Ile).
catalytic activity: tRNA(Ile) + L-isoleucine + ATP = L-isoleucyl-tRNA(Ile) + AMP + diphosphate (RHEA:11060)
cofactor: Zn(2+) Note=Binds 1 zinc ion per subunit
subunit: Monomer
Essentiality Assessment of Cysteinyl and Lysyl-tRNA Synthetases of Mycobacterium smegmatis
Ravishankar, PloS one 2016
- “...HI1391 SA1488 SP0568 LeuRS MSMEG_6917 Rv0041 ML0032 b0642 HI0921 SA1579 SP0254 IleRS MSMEG_3169 Rv1536 ML1195 b0026 HI1586 SA1036 SP1659 TilS MSMEG_6111 - - b0188 - - - SerRS MSMEG_6413 Rv3834c ML0082 b0893 NI0110 SA0009 SP0411 ThrRS MSMEG_2931 Rv2614c ML0456 b1719 HI1367 SA1506 SP1631 ProRS MSMEG_2621MSMEG_5671 Rv2845c...”
Gap-filling analysis of the iJO1366 Escherichia coli metabolic network reconstruction for discovery of metabolic functions
Orth, BMC systems biology 2012
- “...Table 4 False positive model predictions caused by tRNA charging reactions Gene Amino Acid ileS (b0026) L-isoleucine proS (b0194) L-proline cysS (b0526) L-cysteine leuS (b0642) L-leucine glnS (b0680) L-glutamine serS (b0893) L-serine asnS (b0930) L-asparagine tyrS (b1637) L-tyrosine pheT (b1713) L-phenylalanine pheS (b1714) L-phenylalanine thrS (b1719)...”
Reconstitution of the Mycobacterium tuberculosis pupylation pathway in Escherichia coli
Cerda-Maira, EMBO reports 2011 (secret)
Analysis of phage Mu DNA transposition by whole-genome Escherichia coli tiling arrays reveals a complex relationship to distribution of target selection protein B, transcription and chromosome architectural elements
Ge, Journal of biosciences 2011
- “...2.74 insB_ 4 b0988 6 4174775 4174920 3.35 secE b3981 7 22514 22659 2.38 ileS b0026 7 3480066 3480283 3.24 yheS b3352 8 4516775 4517256 2.08 insA_7 b4294 8 483662 483783 3.19 acrB b0462 9 2062706 2062875 2.03 cobS b1991 9 2002228 2002589 3.19 fliD b1924...”
Update on the Keio collection of Escherichia coli single-gene deletion mutants
Yamamoto, Molecular systems biology 2009
- “...synthetase, beta subunit groEL ECK4137 JW4103 b4143 E 2/8 Cpn60 chaperonin GroEL ileS ECK0027 JW0024 b0026 E 2/8 Isoleucyl-tRNA synthetase parC ECK3010 JW2987 b3019 E 2/8 DNA topoisomerase IV, subunit A prfB ECK2886 JW5847 b2891 E 5/8 Peptide chain release factor RF-2 polA ECK3855 JW3835 b3863...”
Microarray analysis of orthologous genes: conservation of the translational machinery across species at the sequence and expression level
Jiménez, Genome biology 2003
- “...operons Operon name Eco ORF Yeast COG ID Function ORF description tRNA synthetase and peptidase b0026 Yes* COG0060 J2 Isoleucine tRNA synthetase tRNA synthetase and peptidase b0027 No COG0597 N Prolipoprotein signal peptidase tRNA synthetase and peptidase b0028 No COG1047 O Probable FKBX-type 16kD peptidyl-prolyl cis-trans...”
Mechanism of discrimination of isoleucyl-tRNA synthetase against nonproteinogenic α-aminobutyrate and its fluorinated analogues.
Zivkovic, The FEBS journal 2020 (PubMed)
- GeneRIF: Mechanism of discrimination of isoleucyl-tRNA synthetase against nonproteinogenic alpha-aminobutyrate and its fluorinated analogues.
Determinants for tRNA-dependent pretransfer editing in the synthetic site of isoleucyl-tRNA synthetase.
Dulic, Biochemistry 2014
- GeneRIF: Data indicate that tyrosine 59 participates in the synthetic reaction of isoleucyl-tRNA synthetase (EcIleRS).
Partitioning of tRNA-dependent editing between pre- and post-transfer pathways in class I aminoacyl-tRNA synthetases.
Dulic, The Journal of biological chemistry 2010
- GeneRIF: analysis of three models for pre-transfer editing by Escherichia coli isoleucyl-tRNA synthetase (IleRS)
The catalytic flexibility of tRNAIle-lysidine synthetase can generate alternative tRNA substrates for isoleucyl-tRNA synthetase.
Salowe, The Journal of biological chemistry 2009
- GeneRIF: catalytic flexibility of tRNAIle-lysidine synthetase can generate alternative tRNA substrates for isoleucyl-tRNA synthetase
Specific sequence homology and three-dimensional structure of an aminoacyl transfer RNA synthetase.
Webster, Science (New York, N.Y.) 1984 (PubMed)
- GeneRIF: N-terminus verified by Edman degradation on mature peptide
RNA-dependent proteome solubility maintenance in Escherichia coli lysates analysed by quantitative mass spectrometry: Proteomic characterization in terms of isoelectric point, structural disorder, functional hub, and chaperone network
Park, RNA biology 2024
- “...48.41 5.18 4.62 18.57 0.165 n.s P0A8M0 AspRS 2 52.44 4.95 3.69 7.37 0.02 * P00956 IleRS 1 104.17 5.87 3.33 6.27 0.164 n.s P21889 AspRS 2 65.91 5.36 2.66 9.58 0 *** P00959 MetRS 1 76.12 5.65 0.19 7.63 0 *** P07395 PheRS, subunit 2...”
Toward Single Bacterium Proteomics
Végvári, Journal of the American Society for Mass Spectrometry 2023
- “...znuA P39172 [275286] [R].MGTLDPLGTNIK.[L] 1259.67 630.34 +2 84.48 1 208.47 0.00% 591 isoleucine-tRNA ligase ileS P00956 [432439] [R].AQSLKEIK.[G] 917.53 459.27 +2 85.49 4 191.84 0.00% 72 low-affinity inorganic phphate transporter PitA pitA P0AFJ7 [332337] [K].LSLDQR.[S] 732.39 366.70 +2 29.73 1 183.61 0.00% nitric oxide reductase FlRd-NAD(+)...”
Structural Basis for the Antibiotic Resistance of Eukaryotic Isoleucyl-tRNA Synthetase
Chung, Molecules and cells 2020
- “...(Q21926), Saccharomyces cerevisiae (P48526), Methanocaldococcus jannaschii (Q58357), Methanothermobacter thermautotrophicus (O27428), Thermus thermophilus (P56690), Escherichia coli (P00956), Staphylococcus aureus (P41972). Strictly conserved and highly conserved residues are highlighted in yellow and pale yellow, respectively. The secondary structure is displayed above the sequence. Every 10th residue is marked...”
Proteomic Study of the Survival and Resuscitation Mechanisms of Filamentous Persisters in an Evolved Escherichia coli Population from Cyclic Ampicillin Treatment
Sulaiman, mSystems 2020
- “...atpA ATP synthase subunit alpha 0.028 1.84 P76372 wzzB Chain length determinant protein 0.045 2.23 P00956 ileS Isoleucine-tRNA ligase 0.005 2.45 P10384 fadL Long-chain fatty acid transport protein 0.040 2.56 P0AFF6 nusA Transcription termination/antitermination protein NusA 0.044 3.32 P0A799 pgk Phosphoglycerate kinase 0.023 3.36 P0A917 ompX...”
Genomic Characterization of Arcobacter butzleri Isolated From Shellfish: Novel Insight Into Antibiotic Resistance and Virulence Determinants
Fanelli, Frontiers in microbiology 2019
- “...6V hlpA Serine/threonine-protein kinase HipA (methicillin resistance) P23874 Ab 6V ileS Isoleucine-tRNA ligase (mupirocine resistance) P00956 Ab 55 Ab6V lmrA Multidrug resistance ABC transporter ATP-binding and permease protein Q9CHL8 Ab 6V - putative metallo-hydrolase (metallo Beta-lactamase) Q5XD24 Ab 55 macA Macrolide export protein MacA P75830 Ab...”
Generation of dominant selectable markers for resistance to pseudomonic acid by cloning and mutagenesis of the ileS gene from the archaeon Methanosarcina barkeri fusaro
Boccazzi, Journal of bacteriology 2000
- “...P41972 (S. aureus I, genomic copy), P46207 (A. aeolicus), P00956 (E. coli), and P18330 (P. fluorescens). The A. pernix and P. horikoshii sequences were from the...”

R7VUG7 Tyrosine--tRNA ligase from Columba livia
32% identity, 19% coverage

Exploration of Proteomics Analysis of Crop Milk in Pigeons (Columba livia) during the Lactation Period
Shao, ACS omega 2021
- “...0.91 0.54 0.33 0.56 0.36 A0A2I0MHX5 cysteinyl-tRNA synthetase (CARS) 0.73 0.75 0.21 0.15 0.29 0.19 R7VUG7 tyrosinetRNA ligase (YARS) 1.18 1.58 0.52 0.41 0.44 0.26 A0A2I0MPR9 tryptophanyl-tRNA synthetase (WARS) 1.02 0.75 0.33 0.15 0.32 0.20 A0A2I0MME0 T-complex protein1 subunit eta (CCT7) 1.13 0.99 0.63 0.31 0.55...”

PA4560 isoleucyl-tRNA synthetase from Pseudomonas aeruginosa PAO1
Q9HVM4 Isoleucine--tRNA ligase from Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
30% identity, 13% coverage

The Breadth and Molecular Basis of Hcp-Driven Type VI Secretion System Effector Delivery
Howard, mBio 2021
- “...A 51.9 PA3183 Zwf 3.9 2.06 Glucose-6-phosphate 1-dehydrogenase 55.6 PA3635 Eno 3.8 2.99 Enolase 45.2 PA4560 IleS 3.7 2.99 Isoleucine-tRNA ligase 105.5 PA2624 Idh 3.7 2.57 Isocitrate dehydrogenase (NADP) 81.6 PA3529 3.6 1.98 Alkylhydroperoxide reductase C 21.8 PA0552 Pgk 3.5 1.40 Phosphoglycerate kinase 40.4 PA0130 BauC...”
Comparative genomics of clinical strains of Pseudomonas aeruginosa strains isolated from different geographic sites
Subedi, Scientific reports 2018
- “...2 1 1 2 2 1 56 PA4265 tufA 1 1 2 PA4277 tufB 0 PA4560 ileS 2 2 2 2 2 2 2 1 4 2 1 1 2 4 2 4 2 2 4 3 1 47 PA4964 parC 2 2 2 2 2...”
Bis-(3'-5')-cyclic dimeric GMP regulates antimicrobial peptide resistance in Pseudomonas aeruginosa
Chua, Antimicrobial agents and chemotherapy 2013
- “...PA0400 PA4138 PA4236 PA0139 PA5322 PA2944 PA3186 PA0036 PA4560 PA4938 PA0077 PA4266 PA4829 PA3328 PA3666 PA2391 PA0956 PA5131 PA3213 PA1833 PA0548 PA5497 PA1342...”
Proteomic profiling spotlights the molecular targets and the impact of the natural antivirulent umbelliferone on stress response, virulence factors, and the quorum sensing network of Pseudomonas aeruginosa
Kasthuri, Frontiers in cellular and infection microbiology 2022
- “...2.49 Q59637 Pyruvate dehydrogenase E1 component AceE 0.02 1.67 B7VB85 GlutaminetRNA ligase GlnS 0.03 2.00 Q9HVM4 IsoleucinetRNA ligase IleS 0.00 2.63 Q4ZQ92 Methylthioribose-1-phosphate isomerase MtnA 0.02 1.18 Q9HU18 C4-dicarboxylate-binding periplasmic protein DctP 0.00 1.57 A6VC02 Large-conductance mechanosensitive channel MscL 0.03 2.72 Q9K3C5 B-type flagellar hook-associated protein...”

AEX15_20105 isoleucine--tRNA ligase from Salmonella enterica subsp. enterica serovar Kentucky
44% identity, 5% coverage

Genomic and Evolutionary Analysis of Two Salmonella enterica Serovar Kentucky Sequence Types Isolated from Bovine and Poultry Sources in North America
Haley, PloS one 2016
- “...54 intergenic 4002925 G A AEX15_20245 SeKA_A4293 chitinase 4165915 A G S Val Val 533 AEX15_20105 SeKA_A4321 isoleucyl-tRNA synthetase 4192511 C A S Thr Thr 62 AEX15_17125 SeKA_A4346 carnitine operon protein CaiE 4219742 C T NS Glu Lys 128 intergenic 4233585 C A AEX15_16055 SeKA_A4409 UDP-N-acetylmuramoyl-L-alanyl-D-glutamate...”

CDR20291_2410 leucyl-tRNA synthetase from Clostridium difficile R20291
CD2521 leucyl-tRNA synthetase from Clostridium difficile 630
26% identity, 17% coverage

Proteomic Signatures of Clostridium difficile Stressed with Metronidazole, Vancomycin, or Fidaxomicin
Maaß, Cells 2018
- “...RpsF CDR20291_3523 30S ribosomal protein S6 x CDIF630erm_00160 Adk CDR20291_0088 adenylate kinase x CDIF630erm_02772 LeuS CDR20291_2410 leucine-tRNA ligas x CDIF630erm_03872 LysS CDR20291_3389 lysine-tRNA ligase x CDIF630erm_00461 CDIF630erm_00461 CDR20291_0338 cobalt-dependent inorganic pyrophosphatase x cells-07-00213-t002_Table 2 Table 2 This table lists all proteins uniquely regulated after treatment with...”
The current riboswitch landscape in Clostridioides difficile
Badilla, Microbiology (Reading, England) 2024
- “...ligase CD0699 Phenylalanyl-tRNA synthetase alpha chain CD1282 Alanine-tRNA synthetase CD1521 Tyrosine-tRNA ligase CD2245 Asparagine-tRNA ligase CD2521 Leucine-tRNA ligase CD2618 Isoleucine-tRNA ligase CD3256 Valine-tRNA ligase CD3540 Methionine-tRNA ligase Amino acid metabolism CD0989 2-Isopropylmalate synthase CD1580 Homoserine dehydrogenase CD1580* Homoserine dehydrogenase CD1785 Argininosuccinate synthase CD2034 N -Acetyl-gamma-glutamyl-phosphate reductase...”

SC0040 isoleucine tRNA synthetase from Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67
44% identity, 5% coverage

Prevalence and characterization of genotypic diversity of Haemophilus parasuis isolates from southern China
Zhang, Canadian journal of veterinary research = Revue canadienne de recherche veterinaire 2012 (secret)

NP_459051 isoleucine tRNA synthetase from Salmonella enterica subsp. enterica serovar Typhimurium str. LT2
STM0046 isoleucine tRNA synthetase from Salmonella typhimurium LT2
STM14_0055, SeKA_A4321 isoleucine--tRNA ligase from Salmonella enterica subsp. enterica serovar Kentucky str. CVM29188
44% identity, 6% coverage

Amplification of the gene for isoleucyl-tRNA synthetase facilitates adaptation to the fitness cost of mupirocin resistance in Salmonella enterica.
Paulander, Genetics 2010
- GeneRIF: Increased expression of the original mutant ileS gene (Mup(R)) also improves fitness while maintaining resistance is presented.
Inorganic Polyphosphate Is Essential for Salmonella Typhimurium Virulence and Survival in Dictyostelium discoideum
Varas, Frontiers in cellular and infection microbiology 2018
- “...membrane protein STM14_5437 STM4525 hsdM DNA methylase M B. Infection with the ppk mutant STM14_0055 STM0046 ileS Isoleucyl-tRNA synthetase STM14_0100 STM0084 Putative sulfatase STM14_0417 STM0357 mod DNA methylase STM14_0529 STM0447 tig Trigger factor STM14_0870 STM0748 tolB Translocation protein TolB STM14_0992 STM0798 uvrB Excinuclease ABC subunit B...”
Subtyping of Salmonella enterica Subspecies I Using Single-Nucleotide Polymorphisms in Adenylate Cyclase
Guard, Foodborne pathogens and disease 2016
- “...0.510 17-Aug Leucine 18 alaS STM2827 2631 390 37 25 0.676 31-Aug Alanine 19 ileS STM0046 2835 382 40 19 0.475 17-Aug Isoleucine 20 valS STM4475 2855 393 48 43 0.896 31-Aug Valine Figure 1B : DGCs 1 STM4551 1065 402 42 24 0.571 16-Sep DGCs...”
Inorganic Polyphosphate Is Essential for Salmonella Typhimurium Virulence and Survival in Dictyostelium discoideum
Varas, Frontiers in cellular and infection microbiology 2018
- “...inner membrane protein STM14_5437 STM4525 hsdM DNA methylase M B. Infection with the ppk mutant STM14_0055 STM0046 ileS Isoleucyl-tRNA synthetase STM14_0100 STM0084 Putative sulfatase STM14_0417 STM0357 mod DNA methylase STM14_0529 STM0447 tig Trigger factor STM14_0870 STM0748 tolB Translocation protein TolB STM14_0992 STM0798 uvrB Excinuclease ABC subunit...”
Genomic and Evolutionary Analysis of Two Salmonella enterica Serovar Kentucky Sequence Types Isolated from Bovine and Poultry Sources in North America
Haley, PloS one 2016
- “...intergenic 4002925 G A AEX15_20245 SeKA_A4293 chitinase 4165915 A G S Val Val 533 AEX15_20105 SeKA_A4321 isoleucyl-tRNA synthetase 4192511 C A S Thr Thr 62 AEX15_17125 SeKA_A4346 carnitine operon protein CaiE 4219742 C T NS Glu Lys 128 intergenic 4233585 C A AEX15_16055 SeKA_A4409 UDP-N-acetylmuramoyl-L-alanyl-D-glutamate synthetase...”

SEN_RS00235 isoleucine--tRNA ligase from Salmonella enterica subsp. enterica serovar Choleraesuis str.
44% identity, 6% coverage

First gene-ontology enrichment analysis based on bacterial coregenome variants: insights into adaptations of Salmonella serovars to mammalian- and avian-hosts
Felten, BMC microbiology 2017
- “...translation impact in Gallinarum Protein translation impact in Pullorum Impact on protein function GO:0006428 54,044 SEN_RS00235 G G T Null Missense variant Modification in Pullorum GO:0006428 54,289 SEN_RS00235 T T C Null Synonymous variant Potential modification GO:0006428 54,658 SEN_RS00235 C C T Null Synonymous variant Potential...”
- “...Pullorum GO:0006522 1,313,706 SEN_RS06395 A A G Null Missense variant Modification in Pullorum GO:0004822 54,044 SEN_RS00235 G G T Null Missense variant Modification in Pullorum GO:0004822 54,289 SEN_RS00235 T T C Null Synonymous variant Potential modification GO:0004822 54,658 SEN_RS00235 C C T Null Synonymous variant Potential...”

ESA_03312 hypothetical protein from Enterobacter sakazakii ATCC BAA-894
44% identity, 6% coverage

Comprehensive approaches to molecular biomarker discovery for detection and identification of Cronobacter spp. (Enterobacter sakazakii) and Salmonella spp
Yan, Applied and environmental microbiology 2011
- “...ESA_03723 ESA_02187 ESA_02251 ESA_00752 ESA_00690 ESA_04401 ESA_03312 ESA_03973 ESA_03690 GU122171 ACE74909 ESA_00031 ESA_03979 Wzx Wzy Chitinase Hypothetical...”

lmo2019 isoleucyl-tRNA synthetase from Listeria monocytogenes EGD-e
36% identity, 6% coverage

SecA2 Associates with Translating Ribosomes and Contributes to the Secretion of Potent IFN-β Inducing RNAs
Teubner, International journal of molecular sciences 2022
- “...DNA-directed RNA polymerase subunit beta Transcription 0.05 0.05 lmo1504 alaS AlaninetRNA ligase Translation 0.04 0.05 lmo2019 ileS IsoleucinetRNA ligase Translation 0.03 0.04 lmo0007 gyrA DNA gyrase subunit A Replication. recombination and repair 0.03 0.03 * COGs = (Clusters of Orthologous Groups of proteins); emPAI = (Exponentially...”
Intracellular gene expression profile of Listeria monocytogenes
Chatterjee, Infection and immunity 2006
- “...synthetases, i.e., alaS (lmo1504), hisS (lmo1520), ileS (lmo2019), glyS (lmo1458), serS (lmo2747), cysS (lmo0239), valS (lmo1552), thrS (lmo1559), leuS...”

lin2127 isoleucyl-tRNA synthetase from Listeria innocua Clip11262
36% identity, 6% coverage

Genome-wide molecular clock and horizontal gene transfer in bacterial evolution
Novichkov, Journal of bacteriology 2004
- “...aureus, BS_ileS of B. subtilis, BH2545 of B. halodurans, lin2127 of L. innocua, L0350 of L. lactis, SPy1513 of S. pyogenes, SP1659 of S. pneumoniae, FN0067 of...”

New Search

For advice on how to use these tools together, see Interactive tools for functional annotation of bacterial genomes.

Statistics

The PaperBLAST database links 793,807 different protein sequences to 1,259,118 scientific articles. Searches against EuropePMC were last performed on March 13 2025.

How It Works

PaperBLAST builds a database of protein sequences that are linked to scientific articles. These links come from automated text searches against the articles in EuropePMC and from manually-curated information from GeneRIF, UniProtKB/Swiss-Prot, BRENDA, CAZy (as made available by dbCAN), BioLiP, CharProtDB, MetaCyc, EcoCyc, TCDB, REBASE, the Fitness Browser, and a subset of the European Nucleotide Archive with the /experiment tag. Given this database and a protein sequence query, PaperBLAST uses protein-protein BLAST to find similar sequences with E < 0.001.

To build the database, we query EuropePMC with locus tags, with RefSeq protein identifiers, and with UniProt accessions. We obtain the locus tags from RefSeq or from MicrobesOnline. We use queries of the form "locus_tag AND genus_name" to try to ensure that the paper is actually discussing that gene. Because EuropePMC indexes most recent biomedical papers, even if they are not open access, some of the links may be to papers that you cannot read or that our computers cannot read. We query each of these identifiers that appears in the open access part of EuropePMC, as well as every locus tag that appears in the 500 most-referenced genomes, so that a gene may appear in the PaperBLAST results even though none of the papers that mention it are open access. We also incorporate text-mined links from EuropePMC that link open access articles to UniProt or RefSeq identifiers. (This yields some additional links because EuropePMC uses different heuristics for their text mining than we do.)

For every article that mentions a locus tag, a RefSeq protein identifier, or a UniProt accession, we try to select one or two snippets of text that refer to the protein. If we cannot get access to the full text, we try to select a snippet from the abstract, but unfortunately, unique identifiers such as locus tags are rarely provided in abstracts.

PaperBLAST also incorporates manually-curated protein functions:

Proteins from NCBI's RefSeq are included if a GeneRIF entry links the gene to an article in PubMed^®. GeneRIF also provides a short summary of the article's claim about the protein, which is shown instead of a snippet.
Proteins from Swiss-Prot (the curated part of UniProt) are included if the curators identified experimental evidence for the protein's function (evidence code ECO:0000269). For these proteins, the fields of the Swiss-Prot entry that describe the protein's function are shown (with bold headings).
Proteins from BRENDA, a curated database of enzymes, are included if they are linked to a paper in PubMed and their full sequence is known.
Every protein from the non-redundant subset of BioLiP, a database of ligand-binding sites and catalytic residues in protein structures, is included. Since BioLiP itself does not include descriptions of the proteins, those are taken from the Protein Data Bank. Descriptions from PDB rely on the original submitter of the structure and cannot be updated by others, so they may be less reliable. (For SitesBLAST and Sites on a Tree, we use a larger subset of BioLiP so that every ligand is represented among a group of structures with similar sequences, but for PaperBLAST, we use the non-redundant set provided by BioLiP.)
Every protein from EcoCyc, a curated database of the proteins in Escherichia coli K-12, is included, regardless of whether they are characterized or not.
Proteins from the MetaCyc metabolic pathway database are included if they are linked to a paper in PubMed and their full sequence is known.
Proteins from the Transport Classification Database (TCDB) are included if they have known substrate(s), have reference(s), and are not described as uncharacterized or putative. (Some of the references are not visible on the PaperBLAST web site.)
Every protein from CharProtDB, a database of experimentally characterized protein annotations, is included.
Proteins from the CAZy database of carbohydrate-active enzymes are included if they are associated with an Enzyme Classification number. Even though CAZy does not provide links from individual protein sequences to papers, these should all be experimentally-characterized proteins.
Proteins from the REBASE database of restriction enzymes are included if they have known specificity.
Every protein with an evidence-based reannotation (based on mutant phenotypes) in the Fitness Browser is included.
Sequence-specific transcription factors (including sigma factors and DNA-binding response regulators) with experimentally-determined DNA binding sites from the PRODORIC database of gene regulation in prokaryotes.
Putative transcription factors from RegPrecise that have manually-curated predictions for their binding sites. These predictions are based on conserved putative regulatory sites across genomes that contain similar transcription factors, so PaperBLAST clusters the TFs at 70% identity and retains just one member of each cluster.
Coding sequence (CDS) features from the European Nucleotide Archive (ENA) are included if the /experiment tag is set (implying that there is experimental evidence for the annotation), the nucleotide entry links to paper(s) in PubMed, and the nucleotide entry is from the STD data class (implying that these are targeted annotated sequences, not from shotgun sequencing). Also, to filter out genes whose transcription or translation was detected, but whose function was not studied, nucleotide entries or papers with more than 25 such proteins are excluded. Descriptions from ENA rely on the original submitter of the sequence and cannot be updated by others, so they may be less reliable.

Except for GeneRIF and ENA, the curated entries include a short curated description of the protein's function. For entries from BioLiP, the protein's function may not be known beyond binding to the ligand. Many of these entries also link to articles in PubMed.

For more information see the PaperBLAST paper (mSystems 2017) or the code. You can download PaperBLAST's database here.

Changes to PaperBLAST since the paper was written:

November 2023: incorporated PRODORIC and RegPrecise. Many PRODORIC entries were not linked to a protein sequence (no UniProt identifier), so we added this information.
February 2023: BioLiP changed their download format. PaperBLAST now includes their non-redundant subset. SitesBLAST and Sites on a Tree use a larger non-redundant subset that ensures that every ligand is represented within each cluster. This should ensure that every binding site is represented.
June 2022: incorporated some coding sequences from ENA with the /experiment tag.
March 2022: incorporated BioLiP.
April 2020: incorporated TCDB.
April 2019: EuropePMC now returns table entries in their search results. This has expanded PaperBLAST's database, but most of the new entries are of low relevance, and the resulting snippets are often just lists of locus tags with annotations.
February 2018: the alignment page reports the conservation of the hit's functional sites (if available from from Swiss-Prot or UniProt)
January 2018: incorporated BRENDA.
December 2017: incorporated MetaCyc, CharProtDB, CAZy, REBASE, and the reannotations from the Fitness Browser.
September 2017: EuropePMC no longer returns some table entries in their search results. This has shrunk PaperBLAST's database, but has also reduced the number of low-relevance hits.

Many of these changes are described in Interactive tools for functional annotation of bacterial genomes.

Secrets

PaperBLAST cannot provide snippets for many of the papers that are published in non-open-access journals. This limitation applies even if the paper is marked as "free" on the publisher's web site and is available in PubmedCentral or EuropePMC. If a journal that you publish in is marked as "secret," please consider publishing elsewhere.

Omissions from the PaperBLAST Database

Many important articles are missing from PaperBLAST, either because the article's full text is not in EuropePMC (as for many older articles), or because the paper does not mention a protein identifier such as a locus tag, or because of PaperBLAST's heuristics. If you notice an article that characterizes a protein's function but is missing from PaperBLAST, please notify the curators at UniProt or add an entry to GeneRIF. Entries in either of these databases will eventually be incorporated into PaperBLAST. Note that to add an entry to UniProt, you will need to find the UniProt identifier for the protein. If the protein is not already in UniProt, you can ask them to create an entry. To add an entry to GeneRIF, you will need an NCBI Gene identifier, but unfortunately many prokaryotic proteins in RefSeq do not have corresponding Gene identifers.

References

PaperBLAST: Text-mining papers for information about homologs.
M. N. Price and A. P. Arkin (2017). mSystems, 10.1128/mSystems.00039-17.

Europe PMC in 2017.
M. Levchenko et al (2017). Nucleic Acids Research, 10.1093/nar/gkx1005.

Gene indexing: characterization and analysis of NLM's GeneRIFs.
J. A. Mitchell et al (2003). AMIA Annu Symp Proc 2003:460-464.

UniProt: the universal protein knowledgebase.
The UniProt Consortium (2016). Nucleic Acids Research, 10.1093/nar/gkw1099.

BRENDA in 2017: new perspectives and new tools in BRENDA.
S. Placzek et al (2017). Nucleic Acids Research, 10.1093/nar/gkw952.

The EcoCyc database: reflecting new knowledge about Escherichia coli K-12.
I. M. Keeseler et al (2016). Nucleic Acids Research, 10.1093/nar/gkw1003.

The MetaCyc database of metabolic pathways and enzymes.
R. Caspi et al (2018). Nucleic Acids Research, 10.1093/nar/gkx935.

CharProtDB: a database of experimentally characterized protein annotations.
R. Madupu et al (2012). Nucleic Acids Research, 10.1093/nar/gkr1133.

The carbohydrate-active enzymes database (CAZy) in 2013.
V. Lombard et al (2014). Nucleic Acids Research, 10.1093/nar/gkt1178.

The Transporter Classification Database (TCDB): recent advances
M. H. Saier, Jr. et al (2016). Nucleic Acids Research, 10.1093/nar/gkv1103.

REBASE - a database for DNA restriction and modification: enzymes, genes and genomes.
R. J. Roberts et al (2015). Nucleic Acids Research, 10.1093/nar/gku1046.

Deep annotation of protein function across diverse bacteria from mutant phenotypes.
M. N. Price et al (2016). bioRxiv, 10.1101/072470.

by Morgan Price, Arkin group
Lawrence Berkeley National Laboratory