Family Search for PF01169 (UPF0016)
April 2024: See Interactive Tools for Functional Annotation of Bacterial Genomes for advice on using these tools.
PF01169 hits 52 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.
B7FUM2 GDT1 family protein (Fragment) from Phaeodactylum tricornutum (strain CCAP 1055/1)
2 alignments in 9:215 / 218 (68.8%), covering up to 98.7% of PF01169, 161.9 bits
- The LysE Superfamily of Transport Proteins Involved in Cell Physiology and Pathogenesis.
Tsu, PloS one 2015 - “...v CaCA2 P76249 G9Y0F1 K9ULS7 P52876 73.0 13.0 62.4 1.3 CadD v CaCA2 O05469 L2SR21 B7FUM2 P52876 50.7 14.2 57.2 2.0 RhtB v MntP P76249 C4GM93 D9SW99 O27840 45.9 13.7 37.5 1.9 CadD v MntP O05469 H3NKZ1 Q727E5 O27840 48.0 15.7 34.3 1.0 CaCA2 v MntP...”
- “...CadD v TerC O05469 WP_010652183 G8LRD3 B5UIP4 46.0 13.6 38.5 3.9 CaCA2 v TerC P52876 B7FUM2 D7V5X7 B5UIP4 57.2 16.2 62.9 1.3 MntP v TerC P76264 E7S0L5 A2TWJ9 Q7UHX7 43.9 13.5 40.3 2.6 ILT v TerC Q58AJ4 G6EJJ4 Q8KAT3 B5UIP4 125.3 13.1 37.6 0.7 LysE v...”
E0UDP4 GDT1 family protein from Gloeothece verrucosa (strain PCC 7822)
2 alignments in 6:203 / 211 (70.6%), covering up to 100.0% of PF01169, 158.3 bits
sll0615 transmembrane protein FT27 from Synechocystis sp. PCC 6803
P52876 GDT1-like protein sll0615 from Synechocystis sp. (strain PCC 6803 / Kazusa)
2 alignments in 6:197 / 206 (72.3%), covering up to 98.7% of PF01169, 158.1 bits
- Gene expression and organization of thylakoid protein complexes in the PSII-less mutant of Synechocystis sp. PCC 6803
Kılıç, Plant direct 2022 - “...the adjacent operon sll1472 sll1475 . Expression of genes encoding a Mn 2+ transporter ( sll0615 ), a member of the PatA family of transcription regulators ( slr1594 ) and several hypothetical proteins were also significantly downregulated (Table 1 ). Nevertheless, the number of significantly differentially...”
- “...Hik32 phytochrome 2.1 .0183 slr1594 PatA subfamily protein 4.8 .0197 slr1593 Hypothetical protein 4.3 .0345 sll0615 Mn 2+ membrane transporter 2.2 .0240 slr1152 Hypothetical protein 4.1 .0100 slr7057 Hypothetical protein 2.4 .0228 Note : Genes marked with * are in same operon. Fold change (FC)>2 indicates...”
- Integrative analysis of the salt stress response in cyanobacteria
Klähn, Biology direct 2021 - “...twofold in salt-acclimated cells. Many other transport proteins such as Slr0798 (Zinc-transporting ATPase, FC 1.64), Sll0615 (GDT1-like, possible Ca 2+ /H + antiporter, FC 1.59) or those involved in uptake of nutrients such as nitrate, phosphate, or magnesium were also present in higher amounts in salt-acclimated...”
- Proteomic analysis reveals resistance mechanism against biofuel hexane in Synechocystis sp. PCC 6803
Liu, Biotechnology for biofuels 2012 - “...biopolymer transport protein exbB-like 2 Slr1531 0.66 Signal recognition particle protein Slr1139 0.63 0.66 Thioredoxin Sll0615 0.61 Transmembrane protein FT 27 Sll0518, Sll0596, Sll0783, Sll0872, Sll1118, Sll1304, Slr0007, Slr0147, Slr0168, Slr0723, Slr1260, Slr1363, Slr1385, Ssr2254 Hypothetical proteins *Proteins with 1.5 fold change and p- value less...”
- New insights into the pathogenicity of TMEM165 variants using structural modeling based on AlphaFold 2 predictions
Legrand, Computational and structural biotechnology journal 2023 - “...A. thaliana UniProtKB ID Q94AX5) (mean pLDDT = 88.5) and SynPAM71/MNX ( Synechocystis UniProtKB ID P52876) (mean pLDDT = 93.9), and plasma membrane MneA ( V. cholerae UniprotKB ID A0A0H3AJF5) (mean pLDDT = 88.4). For all proteins, except SynPAM71, N -terminally-truncated sequences were used for AF2...”
- The LysE Superfamily of Transport Proteins Involved in Cell Physiology and Pathogenesis.
Tsu, PloS one 2015 - “...P76249 G9Y0F1 G9WHF3 O05469 72.0 11.9 a 36.0 1.1 LysE v CaCA2 P94633 E0MXD6 C1MR94 P52876 63.0 13.5 31.7 1.6 RhtB v CaCA2 P76249 G9Y0F1 K9ULS7 P52876 73.0 13.0 62.4 1.3 CadD v CaCA2 O05469 L2SR21 B7FUM2 P52876 50.7 14.2 57.2 2.0 RhtB v MntP P76249...”
- “...1.9 CadD v MntP O05469 H3NKZ1 Q727E5 O27840 48.0 15.7 34.3 1.0 CaCA2 v MntP P52876 E0UDP4 C0DV56 P76264 74.5 15.1 57.3 1.3 RhtB v ILT P0AG34 A1RAR9 Q2NBF8 Q58AJ4 50.5 13.7 125.9 0.4 CadD v ILT O05469 C2D135 G5JVH6 Q5HSD5 43.1 13.5 41.0 4.2 CaCA2...”
F0Y333 GDT1 family protein (Fragment) from Aureococcus anophagefferens
2 alignments in 6:211 / 223 (67.3%), covering up to 98.7% of PF01169, 157.6 bits
- The LysE Superfamily of Transport Proteins Involved in Cell Physiology and Pathogenesis.
Tsu, PloS one 2015 - “...CadD v ILT O05469 C2D135 G5JVH6 Q5HSD5 43.1 13.5 41.0 4.2 CaCA2 v ILT P52876 F0Y333 Q97V64 Q4J7V8 52.7 15.3 67.2 5.3 LysE v TerC P94633 D7GFT1 Q20ZD5 I3XAB3 40.8 14.6 72.7 -0.2 RhtB v TerC P76249 K8W4X6 WP_010022951 B5UIP4 63.3 13.5 54.9 1.4 CadD v...”
- “...13 of the ILT homologue Sso1 (Q97V64) with TMSs 13 of the CaCA2 homologue Aan1 (F0Y333). This comparison yielded a score of 15.3 S.D ( S5C Fig ). A score of 67.2 S.D. resulted when comparing the full sequences of Sso1 and ILT protein, TC# 2.A.108.3.3...”
Q4V899 Putative divalent cation/proton antiporter TMEM165 from Rattus norvegicus
2 alignments in 98:311 / 323 (46.1%), covering up to 98.7% of PF01169, 154.9 bits
TM165_MOUSE / P52875 Putative divalent cation/proton antiporter TMEM165; TPA-regulated locus protein; Transmembrane protein 165; Transmembrane protein PFT27; Transmembrane protein TPARL from Mus musculus (Mouse) (see paper)
NP_035756 transmembrane protein 165 precursor from Mus musculus
2 alignments in 98:311 / 323 (46.1%), covering up to 98.7% of PF01169, 154.9 bits
- function: Putative divalent cation:proton antiporter that exchanges calcium or manganese ions for protons across the Golgi membrane. Mediates the reversible transport of calcium or manganese to the Golgi lumen driven by the proton gradient and possibly the membrane potential generated by V-ATPase. Provides calcium or manganese cofactors to resident Golgi enzymes and contributes to the maintenance of an acidic luminal Golgi pH required for proper functioning of the secretory pathway (By similarity). Promotes Ca(2+) storage within the Golgi lumen of the mammary epithelial cells to be then secreted into milk (PubMed:30622138). The transport mechanism and stoichiometry remains to be elucidated (By similarity).
catalytic activity: Ca(2+)(in) + n H(+)(out) = Ca(2+)(out) + n H(+)(in) (RHEA:76631)
catalytic activity: n H(+)(out) + Mn(2+)(in) = n H(+)(in) + Mn(2+)(out) (RHEA:76635) - Repeated Exposure of Macrophages to Synthetic Amorphous Silica Induces Adaptive Proteome Changes and a Moderate Cell Activation
Torres, Nanomaterials (Basel, Switzerland) 2022 - “...treatment, with a moderate median change of 30%, while the few lysosomal membranes detected (Q9CQW9, P52875, Q9Z0M5, P24668) were increased. This prompted us to test the lysosomal integrity by the acridine orange ratiometric method [ 54 ]. The results, shown in Figure 5 A, indicated no...”
- TMEM165 a new player in proteoglycan synthesis: loss of TMEM165 impairs elongation of chondroitin- and heparan-sulfate glycosaminoglycan chains of proteoglycans and triggers early chondrocyte differentiation and hypertrophy.
Khan, Cell death & disease 2021 - GeneRIF: TMEM165 a new player in proteoglycan synthesis: loss of TMEM165 impairs elongation of chondroitin- and heparan-sulfate glycosaminoglycan chains of proteoglycans and triggers early chondrocyte differentiation and hypertrophy.
- The Ca(2+)/H(+) antiporter TMEM165 expression, localization in the developing, lactating and involuting mammary gland parallels the secretory pathway Ca(2+) ATPase (SPCA1).
Reinhardt, Biochemical and biophysical research communications 2014 (PubMed)- GeneRIF: The timing, magnitude of TMEM165 expression and its Golgi location supports a role for this Golgi Ca2+/H+ antiporter as a contributor to mammary Golgi calcium transport needs, in addition to the better-characterized roles of SPCA1 and 2.
TM35_000032530 uncharacterized protein from Trypanosoma theileri
2 alignments in 14:237 / 260 (57.7%), covering up to 98.7% of PF01169, 153.9 bits
TM165_HUMAN / Q9HC07 Putative divalent cation/proton antiporter TMEM165; Transmembrane protein 165; Transmembrane protein PT27; Transmembrane protein TPARL from Homo sapiens (Human) (see 6 papers)
TC 2.A.106.2.2 / Q9HC07 Ca2+:H+ antiporter, TMEM165 (PT27; TPARL) of 324 aas and 7 TMSs in a 1 (N-erminal) + 3 + 3 TMS arrangement from Homo sapiens
NP_060945 transmembrane protein 165 precursor from Homo sapiens
2 alignments in 98:312 / 324 (46.0%), covering up to 98.7% of PF01169, 153.9 bits
- function: Putative divalent cation:proton antiporter that exchanges calcium or manganese ions for protons across the Golgi membrane. Mediates the reversible transport of calcium or manganese to the Golgi lumen driven by the proton gradient and possibly the membrane potential generated by V-ATPase. Provides calcium or manganese cofactors to resident Golgi enzymes and contributes to the maintenance of an acidic luminal Golgi pH required for proper functioning of the secretory pathway (PubMed:32047108, PubMed:23569283, PubMed:22683087, PubMed:27008884) (By similarity). Promotes Ca(2+) storage within the Golgi lumen of the mammary epithelial cells to be then secreted into milk (By similarity). The transport mechanism and stoichiometry remains to be elucidated.
catalytic activity: Ca(2+)(in) + n H(+)(out) = Ca(2+)(out) + n H(+)(in) (RHEA:76631)
catalytic activity: n H(+)(out) + Mn(2+)(in) = n H(+)(in) + Mn(2+)(out) (RHEA:76635) - substrates: Ca2+, protons
tcdb comment: It may be both a Ca2+:H+ and a Mn2+:H+ antiporter (Dulary et al. 2016), catalyzing uptake of Mn2+ from the cytoplasm into the golgi lumen. TMEM165 has been linked to congenital disorders of glycosylation (CDG). It may influence glycosylation due to its Mn2+ transport activity that regulates Mn2+ homeostasis in the golgi (Thines et al. 2018). TMEM165 is also required for milk production (Snyder et al. 2019) - Insights into the regulation of cellular Mn2+ homeostasis via TMEM165.
Vicogne, Biochimica et biophysica acta. Molecular basis of disease 2023 - GeneRIF: Insights into the regulation of cellular Mn[2+] homeostasis via TMEM165.
- Fetal bovine serum impacts the observed N-glycosylation defects in TMEM165 KO HEK cells.
Vicogne, Journal of inherited metabolic disease 2020 - GeneRIF: Fetal bovine serum impacts the observed N-glycosylation defects in TMEM165 KO HEK cells.
- The human Golgi protein TMEM165 transports calcium and manganese in yeast and bacterial cells.
Stribny, The Journal of biological chemistry 2020 - GeneRIF: The human Golgi protein TMEM165 transports calcium and manganese in yeast and bacterial cells.
- Serum bikunin isoforms in congenital disorders of glycosylation and linkeropathies.
Haouari, Journal of inherited metabolic disease 2020 (PubMed)- GeneRIF: Serum bikunin isoforms in congenital disorders of glycosylation and linkeropathies.
- Dissection of TMEM165 function in Golgi glycosylation and its Mn2+ sensitivity.
Lebredonchel, Biochimie 2019 - GeneRIF: The results show the crucial importance of two conserved motifs of TMEM165 (E-x-G-D-K-[TF] and E-x-G-D-R-[SQ]) and underline the contribution of some specific amino acids in both Golgi glycosylation and Mn(2+) sensitivity.
- Investigating the functional link between TMEM165 and SPCA1.
Lebredonchel, The Biochemical journal 2019 (PubMed)- GeneRIF: TMEM165 was constitutively degraded in lysosomes in the absence of SPCA1.
- TMEM165, a Golgi transmembrane protein, is a novel marker for hepatocellular carcinoma and its depletion impairs invasion activity.
Lee, Oncology reports 2018 - GeneRIF: High TMEM165 expression is associated with hepatocellular carcinoma.
- TMEM165 deficiencies in Congenital Disorders of Glycosylation type II (CDG-II): Clues and evidences for roles of the protein in Golgi functions and ion homeostasis.
Dulary, Tissue & cell 2017 (PubMed)- GeneRIF: This manuscript is a review of the current state of knowledge on TMEM165 deficiencies in Congenital Disorders of Glycosylation as well as new data on function of TMEM165 and some speculative models on TMEM165/Golgi functions are discussed.
- More
- New insights into the pathogenicity of TMEM165 variants using structural modeling based on AlphaFold 2 predictions.
Legrand, Computational and structural biotechnology journal 2023 - “...signal peptides [32] . AF2 prediction conducted on the full-size human TMEM165 sequence (UniProtKB ID Q9HC07) provided five models with average pLDDT (predicted local distance difference test), a per-residue estimate of its confidence on a scale from 0 to 100 [15] , ranging from 71.56 to...”
- “...family. The figure shows the ribbon diagrams predicted by AF2 of human TMEM165 (UniProtKB ID Q9HC07) (mean pLDDT = 86.3) located in the Golgi apparatus, yeast Golgi Gdt1p ( S. cerevisiae UniProtKB ID P38301) (mean pLDDT = 83.8), plant Golgi PML3/BICAT3 ( A. thaliana - UniProtKB...”
- Desmocollin-1 is associated with pro-metastatic phenotype of luminal A breast cancer cells and is modulated by parthenolide.
Lapcik, Cellular & molecular biology letters 2023 - “...beta-13 Q9Y5F0 PCDHB13 3.70 1.82E06 2.29 1.71E03 NA NA NA NA TM165 Transmembrane protein 165 Q9HC07 TMEM165 3.68 3.12E03 1.33 4.51E03 0.41 9.12E06 0.08 0.234 TIM23 Mitochondrial import inner membrane translocase subunit Tim23 O14925 TIMM23 3.50 1.02E03 1.25 0.032 0.10 0.131 0.03 0.244 UPK3L Uroplakin-3b-like protein...”
- Towards understanding the extensive diversity of protein N-glycan structures in eukaryotes.
Toustou, Biological reviews of the Cambridge Philosophical Society 2022 - “...local alignment tool for proteins (BlastP) search with the human TMEM165 protein sequence (accession number Q9HC07) was also carried using the nonredundant protein sequences ( https://blast.ncbi.nlm.nih.gov/ ) or in the EnsemblProtists database ( Phaeodactylum tricornutum ), to identify additional similar sequences. Phylogeny created using the Phylogeny.fr...”
- COVID-19 Salivary Protein Profile: Unravelling Molecular Aspects of SARS-CoV-2 Infection.
Esteves, Journal of clinical medicine 2022 - “...Rab-6A RAB6A 2.18 Antigen receptor-mediated signaling pathway P58499 Protein FAM3B FAM3B 2.25 Antimicrobial response protein Q9HC07 Transmembrane protein 165 TMEM165 2.42 Humoral immune response Q9UBX7 Kallikrein-11 KLK11 2.61 * Protein metabolism Q6UXB3 Ly6/PLAUR domain-containing protein 2 LYPD2 2.62 Mitotic cell cycle Q04941 Proteolipid protein 2 PLP2...”
- Identification of TRAMs as sphingolipid-binding proteins using a photoactivatable and clickable short-chain ceramide analog.
Deng, The Journal of biological chemistry 2021 - “...Q8NBN3 TMEM87A Golgi 0.000 0.000 Q8NBX0 SCCPDH Other 0.038 0.038 Q8TB61 SLC35B2 Golgi 0.052 0.012 Q9HC07 TMEM165 Golgi 0.037 0.037 Q9UIQ6 LNPEP Plasma membrane 0.061 0.031 The majority of the proteins we identified is localized in the Golgi ( Fig.5 D and Table1 ). This observation...”
- Comparison of a human neuronal model proteome upon Japanese encephalitis or West Nile Virus infection and potential role of mosquito saliva in neuropathogenesis.
Besson, PloS one 2020 - “...Q9BT22 56052 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 2.01 (1,08E-02) P04844 6185 RPN2 ribophorin II 1.98 (1,66E-06) Q9HC07 55858 TMEM165 transmembrane protein 165 1.97 (2,59E-02) 10.1371/journal.pone.0232585.t005 Table 5 Top 10 proteins down-regulated by SGE in JEV and/or WNV infected cells. Proteins are sorted according to the fold change...”
- Type 1 diabetes cadaveric human pancreata exhibit a unique exocrine tissue proteomic profile
Liu, Proteomics 2016 - “...11.7 36.9 0.41 4.230 Q99614 Tetratricopeptide repeat protein 1 TTC1 7 23.6 33.5 0.34 5.107 Q9HC07 Transmembrane protein 165 TMEM165 4 16.4 34.9 0.33 3.629 Q14515 SPARC-like protein 1 SPARCL1 4 11.9 61.8 0.25 3.231 Significance of the Study This is the most comprehensive study of...”
- High-throughput quantitative proteomic analysis of dengue virus type 2 infected A549 cells.
Chiu, PloS one 2014 - “...protease that mediates the degradation of misfolded and unassembled polypeptides in the peroxisomal matrix. TMEM165 Q9HC07 Transmembrane protein 165 0.47 2 1.3510 2 May function as a calcium/proton transporter involved in calcium and in lysosomal pH homeostasis. CASKIN2 Q8WXE0 Caskin-2 0.48 3 1.9810 7 Unknown BAIAP2...”
- More
LPMP_190290 membrane protein, putative from Leishmania panamensis
2 alignments in 14:227 / 252 (59.5%), covering up to 98.7% of PF01169, 153.2 bits
NP_997848 transmembrane protein 165 precursor from Danio rerio
2 alignments in 78:293 / 305 (48.9%), covering up to 98.7% of PF01169, 153.2 bits
ABZJ_03714 TMEM165/GDT1 family protein from Acinetobacter baumannii MDR-ZJ06
2 alignments in 5:181 / 191 (79.6%), covering up to 98.7% of PF01169, 153.0 bits
- Colistin Resistance in Acinetobacter baumannii MDR-ZJ06 Revealed by a Multiomics Approach
Hua, Frontiers in cellular and infection microbiology 2017 - “...N-alpha-acetylglutamate synthase (amino-acid acetyltransferase) 1.77044 10.25589 3.24E-20 1.27E-18 ABZJ_01151 hypothetical protein 1.634908 3.574211 4.88E-06 3.84E-05 ABZJ_03714 hypothetical protein 1.61859 8.500912 1.39E-08 1.85E-07 ABZJ_01900 acetoin:2,6-dichlorophenolindophenol oxidoreductase subunit alpha 1.527437 6.102611 2.98E-06 2.49E-05 ABZJ_01222 hypothetical protein 1.515854 2.111384 0.011897 0.034227 ABZJ_01191 hypothetical protein 1.46809 2.203352 0.011349 0.032877 ABZJ_01872...”
Q2JWH3 GDT1 family protein from Synechococcus sp. (strain JA-3-3Ab)
2 alignments in 6:198 / 207 (72.5%), covering up to 100.0% of PF01169, 151.9 bits
- The LysE Superfamily of Transport Proteins Involved in Cell Physiology and Pathogenesis.
Tsu, PloS one 2015 - “...Protein Accession # # of TMSs in Protein TMSs aligned Score (S.D.) Figure # CaCA2 Q2JWH3 6 13 and 46 13.5 S11A I7M883 6 13 and 46 11.3 S11B K4DX00 6 13 and 46 5.7 S11C ILT Q8YX33 7 13 and 46 10.7 S12A K9Q6B8 7...”
- “...protein ( S12 Fig ). Comparing the first and second halves of the Ssp2 protein (Q2JWH3), TMSs 13 and TMSs 46 were found to align. The comparison yielded a score of 13.5 S.D., which is sufficient to establish the existence of two homologous internal repeats. The...”
DQ04_01591030 putative membrane protein from Trypanosoma grayi
2 alignments in 14:225 / 248 (60.5%), covering up to 98.7% of PF01169, 151.5 bits
LOC107436693 transmembrane protein 165 from Parasteatoda tepidariorum
2 alignments in 89:302 / 312 (47.8%), covering up to 98.7% of PF01169, 150.9 bits
AT1G68650 hypothetical protein from Arabidopsis thaliana
2 alignments in 9:218 / 228 (65.8%), covering up to 98.7% of PF01169, 150.2 bits
- Homologous Proteins of the Manganese Transporter PAM71 Are Localized in the Golgi Apparatus and Endoplasmic Reticulum
Hoecker, Plants (Basel, Switzerland) 2020 - “...PAM71-like proteins: PML3 (encoded by At5g36290 ), PML4 (encoded by At1g25520) and PML5 (encoded by At1g68650 ). According to the Transporter Classification Database (TCDB) [ 24 ] this protein family (classification number 2.A.106 in the TCDB) belongs to the LysE superfamily, this superfamily contains no other...”
- “...numbers: NP_564825.1 (PAM71, At1g64150); NP_193095.2 (CMT1, At4g13590); NP_568535.1 (PML3, At5g36290); NP_173923.1 (PML4, At1g25520); NP_177032.1 (PML5, At1g68650). Boxplots were generated in Excel 2016 and a one-way ANOVA with post-hoc Tukey HSD test was performed [ 52 ]. 5. Conclusions The main goal of the present study was...”
- The Understanding of the Plant Iron Deficiency Responses in Strategy I Plants and the Role of Ethylene in This Process by Omic Approaches
Li, Frontiers in plant science 2017 - “...AT2G32270 ZIP3, ZINC TRANSPORTER 3 PRECURSOR 0.5 0.4 0.2 0.2 0.4 0.5 0.3 Not assigned AT1G68650 Unknown protein 0.9 0.7 0.5 0.5 0.4 0.4 0.4 AT2G36885 Unknown protein 0.9 0.6 0.4 0.4 0.4 0.3 0.4 a Underlined genes were also regulated by ethylene . Among the...”
- “...iron homeostasis (Xu and Moller, 2004 ; Xu et al., 2005 ). Notably, two genes AT1G68650 and AT2G36885 encoding proteins with unknown functions were observed to be down-regulated more than two-fold and await further study. CO-expression network of Fe/ethylen response core genes It is assumed that...”
- Iron homeostasis in Arabidopsis thaliana: transcriptomic analyses reveal novel FIT-regulated genes, iron deficiency marker genes and functional gene networks
Mai, BMC plant biology 2016 - “...-1 -1 0 -1 -1 0 0 -1 -1 0 -0.58 uncharacterized protein family (UPF0016) AT1G68650 -1 0 0 0 -1 -1 -1 -1 -1 0 -1 0 -0.58 PER21 AT2G37130 -1 0 -1 -1 0 -1 -1 0 0 -1 -1 0 -0.58 FER4 AT2G40300...”
- Genome-wide discovery and analysis of phased small interfering RNAs in Chinese sacred lotus
Zheng, PloS one 2014 - “...2.5 Similar to DNAJB13 DnaJ homolog subfamily B member 13 sfd_88_1_siR6 NNU_012697 2.5 Similar to At1g68650 GDT1-like protein 5 sfd_5_1_siR8 NNU_016474 2.5 Similar to TIFY6B Protein TIFY 6B sfd_39_1_siR3 NNU_003001 2.5 Similar to MYB315 Myb-related protein 315 sfd_88_1_siR7 NNU_010637 2.5 Similar to ABP19A Auxin-binding protein ABP19a...”
- Use of natural variation reveals core genes in the transcriptome of iron-deficient Arabidopsis thaliana roots
Stein, Journal of experimental botany 2012 - “...family protein 1.6 1.5 2.4 2.8 At2g36885 Unknown protein 1.7 Down Down Down 2.8 2.5 At1g68650 Unknown protein Down Down 2.4 2.3 a Buckhout et al . (2009) b Garcia et al . (2010) c Long et al . (2010) d Dinnenny et al . (2008)...”
- Early iron-deficiency-induced transcriptional changes in Arabidopsis roots as revealed by microarray analyses
Buckhout, BMC genomics 2009 - “...251735_at At3g56090 Ferritin 3 (ATFER3) 0.007 253393_at At4g32690 Expressed protein, 2-on-2 hemoglobin (GLB3) 0.034 262277_at At1g68650 Expressed transmembrane protein of unknown function 0.002 263549_at At2g21650 MEE3 (maternal effect embryo arrest 3); myb-like transcription factor 0.001 263840_at At2g36885 Expressed protein with unknown function 0.001 a Listed are...”
AT1G25520 hypothetical protein from Arabidopsis thaliana
Q9C6M1 GDT1-like protein 4 from Arabidopsis thaliana
2 alignments in 9:220 / 230 (65.2%), covering up to 98.7% of PF01169, 150.0 bits
- Identification of Yellow Seed Color Genes Using Bulked Segregant RNA Sequencing in Brassica juncea L
Wang, International journal of molecular sciences 2024 - “...qSCA09-7 A09 42,895,126 42,896,198 12.29 0.28 BjuOA09G40800 AT1G14800 qSCA09-7 A09 42,915,568 42,917,540 78.09 32.19 BjuOA09G40860 AT1G25520 qSCA09-7 A09 43,276,364 43,278,604 34.41 3.97 BjuOA09G41440 AT1G26680 qSCA09-7 A09 43,368,606 43,369,235 26.12 1.14 BjuOA09G41640 AT5G13930 qSCA09-7 A09 43,401,376 43,402,160 69.82 12.92 BjuOA09G41660 AT1G26920 qSCA09-7 A09 44,111,932 44,114,261 184.46 646.93...”
- Homologous Proteins of the Manganese Transporter PAM71 Are Localized in the Golgi Apparatus and Endoplasmic Reticulum
Hoecker, Plants (Basel, Switzerland) 2020 - “...refer here as PML for PAM71-like proteins: PML3 (encoded by At5g36290 ), PML4 (encoded by At1g25520) and PML5 (encoded by At1g68650 ). According to the Transporter Classification Database (TCDB) [ 24 ] this protein family (classification number 2.A.106 in the TCDB) belongs to the LysE superfamily,...”
- “...the following accession numbers: NP_564825.1 (PAM71, At1g64150); NP_193095.2 (CMT1, At4g13590); NP_568535.1 (PML3, At5g36290); NP_173923.1 (PML4, At1g25520); NP_177032.1 (PML5, At1g68650). Boxplots were generated in Excel 2016 and a one-way ANOVA with post-hoc Tukey HSD test was performed [ 52 ]. 5. Conclusions The main goal of the...”
- The Mediator complex subunits MED25/PFT1 and MED8 are required for transcriptional responses to changes in cell wall arabinose composition and glucose treatment in Arabidopsis thaliana
Seguela-Arnaud, BMC plant biology 2015 - “...genes on chromosome 1 showed strongly reduced RNA levels in soh715hsr8-1 compared to hsr8-1 (At1g25510, At1g25520, At1g25530, At1g25540, At1g25550, At1g25560; Fig. 2a ). This result, taken together with the preliminary genetic mapping data, indicated that a deletion encompassing 6 genes on chromosome 1 suppressed the hsr8-1...”
- Microsome-associated proteome modifications of Arabidopsis seedlings grown on board the International Space Station reveal the possible effect on plants of space stresses other than microgravity
Mazars, Plant signaling & behavior 2014 - “...protein Q9LV60 AT5G48540 2.506 cysteine-rich repeat secretory protein 55 O82251 AT2G47840 2.440 uncharacterized protein Q9C6M1 AT1G25520 2.376 putative transmembrane protein Q9SZV4 AT4G30010 2.168 uncharacterized protein Q0WPB8 2.165 hypothetical protein Q9SN96 AT5G59613 2.142 uncharacterized protein Q38842 AT4G00860 2.043 uncharacterized protein Q9FF91 AT5G23890 2.023 uncharacterized protein Q9ASX8 AT1G27760...”
- Using the Yeast Three-Hybrid System to Identify Proteins that Interact with a Phloem-Mobile mRNA
Cho, Frontiers in plant science 2012 - “...metallothionein 2B 0.007 TC217979 50 #61 AT3G15610 Transducin/WD40 repeat-like superfamily protein 3E34 TC199143 5 #62 AT1G25520 Uncharacterized protein family (UPF0016) 3E88 TC215875 5 #64 AT2G19730 Ribosomal L28e protein family 4E59 TC200167 5 #65 AT3G16240 DELTA-TIP, TIP2;1, DELTA-TIP1, AQP1, ATTIP2;1 3E77 TC195833 5 #66 AT2G42610 LSH10 |...”
- Microsome-associated proteome modifications of Arabidopsis seedlings grown on board the International Space Station reveal the possible effect on plants of space stresses other than microgravity
Mazars, Plant signaling & behavior 2014 - “...uncharacterized protein Q9LV60 AT5G48540 2.506 cysteine-rich repeat secretory protein 55 O82251 AT2G47840 2.440 uncharacterized protein Q9C6M1 AT1G25520 2.376 putative transmembrane protein Q9SZV4 AT4G30010 2.168 uncharacterized protein Q0WPB8 2.165 hypothetical protein Q9SN96 AT5G59613 2.142 uncharacterized protein Q38842 AT4G00860 2.043 uncharacterized protein Q9FF91 AT5G23890 2.023 uncharacterized protein Q9ASX8...”
MSMEG_5329 hypothetical protein from Mycobacterium smegmatis str. MC2 155
2 alignments in 6:180 / 246 (61.0%), covering up to 98.7% of PF01169, 148.9 bits
PA4629 hypothetical protein from Pseudomonas aeruginosa PAO1
2 alignments in 5:178 / 192 (79.2%), covering up to 100.0% of PF01169, 147.4 bits
- High-throughput detection of RNA processing in bacteria
Gill, BMC genomics 2018 - “...recJ , nrdG , PA3522, PA3949, PA5325 5 8 3,312,5773,312,693 PA2952.1 117 Not identified PA14sr_061 PA4629 2 2 3,545,5723,545,872 PA3159.1 301 pant292 no PA14 ortholog None 2 3 3,697,2263,697,433 PA3299.1 208 Not identified Not identified PA0690, cyoB 2 1 3,930,2823,930,639 PA3514.1 358 pant326 no PA14 ortholog...”
Q48MR5 GDT1 family protein from Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
2 alignments in 6:180 / 194 (78.4%), covering up to 98.7% of PF01169, 147.4 bits
XP_712922 putative ribosome biosynthesis protein from Candida albicans SC5314
2 alignments in 106:337 / 350 (42.9%), covering up to 98.7% of PF01169, 145.6 bits
GDT1_YEAST / P38301 Divalent cation/proton antiporter GDT1; GCR1-dependent translation factor 1 from Saccharomyces cerevisiae (strain ATCC 204508 / S288c) (Baker's yeast) (see 6 papers)
YBR187W Gdt1p from Saccharomyces cerevisiae
NP_009746 putative ribosome biosynthesis protein GDT1 from Saccharomyces cerevisiae S288C
2 alignments in 43:268 / 280 (53.6%), covering up to 98.7% of PF01169, 145.5 bits
- function: Divalent cation:proton antiporter that exchanges calcium or manganese ions for protons across the Golgi membrane. Mediates the reversible transport of calcium or manganese to the Golgi lumen driven by the proton gradient and possibly the membrane potential generated by V-ATPase. Provides calcium or manganese cofactors to resident Golgi enzymes and contributes to the maintenance of an acidic luminal Golgi pH required for proper functioning of the secretory pathway. The transport stoichiometry remains to be elucidated.
catalytic activity: Ca(2+)(in) + n H(+)(out) = Ca(2+)(out) + n H(+)(in) (RHEA:76631)
catalytic activity: n H(+)(out) + Mn(2+)(in) = n H(+)(in) + Mn(2+)(out) (RHEA:76635)
disruption phenotype: Growth deficiency in the presence of high calcium concentrations. - Investigation the global effect of rare earth gadolinium on the budding Saccharomyces cerevisiae by genome-scale screening
Cao, Frontiers in microbiology 2022 - “...antiporter with Ca 2+ /H + and K + /H + exchange activity vacuole membrane YBR187W GDT1 Ca 2+ and Mn 2+ transporter with higher affinity for Ca 2+ Golgi apparatus/ vacuole membrane YJL129C TRK1 Component of the Trk1p-Trk2p potassium transport system plasma membrane YNL323W LEM3...”
- Deletion of a Golgi protein in Trypanosoma cruzi reveals a critical role for Mn2+ in protein glycosylation needed for host cell invasion and intracellular replication
Ramakrishnan, PLoS pathogens 2021 - “...Topology models of T . cruzi TcGDT1 (TcCLB.506211.50) (C) and orthologs from S . cerevisiae (YBR187W) (B) and H . sapiens (ENSP0000370736) (A). GDT1 sequences were analyzed using Protter. (D) Protein sequence alignment was performed using Clustal Omega. Highlighted amino acids indicate the position of critical...”
- “...(LINF_190008000); L . donovani strain LV9 (LdBPK_19310.1); Homo sapiens _TMEM165 (ENSP0000370736); S . cerevisiae _GDT1 (YBR187W); T . cruzi _YC6 (TcYC6_0114230); T. cruzi_BrA4 (TcBrA4_0085790). (TIF) Click here for additional data file. S1 Table Oligonucleotide primers used in this work. (DOCX) Click here for additional data file....”
- The Reduced Level of Inorganic Polyphosphate Mobilizes Antioxidant and Manganese-Resistance Systems in Saccharomyces cerevisiae
Trilisenko, Cells 2019 - “...Golgi 1.27 0.82 0.08 YLR220W CCC1 Vacuolar Fe 2+ /Mn 2+ transporter 0.09 0.00 0.56 YBR187W GDT1P Calcium and manganese transporter of Golgi 1.62 0.78 0.87 YBR056W-A MNC1 Putative manganese chelating CYSTM-family protein 2.32 1.24 0.02 Plasma Membrane ATPases YGL008C PMA1 Plasma membrane H + -ATPase...”
- Molecular evolution of a novel family of putative calcium transporters
Demaegd, PloS one 2014 - “...MEGA5 [35] software. Briefly, the sequences were acquired using a psiBLAST algorithm against the GDT1 (YBR187w) sequence and by selecting as much organism variety as possible among the fully sequenced genomes (NCBI genome database: http://www.ncbi.nlm.nih.gov/genome/browse/ , consulted in December 2013). The sequences were then aligned with...”
- Uncovering biological network function via graphlet degree signatures
Milenković, Cancer informatics 2008 - “...4 66.67% 0.00% Protein with binding function or cofactor requirement (structural or catalytic) 4 GDT1 (YBR187W) 6 Krogan 3 1 Transcription 2 100.00% 0.00% YLR455W 19 Krogan 7 2 Transcription 4 80.00% 0.00% Protein with binding function or cofactor requirement (structural or catalytic) 3 PBY1 (YBR094W)...”
- Investigating the function of Gdt1p in yeast Golgi glycosylation.
Dulary, Biochimica et biophysica acta. General subjects 2018 (PubMed)- GeneRIF: Gdt1p,to sustain the Golgi glycosylation process, imports Mn(2+) inside the Golgi lumen when Pmr1p exclusively transports Ca(2+). Gdt1p is a Mn(2+)-sensitive protein whose abundance dependents on the kind of the ion transported by Pmr1p. The aspartic residues of the 2 conserved motifs E-x-G-D-[KR], in the cation binding sites of Gdt1p, play a role in Golgi glycosylation and hence in Mn(2+)/Ca(2+)transport.
- The yeast protein Gdt1p transports Mn2+ ions and thereby regulates manganese homeostasis in the Golgi.
Thines, The Journal of biological chemistry 2018 - GeneRIF: obtained first evidence that Gdt1p from yeast directly transports manganese, which strongly reinforces the suggested link between the UPF0016 family and Mn(2+) homeostasis
- H+ and Pi Byproducts of Glycosylation Affect Ca2+ Homeostasis and Are Retrieved from the Golgi Complex by Homologs of TMEM165 and XPR1.
Snyder, G3 (Bethesda, Md.) 2017 - GeneRIF: Erd1 transports Pi in the opposite direction from XPR1 and other EXS family proteins and facilitates byproduct removal from the Golgi complex together with Gdt1
- Yeast Gdt1 is a Golgi-localized calcium transporter required for stress-induced calcium signaling and protein glycosylation.
Colinet, Scientific reports 2016 - GeneRIF: Gdt1p controls cellular calcium stores and plays a major role in the calcium response induced by osmotic shock when the Golgi calcium pump, Pmr1p, is absent. Furthermore, in the presence of a high concentration of external calcium, Gdt1p is required for glycosylation of carboxypeptidase Y and the glucanosyltransferase Gas1p.
- New insights into the pathogenicity of TMEM165 variants using structural modeling based on AlphaFold 2 predictions
Legrand, Computational and structural biotechnology journal 2023 - “...= 86.3) located in the Golgi apparatus, yeast Golgi Gdt1p ( S. cerevisiae UniProtKB ID P38301) (mean pLDDT = 83.8), plant Golgi PML3/BICAT3 ( A. thaliana - UniProtKB ID Q93Y38) (mean pLDDT = 84.6), chloroplast inner membrane CMT1/PAM71-HL ( A. thaliana UniProtKB ID Q9T0H9) (mean pLDDT...”
- Exploring hierarchical and overlapping modular structure in the yeast protein interaction network
Liu, BMC genomics 2010 - “...19.64 transcription O13563 25.25 protein catabolic process P36139 19.64 transcription P36003 25.25 protein catabolic process P38301 19.64 transcription P50086 25.25 protein catabolic process P38352 19.64 transcription P53196 25.25 protein catabolic process P38717 19.64 transcription Q06665 25.25 protein catabolic process P38915 19.64 transcription Q05778 25.25 protein catabolic...”
AT5G36290 hypothetical protein from Arabidopsis thaliana
NP_568535 Uncharacterized protein family (UPF0016) from Arabidopsis thaliana
Q93Y38 GDT1-like protein 3 from Arabidopsis thaliana
2 alignments in 86:284 / 293 (51.2%), covering up to 98.7% of PF01169, 145.4 bits
- The trans-Golgi-localized protein BICAT3 regulates manganese allocation and matrix polysaccharide biosynthesis
He, Plant physiology 2022 - “...Genome Initiative locus numbers for the genes mentioned in this article are as follows: BICAT3 (AT5G36290); ECA3 (AT1G10130). Supplemental data The following materials are available in the online version of this article. Supplemental Figure S1 . Expression of BICAT3:Venus driven by the native BICAT3 promoter complements...”
- Towards understanding the extensive diversity of protein N-glycan structures in eukaryotes
Toustou, Biological reviews of the Cambridge Philosophical Society 2022 - “...al .( 2021 ) recently characterized the function of PML3 (photosynthesisaffected mutant 71 like 3; At5g36290), one of the five UPF0016 family members found in Arabidopsis thaliana , and demonstrated that PML3 played a critical role in Golgi glycosylation and cell wall biosynthesis under Mn 2+...”
- A Golgi-localized manganese transporter functions in pollen tube tip growth to control male fertility in Arabidopsis
Zhang, Plant communications 2021 - “...member of the UPF0016 family in Arabidopsis , PML3 (photosynthesis-affected mutant 71- l ike 3, AT5G36290) ( Hoecker etal., 2020 ), is a cis -Golgi-localized Mn transporter that plays a key role in Mn homeostasis and is crucial for leaf and pollen tube growth. Results PML3...”
- “...PML3 protein in planta , we analyzed two transfer-DNA (T-DNA) insertional alleles of PML3 ( AT5G36290 ) named pml3-1 (GABI_027F07) and pml3-2 (SALK_097998). Transcript analysis using RT-PCR showed that pml3-1 was a knockout allele and pml3-2 was a knockdown allele ( Figure4 A and 4B). Both...”
- Homologous Proteins of the Manganese Transporter PAM71 Are Localized in the Golgi Apparatus and Endoplasmic Reticulum
Hoecker, Plants (Basel, Switzerland) 2020 - “...[ 23 ], which we refer here as PML for PAM71-like proteins: PML3 (encoded by At5g36290 ), PML4 (encoded by At1g25520) and PML5 (encoded by At1g68650 ). According to the Transporter Classification Database (TCDB) [ 24 ] this protein family (classification number 2.A.106 in the TCDB)...”
- “...51 ] under the following accession numbers: NP_564825.1 (PAM71, At1g64150); NP_193095.2 (CMT1, At4g13590); NP_568535.1 (PML3, At5g36290); NP_173923.1 (PML4, At1g25520); NP_177032.1 (PML5, At1g68650). Boxplots were generated in Excel 2016 and a one-way ANOVA with post-hoc Tukey HSD test was performed [ 52 ]. 5. Conclusions The main...”
- Overexpression of a developing xylem cDNA library in transgenic poplar generates high mutation rate specific to wood formation
Rauschendorfer, Plant biotechnology journal 2020 - “...superfamily protein 3F107.1 0 Potri.006G279100 AT4G31270 HARBINGER TRANSPOSON DERIVED PROTEIN 2 (HDP2) 3F108.2 4.5E86 Potri.013G086700 AT5G36290 Uncharacterized protein family (UPF0016) 3F127 0 Potri.018G047700 AT2G26280 CTCINTERACTING DOMAIN 7 (CID7) 3F165 2.1E176 Potri.004G210800 AT2G28430 C3HC4 type family protein 3F166 3.5E89 Potri.009G010800 AT2G28305 LONELY GUY 1 (LOG1) 3F177 8.9E176...”
- Prevalence of alternative splicing choices in Arabidopsis thaliana
English, BMC plant biology 2010 - “...ESTs G A G P ESTs G P AS type Size D R % MF AT5G36290 Uncharacterised protein family UPF0016 (InterPro: IPR001727) .1 30 .2 16 RI 100 (U) 34 AT5G62000 Encodes an auxin response factor. Mutants have ... defects including enlarged rosette leaves, reduced fertility,...”
- A Golgi-localized manganese transporter functions in pollen tube tip growth to control male fertility in Arabidopsis.
Zhang, Plant communications 2021 - GeneRIF: A Golgi-localized manganese transporter functions in pollen tube tip growth to control male fertility in Arabidopsis.
- New insights into the pathogenicity of TMEM165 variants using structural modeling based on AlphaFold 2 predictions
Legrand, Computational and structural biotechnology journal 2023 - “...ID P38301) (mean pLDDT = 83.8), plant Golgi PML3/BICAT3 ( A. thaliana - UniProtKB ID Q93Y38) (mean pLDDT = 84.6), chloroplast inner membrane CMT1/PAM71-HL ( A. thaliana UniProtKB ID Q9T0H9) (mean pLDDT = 83.9), thylakoid membrane PAM71 ( A. thaliana UniProtKB ID Q94AX5) (mean pLDDT =...”
- “...fifth-ranked (right mean pLDDT = 80.3) AF2-predicted ribbon diagrams of A. thaliana PML3/BICAT3 (UniprotKB ID Q93Y38) deleted of the first 77 N -terminal aa residues are shown. The blue and red disks indicate the surfaces of the hydrophobic layer at the cytosolic and Golgi lumen sides,...”
TGME49_119550 membrane protein C17G8.08c, putative from Toxoplasma gondii ME49
2 alignments in 63:335 / 343 (44.0%), covering up to 100.0% of PF01169, 145.3 bits
SO_1071 TMEM165/GDT1 family protein from Shewanella oneidensis MR-1
2 alignments in 5:178 / 184 (82.6%), covering up to 98.7% of PF01169, 144.9 bits
SO1071 conserved hypothetical protein from Shewanella oneidensis MR-1
2 alignments in 18:191 / 197 (77.2%), covering up to 98.7% of PF01169, 144.5 bits
- Discovering cis-regulatory RNAs in Shewanella genomes by Support Vector Machines
Xu, PLoS computational biology 2009 - “...0.523 rpsB ribosomal protein S2 RF00127 t44 RNA RNA gene 34 24346699 1.000 1.000 + SO1071 conserved hypothetical protein RF00080 yybP-ykoY Riboswitch 39 24347085 1.000 0.997 + pheA chorismate mutase/prephenate dehydratase RF00513 Trp_leader RNA element 64 24346616 1.000 1.000 + SO1007 conserved hypothetical protein RF00168 Lysine...”
SPAC17G8.08c human TMEM165 homolog from Schizosaccharomyces pombe
2 alignments in 51:278 / 287 (52.3%), covering up to 98.7% of PF01169, 143.8 bits
D3TSM2 GDT1 family protein from Glossina morsitans morsitans
2 alignments in 106:320 / 331 (45.0%), covering up to 100.0% of PF01169, 143.4 bits
A1S_3326 hypothetical protein from Acinetobacter baumannii ATCC 17978
2 alignments in 1:166 / 176 (80.1%), covering up to 98.7% of PF01169, 143.2 bits
PP0760 conserved hypothetical protein from Pseudomonas putida KT2440
2 alignments in 6:179 / 194 (78.4%), covering up to 100.0% of PF01169, 142.8 bits
VC0022 conserved hypothetical protein from Vibrio cholerae O1 biovar eltor str. N16961
2 alignments in 21:194 / 200 (76.5%), covering up to 98.7% of PF01169, 142.4 bits
MNEA_VIBC3 / A0A0H3AJF5 Putative manganese exporter; Manganese exporter A from Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395) (see paper)
2 alignments in 21:194 / 200 (76.5%), covering up to 98.7% of PF01169, 141.8 bits
- function: Involved in manganese homeostasis. May function as a manganese exporter.
disruption phenotype: Mutant exhibits sensitivity to manganese but not to other cations. Under high-manganese conditions, the mutant accumulates high levels of intracellular manganese with a concomitant decrease in intracellular iron levels. Mutant also shows a small, but significant, increase in resistance to oxidative stress induced by hydrogen peroxide.
VDA_003255 TMEM165/GDT1 family protein from Photobacterium damselae subsp. damselae CIP 102761
2 alignments in 5:178 / 185 (82.7%), covering up to 98.7% of PF01169, 140.3 bits
- Molecular Epidemiology of Photobacterium damselae subsp. damselae Outbreaks in Marine Rainbow Trout Farms Reveals Extensive Horizontal Gene Transfer and High Genetic Diversity
Terceti, Frontiers in microbiology 2018 - “...A PCR using the primer pair ups-colp-F and downs-colp-R , designed within the flanking genes VDA_003255 and VDA_003256, respectively, produces an amplicon of 4,456 bp. (B) Gelatinase-negative strains test negative for internal primers of colP gene (data not shown), and yield a smaller amplification fragment of...”
- “...DK32 yields a different amplicon band due to the insertion of a transposase gene between VDA_003255 and VDA_003256. (D) Agarose gel electrophoresis of the three different amplicon sizes produced with primer pair ups-colp-F and downs-colp-R , revealing three different genotypes in the variable region encoding ColP...”
- Chromosome-Encoded Hemolysin, Phospholipase, and Collagenase in Plasmidless Isolates of Photobacterium damselae subsp. damselae Contribute to Virulence for Fish
Vences, Applied and environmental microbiology 2017 - “...Photobacterium). colP is located between two genes annotated as VDA_003255 and VDA_003256 in the type strain (Fig. 7B). By PCR analysis, we confirmed that the...”
VSAL_II1080 TMEM165/GDT1 family protein from Aliivibrio salmonicida LFI1238
2 alignments in 5:178 / 185 (82.7%), covering up to 98.7% of PF01169, 140.1 bits
VSAL_II1080 membrane protein from Vibrio salmonicida LFI1238
2 alignments in 9:182 / 189 (81.0%), covering up to 98.7% of PF01169, 140.0 bits
D1JG69 Conserved hypothetical membrane protein, UPF0016 family from Uncultured archaeon
2 alignments in 6:179 / 185 (81.6%), covering up to 97.3% of PF01169, 139.2 bits
K9ULS7 GDT1 family protein from Chamaesiphon minutus (strain ATCC 27169 / PCC 6605)
2 alignments in 6:212 / 220 (74.5%), covering up to 98.7% of PF01169, 139.1 bits
CNE04690 vacuole protein from Cryptococcus neoformans var. neoformans JEC21
2 alignments in 15:284 / 302 (49.7%), covering up to 100.0% of PF01169, 138.8 bits
I7M883 GDT1 family protein from Tetrahymena thermophila (strain SB210)
2 alignments in 51:286 / 296 (50.7%), covering up to 97.3% of PF01169, 138.5 bits
- The LysE Superfamily of Transport Proteins Involved in Cell Physiology and Pathogenesis.
Tsu, PloS one 2015 - “...Protein TMSs aligned Score (S.D.) Figure # CaCA2 Q2JWH3 6 13 and 46 13.5 S11A I7M883 6 13 and 46 11.3 S11B K4DX00 6 13 and 46 5.7 S11C ILT Q8YX33 7 13 and 46 10.7 S12A K9Q6B8 7 13 and 46 9.4 S12B J2KV33 7...”
- “...TMS#13 and TMS#46 for three CaCA2 homologues with assigned UniProt accession numbers. (A) Q2JWH3. (B) I7M883. (C) K4DX00. (PDF) Click here for additional data file. S13 Fig Identification of internal repeats in the ILT family. GSAT comparisons between TMS#13 and TMS#46 for three ILT homologues with...”
YLY5_SCHPO / Q9P7Q0 GDT1-like protein C186.05c from Schizosaccharomyces pombe (strain 972 / ATCC 24843) (Fission yeast) (see paper)
SPAC186.05c human TMEM165 homolog from Schizosaccharomyces pombe
2 alignments in 28:254 / 262 (57.3%), covering up to 98.7% of PF01169, 137.0 bits
- Inorganic polyphosphate abets silencing of a sub-telomeric gene cluster in fission yeast
Sanchez, microPublication biology 2023 - “...strain. The log2 fold changes are shown. Systematic ID Gene Product log2 fold change upregulated SPAC186.05c gdt1 Golgi calcium and manganese antiporter 6.82 SPAC186.06 PhzF protein family 5.71 SPAC750.01 NADP-dependent aldo/keto reductase 5.52 SPAC186.04c 5.55 SPBPB10D8.03 pseudogene transporter 1.29 SPCC1223.13 cbf12 DNA-binding transcription factor 1.10 SPBC1711.15c...”
- “...analyses Gene Strand Sequence act1 Sense 5AAGTACCCCATTGAGCACGG Antisense 5CAGTCAACAAGCAAGGGTGC SPAC186.04c Sense 5GCGAAGAAAACCCAACAAGC Antisense 5TCATCGTTTACTCTGATCCGTGA gdt1 (SPAC186.05c) Sense 5AAATTTTCCCGGGCTTTCAT Antisense 5TCCGACAATCACCGCTACC SPAC186.06 Sense 5GGGAGTGGAGCTGGATCAGT Antisense 5CGCCACCAACATGAATATCG SPAC750.01 Sense 5TATTGGGAAGACTGGGTGCTTGAAG Antisense 5CCAACCAATTCTTCTGACACCCCA Primers for all genes (except for act1 ) were the same used by Cohen et al....”
- Dataset describing the genome wide effects on transcription resulting from alterations in the relative levels of the bZIP transcription factors Atf1 and Pcr1 in Schizosaccharomyces pombe
Basu, Data in brief 2022 - “...snR30 non-coding RNA SPAC823.17 tom6 mitochondrial TOM complex subunit Tom6 SPAC688.16 SPAC688.16 human TMEM254 ortholog SPAC186.05c gdt1 Golgi calcium and manganese antiporter Gdt1 SPBC660.05 wwm3 WW domain containing conserved fungal protein Wwm3 SPBC2A9.02 SPBC2A9.02 NADH-dependent glycolaldehyde/furfural/butyraldehyde/propylaldehydealdehyde reductase SPAC22F8.05 SPAC22F8.05 alpha,alpha-trehalose-phosphate synthase SPAC4G8.02c sss1 translocon gamma subunit...”
- Global regulation of heterochromatin spreading by Leo1
Verrier, Open biology 2015 - “...indicated loci relative to total H3, normalized to wild-type. ( e ) RT-qPCR analysis of SPAC186.05c + transcript levels relative to a control transcript act1 + , normalized to wild-type. ( f ) ChIP-qPCR analysis of H4K16ac levels at the SPAC186.05c + locus relative to total...”
- A metabolic strategy to enhance long-term survival by Phx1 through stationary phase-specific pyruvate decarboxylases in fission yeast
Kim, Aging 2014 - “...crp79, SPBC530.02, abc3, atp2 non-coding RNA 6 prl3, SPNCRNA.93, SPNCRNA.133, SPNCRNA.134, prl7, SPNCRNA.63 others 25 SPAC186.05c, SPAC977.07c, SPAC186.04c, SPAC1A6.03c, mik1, SPAC212.03, SPAPB18E9.05c, SPAC977.04, SPAC977.05c, SPAC977.02, SPCC584.16c, SPAC513.04, SPBC359.06, SPAPB15E9.01c, SPBC1348.04, SPAC977.03, SPBC9B6.03, SPCC553.10, SPCC1450.07c, SPBPB2B2.19c, SPBC1348.03, arg7, SPAC977.01, SPAC27E2.04c, SPAC24C9.08 The genes positively affected by Phx1...”
- The SET domain protein, Set3p, promotes the reliable execution of cytokinesis in Schizosaccharomyces pombe
Rentas, PloS one 2012 - “...expected, this list included set3 itself, as well as mfm2 , and the uncharacterized ORF, SPAC186.05c. Thus, under normal growth conditions where the set3 mutant shows no obvious phenotype gene expression patterns were not altered to a great extent. 10.1371/journal.pone.0031224.g008 Figure 8 Identification of S. pombe...”
- Role for cohesin in the formation of a heterochromatic domain at fission yeast subtelomeres
Dheur, Molecular and cellular biology 2011 - “...SPAC869.10c SPAC186.01 SPAC186.02c SPAC186.04c SPAC186.05c SPAC186.06 SPAC750.07c act1 Forward Reverse TTTTGGACAGAATGGATGGA ACGGCATCGCTTGTACTTTT...”
- “...in mis4-367 at 25C SPAC186.06 SPBCPT2R1.02 SPAC186.05c SPAC186.04c SPAC212.02 SPAC750.05c SPAC977.04 Downregulated in mis4-367 at 37C SPMIT.06 SPMIT.04...”
- Expression profiling of S. pombe acetyltransferase mutants identifies redundant pathways of gene regulation
Nugent, BMC genomics 2010 - “...Gene Log change p-value Gene Log change p-value Gene Log change p-value his3 -5.12 7.16E-03 SPAC186.05c -3.77 4.00E-07 SPAC186.05c -4.31 1.11E-04 SPAC186.05c -4.09 1.26E-07 SPBPB2B2.06c -3.66 6.60E-07 SPAC186.06 -3.23 7.69E-03 gcn5 -3.47 1.08E-02 SPAC186.06 -3.52 1.94E-06 inv1 -2.57 4.30E-02 SPBPB2B2.06c -3.26 3.11E-06 SPAC17G8.13c -2.76 2.03E-02 str1...”
- Sterol regulatory element binding protein is a principal regulator of anaerobic gene expression in fission yeast
Todd, Molecular and cellular biology 2006 - “...SPAP8A3.02c rds1 Unknown SPAC22A12.06c SPBPB7E8.01 SPAC18G6.01c SPAC186.05c SPBC21D10.06c Descriptionb Fold changec WT / O2 WT/sre1 YGR012W YPR1, GCY1...”
L7L942 GDT1 family protein from Gordonia hirsuta DSM 44140 = NBRC 16056
2 alignments in 11:192 / 251 (65.3%), covering up to 98.7% of PF01169, 136.8 bits
PAM71_ARATH / Q94AX5 Protein PAM71, chloroplastic; CA(2+)/H(+) ANTIPORTER 1; GDT1-like protein 1; PHOTOSYNTHESIS AFFECTED MUTANT71 from Arabidopsis thaliana (Mouse-ear cress) (see 2 papers)
AT1G64150 hypothetical protein from Arabidopsis thaliana
2 alignments in 160:361 / 370 (43.2%), covering up to 98.7% of PF01169, 136.8 bits
- function: Mn(2+)/H(+) exchanger, which transport Mn(2+)from the chloroplast stroma into the acidic thylakoid lumen (PubMed:27020959). Might be a chloroplast-localized Ca(2+)/H(+) antiporter (PubMed:27302341). Regulates Ca(2+), Mn(2+) and pH homeostasis (PubMed:27302341). Required for chloroplast development (PubMed:27302341).
subunit: Homodimer.
disruption phenotype: Defects in photosynthesis and reduced growth rate (PubMed:27302341, PubMed:27020959). Pale yellow leaves with reduced PSII activity (PubMed:27302341). Altered Ca(2+) and Mn(2+) partitioning in chloroplasts and reduced Mn(2+) binding to PSII (PubMed:27020959). - New insights into the pathogenicity of TMEM165 variants using structural modeling based on AlphaFold 2 predictions
Legrand, Computational and structural biotechnology journal 2023 - “...UniProtKB ID Q9T0H9) (mean pLDDT = 83.9), thylakoid membrane PAM71 ( A. thaliana UniProtKB ID Q94AX5) (mean pLDDT = 88.5) and SynPAM71/MNX ( Synechocystis UniProtKB ID P52876) (mean pLDDT = 93.9), and plasma membrane MneA ( V. cholerae UniprotKB ID A0A0H3AJF5) (mean pLDDT = 88.4). For...”
- Shoot and root single cell sequencing reveals tissue- and daytime-specific transcriptome profiles
Apelt, Plant physiology 2022 - “...the chloroplastic antiporter CA ( 2+ )/ H ( + ) ANTIPORTER1 ( CCHA1 , AT1G64150) necessary for the assembly of the PSII core subunits and the oxygen-evolving complex ( Wang et al., 2016 ). Another example of distinct sugar metabolism was found in the ED...”
- Chloroplast pH Homeostasis for the Regulation of Photosynthesis
Trinh, Frontiers in plant science 2022 - “...et al., 2014 Armbruster et al., 2016 Wang et al., 2017 Wang and Shikanai, 2019 At1g64150 CCHA1 PAM71 BICAT1 Thylakoid membranes Putative Ca 2+/ H + antiporter Mn 2+ , Ca 2+ , and pH homeostasis in chloroplasts Bivalent cation transporter Wang et al., 2016 Schneider...”
- A metabolic, phylogenomic and environmental atlas of diatom plastid transporters from the model species Phaeodactylum
Liu, Frontiers in plant science 2022 - “...( Pick etal., 2013 ), the GDT1-family Ca 2+ /H + antiporter CCHA1 and CMT1 (AT1G64150 and AT4G13590) ( Wang etal., 2016 ), and members of the BASS superfamily (AT2G26900, AT4G22840, AT4G12030, AT1G78560) ( Figure1C ). These may represent distant mitochondrial homologues of A. thaliana plastid...”
- Homologous Proteins of the Manganese Transporter PAM71 Are Localized in the Golgi Apparatus and Endoplasmic Reticulum
Hoecker, Plants (Basel, Switzerland) 2020 - “...National Center for Biotechnology Information [ 51 ] under the following accession numbers: NP_564825.1 (PAM71, At1g64150); NP_193095.2 (CMT1, At4g13590); NP_568535.1 (PML3, At5g36290); NP_173923.1 (PML4, At1g25520); NP_177032.1 (PML5, At1g68650). Boxplots were generated in Excel 2016 and a one-way ANOVA with post-hoc Tukey HSD test was performed [...”
- Chloroplast Calcium Signaling in the Spotlight
Navazio, Frontiers in plant science 2020 - “...At5g53010 Calcium-transporting ATPase, putative P2B-type calcium cation-transporting ATPase mitochondrion, PM, ER plastid Tomizioli etal., 2014 At1g64150 AtBICAT1/AtPAM71/AtCCHA1 Putative calcium/manganese cation transporter PAM71-type manganese/calcium cation transporter plastid, mitochondrion thylakoid membrane Mn 2+ homeostasis, phototropic growth, chloroplast Ca 2+ homeostasis, photosynthesis Wang etal., 2016 ; Schneider etal., 2016...”
- An integrated approach (CLuster Analysis Integration Method) to combine expression data and protein-protein interaction networks in agrigenomics: application on Arabidopsis thaliana
Santoni, Omics : a journal of integrative biology 2014 - “...AT1G32640 AT1G28480 AT2G02810 AT3G02140 AT2G22510 AT1G64150 AT1G31280 AT1G24260 AT2G38300 AT4G22212 AT1G62180 AT4G34920 AT4G37890 AT4G14060 AT4G11310 AT4G11280...”
- AGAMOUS controls GIANT KILLER, a multifunctional chromatin modifier in reproductive organ patterning and differentiation
Ng, PLoS biology 2009 - “...1-PEX, AT1G14540; 1-RIG, AT1G80400; 1-SEC, AT1G56660; 1-SKK, AT1G60940; 1-SRP, AT1G47710; 1-TIN, AT1G22810; 1-TNY, AT1G74930; 1-TRA, AT1G64150; 2-AG5, AT2G42830; 2-ATH, AT2G35270; 2-BRA, AT2G19460; 2-BZP, AT2G36270; 2-CHA, AT2G02710; 2-CON, AT2G15590; 2-CTH, AT2G04240; 2-CYP, AT2G28850; 2-DOB, AT2G41940; 2-DSK, AT2G17530; 2-INI, AT2G31430; 2-LIP, AT2G15230; 2-PHD, AT2G31650; 2-RLK, AT2G02220; 2-SIG, AT2G18770;...”
- Host origin of plastid solute transporters in the first photosynthetic eukaryotes
Tyra, Genome biology 2007 - “...exchanger At1g54320 Ligand-effect modulator 3 (LEM3) family At1g59870 ABC transporter At1g61800 Glucose-6-phosphate/phosphate translocator 2 (GPT2) At1g64150 Expressed protein At1g66950 ABC transporter At1g70610 Transporter associated with antigen processing protein 1 (AtTAP1) At1g79450 Ligand-effect modulator 3 (LEM3) family At2g04620 Cation efflux family protein At2g13100 Glycerol-3-phosphate transporter At2g27810 Xanthine/uracil...”
PA71H_ARATH / Q9T0H9 Protein PAM71-homolog, chloroplastic; GDT1-like protein 2; PHOTOSYNTHESIS AFFECTED MUTANT71-homolog from Arabidopsis thaliana (Mouse-ear cress) (see paper)
TC 2.A.106.1.7 / Q9T0H9 Photosynthesis-affected mutant 71, PAM71 homologue, PAM71-HL, of 359 aas and 7 TMSs (Hoecker et al. 2017). Probably a manganese ion transporter; a member of the UPF0016 family from Arabidopsis thaliana
AT4G13590 hypothetical protein from Arabidopsis thaliana
2 alignments in 147:351 / 359 (43.2%), covering up to 100.0% of PF01169, 135.4 bits
- function: Probable chloroplast-localized Mn(2+)/H(+) and/or Ca(2+)/H(+) antiporter regulating Ca(2+), Mn(2+) and pH homeostasis.
- substrates: Manganese 2+
- New insights into the pathogenicity of TMEM165 variants using structural modeling based on AlphaFold 2 predictions
Legrand, Computational and structural biotechnology journal 2023 - “...ID Q93Y38) (mean pLDDT = 84.6), chloroplast inner membrane CMT1/PAM71-HL ( A. thaliana UniProtKB ID Q9T0H9) (mean pLDDT = 83.9), thylakoid membrane PAM71 ( A. thaliana UniProtKB ID Q94AX5) (mean pLDDT = 88.5) and SynPAM71/MNX ( Synechocystis UniProtKB ID P52876) (mean pLDDT = 93.9), and plasma...”
- Chloroplast pH Homeostasis for the Regulation of Photosynthesis
Trinh, Frontiers in plant science 2022 - “...al., 2014 Aranda Sicilia et al., 2021 At4g00630 KEA2 Chloroplast envelope membrane (distinct spots) * At4g13590 PAM71-HL BICAT2 Chloroplast envelope membrane Putative Ca 2+/ H + antiporter Mn 2+ , Ca 2+ , and pH homeostasis in chloroplasts Bivalent cation transporter Schneider et al., 2016 Frank...”
- A metabolic, phylogenomic and environmental atlas of diatom plastid transporters from the model species Phaeodactylum
Liu, Frontiers in plant science 2022 - “...etal., 2013 ), the GDT1-family Ca 2+ /H + antiporter CCHA1 and CMT1 (AT1G64150 and AT4G13590) ( Wang etal., 2016 ), and members of the BASS superfamily (AT2G26900, AT4G22840, AT4G12030, AT1G78560) ( Figure1C ). These may represent distant mitochondrial homologues of A. thaliana plastid transporters, with...”
- Homologous Proteins of the Manganese Transporter PAM71 Are Localized in the Golgi Apparatus and Endoplasmic Reticulum
Hoecker, Plants (Basel, Switzerland) 2020 - “...Biotechnology Information [ 51 ] under the following accession numbers: NP_564825.1 (PAM71, At1g64150); NP_193095.2 (CMT1, At4g13590); NP_568535.1 (PML3, At5g36290); NP_173923.1 (PML4, At1g25520); NP_177032.1 (PML5, At1g68650). Boxplots were generated in Excel 2016 and a one-way ANOVA with post-hoc Tukey HSD test was performed [ 52 ]. 5....”
- Chloroplast Calcium Signaling in the Spotlight
Navazio, Frontiers in plant science 2020 - “...Ca 2+ homeostasis, photosynthesis Wang etal., 2016 ; Schneider etal., 2016 ; Frank etal., 2019 At4g13590 AtBICAT2/AtCMT1 Putative calcium/manganese cation transporter PAM71-type manganese/calcium cation transporter plastid, mitochondrion chloroplast envelope Mn 2+ homeostasis, phototropic growth, chloroplast Ca 2+ homeostasis, photosynthesis Ferro etal., 2010 ; Zybailov etal., 2008...”
- Defining the core proteome of the chloroplast envelope membranes
Simm, Frontiers in plant science 2013 - “...4 I At3g54390 Putative DNA-binding protein (SWI3, ADA2, N-CoR, and TFIIIB) A None 1 III At4g13590 PF27 (small family from bacteria and eukaryotes) belongs to the lysine exporter superfamily) A 7 -Helical TM 4 I At5g03900 Iron-sulfur cluster biosynthesis family protein A 2 -Helical TM 4...”
- “...to the IE membrane. The proteins encoded by AT1G33810, AT1G42960, AT2G35800, AT2G38550, AT3G02900, AT3G10840, AT3G32930, AT4G13590, AT5G03900, AT5G08540, and AT5G12470 are assigned as (inner) envelope proteins (Ferro et al., 2003 , 2010 ; Froehlich et al., 2003 ; Brutigam et al., 2008 ; Brutigam and Weber,...”
- Host origin of plastid solute transporters in the first photosynthetic eukaryotes
Tyra, Genome biology 2007 - “...Cyclic nucleotide-binding transporter 1 At3g45890 Expressed protein At3g52310 ABC transporter At4g00370 Anion transporter 2 (ANTR2) At4g13590 Expressed protein At4g17340 Major intrinsic family protein At4g25750 ABC transporter At4g32400 Adenine nucleotide uniporter At4g32650 Arabidopsis thaliana K + rectifying channel 1 (ATKC1) At4g38380 Multi antimicrobial extrusion (MATE Efflux) protein...”
Rv3848 PROBABLE CONSERVED TRANSMEMBRANE PROTEIN from Mycobacterium tuberculosis H37Rv
2 alignments in 6:180 / 302 (49.7%), covering up to 98.7% of PF01169, 134.3 bits
- Genome-wide screen identifies host loci that modulate Mycobacterium tuberculosis fitness in immunodivergent mice
Meade, G3 (Bethesda, Md.) 2023 - “...43.085 4.19 29.537 52.408 3.09E-03 hp027 Rv2957 Rv2957 5 117.550 3.27 3.143 139.501 3.26E-02 hp028 Rv3848 Rv3848 5 136.015 5.69 133.911 138.657 1.55E-02 hp029 Rv0359 rip2 6 76.492 4.18 75.970 82.500 5.63E-03 hp030 Rv0955 perM 6 82.500 4.80 80.286 83.092 1.29E-02 hp031 Rv2140c TB18.6 6 84.277...”
- Distribution of Common and Rare Genetic Markers of Second-Line-Injectable-Drug Resistance in Mycobacterium tuberculosis Revealed by a Genome-Wide Association Study
Conkle-Gutierrez, Antimicrobial agents and chemotherapy 2022 (secret) - Machine learning and structural analysis of Mycobacterium tuberculosis pan-genome identifies genetic signatures of antibiotic resistance
Kavvas, Nature communications 2018 - “...In addition to these known AMR determinants of ethambutol, our analysis implicated ubiA interactions with Rv3848 in ethambutol resistance (Table 2 and Supplementary Data 4 ). Interestingly, the resistant-dominant allele of Rv3848 occurs exclusively in the background of the AMR-neutral ubiA allele 3, hinting at an...”
- “...(Methods) Table 2 Newly proposed AMR genes Gene Drug Dominant allele Mutation Structural domain feature Rv3848 EMB, XDR R: (25/26) SNP Outside transmembrane helical domain embR EMB S: (2/37, 9/129) SNP Proximal to DNA-binding domain Rv3129 EMB R: (8/11) SNP proC EMB S: (1/27, 11/127) SNP...”
- MntR(Rv2788): a transcriptional regulator that controls manganese homeostasis in Mycobacterium tuberculosis
Pandey, Molecular microbiology 2015 - “...mRNA Wt HMn/LMn Function Rv2358 4.40.6 Transcriptional regulator Rv3269 3.20.8 CHP Rv3418c groES 2.50.1 chaperonin Rv3848 7.32.8 Membrane protein...”
- Virulence regulator EspR of Mycobacterium tuberculosis is a nucleoid-associated protein
Blasco, PLoS pathogens 2012 - “...by 5 RACE using RNA extracted from Mtb H37Rv at mid-log phase. Translational stop of rv3848 and translational start of espR are highlighted in red with +1 corresponding to the first base of the espR open reading frame. Transcriptional start mapped by 5 RACE is boxed...”
- aprABC: a Mycobacterium tuberculosis complex-specific locus that modulates pH-driven adaptation to the macrophage phagosome
Abramovitch, Molecular microbiology 2011 - “...0.9481773 0.89457 0.7828317 Putative esterase/lipase Rv3763 ( lpqH ) 0.58558774 0.90165645 0.74419534 0.8778406 19-kDa lipoprotein Rv3848 0.6989153 1.076215 0.8821779 0.6418377 CHP, putative transmembrane protein aprA -dependent repression MT1802 1.5182296 1.2456129 1.2637565 1.092666 MmpL family protein Rv0204c 1.7301755 1.301969 1.377424 1.7235136 Putative transmembrane protein Rv0677c 1.492198 1.2457488...”
BCG_3911 putative transmembrane protein from Mycobacterium bovis BCG str. Pasteur 1173P2
2 alignments in 6:180 / 302 (49.7%), covering up to 98.7% of PF01169, 133.4 bits
AFUA_3G07080 UPF0016 domain protein, putative from Aspergillus fumigatus Af293
2 alignments in 255:532 / 541 (31.2%), covering up to 97.3% of PF01169, 132.1 bits
- In-host microevolution of Aspergillus fumigatus: A phenotypic and genotypic analysis
Ballard, Fungal genetics and biology : FG & B 2018 - “...C2H2 type zinc finger domain protein C292Y AFUA_3G04300 Actin cytoskeleton organization and biogenesis protein P1125H AFUA_3G07080 UPF0016 domain protein V470M AFUA_3G07940 Phosphoinositide phospholipase C KSS213KS KSS213KS KSS213KS KSS213KS AFUA_3G08570 Uncharacterised protein V54L AFUA_3G08990 Cell surface protein F141S F141S AFUA_3G10250 Cell division control protein (Cdc15) D220G D220G...”
- Receptor-mediated signaling in Aspergillus fumigatus
Grice, Frontiers in microbiology 2013 - “...protein AFUA_3G02450 XP_748568.1 RTA1 domain protein AFUA_3G03310 XP_748650.1 PKS-like enzyme AFUA_3G03540 XP_748674.1 UPF0016 domain protein AFUA_3G07080 XP_754898.1 Phosphatidylinositol: UDP-GlcNAc transferase PIG-C AFUA_3G07170 XP_754889.1 Conserved hypothetical protein AFUA_3G07420 XP_754867.2 DUF1275 domain protein AFUA_3G07550 XP_754856.1 Sucrose transporter AFUA_3G08480 XP_754766.1 Conserved hypothetical protein AFUA_3G09650 XP_754654.1 PQ loop repeat protein...”
C1MR94 GDT1 family protein (Fragment) from Micromonas pusilla (strain CCMP1545)
2 alignments in 4:207 / 207 (69.1%), covering up to 98.7% of PF01169, 128.7 bits
- The LysE Superfamily of Transport Proteins Involved in Cell Physiology and Pathogenesis.
Tsu, PloS one 2015 - “...RhtBvCadD P76249 G9Y0F1 G9WHF3 O05469 72.0 11.9 a 36.0 1.1 LysE v CaCA2 P94633 E0MXD6 C1MR94 P52876 63.0 13.5 31.7 1.6 RhtB v CaCA2 P76249 G9Y0F1 K9ULS7 P52876 73.0 13.0 62.4 1.3 CadD v CaCA2 O05469 L2SR21 B7FUM2 P52876 50.7 14.2 57.2 2.0 RhtB v MntP...”
- “...LysE, and RhtB homologues ( S3AS3C Fig ). TMSs 13 of the CaCA2 homologue Mpu4 (C1MR94) and the LysE homologue Cac2 (E0MXD6) were compared, yielding a score of 13.5 S.D. A score of 31.7 S.D. occurred when comparing the full sequences of Mpu4 and the CaCA2...”
SCO2347 integral membrane protein from Streptomyces coelicolor A3(2)
2 alignments in 8:183 / 193 (77.7%), covering up to 97.3% of PF01169, 126.5 bits
G0PPC8 GDT1 family protein from Streptomyces sp. ACT-1
2 alignments in 9:184 / 194 (76.8%), covering up to 98.7% of PF01169, 122.6 bits
HVO_0820 hypothetical protein from Haloferax volcanii DS2
2 alignments in 9:204 / 233 (64.8%), covering up to 97.3% of PF01169, 90.4 bits
slr1170 unknown protein from Synechocystis sp. PCC 6803
Aligns to 32:107 / 117 (65.0%), covers 98.7% of PF01169, 81.6 bits
- Expression of tardigrade disordered proteins impacts the tolerance to biofuels in a model cyanobacterium Synechocystis sp. PCC 6803
Zhang, Frontiers in microbiology 2022 - “...cytosine methyltransferase ssl7046 3.115 0.022 Putative toxin-antitoxin system toxin component sll8033 3.115 0.022 Hypothetical protein slr1170 2.840 0.000 TMEM165/GDT1 family protein slr0305 2.676 0.012 TVP38/TMEM64 family protein slr7071 2.570 0.018 CRISPR-associated endonuclease Cas1 Top down-regulated genes included hypothetical proteins (9), TF or TF domain-containing proteins (DUF6,...”
- “...( sll0909 ), DNA cytosine methyltransferase, putative toxin-antitoxin system toxin component, TMEM family proteins ( slr1170 and slr0305 ), transposase and CRISPR-associated endonuclease Cas1 ( slr7071 ). Compared with our previous OMIC studies, these TOP genes were not highlighted before ( Wang et al., 2012 ;...”
ssr1558 hypothetical protein from Synechocystis sp. PCC 6803
Aligns to 7:82 / 92 (82.6%), covers 97.3% of PF01169, 74.7 bits
rrnAC0497 unknown from Haloarcula marismortui ATCC 43049
Aligns to 53:129 / 156 (49.4%), covers 97.3% of PF01169, 68.0 bits
- Genome information management and integrated data analysis with HaloLex
Pfeiffer, Archives of microbiology 2008 - “...OE2288F, NP2702A, HQ2668A rrnAC0481 1,002 894 Extended NP2798A rrnAC0494 249 306 Shortened NP4192A, OE1860F, HQ1556A rrnAC0497 708 471 Extended HQ1562A, OE1794R rrnAC0505 1,710 1,485 Extended OE3490R, NP1742A, HQ3347A rrnAC0506 1,527 1,575 Shortened NP3956A, OE2049R rrnAC0536 573 606 Shortened NP2906A, HQ2751A rrnAC0546 1,791 1,833 Shortened HQ1573A, OE1495R,...”
Or search for genetic data about PF01169 in the Fitness Browser
by Morgan Price,
Arkin group
Lawrence Berkeley National Laboratory