Family Search for PF01170 (UPF0020)

PF01170 hits 488 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.

TRM14_METJA / Q57880 tRNA (guanine(6)-N2)-methyltransferase; tRNA m2G6-methyltransferase; EC 2.1.1.256 from Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440) (Methanococcus jannaschii) (see paper)
Q57880 tRNA (guanine6-N2)-methyltransferase (EC 2.1.1.256) from Methanocaldococcus jannaschii (see paper)
WP_010869937 tRNA (guanine(6)-N2)-methyltransferase from Methanocaldococcus jannaschii DSM 2661
MJ0438 conserved hypothetical protein (NCBI ptt file) from Methanocaldococcus jannaschii DSM 2661
Aligns to 166:375 / 381 (55.1%), covers 99.5% of PF01170, 248.5 bits

• function: S-adenosyl-L-methionine-dependent methyltransferase that catalyzes the methylation of the guanosine nucleotide at position 6 (m2G6) in tRNA(Cys).
  catalytic activity: guanosine(6) in tRNA + S-adenosyl-L-methionine = H(+) + N(2)- methylguanosine(6) in tRNA + S-adenosyl-L-homocysteine (RHEA:51116)
• Formation of m2G6 in Methanocaldococcus jannaschii tRNA catalyzed by the novel methyltransferase Trm14.
  Menezes, Nucleic acids research 2011
  • GeneRIF: The MJ0438 gene from Methanocaldococcus jannaschii encodes a novel S-adenosylmethionine-dependent methyltransferase, now identified as Trm14, which generates m(2)G at position 6 in tRNA(Cys).
• tRNA Modification Profiles and Codon-Decoding Strategies in Methanocaldococcus jannaschii.
  Yu, Journal of bacteriology 2019
  • “...(i) m2G(6). Trm14, previously identified in M. jannaschii (MJ0438), is believed to responsible for m2G at position 6 (47). Our mapping analyses detected the...”
  • “...or charging. It is not yet known whether Trm14 (MJ0438) would also be responsible for modifying G67 or if a different methyltransferase is required. M....”
• The open reading frame TTC1157 of Thermus thermophilus HB27 encodes the methyltransferase forming N²-methylguanosine at position 6 in tRNA
  Roovers, RNA (New York, N.Y.) 2012
  • “...from Archaeoglobus fulgidus, PAB0923 from P. abyssi, MJ0438 from Methanocaldococcus jannaschii, and PF1002 from P. furiosus. All these proteins were shown...”
  • “...Amplification of ORF AF2178 Amplification of ORF MJ0438 Amplification of ORF MK0969 Amplification of ORF PAB0923 Amplification of ORF TK1863 Amplification...”
• Formation of m2G6 in Methanocaldococcus jannaschii tRNA catalyzed by the novel methyltransferase Trm14
  Menezes, Nucleic acids research 2011
  • “...m 2 G synthesis in the acceptor stem are uncharacterized. Here, we report that the MJ0438 gene from Methanocaldococcus jannaschii encodes a novel S -adenosylmethionine-dependent methyltransferase, now identified as Trm14, which generates m 2 G at position 6 in tRNA Cys . The 381 amino acid...”
  • “...instead strongly suggests activity toward RNA substrates ( 32 ). Cloning and characterization of the MJ0438 gene product from M. jannaschii , a representive member of the archaeal clade, demonstrates that this protein catalyzes formation of m 2 G6 in M. jannaschii tRNA Cys . This...”

YPSC_BACSU / P50840 Putative RNA methyltransferase YpsC; EC 2.1.1.- from Bacillus subtilis (strain 168) (see paper)
Aligns to 164:370 / 385 (53.8%), covers 99.0% of PF01170, 236.8 bits

• subunit: Interacts with the RNA polymerase core.

RlmK / b0948 fused 23S rRNA m²G2445 methyltransferase and 23S rRNA m⁷G2069 methyltransferase (EC 2.1.1.264; EC 2.1.1.173) from Escherichia coli K-12 substr. MG1655 (see 9 papers)
RLMKL_ECOLI / P75864 Ribosomal RNA large subunit methyltransferase K/L; EC 2.1.1.173; EC 2.1.1.264 from Escherichia coli (strain K12) (see 3 papers)
P75864 23S rRNA (guanine2445-N2)-methyltransferase (EC 2.1.1.173) from Escherichia coli (see 6 papers)
rlmL / P75864 fused 23S rRNA m²G2445 methyltransferase and 23S rRNA m⁷G2069 methyltransferase (EC 2.1.1.264; EC 2.1.1.173) from Escherichia coli (strain K12) (see 8 papers)
rlmL ribosomal RNA large subunit methyltransferase L; EC 2.1.1.52 from Escherichia coli K12 (see 4 papers)
NP_415468 fused 23S rRNA m(2)G2445 methyltransferase and 23S rRNA m(7)G2069 methyltransferase from Escherichia coli str. K-12 substr. MG1655
b0948 predicted methyltransferase (NCBI) from Escherichia coli str. K-12 substr. MG1655
Aligns to 162:376 / 702 (30.6%), covers 99.5% of PF01170, 235.7 bits

• function: Specifically methylates the guanine in position 2445 (m2G2445) and the guanine in position 2069 (m7G2069) of 23S rRNA. Methylation occurs before assembly of 23S rRNA into 50S subunits.
  catalytic activity: guanosine(2445) in 23S rRNA + S-adenosyl-L-methionine = H(+) + N(2)-methylguanosine(2445) in 23S rRNA + S-adenosyl-L-homocysteine (RHEA:42740)
  catalytic activity: guanosine(2069) in 23S rRNA + S-adenosyl-L-methionine = H(+) + N(2)-methylguanosine(2069) in 23S rRNA + S-adenosyl-L-homocysteine (RHEA:43772)
  subunit: Monomer.
• Identification of bacterial factors involved in type 1 fimbria expression using an Escherichia coli K12 proteome chip
  Chen, Molecular & cellular proteomics : MCP 2014
  • “...NP_414592 NP_415912 NP_417164 NP_415785 NP_416249 NP_417399 NP_417573 NP_415468 NP_418508 NP_415858 NP_417776 YjcZ YdaV TrpL YebN Spr YleB YaiX YafZ ApaG PaaG...”
• Base methylations in the double-stranded RNA by a fused methyltransferase bearing unwinding activity.
  Kimura, Nucleic acids research 2012
  • GeneRIF: RlmKL is a novel type of fused methyltransferase bearing dual active sites responsible for different methyl modifications at distinct positions.
• Structure of the bifunctional methyltransferase YcbY (RlmKL) that adds the m7G2069 and m2G2445 modifications in Escherichia coli 23S rRNA.
  Wang, Nucleic acids research 2012
  • GeneRIF: E. coli YcbY is a bifunctional rRNA methyltransferase catalyzing the m2G2445 and m7G2069 modifications located on opposite sides of helix 74.
• Purification, crystallization and preliminary X-ray crystallographic analysis of 23S RNA m(2)G2445 methyltransferase RlmL from Escherichia coli.
  Wang, Acta crystallographica. Section F, Structural biology and crystallization communications 2010
  • GeneRIF: final crystals of RlmL diffracted to 2.2 A resolution
• Identification of Escherichia coli m2G methyltransferases: I. the ycbY gene encodes a methyltransferase specific for G2445 of the 23 S rRNA.
  Lesnyak, Journal of molecular biology 2006 (PubMed)
  • GeneRIF: Results describe the identification of a gene, ycbY, as encoding an enzyme responsible for methylation of 23 S rRNA G2445.
• Evolutionary and sequence-based relationships in bacterial AdoMet-dependent non-coding RNA methyltransferases
  Mosquera-Rendón, BMC research notes 2014
  • “...] RlmK/L* YcbY 23S rRNA m 7 G2069 / m 2 G2445 Class I (RFM) P75864 [ 47 - 49 ] RlmM YgdE 23S rRNA Cm2498 Class I (RFM) P0ADR6 [ 50 ] RlmN YfgB 23S rRNA / tRNAs m2A2503 / m2A37 Radical SAM P36979 [...”
• The Escherichia coli proteome: past, present, and future prospects
  Han, Microbiology and molecular biology reviews : MMBR 2006
  • “...YbiS YbjP YcbL YcbY P0AAX8 P75818 P75849 P75864 5.6/30,863.3 5.48/16,984.75 4.95/23,784.05 8.96/78,854.1 YccU YcdO YceB YceD YceI P75874 P0AB24 P0AB26 P0AB28...”
• Structure of the bifunctional methyltransferase YcbY (RlmKL) that adds the m7G2069 and m2G2445 modifications in Escherichia coli 23S rRNA
  Wang, Nucleic acids research 2012
  • “...KEGG database ( 23 ) ( http://www.genome.jp/kegg ) using the E. coli sequence (accession code b0948) as the query. Candidate sequences were fed into the proteinprotein interaction database StringDB ( 24 ) ( http://string.embl.de ) to detect possible functional relationships. Evidence of gene fusion, as well...”
• Profiling of methyltransferases and other S-adenosyl-L-homocysteine-binding Proteins by Capture Compound Mass Spectrometry (CCMS).
  Lenz, Journal of visualized experiments : JoVE 2010
  • “...rRNA m5C1962 MTase rRNA (m5C) 17 0 17 0 20 RlmL b0948 78.9 23S rRNA m2G2445 MTase rRNA (m2G) 12 0 0 0 10 TrmB b2960 27.3 tRNA (guanine-N(7)-)-MTase tRNA (m7G)...”

ECs1032 putative oxidoreductase (NCBI ptt file) from Escherichia coli O157:H7 str. Sakai
Aligns to 162:376 / 702 (30.6%), covers 99.5% of PF01170, 235.6 bits

• Physiological Response of Escherichia coli O157:H7 Sakai to Dynamic Changes in Temperature and Water Activity as Experienced during Carcass Chilling
  King, Molecular & cellular proteomics : MCP 2016
  • “..., ECs3166 , cydA / ECs0768 , ECs3162 , ECs3168 , ECs1031 , ycbY / ECs1032 , nuoC / ECs3170 ). These results correlate with the T-profiler analysis of the transcriptomic data ( supplemental Table S14 ), with significant downregulation observed for genes involved in aerobic...”

Q0I4C6 Ribosomal RNA large subunit methyltransferase K/L from Haemophilus somnus (strain 129Pt)
Aligns to 162:376 / 718 (29.9%), covers 99.5% of PF01170, 235.5 bits

• Proteomic profiling of liver from Elaphe taeniura, a common snake in eastern and southeastern Asia
  Chen, Genetics and molecular biology 2013
  • “...- Local Elaphe taeniura 6.49/89044 3.50E-07 25 114 70 Ribosomal RNA large subunit methyltransferase L Q0I4C6 Swiss-Prot Haemophilus somnus 129PT 7.96/82748 2.20E-02 25 74 71 Predicted: hypothetical protein gi|114672613 NCBInr Pan troglodytes 7.26/227989 5.20E-02 10 74 73 Protease gi|308187502 NCBInr Pantoea vagans C9-1 5.96/52002 1.30E-02 33...”

S1014 putative oxidoreductase (NCBI ptt file) from Shigella flexneri 2a str. 2457T
Aligns to 162:376 / 702 (30.6%), covers 99.5% of PF01170, 233.4 bits

• Addendum
  , Open forum infectious diseases 2019

AF2178 conserved hypothetical protein (NCBI ptt file) from Archaeoglobus fulgidus DSM 4304
Aligns to 192:386 / 392 (49.7%), covers 99.5% of PF01170, 231.6 bits

• The open reading frame TTC1157 of Thermus thermophilus HB27 encodes the methyltransferase forming N²-methylguanosine at position 6 in tRNA
  Roovers, RNA (New York, N.Y.) 2012
  • “...Thermococcus kodakaraensis, MK0969 from Methanopyrus kandleri, AF2178 from Archaeoglobus fulgidus, PAB0923 from P. abyssi, MJ0438 from Methanocaldococcus...”
  • “...Amplification of ORF PF1002 Amplification of ORF AF2178 Amplification of ORF MJ0438 Amplification of ORF MK0969 Amplification of ORF PAB0923 Amplification...”

YPO1418 conserved hypothetical protein (NCBI ptt file) from Yersinia pestis CO92
Aligns to 162:376 / 706 (30.5%), covers 99.5% of PF01170, 225.2 bits

• Phylogeny and Classification of Yersinia pestis Through the Lens of Strains From the Plague Foci of Commonwealth of Independent States
  Kutyrev, Frontiers in microbiology 2018
  • “...high-mountain focus belong to the 4.ANT branch, as they contain the marker SNP in the YPO1418 locus, as well as the pTP33 plasmid sequence, found in strains of the 4.ANT branch ( Afanasev et al., 2016 ). Whole-genome sequencing of the strains KM932 (I-3223), M-1944, 1454,...”

RLML_NEIMB / Q9K0V4 Ribosomal RNA large subunit methyltransferase L; 23S rRNA m2G2445 methyltransferase; rRNA (guanine-N(2)-)-methyltransferase RlmL; EC 2.1.1.173 from Neisseria meningitidis serogroup B (strain MC58) (see paper)
NMB0455 hypothetical protein (NCBI) from Neisseria meningitidis MC58
Aligns to 165:370 / 380 (54.2%), covers 98.5% of PF01170, 222.6 bits

• function: Specifically methylates the guanine in position 2445 (m2G2445) of 23S rRNA.
  catalytic activity: guanosine(2445) in 23S rRNA + S-adenosyl-L-methionine = H(+) + N(2)-methylguanosine(2445) in 23S rRNA + S-adenosyl-L-homocysteine (RHEA:42740)
• Base methylations in the double-stranded RNA by a fused methyltransferase bearing unwinding activity
  Kimura, Nucleic acids research 2012
  • “...have the same activities as the E. coli RlmKL. We cloned the N. meningitidis rlmL (NMB0455) and rlmK (NMB1367) homologs into multicopy plasmids, and introduced each construct into the E. coli rlmKL strain. As shown in Figure 3 C, the N. meningitidis rlmL and rlmK homologs...”
• Towards New Drug Targets? Function Prediction of Putative Proteins of Neisseria meningitidis MC58 and Their Virulence Characterization
  Shahbaaz, Omics : a journal of integrative biology 2015
  • “...34. 35. 36. 37. 38. 39. Q9K1J6 Q9K196 Q9K0Z2 Q9K0V4 Q9JZ46 Q9JZ42 Q7DDK6 Q9JZH0 Q9JZ67 Q9JYY8 Q9JYF4 Q9JXS3 Q9JXE3 Q9JX96 Q9K164 Q9K0Q3 Q9K0H7 Q9K047 Q9JZX1...”

VC1488 conserved hypothetical protein (NCBI ptt file) from Vibrio cholerae O1 biovar eltor str. N16961
Aligns to 162:375 / 708 (30.2%), covers 99.5% of PF01170, 220.3 bits

• Evidence for the emergence of non-O1 and non-O139 Vibrio cholerae strains with pathogenic potential by exchange of O-antigen biosynthesis regions
  Li, Infection and immunity 2002
  • “...coordinate 1539558) and ending with coordinate 1594273 within VC1488 (encoding a hypothetical protein). It included sequences upstream of RTX, the RTX cassette,...”

3v97A / P75864 Crystal structure of bifunctional methyltransferase ycby (rlmlk) from escherichia coli, sah binding (see paper)
Aligns to 163:374 / 667 (31.8%), covers 99.5% of PF01170, 217.7 bits

• Ligands: alpha-d-glucopyranose; 6-o-octanoyl-beta-d-fructofuranose; s-adenosyl-l-homocysteine (3v97A)

slr0064 hypothetical protein (NCBI ptt file) from Synechocystis sp. PCC 6803
Aligns to 172:380 / 384 (54.4%), covers 99.5% of PF01170, 215.6 bits

• A transcriptional regulator Sll0794 regulates tolerance to biofuel ethanol in photosynthetic Synechocystis sp. PCC 6803
  Song, Molecular & cellular proteomics : MCP 2014
  • “...Sll0853 Sll0858 Sll1127 Sll1283 Sll1750 Sll1871 Sll1980 Slr0064 Slr0080 Slr0115 Slr0288 Slr0646 Slr0649 Slr0783 Slr0809 Slr0889 Slr0984 Slr1490 Slr1718 Slr1829...”
  • “...protein TrxA Putative RNA methyltransferase slr0064; Ribonuclease H Response regulator Glutamate-ammonia ligase Probable D-alanyl-D-alanine carboxypeptidase...”

Q5F6P5 DNA methylase from Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
NGO1504 hypothetical protein (NCBI) from Neisseria gonorrhoeae FA 1090
Aligns to 165:370 / 380 (54.2%), covers 98.5% of PF01170, 206.1 bits

• Quantitative proteomics of the Neisseria gonorrhoeae cell envelope and membrane vesicles for the discovery of potential therapeutic targets
  Zielke, Molecular & cellular proteomics : MCP 2014
  • “...Q5F520 Q5F5E5 Q5F5P4 Q5F5W7 Q5F657 Q5F676 Q5F6K2 Q5F6P5 Q5F7A6 Q5F7C7 Q5FAK6 Q5F9Q0 Q5F9E3 O87406 Name Putative carboxy-terminal processing protease Putative...”
• Quantitative proteomics of the Neisseria gonorrhoeae cell envelope and membrane vesicles for the discovery of potential therapeutic targets
  Zielke, Molecular & cellular proteomics : MCP 2014
  • “...NGO2119 NGO1984 NGO1873 NGO1802 NGO1709 NGO1686 NGO1549 NGO1504 NGO1274 NGO1251 NGO0028 lepB/NGO0343 pilX/NGO0455 NGO0425 1.73 0.17 1.17 0.1 1.01 0.02 1.11...”

lmo1887 similar to conserved hypothetical proteins (NCBI ptt file) from Listeria monocytogenes EGD-e
Q8Y615 Lmo1887 protein from Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Aligns to 163:369 / 382 (54.2%), covers 99.0% of PF01170, 205.5 bits

• Proteomic dataset of Listeria monocytogenes exposed to sublethal concentrations of free and nanoencapsulated nisin
  Pinilla, Data in brief 2022
  • “.../ LNis Annotation not available Q8Y828 lmo1090 lmo1090 Nis / LNis Annotation not available Q8Y615 lmo1887 lmo1887 Nis / LNis Hypothetical protein; belongs to the methyltransferase superfamily Q8Y437 lmo2636 lmo2636 Nis/ LNis Hypothetical protein; flavin transferase that catalyzes the transfer of the FMN moiety of FAD...”
• Proteomic dataset of Listeria monocytogenes exposed to sublethal concentrations of free and nanoencapsulated nisin
  Pinilla, Data in brief 2022
  • “...Nis / LNis Annotation not available Q8Y828 lmo1090 lmo1090 Nis / LNis Annotation not available Q8Y615 lmo1887 lmo1887 Nis / LNis Hypothetical protein; belongs to the methyltransferase superfamily Q8Y437 lmo2636 lmo2636 Nis/ LNis Hypothetical protein; flavin transferase that catalyzes the transfer of the FMN moiety of...”

3v97B / P75864 Crystal structure of bifunctional methyltransferase ycby (rlmlk) from escherichia coli, sah binding (see paper)
Aligns to 143:351 / 641 (32.6%), covers 98.0% of PF01170, 201.9 bits

• Ligands: 6-o-octanoyl-beta-d-fructofuranose; alpha-d-glucopyranose; s-adenosyl-l-homocysteine (3v97B)

SACOL1483 hypothetical protein (NCBI) from Staphylococcus aureus subsp. aureus COL
SAOUHSC_01460 hypothetical protein (NCBI) from Staphylococcus aureus subsp. aureus NCTC 8325
SAUSA300_1336 hypothetical protein (NCBI) from Staphylococcus aureus subsp. aureus USA300_FPR3757
Aligns to 161:368 / 381 (54.6%), covers 99.5% of PF01170, 196.7 bits

• Investigations to the Antibacterial Mechanism of Action of Kendomycin
  Elnakady, PloS one 2016
  • “...gapA2 Glyceraldehyde3-phosphate dehydrogenase 37141 5.95 13 144 100 -1.83 11 1198 HP Putative RNA methylasefamily (SACOL1483) 43621 5.07 12 139 100 -1.81 12 840 fhs Formate-tetrahydrofolateligase 60017 5.76 11 145 100 -1.66 13 599 thrS Threonyl-tRNAsynthetase 74455 5.26 23 189 100 -1.59 14 842 fhs Formate-tetrahydrofolateligase...”
• Aureolib - a proteome signature library: towards an understanding of staphylococcus aureus pathophysiology
  Fuchs, PloS one 2013
  • “...SACOL1447, SACOL2106, SACOL2722, SACOL0618, SACOL0917, SACOL1445; http://www.aureolib.de/?m7 ) or with the tolerance phase (SACOL0427, SACOL0457, SACOL1483, SACOL1768, SACOL2171; http://www.aureolib.de/?m8 ). Stress-specific induction patterns of the synthesis of hypothetical proteins provide first hints for the function of these proteins Of the predicted cytoplasmic proteins in S. aureus...”
• Global analysis of the Staphylococcus aureus response to mupirocin
  Reiss, Antimicrobial agents and chemotherapy 2012
  • “...SACOL0944 SACOL0945 SACOL1108 SACOL1236 SACOL1386 SACOL1483 SACOL2136 SACOL2293 SACOL2335 SACOL2596 SACOL2597 SACOL1773 SACOL1449 SACOL1377 SACOL0829 SACOL1118...”
  • “...SACOL0617 SACOL0944 SACOL0945-2 SACOL1108 SACOL1236 SACOL1386 SACOL1483 SACOL2136 SACOL2293 SACOL2335 SACOL2596 SACOL2597 SerA-1 SucA-1 Tkt-2 TrxB TypA TyrS...”
• A new platform for ultra-high density Staphylococcus aureus transposon libraries
  Santiago, BMC genomics 2015
  • “...likely decreases the pool of menaquinones (Figure 7 B). We also identified insertions in hemY (SAOUHSC_01460), a gene involved in the production of protoheme [ 84 ]. Loss of these factors is thought to shift S. aureus growth towards an anaerobic metabolic regime, which markedly impacts...”
• Short and Robust Anti-Infective Lipopeptides Engineered Based on the Minimal Antimicrobial Peptide KR12 of Human LL-37
  Lakshmaiah, ACS infectious diseases 2021
  • “...SAUSA300_1865 vraR DNA-binding response regulator 1.6 Yes SAUSA300_0647 vraF ABC transporter ATP-binding protein 1.6-3.1 Yes SAUSA300_1336 Hypothetical protein 3.1 No SAUSA300_1898 Conserved hypothetical protein 3.1 No SAUSA300_1037 pheS Phenylalanyl-tRNA synthetase subunit alpha 1.6 Yes SAUSA300_1503 Putative competence protein ComGB 3.1 No SAUSA300_1867 Conserved hypothetical protein 3.1...”
• Resistome of Staphylococcus aureus in Response to Human Cathelicidin LL-37 and Its Engineered Antimicrobial Peptides
  Golla, ACS infectious diseases 2020
  • “...SAUSA300_1228 thrB homoserine kinase SAUSA300_1255 mprF Oxacillin resistance-related FmtC protein SAUSA300_1308 arlR DNA-binding response regulator SAUSA300_1336 Hypothetical protein SAUSA300_1465 2-oxoisovalerate dehydrogenase, E1 component, beta subunit SAUSA300_1469 argR arginine repressor SAUSA300_1503 Putative competence protein ComGB SAUSA300_1515 ABC transporter permease SAUSA300_1865 vraR DNA-binding response regulator SAUSA300_1867 Conserved hypothetical...”
• A secreted bacterial protease tailors the Staphylococcus aureus virulence repertoire to modulate bone remodeling during osteomyelitis
  Cassat, Cell host & microbe 2013
  • “...6.5714 0.0154 Putative phage infection protein; SAUSA300_2578 Q2FGZ5|Q2FGZ5_STAA3 0.0000 6.3333 6.3333 0.0381 Putative uncharacterized protein; SAUSA300_1336 Q2FIF6|Y822_STAA3 1.0000 6.0000 6.0000 0.0307 UPF0051 protein; SAUSA300_0822 Q2FJ32|Q2FJ32_STAA3 0.0000 5.6667 5.6667 0.0131 Putative uncharacterized protein; SAUSA300_0593 Q2FIM8|Y748_STAA3 0.0000 5.6667 5.6667 0.0279 UPF0042 nucleotide-binding protein; SAUSA300_0748 Q2FFY6|Q2FFY6_STAA3 0.0000 5.3333 5.3333...”

SA1277 hypothetical protein (NCBI) from Staphylococcus aureus subsp. aureus N315
SAV1444 similar to methyltransferase (NCBI) from Staphylococcus aureus subsp. aureus Mu50
Aligns to 161:368 / 381 (54.6%), covers 99.5% of PF01170, 196.6 bits

• Characterizing the effects of inorganic acid and alkaline shock on the Staphylococcus aureus transcriptome and messenger RNA turnover
  Anderson, FEMS immunology and medical microbiology 2010
  • “...5-phosphate decarboxylase sa_c4482s3827_a_at 8.1 2.5 2.5 pyrG SA2119 CTP synthase sa_c9613s8375_a_at 2.8 2.5 2.5 pyrH SA1277 uridylate kinase sa_c1147s928_a_at * 13.2 2.5 2.5 pyrR SA1210 pyrimidine regulatory protein sa_c9829s8568_a_at * 3.9 2.5 2.5 tdk SA2111 thymidine kinase sa_c7447s6470_a_at 2.9 2.5 2.5 tmk SA0524 thymidylate kinase sa_c9569s8332_a_at...”
• Genome sequencing of linezolid-resistant Streptococcus pneumoniae mutants reveals novel mechanisms of resistance
  Feng, Genome research 2009
  • “...NRS127 (Table 4). The spr0333 ortholog in S. aureus is SAV1444 (nomenclature of S. aureus Mu50) (Kuroda et al. 2001), and it shares ;45% identity with the S....”
  • “...highest MIC against linezolid, the sequence of the SAV1444 gene revealed a 39-bp deletion in the SAM-methylation domain (Table 4). No mutations were observed...”

DMB76_006500 class I SAM-dependent RNA methyltransferase from Staphylococcus saccharolyticus
Aligns to 161:368 / 378 (55.0%), covers 99.5% of PF01170, 195.8 bits

• Biofilm formation and inflammatory potential of Staphylococcus saccharolyticus: A possible cause of orthopedic implant-associated infections
  Afshar, Frontiers in microbiology 2022
  • “...5.7 2.1 DMB76_004380 DUF3267 domain-containing protein 104.6 2.1 DMB76_002540 copper resistance protein CopC 94.3 2.1 DMB76_006500 class I SAM-dependent RNA methyltransferase 1274.6 2.2 DMB76_000990 intracellular adhesion protein D 7.0 2.4 DMB76_009775 Bax inhibitor-1/YccA family protein 155.8 2.5 DMB76_010290 deoxynucleoside kinase 172.0 2.6 DMB76_001160 Csa1 family protein...”

SCA_1079 class I SAM-dependent RNA methyltransferase from Staphylococcus carnosus subsp. carnosus TM300
Sca_1079 putative RNA methylase (RefSeq) from Staphylococcus carnosus subsp. carnosus TM300
Aligns to 161:368 / 374 (55.6%), covers 99.5% of PF01170, 191.0 bits

• Transcriptomic analysis of staphylococcal sRNAs: insights into species-specific adaption and the evolution of pathogenesis
  Broach, Microbial genomics 2016
  • “...1055393..1055592 SCA_1036 > lysC 3098.2 SCAs031 jacL-31 1080768..1080936 SCA_1060 > SCA_1061 139.58 SCAs032 jacL-32 1098995..1099432 SCA_1079 < SCA_1080 1725.71 SCAs033 jacL-33 1103951..1104094 pbp2 < SCA_1085 230.73 SCAs034 jacL-34 1136220..1136427 SCA_1116 < srrB 1380.1 SCAs035 jacL-35 1239320..1239485 alaS < SCA_1231 28.02 SCAs036 jacL-36 1249565..1249804 SCA_1240 < asp...”
• Transcriptomic analysis of staphylococcal sRNAs: insights into species-specific adaption and the evolution of pathogenesis
  Broach, Microbial genomics 2016
  • “...1055393..1055592 SCA_1036 > lysC 3098.2 SCAs031 jacL-31 1080768..1080936 SCA_1060 > SCA_1061 139.58 SCAs032 jacL-32 1098995..1099432 SCA_1079 < SCA_1080 1725.71 SCAs033 jacL-33 1103951..1104094 pbp2 < SCA_1085 230.73 SCAs034 jacL-34 1136220..1136427 SCA_1116 < srrB 1380.1 SCAs035 jacL-35 1239320..1239485 alaS < SCA_1231 28.02 SCAs036 jacL-36 1249565..1249804 SCA_1240 < asp...”

3lduA / Q186Y7 The crystal structure of a possible methylase from clostridium difficile 630.
Aligns to 164:367 / 377 (54.1%), covers 98.0% of PF01170, 190.6 bits

• Ligand: guanosine-5'-triphosphate (3lduA)

SO_1851 conserved hypothetical protein (NCBI ptt file) from Shewanella oneidensis MR-1
Aligns to 162:373 / 711 (29.8%), covers 98.5% of PF01170, 189.8 bits

• Validating annotations for uncharacterized proteins in Shewanella oneidensis
  Louie, Omics : a journal of integrative biology 2008
  • “...10377098 15901686, 16452451 11488932 12055309 SO_1608 SO_1789 SO_1851 SO_1963 SO_2042 SO_2043 SO_2593 SO_2603 SO_2614 SO_2627 SO_3014 SO_3015 SO_3367 SO_3436...”

THUM3_MOUSE / P97770 tRNA (guanine(6)-N2)-methyltransferase THUMP3; GtROSA26asSor; THUMP domain-containing protein 3; EC 2.1.1.256 from Mus musculus (Mouse) (see 2 papers)
Aligns to 294:480 / 505 (37.0%), covers 99.0% of PF01170, 189.3 bits

• function: Methyltransferase which catalyzes the formation of N(2)- methylguanosine at position 6 in a broad range of tRNA substrates containing the characteristic 3'-CCA terminus of mature tRNAs (By similarity). Also catalyzes the formation of N(2)-methylguanosine at position 7 of tRNA(Trp) (By similarity). Requires the methyltransferase adapter protein TRM112 for tRNA methyltransferase activity (By similarity).
  catalytic activity: guanosine(6) in tRNA + S-adenosyl-L-methionine = H(+) + N(2)- methylguanosine(6) in tRNA + S-adenosyl-L-homocysteine (RHEA:51116)
  subunit: Interacts with TRMT112; the interaction is direct and is required for THUMPD3 methyltransferase activity.

gbs0292 unknown (NCBI ptt file) from Streptococcus agalactiae NEM316
Aligns to 167:373 / 384 (53.9%), covers 99.0% of PF01170, 188.3 bits

• Single nucleotide resolution RNA-seq uncovers new regulatory mechanisms in the opportunistic pathogen Streptococcus agalactiae
  Rosinski-Chupin, BMC genomics 2015
  • “...), for a RNA methylase potentially involved in the modification of 23S RNA m2G2445 ( gbs0292 ) and for a protein of unknown function ( gbs0293). The association between the three coding genes and RNaseP mRNA is conserved among all streptococci, suggesting a functional and regulatory...”

SAG0303 conserved hypothetical protein (NCBI ptt file) from Streptococcus agalactiae 2603V/R
Aligns to 167:373 / 384 (53.9%), covers 99.0% of PF01170, 188.3 bits

• Transcriptional and proteomic profiles of group B Streptococcus type V reveal potential adherence proteins associated with high-level invasion
  Johri, Infection and immunity 2007
  • “...mraY gapN atpF pfk pyk ldh gap Conserved hypothetical proteins SAG0303 SAG0304 SAG0785 SAG0963 SAG1830 Fold increase 2.1 2.0 1.9 2.2 1.9 2.3 2.7 2.0 2.1 3.0 3.2...”

SSU0374 RNA methylase family protein (RefSeq) from Streptococcus suis P1/7
Aligns to 167:383 / 388 (55.9%), covers 99.0% of PF01170, 188.0 bits

• Identification and characterization of the cell division protein MapZ from Streptococcus suis
  Dresen, MicrobiologyOpen 2021
  • “...Spec_for AGTCGTCGTATCTGAACC Spec_rev TTCAGCCACTGCATTTCC Amplification of Cm cassette CM_for GGCACCTATCTCAGCGATC CM_rev TCCGATAATTCGATGGGTTCC qRTPCR Amplification of SSU0374 SSU0374_for_qRT CCAAGTGTGCAGGCTATTTC SSU0374_rev_qRT TGACTGTCGCCACATCTTTC Amplification of SSU0375 SSU0375_for_qRT AAGCCATTGCAGCCATTCAG SSU0375_rev_qRT TGTCGTTGTCGCAGAAAGAG Amplification of SSU0376 SSU0376_for_qRT TGGGCTAATCGACTGCTCTC SSU0376_rev_qRT CTCCCAAGTGATGCCTTCTG Amplification of gyrB gyrB_for GGACCTGGGTGCTTAACAGA gyrB_rev AGGTGGTACCCATGAGCAAG John Wiley & Sons, Ltd...”

U876_11965 bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL from Aeromonas hydrophila NJ-35
Aligns to 174:394 / 723 (30.6%), covers 99.5% of PF01170, 186.4 bits

• Identification and Characterization of an Aeromonas hydrophila Oligopeptidase Gene pepF Negatively Related to Biofilm Formation
  Du, Frontiers in microbiology 2016
  • “...456/1580 Phosphodiesterase TM715 U876_10760 679/1223 Diguanylate phosphodiesterase Other functions TM553 U876_23065 231/674 Hypothetical protein TM610 U876_11965 1089/2171 23S rRNA methyltransferase; rlmL a DNA homologies with the complete genome sequence of the reference strain NJ-35 were evaluated. b Insertion sites were identified using TAIL-PCR and sequence analysis....”

SpyM3_1386 putative N6-adenine-specific DNA methylase (NCBI ptt file) from Streptococcus pyogenes MGAS315
Aligns to 167:373 / 384 (53.9%), covers 99.0% of PF01170, 185.1 bits

• Novel regulatory small RNAs in Streptococcus pyogenes
  Tesorero, PloS one 2013
  • “...Z, P SSRC31 SPyM3_1356 hypothetical protein >>> SPyM3_1357 hypothetical protein >>> Q, Z SSRC32 * SPyM3_1386 putative N6-adenine-specific DNA methylase <<< SPyM3_1387 hypothetical protein <<< Q, Z, P [20] , [42] SSRC33 * SPyM3_1391 putative aminopeptidase C <<< SPyM3_1392 NAD synthetase <<< Q, Z, P SSRC34...”

Spy49_1275c hypothetical protein (RefSeq) from Streptococcus pyogenes NZ131
Aligns to 167:373 / 384 (53.9%), covers 99.0% of PF01170, 184.7 bits

• Identification of novel growth phase- and media-dependent small non-coding RNAs in Streptococcus pyogenes M49 using intergenic tiling arrays
  Patenge, BMC genomics 2012
  • “...34 sRNASpy491243 1246370 1246419 49 + Spy49_1243 Spy49_1244 a 35 sRNASpy491275c 1282084 1282413 329 - Spy49_1275c Spy49_1276c RNaseP_bact b RNA1320100 [ 20 ] c 36 sRNASpy491311c 1321638 1321853 d 84 - e glyQ Spy49_1312c b 37 sRNASpy491336c 1341554 1341603 49 + rbfA infB b 38 sRNASpy491340c...”

SPD_0341 RNA methylase family protein UPF0020, putative (NCBI) from Streptococcus pneumoniae D39
Aligns to 167:373 / 385 (53.8%), covers 99.0% of PF01170, 183.6 bits

• The Rgg1518 transcriptional regulator is a necessary facet of sugar metabolism and virulence in Streptococcus pneumoniae
  Shlla, Molecular microbiology 2021
  • “...an operon including SPD_0315, SPD_1053, SPD_1634, SPD_1342, SPD_1461, SPD_1127, SPD_0113, SPD_0122, SPD_0193, SPD_0197, SPD_0208, SPD_0126, SPD_0341, SPD_0378, SPD_0404 and SPD_1512. The genetic fragment containing the putative promoter sites of target genes were amplified using primers containing 5-FAM fluorescent tags ( STable 4 ), and the amplicons...”
• Pivotal Roles for Ribonucleases in Streptococcus pneumoniae Pathogenesis
  Sinha, mBio 2021
  • “...Clp proteinase ATP-binding subunit ClpL 9.68 9.97E22 SPD_0339 gpsB Cell division protein GpsB 1.88 2.51E02 SPD_0341 rlmL 23S rRNA methyltransferase 4.75 5.59E26 SPD_0342 mapZ Midcell-anchored-protein Z 4.13 1.65E21 SPD_0345 cbpF Choline-binding protein CbpF 1.89 1.42E04 SPD_0373 mip Macrophage infectivity potentiator protein 2.15 2.04E03 SPD_0380 c fabH...”

spr0333 Conserved hypothetical protein (NCBI ptt file) from Streptococcus pneumoniae R6
Aligns to 172:378 / 390 (53.1%), covers 99.0% of PF01170, 183.5 bits

• Biological and Epidemiological Features of Antibiotic-Resistant Streptococcus pneumoniae in Pre- and Post-Conjugate Vaccine Eras: a United States Perspective
  Kim, Clinical microbiology reviews 2016
  • “...a role in resistance for a 23S rRNA methyltransferase (spr0333) and for the ABC proteins PatA and PatB (250). A proteomic and transcriptomic screen suggested...”
• LocZ is a new cell division protein involved in proper septum placement in Streptococcus pneumoniae
  Holečková, mBio 2014
  • “...quantitative reverse transcription PCR (qRT-PCR). No changes in the expression of the flanking spr0332 , spr0333 , spr0335 , and spr0336 genes were observed (see TableS1 in the supplemental material), indicating that deletion of locZ did not prevent the expression of the upstream or the downstream...”
• Antimicrobial resistance and virulence: a successful or deleterious association in the bacterial world?
  Beceiro, Clinical microbiology reviews 2013
  • “...transporter ATP-binding/ membrane-spanning protein), and spr0333 (conserved hypothetical/rRNA methyltransferase) conferred resistance to LZD. These compensatory...”
  • “...spr1021 and spr1887 genes and also the methyltransferase gene spr0333), which appears to restore the original fitness by the action of the new ABC transporter...”
• Resistance to linezolid caused by modifications at its binding site on the ribosome
  Long, Antimicrobial agents and chemotherapy 2012
  • “...from PTC antibiotics (88). Inactivation of the spr0333 methyltransferase targeting G2445 in 23S rRNA results in decreased susceptibility to linezolid in...”
• Whole genome analysis of linezolid resistance in Streptococcus pneumoniae reveals resistance and compensatory mutations
  Billal, BMC genomics 2011
  • “...I79L A235G I79L A235G I79L ABC transporter ATP-binding subunit spr1021 G-29T G-29T Conserved hypothetical/rRNA methyltransferase spr0333 G503T S168I Sodium/hydrogen exchanger family protein spr0573 G141A T47I Conserved hypothetical protein spr0855 G25A A9T Fibronectin-binding protein-like protein A spr0868 C617A S206I Conserved hypothetical protein spr1115 C29T T10I Transcription antitermination...”
  • “...FFC (florfenicol); PCG (penicillin G). Table 4 Functional analysis of mutations in genes spr0188, spr0196, spr0333, spr1021 and spr1887 in resistance to LNZ and other antibiotics in S. pneumoniae . Strains/transformants a Locus b No. of colonies tested Mutation status 1974M1 c,d Mutation status Transformants c,d...”
• Genome sequencing of linezolid-resistant Streptococcus pneumoniae mutants reveals novel mechanisms of resistance
  Feng, Genome research 2009
  • “...to linezolid and other antibiotics. The hypothetical protein spr0333 contains an RNA methyltransferase domain, and mutations within that domain were found in...”
  • “...linezolid-resistant strains. Primer extension experiments indicated that spr0333 methylates G2445 of the 23S rRNA and mutations in spr0333 abolished this...”

SP_0373 hypothetical protein (RefSeq) from Streptococcus pneumoniae TIGR4
Aligns to 167:373 / 385 (53.8%), covers 99.0% of PF01170, 181.2 bits

• LINEZOLID RESISTANCE MUTATIONS IN GRAM-POSITIVE BACTERIA
  QUELLETTE, 2009

SMU_472 class I SAM-dependent RNA methyltransferase from Streptococcus mutans UA159
Aligns to 167:373 / 384 (53.9%), covers 99.0% of PF01170, 181.1 bits

• Genome-Wide Identification of Novel sRNAs in Streptococcus mutans
  Krieger, Journal of bacteriology 2022 (secret)
• Structure of the bifunctional methyltransferase YcbY (RlmKL) that adds the m7G2069 and m2G2445 modifications in Escherichia coli 23S rRNA
  Wang, Nucleic acids research 2012
  • “...(YcbY-N and YcbY-C). These are exemplified here by the S. mutans proteins Smu472 (accession code SMU_472) and Smu776 (SMU_776). Multiple sequence alignments of all YcbY orthologs were made using the CLUSTALX software program ( 25 ), structural comparisons were carried out using DALI, and conserved domains...”

LSA0921 Putative adenine-specific DNA methyltransferase (NCBI) from Lactobacillus sakei subsp. sakei 23K
Aligns to 162:368 / 383 (54.0%), covers 98.5% of PF01170, 180.4 bits

• Global transcriptome response in Lactobacillus sakei during growth on ribose
  McLeod, BMC microbiology 2011
  • “...S-methyltransferase -0.6 DNA restriction and modification LSA0143 lsa0143 Putative adenine-specific DNA methyltransferase -0.7 D D LSA0921 lsa0921 Putative adenine-specific DNA methyltransferase 0.8 LSA1299 lsa1299 Putative adenine-specific DNA methyltransferase 0.9 0.7 1.2 Information pathways LSA0326 lsa0326 Putative DNA helicase -0.6 U DNA packaging and segregation LSA0135 lsa0135...”

3ldgA / Q8DVL0 Crystal structure of smu.472, a putative methyltransferase complexed with sah
Aligns to 165:370 / 377 (54.6%), covers 97.5% of PF01170, 174.9 bits

• Ligand: s-adenosyl-l-homocysteine (3ldgA)

WP_002824330 class I SAM-dependent RNA methyltransferase from Oenococcus oeni
Aligns to 163:369 / 376 (55.1%), covers 99.0% of PF01170, 171.7 bits

• Phylogenomic and comparative genomic analyses of Leuconostocaceae species: identification of molecular signatures specific for the genera Leuconostoc, Fructobacillus and Oenococcus and proposal for a novel genus Periweissella gen. nov
  Bello, International journal of systematic and evolutionary microbiology 2022
  • “...membrane protein insertase WP_180369397 1 aa Ins 1976 Fig. S34 Class I SAM-dependent RNA methyltransferase WP_002824330 1 aa Ins 73111 Fig. S35 GTPase HflX WP_071438355 2 aa Ins 67135 Fig. S36 Phospho- N -acetylmuramoyl-pentapeptide-transferases WP_075270024 8 aa Ins 281315 Figs 6(b) and S37 Weissella main clade...”

THUM3_HUMAN / Q9BV44 tRNA (guanine(6)-N2)-methyltransferase THUMP3; THUMP domain-containing protein 3; EC 2.1.1.256 from Homo sapiens (Human) (see 2 papers)
XP_011531872 THUMP domain-containing protein 3 isoform X1 from Homo sapiens
Aligns to 292:478 / 507 (36.9%), covers 98.5% of PF01170, 169.5 bits

• function: Methyltransferase which catalyzes the formation of N(2)- methylguanosine at position 6 in a broad range of tRNA substrates containing the characteristic 3'-CCA terminus of mature tRNAs (PubMed:34669960). Also catalyzes the formation of N(2)-methylguanosine at position 7 of tRNA(Trp) (PubMed:34669960). Requires the methyltransferase adapter protein TRM112 for tRNA methyltransferase activity (PubMed:34669960).
  catalytic activity: guanosine(6) in tRNA + S-adenosyl-L-methionine = H(+) + N(2)- methylguanosine(6) in tRNA + S-adenosyl-L-homocysteine (RHEA:51116)
  subunit: Interacts with TRMT112; the interaction is direct and is required for THUMPD3 methyltransferase activity.
• THUMPD3-TRMT112 is a m2G methyltransferase working on a broad range of tRNA substrates.
  Yang, Nucleic acids research 2021
  • GeneRIF: THUMPD3-TRMT112 is a m2G methyltransferase working on a broad range of tRNA substrates.
• Apigenin inhibits growth and induces apoptosis in human cholangiocarcinoma cells.
  Subhasitanont, Oncology letters 2017

PSPTO_2311 methylase, putative (NCBI ptt file) from Pseudomonas syringae pv. tomato str. DC3000
Aligns to 177:394 / 762 (28.6%), covers 98.5% of PF01170, 161.6 bits

• Characterization of the Fur regulon in Pseudomonas syringae pv. tomato DC3000
  Butcher, Journal of bacteriology 2011
  • “...divergent region between PSPTO_2310 (rmf) and PSPTO_2311 Upstream of PSPTO_2853 Within PSPTO_5056 (pseudogene) Within PSPTO_5375 121232-121269 354705-354745...”
  • “...found between two divergently transcribed genes (PSPTO_2310 and PSPTO_2311) in a region where a ncRNA (rmf) is predicted upstream of PSPTO_2310 (40)....”

6zxvA / O29011 Structure of archaeoglobus fulgidus trm11 m2g10 tRNA methyltransferase enzyme bound to sinefungin
Aligns to 153:319 / 325 (51.4%), covers 99.5% of PF01170, 157.4 bits

• Ligand: sinefungin (6zxvA)

AF_1257 TIGR01177 family methyltransferase from Archaeoglobus fulgidus DSM 4304
Aligns to 149:315 / 320 (52.2%), covers 99.5% of PF01170, 157.4 bits

• Structural and functional insights into Archaeoglobus fulgidus m2G10 tRNA methyltransferase Trm11 and its Trm112 activator
  Wang, Nucleic acids research 2020
  • “...co-expression in E. coli was designed to produce A. fulgidus AF_RS01245 ( Af Trm112) and AF_1257 (with a C-terminal His 6 -tag) gene products. This fragment was obtained by de novo synthesis (Integrated DNA Technologies, Belgium) and cloned into pET21-a between Nde I and Xho I...”
  • “...To express the AF_1257 protein alone, a DNA fragment encoding a C-terminally His-tagged version of AF_1257 was inserted into a BamH I/ Xho I-digested vector pET21a to generate plasmid pMG964. A second plasmid (pMG979) expressing AF_1257 was obtained by inserting the polymerase chain reaction (PCR) product...”

PA3048 hypothetical protein (NCBI) from Pseudomonas aeruginosa PAO1
Aligns to 165:383 / 725 (30.2%), covers 98.5% of PF01170, 156.9 bits

• Fitness landscape of antibiotic tolerance in Pseudomonas aeruginosa biofilms
  Amini, PLoS pathogens 2011
  • “..., 878276; mexE , 880212; nuoA , 882344; nuoK , 882355; PA2653, 882362; PA2771, 882750; PA3048, 882879; PA3222, 882553; rhlI , 878967; PA3726, 880374; purT , 880455; PA3844, 879831; PA3966, 878878; PA4175, 880208; PA4516, 881122; PA5207, 879542; wzm , 883118. Supporting Information Dataset S1 Hybridization signals...”
  • “...growth advantage in the planktonic phase: SAH018 (PA1329), SAH041 (PA3476, rhlI ), SA087 (MPAO1), SAH116 (PA3048), SAH124 (PA3844), SAH128 (PA3222), SAH129 (PA3966), SAH130 (PA5207), and SAH027 (PA2646, nuoK ). (PDF) Click here for additional data file. Figure S9 Complete data for tobramycin-outer membrane interaction assay. As...”

FTN_0798 hypothetical protein (NCBI) from Francisella tularensis subsp. novicida U112
Aligns to 163:378 / 718 (30.1%), covers 98.5% of PF01170, 154.8 bits

• Common ancestry and novel genetic traits of Francisella novicida-like isolates from North America and Australia as revealed by comparative genomic analyses
  Siddaramappa, Applied and environmental microbiology 2011
  • “...acid hydroxylase (FTN_0797, 182 aa), an rRNA methyltransferase (FTN_0798, 718 aa), and a hipB gene. Adjacent to this transposase gene, strain U112 contained two...”

BMA2374 THUMP domain protein (NCBI) from Burkholderia mallei ATCC 23344
Aligns to 174:332 / 430 (37.0%), covers 69.5% of PF01170, 153.0 bits

• Genome sequence alterations detected upon passage of Burkholderia mallei ATCC 23344 in culture and in mammalian hosts
  Romero, BMC genomics 2006
  • “...5 GGGGCTTC 9 8 no no BMA2063 Transcriptional regulator 6 TGCGCGA 19 15 no no BMA2374 THUMP domain protein 7 No (-G) NA NA yes no BMAA0389 Hypothetical protein 8 CTGTCGTG 21 22 no no BMAA0376 Transporter 9 GTGCGAT 19 20 no no BMAA1878 Transcriptional regulator...”

SYNW0346 Putative RNA methylase family UPF0020 (VIMSS) from Synechococcus sp. WH 8102
Aligns to 176:384 / 388 (53.9%), covers 99.5% of PF01170, 151.0 bits

• Computational inference and experimental validation of the nitrogen assimilation regulatory network in cyanobacterium Synechococcus sp. WH 8102
  Su, Nucleic acids research 2006
  • “...11.947 synw0436 synw0437 - - 24 synw2151 psbA3 GTAaacgggcgAAC ACACCTCTCAACCTTCCGT TACATT GGCGTG 93 11.936 25 synw0346 - GTAaaattagcTAC AGAACAAAAGCAATTGGCT TAATTG ATACCA 627 11.920 26 synw0462 glnB GTTacaggggcTAC CCACACCGCCACCATTCACG TCATGC TTAAT 51 11.915 27 synw2097 - GTGctcagcgtTAC CAAGGGGGGCTTGGTGGAATCGA TAGCAT GC 51 11.883 28 synw0015 - GTGgtattccgTAC GGGGAATGATCAATTTGAAATC...”

Alvin_2173 putative RNA methylase (RefSeq) from Allochromatium vinosum DSM 180
Aligns to 164:380 / 735 (29.5%), covers 99.0% of PF01170, 147.8 bits

• Regulation of dissimilatory sulfur oxidation in the purple sulfur bacterium allochromatium vinosum
  Grimm, Frontiers in microbiology 2011
  • “...structure in the corresponding mRNA was found within the nucleotide sequence of the downstream gene Alvin_2173 (formerly ORFc) by Hensen et al. ( 2006 ) and proposed to function as a site for transcription termination. A second predicted transcriptional unit comprises the gene soxB and probably...”

TRM14_PYRFU / Q8U248 tRNA (guanine(6)-N2)-methyltransferase; tRNA:m2G6 methyltransferase; EC 2.1.1.256 from Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1) (see 3 papers)
Q8U248 tRNA (guanine6-N2)-methyltransferase (EC 2.1.1.256) from Pyrococcus furiosus (see 2 papers)
WP_011012139 tRNA (guanine(6)-N2)-methyltransferase from Pyrococcus furiosus DSM 3638
PF1002 hypothetical protein (NCBI ptt file) from Pyrococcus furiosus DSM 3638
Aligns to 191:360 / 365 (46.6%), covers 99.0% of PF01170, 137.3 bits

• function: S-adenosyl-L-methionine-dependent methyltransferase that catalyzes the methylation of the guanosine nucleotide at position 6 (m2G6) in tRNA(Phe).
  catalytic activity: guanosine(6) in tRNA + S-adenosyl-L-methionine = H(+) + N(2)- methylguanosine(6) in tRNA + S-adenosyl-L-homocysteine (RHEA:51116)
  subunit: Monomer in solution.
• Crystallization and preliminary X-ray crystallographic analysis of putative tRNA-modification enzymes from Pyrococcus furiosus and Thermus thermophilus.
  Fislage, Acta crystallographica. Section F, Structural biology and crystallization communications 2011
  • GeneRIF: protein encoded by the gene pf1002 from the archaeon Pyrococcus furiosus was crystallized in the monoclinic space group P2(1). A complete data set was collected to 2.2 A resolution
• The open reading frame TTC1157 of Thermus thermophilus HB27 encodes the methyltransferase forming N²-methylguanosine at position 6 in tRNA
  Roovers, RNA (New York, N.Y.) 2012
  • “...T. thermophilus. Individual THUMP and RFM domains of PF1002 from Pyrococcus furiosus were produced. These separate domains were inactive and did not bind tRNA,...”
  • “...from P. abyssi, MJ0438 from Methanocaldococcus jannaschii, and PF1002 from P. furiosus. All these proteins were shown to catalyze m2G formation in tRNA. Among...”
• Crystal structures of the tRNA:m2G6 methyltransferase Trm14/TrmN from two domains of life
  Fislage, Nucleic acids research 2012
  • “...TTC TrmN from Thermus thermophilus (TTC1157) and its archaeal ortholog Pf Trm14 from Pyrococcus furiosus (PF1002) in complex with the methyl donor SAM, the product S -adenosyl-homocysteine (SAH) and the inhibitor SFG (sinefungin). This study provides the first detailed crystallographic structure analysis of tRNA-modifying enzymes consisting...”
• Crystallization and preliminary X-ray crystallographic analysis of putative tRNA-modification enzymes from Pyrococcus furiosus and Thermus thermophilus
  Fislage, Acta crystallographica. Section F, Structural biology and crystallization communications 2011
  • “...are reported. The protein encoded by the gene pf1002 from the archaeon Pyrococcus furiosus was crystallized in the monoclinic space group resolution. The...”
  • “...of life: the archaeal protein encoded by the gene pf1002 from P. furiosus, hereafter referred to as Pf1002, and the eubacterial homologue encoded by the gene...”

TK1863 predicted N6-adenine-specific DNA methylase (NCBI) from Thermococcus kodakaraensis KOD1
Aligns to 191:360 / 365 (46.6%), covers 99.0% of PF01170, 136.2 bits

• Distinct Modified Nucleosides in tRNATrp from the Hyperthermophilic Archaeon Thermococcus kodakarensis and Requirement of tRNA m2G10/m22G10 Methyltransferase (Archaeal Trm11) for Survival at High Temperatures.
  Hirata, Journal of bacteriology 2019 (secret)
• The open reading frame TTC1157 of Thermus thermophilus HB27 encodes the methyltransferase forming N²-methylguanosine at position 6 in tRNA
  Roovers, RNA (New York, N.Y.) 2012
  • “...were cloned and expressed in E. coli: TK1863 from Thermococcus kodakaraensis, MK0969 from Methanopyrus kandleri, AF2178 from Archaeoglobus fulgidus, PAB0923...”
  • “...of ORF PAB0923 Amplification of ORF TK1863 Amplification of THUMP-TTC1157 Amplification of MTase-TTC1157 Amplification of THUMP-PF1002 Amplification of...”

PAB0923 hypothetical protein (NCBI ptt file) from Pyrococcus abyssi GE5
Aligns to 190:358 / 363 (46.6%), covers 99.0% of PF01170, 133.6 bits

• The open reading frame TTC1157 of Thermus thermophilus HB27 encodes the methyltransferase forming N²-methylguanosine at position 6 in tRNA
  Roovers, RNA (New York, N.Y.) 2012
  • “...from Methanopyrus kandleri, AF2178 from Archaeoglobus fulgidus, PAB0923 from P. abyssi, MJ0438 from Methanocaldococcus jannaschii, and PF1002 from P. furiosus....”
  • “...Amplification of ORF MK0969 Amplification of ORF PAB0923 Amplification of ORF TK1863 Amplification of THUMP-TTC1157 Amplification of MTase-TTC1157 Amplification...”

B5T_01813 bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL from Alcanivorax dieselolei B5
Aligns to 154:365 / 703 (30.2%), covers 90.9% of PF01170, 133.6 bits

• Microbial oil-degradation under mild hydrostatic pressure (10 MPa): which pathways are impacted in piezosensitive hydrocarbonoclastic bacteria?
  Scoma, Scientific reports 2016
  • “...3.04 6.5 53.9 889 B5T_00978 Ribosomal RNA small subunit methyltransferase A 3.14 1.2 10.3 895 B5T_01813 Ribosomal RNA large subunit methyltransferase L 3.31 0.3 3.2 1702 B5T_03442 Ribosomal-protein-alanine acetyltransferase 4.28 2.2 41.6 2014 B5T_01081 Ribosomal RNA large subunit methyltransferase H Table 2 Expression of tRNA modification...”

NEQ522 NEQ522 (NCBI) from Nanoarchaeum equitans Kin4-M
Aligns to 153:358 / 366 (56.3%), covers 97.5% of PF01170, 132.6 bits

• The genome of Nanoarchaeum equitans: insights into early archaeal evolution and derived parasitism
  Waters, Proceedings of the National Academy of Sciences of the United States of America 2003
  • “...methyltransferases (NEQ108, NEQ228, NEQ337, NEQ440, and NEQ522), rRNA methyltransferases (NEQ053, NEQ238, and NEQ384), pseudouridine synthases (NEQ293, NEQ333,...”

3tm5A / Q8U248 Crystal structure of trm14 from pyrococcus furiosus in complex with sinefungin (see paper)
Aligns to 191:359 / 368 (45.9%), covers 99.0% of PF01170, 129.6 bits

• Ligand: sinefungin (3tm5A)

LOC105559780 THUMP domain-containing protein 3-like from Vollenhovia emeryi
Aligns to 259:428 / 474 (35.9%), covers 87.3% of PF01170, 120.1 bits

• QTL Mapping of Sex Determination Loci Supports an Ancient Pathway in Ants and Honey Bees
  Miyakawa, PLoS genetics 2015
  • “...motif and ankyrin repeat domain-containing protein LOC105559779 BET1 homolog LOC105559781 probable ribosome production factor 1 LOC105559780 THUMP domain-containing protein 3-like LOC105559782 cysteine-rich with EGF-like domain protein 2 LOC105559784 coatomer subunit alpha LOC105559783 uncharacterized LOC105559785 host cell factor LOC105559786 probable myosin heavy chain ECU04_1000 LOC105559787 GTP-binding protein...”

XP_012941090 THUMP domain-containing protein 3 from Aplysia californica
Aligns to 26:205 / 281 (64.1%), covers 90.9% of PF01170, 106.9 bits

• The methylome of Biomphalaria glabrata and other mollusks: enduring modification of epigenetic landscape and phenotypic traits by a new DNA methylation inhibitor
  Luviano, Epigenetics & chromatin 2021
  • “...66.4% of identity with the THUMP domain-containing protein 3-like of Aplysia californica (NCBI reference sequence XP_012941090) and 52.8% of identity with the THUMP domain protein 3 of the brachiopod Lingula anatina (XP_013378720.1), and these proteins are part of AdoMet_MTases superfamily, enzymes that use S -adenosyl- l...”

TMG10_PYRAB / Q9UY84 tRNA (guanine(10)-N2)-dimethyltransferase; (Pab)Trm-G10; tRNA:G10 dimethyltransferase; EC 2.1.1.213 from Pyrococcus abyssi (strain GE5 / Orsay) (see paper)
Q9UY84 tRNA (guanine10-N2)-dimethyltransferase (EC 2.1.1.213) from Pyrococcus abyssi (see paper)
PAB1283 / Q9UY84 tRNA (guanine¹⁰-N²)-dimethyltransferase (EC 2.1.1.213) from Pyrococcus abyssi (strain GE5 / Orsay) (see paper)
Aligns to 154:321 / 329 (51.1%), covers 91.9% of PF01170, 101.1 bits

• function: Catalyzes the adenosylmethionine-dependent methylation of the exocyclic amino group (N(2)) of guanosine at position 10 of various tRNAs. Acts via a two-step process that leads to the formation of either N(2)-monomethyl (m(2)G) or N(2)-dimethylguanosine (m(2)(2)G).
  catalytic activity: guanosine(10) in tRNA + 2 S-adenosyl-L-methionine = 2 H(+) + N(2)-dimethylguanosine(10) in tRNA + 2 S-adenosyl-L-homocysteine (RHEA:43124)
  subunit: Monomer.

PAB1283 hypothetical protein (NCBI ptt file) from Pyrococcus abyssi GE5
Aligns to 157:324 / 332 (50.6%), covers 91.9% of PF01170, 101.0 bits

• Random mutagenesis of a hyperthermophilic archaeon identified tRNA modifications associated with cellular hyperthermotolerance
  Orita, Nucleic acids research 2019
  • “...FFH32, consequently leading to the thermosensitive phenotype. aTrm11 from T. kodakarensis (TK0981) and P. abyssi (PAB1283) showed in vitro activity to form m 2 G10 and m 2,2 G10 modifications ( 49 , 50 , 69 ). It has been reported that the m 2,2 G10...”
• Trm112, a Protein Activator of Methyltransferases Modifying Actors of the Eukaryotic Translational Apparatus.
  Bourgeois, Biomolecules 2017
  • “...2 G 10 modification by Trm11 [ 12 ], whereas archaeal orthologs studied so far (PAB1283 from Pyrococcus abyssi and aTrm11 from Thermococcus kodakarensis ) are active on their own [ 28 , 32 ]. Initially, the m 2 G 10 modification could only be recapitulated...”
• Activation mode of the eukaryotic m2G10 tRNA methyltransferase Trm11 by its partner protein Trm112
  Bourgeois, Nucleic acids research 2017
  • “...in vivo in yeast ( 13 ) while two archaeal orthologous proteins from Pyrococcus abyssii (PAB1283 or Pab Trm-G10) and Thermococcus kodakarensis (TkoTrm11) catalyzing the formation of m 2 G prior to m 2,2 G at position 10, are active on their own ( 30 32...”
• Crystal structures of the tRNA:m2G6 methyltransferase Trm14/TrmN from two domains of life
  Fislage, Nucleic acids research 2012
  • “...a THUMP domain fused to an RFM domain are described in literature, like Trm11 and PAB1283, involved in the m 2 G10 and G10 modification ( 12 , 13 , 28 ), and Trm14, involved in the formation of m 2 G on position 6 of...”
  • “...). However, previous studies with the isolated THUMP domain of the m 2 G10 MTase PAB1283 have already shown that the isolated THUMP domain is not able to bind the tRNA substrate ( 28 ). This is in agreement with our suggestion that the tRNA binding...”
• The open reading frame TTC1157 of Thermus thermophilus HB27 encodes the methyltransferase forming N²-methylguanosine at position 6 in tRNA
  Roovers, RNA (New York, N.Y.) 2012
  • “...(Bujnicki et al. 2002). However, using TrmG10 (the product of the PAB1283 ORF) as a query revealed the existence of a homolog (E value = 7 3 10 4) in T....”
• Crystallization and preliminary X-ray crystallographic analysis of putative tRNA-modification enzymes from Pyrococcus furiosus and Thermus thermophilus
  Fislage, Acta crystallographica. Section F, Structural biology and crystallization communications 2011
  • “...literature: the tRNA:m22G10 methyltransferase from Pyrococcus abyssi (Pab1283; Gabant et al., 2006; Armengaud et al., 2004) and Trm14 from Methanocaldococcus...”
• THUMP from archaeal tRNA:m22G10 methyltransferase, a genuine autonomously folding domain
  Gabant, Nucleic acids research 2006
  • “...For commercial re-use, please contact journals.permissions@oxfordjournals.org The tRNA:m 2 2 G10 methyltransferase of Pyrococus abyssi (PAB1283, a member of COG1041) catalyzes the N 2 , N 2 -dimethylation of guanosine at position 10 in tRNA. Boundaries of its THUMP (THioUridine synthases, RNA Methyltransferases and Pseudo-uridine synthases)containing...”
  • “...by mass spectrometry, and identification of an intramolecular disulfide bridge. A model of the whole PAB1283 enzyme docked onto its tRNA Asp substrate suggests that the THUMP module specifically takes support on the co-axially stacked helices of T-arm and acceptor stem of tRNA and, together with...”
• N2-methylation of guanosine at position 10 in tRNA is catalyzed by a THUMP domain-containing, S-adenosylmethionine-dependent methyltransferase, conserved in Archaea and Eukaryota
  Armengaud, The Journal of biological chemistry 2004 (PubMed)
  • “...pseudouridine synthases) domain in the N terminus. Recombinant PAB1283 protein from the archaeon Pyrococcus abyssi GE5, a member of COG1041, was purified and...”
  • “...of a slightly modified version of P. abyssi PAB1283 open reading frame. The Met-ATG located at 1592098 (numbering refers to whole P. abyssi genomic...”

E1BZ71 THUMP domain containing 2 from Gallus gallus
Aligns to 185:346 / 417 (38.8%), covers 84.3% of PF01170, 96.9 bits

• Construction of a T7 phage display nanobody library for bio-panning and identification of chicken dendritic cell-specific binding nanobodies
  Xu, Scientific reports 2022
  • “...Uncharacterized protein OS= Gallus gallus OX=9031 GN=ZBTB26 PE=4 SV=1 31 50.8 1 1 6.11 0.06 E1BZ71 THUMP domain-containing protein OS= Gallus gallus OX=9031 GN=THUMPD2 PE=3 SV=4 30 46.1 1 1 5.32 0.07 Q08392 Glutathione S-transferase OS= Gallus gallus OX=9031 PE=2 SV=1 30 25.3 1 1 8.86...”

PH0338 hypothetical protein (NCBI ptt file) from Pyrococcus horikoshii OT3
Aligns to 155:322 / 329 (51.1%), covers 91.4% of PF01170, 94.5 bits

• Characterization of an extremely thermostable restriction enzyme, PspGI, from a Pyrococcus strain and cloning of the PspGI restriction-modification system in Escherichia coli
  Morgan, Applied and environmental microbiology 1998
  • “...there are four putative type II methylases (PH0338, PH0584, PH0905, and PH1032) that contain conserved motifs of aminomethyltransferases. The putative methylase...”

NEQ440 NEQ440 (NCBI) from Nanoarchaeum equitans Kin4-M
Aligns to 122:256 / 295 (45.8%), covers 77.2% of PF01170, 94.2 bits

• The genome of Nanoarchaeum equitans: insights into early archaeal evolution and derived parasitism
  Waters, Proceedings of the National Academy of Sciences of the United States of America 2003
  • “...(40). tRNA methyltransferases (NEQ108, NEQ228, NEQ337, NEQ440, and NEQ522), rRNA methyltransferases (NEQ053, NEQ238, and NEQ384), pseudouridine synthases...”

TK0981 N2, N2-dimethylguanosine tRNA methyltransferase (NCBI) from Thermococcus kodakaraensis KOD1
Aligns to 154:324 / 331 (51.7%), covers 85.8% of PF01170, 93.3 bits

• Distinct Modified Nucleosides in tRNATrp from the Hyperthermophilic Archaeon Thermococcus kodakarensis and Requirement of tRNA m2G10/m22G10 Methyltransferase (Archaeal Trm11) for Survival at High Temperatures.
  Hirata, Journal of bacteriology 2019 (secret)
• Random mutagenesis of a hyperthermophilic archaeon identified tRNA modifications associated with cellular hyperthermotolerance
  Orita, Nucleic acids research 2019
  • “...FFH02, FFH32 (15221530) + tk0760 7-Cyano-7-deazaguanine tRNA-ribosyltransferase (TgtA) FFH16, FFH17, FFH18 (962970), FFH21 (11671175) + tk0981 Guanine10- N 2 -dimethyltransferase(Trm11) FFH35 (105113) + tk1198 Organic radical activating protein (QueE) FFH05 (595603),FFH24 (497505) + tk1328 N 1 -methyladenosine methyltransferase (TrmI) FFH20 (135143) + metabolism tk0672 Putative glutamate...”
  • “...were identified to be tk0754 (2 mutants had the transposon insertion at the same site), tk0981 and tk1328 . TK0754 shared 20% identity with tRNA(Met) cytidine acetyltransferase (TmcA) from E. coli . TmcA is a GNAT family acetyltransferase forming N 4 -acetylcytidine derivative (ac 4 C)...”
• Structural and functional analyses of the archaeal tRNA m2G/m22G10 methyltransferase aTrm11 provide mechanistic insights into site specificity of a tRNA methyltransferase that contains common RNA-binding modules
  Hirata, Nucleic acids research 2016
  • “...DNA was extracted from the cells with a phenol-chloroform mixture. Tko Trm11 was assigned as TK0981, N 2 , N 2 -dimethylguanosine tRNA methyltransferase, in the Tko genome project ( 45 ). The TK0981 gene was subcloned into a pMD20-T vector using the Mighty TA cloning...”
  • “...then sequenced. The resulting vector was used as a template to amplify regions of the TK0981 gene by PCR, using the primers listed in Supplementary Table S1. Following NcoI and BamHI digestion, the polymerase chain reaction (PCR) product was ligated into a pET-30a vector (Novagen), which...”
• An uncharacterized member of the ribokinase family in Thermococcus kodakarensis exhibits myo-inositol kinase activity
  Sato, The Journal of biological chemistry 2013
  • “...Seven gene products (TK1267, TK2102, TK1824, TK0253, TK1520, TK0981, and TK0319) in T. kodakarensis displayed higher homology to MIK_ZM than the TK2285 protein....”
• Association of a multi-synthetase complex with translating ribosomes in the archaeon Thermococcus kodakarensis
  Raina, FEBS letters 2012
  • “...S6e TK0187 glutamine amidotransferase, class I TK1239 peptide chain release factor 1 TK1671 tRNA-modifying enzyme TK0981 N2, N2-dimethylguanosine tRNA methyltransferase TK0970 N(2),N(2)-dimethylguanosine tRNA methyltransferase TK0704 SAM-dependent methyltransferase a Open reading frames (ORFs) are numbered according to the annotated genome sequence of T. kodakarensis [ 35 ]....”

THUM2_HUMAN / Q9BTF0 THUMP domain-containing protein 2 from Homo sapiens (Human) (see 2 papers)
Aligns to 272:433 / 503 (32.2%), covers 84.8% of PF01170, 92.9 bits

• subunit: Interacts with TRMT112.
• Quantitative plasma proteomics of survivor and non-survivor COVID-19 patients admitted to hospital unravels potential prognostic biomarkers and therapeutic targets
  Flora, 2021
• Belinostat, a potent HDACi, exerts antileukaemic effect in human acute promyelocytic leukaemia cells via chromatin remodelling.
  Valiuliene, Journal of cellular and molecular medicine 2015
  • “...2.13828 Protein and ATP binding 65 P0CG39 POTEJ 107.66 1.46228 Protein and ATP binding 66 Q9BTF0 THUMPD2 238.14 C RNA binding. Methyltransferase activity 67 Q68CQ7 GLT8D1 206.26 C Glycosyltransferase 68 A6NIV6 LRRIQ4 145.7 Bel Leucine-rich repeats and IQ motif containing * C denotes that protein is...”
• Characterization of the Cardiac Overexpression of HSPB2 Reveals Mitochondrial and Myogenic Roles Supported by a Cardiac HspB2 Interactome.
  Grose, PloS one 2015
  • “...Ribosome 2 45106 Ribosomal protein S11, 40S P62280 RPS11 Ribosome 4 90158 THUMP domain-containing 2 Q9BTF0 THUMPD2 Cytoplasm 2 11503 # Transport ATP-binding cassette, sub-family C, member 9 O60706 ABCC9 PM 2 12631549 # ATP-binding cassette, sub-family D, member 4 O14678 ABCD4 Peroxisome 2 204606 ATPase,...”

Q9CZB3 THUMP domain-containing protein 2 from Mus musculus
Aligns to 272:425 / 528 (29.2%), covers 84.8% of PF01170, 92.0 bits

• Genomic variants in an inbred mouse model predict mania-like behaviors
  Saul, PloS one 2018
  • “...Fndc1 E9Q043 Missense L906H 0.06 chr17:54297024 C/T Slc5a7 Q8BGY9 Missense R38H 0.08 chr17:81054224 C/CTAT Thumpd2 Q9CZB3 Insertion S191NS --- Based upon previous behavioral work demonstrating alterations in seasonality in MSN mice [ 15 ], a variant in Npas2 interested us greatly due to that genes involvement...”
• Anterior segment alterations and comparative aqueous humor proteomics in the buphthalmic rabbit (an American Ophthalmological Society thesis).
  Edward, Transactions of the American Ophthalmological Society 2011

HVO_0156 N2-methylguanosine tRNA methyltransferase (RefSeq) from Haloferax volcanii DS2
D4GZA0 tRNA (Guanine(10),N(2))-dimethyltransferase from Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
Aligns to 150:316 / 321 (52.0%), covers 98.0% of PF01170, 85.2 bits

• Towards a systems approach in the genetic analysis of archaea: Accelerating mutant construction and phenotypic analysis in Haloferax volcanii
  Blaby, Archaea (Vancouver, B.C.) 2010
  • “...growth rate Hv-YPC a Strain growth rate CDM a,b Phenotype/essentiality verified H26 (wild-type) 0.0227 0.0133 HVO_0156 1041 0.0223 0.0105 HVO_0658 0585 0.0281 0.0175 HVO_2001 0343 0.0233 0.0123 Cold-sensitivity HVO_0236 1867 0.0238 0.0104 HVO_2906 0565 ND c ND c HVO_2888 1243 0.0102 0.0115 Severe growth defect HVO_0580...”
• RNomics and Modomics in the halophilic archaea Haloferax volcanii: identification of RNA modification genes
  Grosjean, BMC genomics 2008
  • “...2 G G1-4/R1, D1, Q1, E1-2, H1, P1-3 Homology with P. abyssi PAB1283*[ 177 ] HVO_0156 1041 13 R1, D1, Q1, E1-2, G1-2, H1, Me, Mi, P1-3, S1,T1,V1-2 Homology with E. coli TruD*[ 178 ] HVO_0658 0585 1Z2Z 15 G + R2-3, N1, C1, I2, L1-5,...”
• Evolutionary insights into Trm112-methyltransferase holoenzymes involved in translation between archaea and eukaryotes
  van, Nucleic acids research 2018
  • “...0.0598 Methyltransferase activator - - 2 HVO_0773 D4GTS8 0.0193 Unknown YES Class I 6 TrmG10 D4GZA0 0.0088 tRNA (Guanine(10).N(2))-dimethyltransferase NO b Class I 7 HVO_A0501 D4GRG4 0.0084 Unknown Not tested Class I 8 MenG D4GZT8 0.0084 Demethylmenaquinone methyltransferase Not tested Class I 9 SirC D4GWE7 0.0083...”

TTHA1521 hypothetical protein (NCBI) from Thermus thermophilus HB8
Aligns to 128:297 / 306 (55.6%), covers 86.3% of PF01170, 85.1 bits

• The open reading frame TTC1157 of Thermus thermophilus HB27 encodes the methyltransferase forming N²-methylguanosine at position 6 in tRNA
  Roovers, RNA (New York, N.Y.) 2012
  • “...in T. thermophilus HB8 present in the database (TTHA1521) is N-terminally truncated by 29 residues with respect to TTC1157. Similarly to TrmG10, the TTC1157...”
  • “...residues was produced based on the proposed sequence of TTHA1521. This shortened form of the protein was found to be inactive (data not shown). Since other tRNA...”

TRMN_THET2 / Q72IH5 tRNA (guanine(6)-N2)-methyltransferase; tRNA:m2G6 methyltransferase; EC 2.1.1.256 from Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27) (see 3 papers)
Q72IH5 tRNA (guanine6-N2)-methyltransferase (EC 2.1.1.256) from Thermus thermophilus (see 2 papers)
TTC1157 No description from Thermus thermophilus HB27
Aligns to 157:326 / 335 (50.7%), covers 86.3% of PF01170, 82.0 bits

• function: S-adenosyl-L-methionine-dependent methyltransferase that catalyzes the methylation of the guanosine nucleotide at position 6 (m2G6) in tRNA(Phe).
  catalytic activity: guanosine(6) in tRNA + S-adenosyl-L-methionine = H(+) + N(2)- methylguanosine(6) in tRNA + S-adenosyl-L-homocysteine (RHEA:51116)
  subunit: Monomer in solution.
  disruption phenotype: Inactivation of the gene leads to a total absence of m(2)G in tRNA but does not affect cell growth or the formation of other modified nucleosides in tRNA(Phe).
• The open reading frame TTC1157 of Thermus thermophilus HB27 encodes the methyltransferase forming N²-methylguanosine at position 6 in tRNA
  Roovers, RNA (New York, N.Y.) 2012
  • “...Harbor Laboratory Press The open reading frame TTC1157 of Thermus thermophilus HB27 encodes the methyltransferase forming N2-methylguanosine at position 6 in...”
  • “...thermophilus HB27 methyltransferase (MTase) encoded by the TTC1157 open reading frame that catalyzes the formation of this modified nucleoside....”
• Crystal structures of the tRNA:m2G6 methyltransferase Trm14/TrmN from two domains of life
  Fislage, Nucleic acids research 2012
  • “...X-ray crystal structures of the bacterial tRNA:m 2 G6 MTase TTC TrmN from Thermus thermophilus (TTC1157) and its archaeal ortholog Pf Trm14 from Pyrococcus furiosus (PF1002) in complex with the methyl donor SAM, the product S -adenosyl-homocysteine (SAH) and the inhibitor SFG (sinefungin). This study provides...”
  • “...M Oudjama Y Fislage M Bujnicki JM Verses W Droogmans L The open reading frame TTC1157 of Thermus thermophilus HB27 encodes the methyltransferase forming N2-methylguanosine at position 6 in tRNA RNA 2012 18 815 824 22337946 17 Czerwoniec A Kasprzak JM Kaminska KH Rother K Purta...”
• Crystallization and preliminary X-ray crystallographic analysis of putative tRNA-modification enzymes from Pyrococcus furiosus and Thermus thermophilus
  Fislage, Acta crystallographica. Section F, Structural biology and crystallization communications 2011
  • “...set was collected to 2.2 A by the gene ttc1157 from the eubacterium Thermus thermophilus was crystallized in the trigonal space group P3221. A complete data set...”
  • “...and the eubacterial homologue encoded by the gene ttc1157 from Thermus thermophilus, hereafter referred to as TTC1157. Sequence alignment shows that these...”

MK0969 Predicted N6-adenine-specific RNA methylase containing THUMP domain (NCBI ptt file) from Methanopyrus kandleri AV19
Aligns to 177:347 / 352 (48.6%), covers 98.5% of PF01170, 80.7 bits

• The open reading frame TTC1157 of Thermus thermophilus HB27 encodes the methyltransferase forming N²-methylguanosine at position 6 in tRNA
  Roovers, RNA (New York, N.Y.) 2012
  • “...in E. coli: TK1863 from Thermococcus kodakaraensis, MK0969 from Methanopyrus kandleri, AF2178 from Archaeoglobus fulgidus, PAB0923 from P. abyssi, MJ0438 from...”
  • “...Amplification of ORF MJ0438 Amplification of ORF MK0969 Amplification of ORF PAB0923 Amplification of ORF TK1863 Amplification of THUMP-TTC1157 Amplification of...”
• Formation of m2G6 in Methanocaldococcus jannaschii tRNA catalyzed by the novel methyltransferase Trm14
  Menezes, Nucleic acids research 2011
  • “...as query revealed a predicted N 6 -adenine specific RNA methylase containing a THUMP domain (MK0969) also from M. kandleri . Subsequent BLAST searches of all methanogen genomes using MK0969 as query sequence then revealed that a highly similar protein is present in a subset of...”
  • “...Some methanogens, such as M. burtonii and M. thermautotrophicus , lack both CysRS and the MK0969 homolog. An MK0969 homolog is never present when both SepRS and CysRS are found in a methanogen genome. These characteristics suggested that the function of the protein might be related...”

5e72A / Q5JID5 Crystal structure of the archaeal tRNA m2g/m22g10 methyltransferase (atrm11) in complex with s-adenosyl-l-methionine (sam) from thermococcus kodakarensis (see paper)
Aligns to 154:316 / 323 (50.5%), covers 85.8% of PF01170, 79.2 bits

• Ligand: s-adenosylmethionine (5e72A)

Saci_1283 RNA methylase (NCBI) from Sulfolobus acidocaldarius DSM 639
Aligns to 134:293 / 301 (53.2%), covers 94.9% of PF01170, 78.5 bits

• The DNA Methylome of the Hyperthermoacidophilic Crenarchaeon Sulfolobus acidocaldarius
  Couturier, Frontiers in microbiology 2018
  • “...* ; ( 15 ) Saci_0975; ( 18 ) Saci_1280 * ; ( 7 ) Saci_1283 * ; ( 22 ) Saci_1490 * ; ( 9 ) Saci_1537 * ; ( 11 ) Saci_1975; ( 12 ) Saci_2156 CELLULAR PROCESSES AND SIGNALING D: Cell cycle control...”

PA14_24665 hypothetical protein (NCBI) from Pseudomonas aeruginosa UCBPP-PA14
Aligns to 165:268 / 367 (28.3%), covers 37.1% of PF01170, 71.9 bits

• Pseudomonas aeruginosa Genomic Structure and Diversity
  Klockgether, Frontiers in microbiology 2011
  • “...wzz O-antigen chain length regulator 2149425 T C PA14_24600 syn. Putative carboxypeptidase 2156146 C A PA14_24665 Q K Hypothetical protein 2209674 A G PA14_25250 K E gapA Glyceraldehyde-3-phosphate dehydrogenase 2318606 A G PA14_26600 syn. RNA polymerase sigma factor 2407435 C G PA14_27755 syn. yliJ Glutathione S-transferase...”

rrnAC2834 putative RNA methylase (NCBI) from Haloarcula marismortui ATCC 43049
Aligns to 375:553 / 558 (32.1%), covers 90.9% of PF01170, 71.4 bits

• Genome information management and integrated data analysis with HaloLex
  Pfeiffer, Archives of microbiology 2008
  • “...OE3882R rrnAC2822 951 309 Extended NP2248A, OE3879F, HQ3106A rrnAC2831 540 411 Extended NP5076A, HQ1339A, OE3871R rrnAC2834 1,032 1,677 Shortened NP1066A, OE4144R, HQ1407A rrnAC2836 1,206 1,359 Shortened HQ2439A, NP3538A rrnAC2851 744 786 Shortened NP0554A, OE4165R, HQ3686A rrnAC2857 2,196 2,238 Shortened NP1350A, OE4181R, HQ3684A rrnAC2859 630 678 Shortened...”

TON_1221 Hypothetical DNA methylase (RefSeq) from Thermococcus onnurineus NA1
Aligns to 164:329 / 364 (45.6%), covers 80.7% of PF01170, 56.6 bits

• Proteome analyses of hydrogen-producing hyperthermophilic archaeon Thermococcus onnurineus NA1 in different one-carbon substrate culture conditions
  Moon, Molecular & cellular proteomics : MCP 2012
  • “...Proteomics 11.6 b a TON_0937 TON_0989 TON_1040 TON_1221 TON_1382 TON_1414 TON_1420 TON_1421 TON_1423 TON_1634 TON_1642 TON_1647 TON_1777 TON_1882 TON_1921...”

M.Aba6200I Type I methyltransferase recognizing YACNNNNNGTAG with methylation at 2(6mA),-3(6mA) from Acinetobacter baumannii 6200
Aligns to 196:392 / 552 (35.7%), covers 74.1% of PF01170, 49.5 bits

M.Axy10807I Type I methyltransferase recognizing CAANNNNNNNTACG with methylation at 3(6mA),-4(6mA) from Achromobacter xylosoxidans subsp. xylosoxidans
Aligns to 196:392 / 554 (35.6%), covers 74.1% of PF01170, 48.9 bits

M.ApaHSI Type I methyltransferase recognizing AYCNNNNNCTTC with methylation at 1(6mA),-3(6mA) from Atopobium parvulum
Aligns to 322:511 / 796 (23.9%), covers 70.6% of PF01170, 48.6 bits

M.PstRCH2I Type I methyltransferase recognizing YACNNNNNCTCC with methylation at 2(6mA),-3(6mA) from Pseudomonas stutzeri RCH2
Aligns to 196:392 / 554 (35.6%), covers 74.1% of PF01170, 48.6 bits

PAM18_2238 type I restriction-modification system subunit M from Pseudomonas aeruginosa M18
Aligns to 196:387 / 554 (34.7%), covers 65.5% of PF01170, 47.9 bits

• Genomic analysis and temperature-dependent transcriptome profiles of the rhizosphere originating strain Pseudomonas aeruginosa M18
  Wu, BMC genomics 2011
  • “...of the type III restriction-modification (RM) system. MGI-II contains another three genes, hsdR (PAM18_2237), hsdM (PAM18_2238) and hsdS (PAM18_2239) that code for all the three subunits in the multifunctional type I RM system which quite differ from the two type I RM systems in the PA7...”

Q7TNK6 tRNA (guanine(10)-N2)-methyltransferase homolog from Rattus norvegicus
Aligns to 189:333 / 463 (31.3%), covers 70.1% of PF01170, 47.5 bits

• Gonadal transcriptomics elucidate patterns of adaptive evolution within marine rockfishes (Sebastes).
  Heras, BMC genomics 2015
  • “...O95807 1.58E-65 O95807 3.27E-37 trna guanosine-2 -o-methyltransferase trm11 homolog 0.036 0.021 1.704 285 Q05B63 2.25E-57 Q7TNK6 7.43E-34 tumor necrosis factor ligand superfamily member 10 0.151 0.127 1.186 309 P50591 2.46E-15 P50591 1.43E-08 tumor necrosis factor receptor superfamily member 0.12 0.105 1.14 309 Q92956 2.24E-28 Q92956 6.81E-13...”
• Proteomic analysis of immature rat pups brain in response to hypoxia and ischemia challenge.
  Yang, International journal of clinical and experimental pathology 2014

M.Kpn126I Type I methyltransferase recognizing AGCNNNNNCTTC with methylation at 1(6mA),-3(6mA) from Klebsiella pneumoniae AR_0126
M.Kpn160I Type I methyltransferase recognizing AGCNNNNNCTTC with methylation at 1(6mA),-3(6mA) from Klebsiella pneumoniae AR_0160
M.Kpn447I Type I methyltransferase recognizing AGCNNNNNCTTC with methylation at 1(6mA),-3(6mA) from Klebsiella pneumoniae FDAARGOS_447
M.KpnNH54I Type I methyltransferase recognizing AGCNNNNNCTTC with methylation at 1(6mA),-3(6mA) from Klebsiella pneumoniae NH54
M.Sen64034II Type I methyltransferase recognizing AGCNNNNNCTTC with methylation at 1(6mA),-3(6mA) from Salmonella enterica CFSAN064034
Aligns to 196:399 / 557 (36.6%), covers 75.1% of PF01170, 47.5 bits

M.Kpn0138I Type I methyltransferase recognizing AGCNNNNNCTTC with methylation at 1(6mA),-3(6mA) from Klebsiella pneumoniae AR_0138
M.Kpn1215II Type I methyltransferase recognizing AGCNNNNNCTTC with methylation at 1(6mA),-3(6mA) from Klebsiella pneumoniae CRKP-1215
M.Kpn156I Type I methyltransferase recognizing AGCNNNNNCTTC with methylation at 1(6mA),-3(6mA) from Klebsiella pneumoniae FDAARGOS_156
M.Kpn2297II Type I methyltransferase recognizing AGCNNNNNCTTC with methylation at 1(6mA),-3(6mA) from Klebsiella pneumoniae CRKP-2297
M.KpnGH01II Type I methyltransferase recognizing AGCNNNNNCTTC with methylation at 1(6mA),-3(6mA) from Klebsiella pneumoniae SKGH01
Aligns to 196:399 / 557 (36.6%), covers 75.1% of PF01170, 47.5 bits

M.Sth6578I Type I methyltransferase recognizing GCANNNNNNGTC with methylation at 3(6mA),-2(6mA) from Spirochaeta thermophila DSM 6578
Aligns to 190:376 / 552 (33.9%), covers 82.7% of PF01170, 47.2 bits

CG1074 uncharacterized protein from Drosophila melanogaster
Aligns to 188:326 / 488 (28.5%), covers 69.5% of PF01170, 47.1 bits

• Myopathic lamin mutations cause reductive stress and activate the nrf2/keap-1 pathway
  Dialynas, PLoS genetics 2015
  • “...3.48 1.03E-05 Glutamate gated ion channel activity * CG34007 - 7.96 7.33E-05 33.49 3.47E-06 Unknown CG1074 - 7.36 2.87E-07 2.14 8.15E-05 Methyltransferase activity; nucleic acid binding * CG31781 - 5.50 5.18E-06 4.21 3.05E-04 Lateral inhibition in cell fate determination GstD9 Glutathione S transferase D9 4.91 9.40E-05...”

M.Bau1417II Type I methyltransferase recognizing CGANNNNNNNTTCC with methylation at 3(6mA),-4(6mA) from Brevibacterium aurantiacum SMQ-1417
Aligns to 170:354 / 490 (37.8%), covers 66.0% of PF01170, 47.0 bits

AT3G26410 methyltransferase/ nucleic acid binding (RefSeq) from Arabidopsis thaliana
Aligns to 192:321 / 477 (27.3%), covers 70.1% of PF01170, 46.8 bits

• Data-Independent Acquisition for the Detection of Mononucleoside RNA Modifications by Mass Spectrometry
  Janssen, Journal of the American Society for Mass Spectrometry 2022
  • “...mRNA Levels of tRNA Modifiers a . Gene Control (RPM) Salt (RPM) TRM11 Isoform 1: AT3G26410 5.60 8.85 TRM11 Isoform 2: AT4G23020 5.14 7.00 TRM9 Isoform 1: AT1G31600 10.28 14.55 TRM9 Isoform 2: AT1G36310 24.05 25.57 AtELP1: AT3G52850 69.49 119.35 a Table 1 : mRNA Levels...”
• Identification of tRNA nucleoside modification genes critical for stress response and development in rice and Arabidopsis
  Wang, BMC plant biology 2017
  • “...9.3E-42 Trm10 m 1 G At5g47680 (AtTRM10) 1.0E-29 LOC_Os02g49360 (OsTRM10) 1.5E-28 Trm11 m 2 G At3g26410 (AtTRM11) 2.0E-53 LOC_Os02g35060 (OsTRM11) 2.0E-54 Trm13 Am At4g01880 (AtTRM13) 5.0E-24 LOC_Os03g61750 (OsTRM13) 1.6E-09 Trm61 m 1 A At5g14600 (AtTRM61) 7.0E-47 LOC_Os04g25360 (OsTRM61a) 2.8E-44 LOC_Os04g25990 (OsTRM61b) 1.5E-43 LOC_Os05g07830 (OsTRM61c) 1.2E-15 Trm82...”
  • “...HMMPfam PF05958.4 tRNA_U5-meth_tr 366554 (m 2 G)Trm11 Pfam PF01170 Putative RNA methylase family UPF0020 184297 AT3G26410 pfam PF01170 Putative RNA methylase 193315 (Gm)Trm3 Pfam PF00588 tRNA/rRNA meth_tr, SpoU 12861428 LOC_Os02g35060 pfam PF01170.11 UPF0020 193315 AT4G17610 pfam PF00588 tRNA/rRNA meth_tr, SpoU 17001842 LOC_Os03g01110 HMMPfam PF00588.12 SpoU_methylase 15751716...”
• Deciphering the epitranscriptome: A green perspective
  Burgess, Journal of integrative plant biology 2016
  • “...transfer RNA methyltransferase (TRM) enzymes have been identified in Arabidopsis , namely AtTRM10 (At5g47680), AtTRM11 (At3g26410) and AtTRM82 (At1g03110), which mediate m 1 G, m 2 G and m 7 G in tRNAs, respectively (Chen et al. 2010 ). Of these, a biological role in plant...”
• Transfer RNA modifications and genes for modifying enzymes in Arabidopsis thaliana
  Chen, BMC plant biology 2010
  • “...U (Figure 6C ). The corresponding genes, At5g13680 and At1g13870 were named AtELP1 and AtKTI12. At3g26410 was homologous to Trm11pthe gene required for m 2 G modification in S. cerevisiae . Only 7.3% of m 2 G remained in mutant plants compared to wild type plants...”
  • “...N661341 At5g13680 (AtELP1) < 0.0002 (< 0.01%) N658947 At1g13870 (AtKTI12) < 0.0003 (< 0.02%) N622158 At3g26410 (AtTRM11) 0.020 (7.3%) Amount of certain modified nucleosides were shown using relative quantification to internal standard (), percentage of wild type level was shown in bracket. Figure 5 T-DNA lines...”

M.DfaPA1I Type I methyltransferase recognizing CGANNNNNNCTCC with methylation at 3(6mA),-3(6mA) from Dickeya fangzhongdai PA1
Aligns to 210:408 / 568 (35.0%), covers 65.5% of PF01170, 46.8 bits

M.BspLA1I Type I methyltransferase recognizing GAANNNNNNCTCC with methylation at 3(6mA),-3(6mA) from Bradyrhizobium species CCGE-LA001
Aligns to 210:388 / 566 (31.6%), covers 65.5% of PF01170, 46.1 bits

M.Bst12778I Type I methyltransferase recognizing GNNGAYNNNNNNGTA with methylation at 5(6mA),-2(6mA) from Bacteriovorax stolpii DSM 12778
Aligns to 189:370 / 501 (36.3%), covers 90.4% of PF01170, 45.7 bits

TRM11_HUMAN / Q7Z4G4 tRNA (guanine(10)-N2)-methyltransferase homolog; tRNA guanosine-2'-O-methyltransferase TRM11 homolog; EC 2.1.1.- from Homo sapiens (Human) (see paper)
NP_001026882 tRNA (guanine(10)-N2)-methyltransferase homolog isoform a from Homo sapiens
Aligns to 189:326 / 463 (29.8%), covers 70.1% of PF01170, 45.2 bits

• function: Catalytic subunit of an S-adenosyl-L-methionine-dependent tRNA methyltransferase complex that mediates the methylation of the guanosine nucleotide at position 10 (m2G10) in tRNAs.
  subunit: Interacts with TRMT112.
• Dcf1 induces glioblastoma cells apoptosis by blocking autophagy
  Luo, Cancer medicine 2022
  • “...8 Q96CW5 TUBGCP3 1.347 1 907 103.506 9 Q9UNI6 DUSP12 1.287 1 340 37.663 10 Q7Z4G4 TRMT11 1.333 1 463 53.387 11 P07948 LYN 1.283 1 512 58.537 12 Q9Y2H2 INPP5F 1.286 2 1132 128.326 13 P48201 ATP5G3 1.328 1 142 14.684 14 Q9H4I9 SMDT1 1.303...”
• Chemical Proteomic Profiling of Human Methyltransferases.
  Horning, Journal of the American Chemical Society 2016
  • “...Q96LA8 PRMT6 Protein 20 20 Q9H1A3 METTL9 Uncharacterized 20 20 Q96G04 EEF2KM Protein 20 20 Q7Z4G4 TRMT1 Uncharacterized 20 20 Q5JPI9 METTL1 Protein 20 20 Non-MTs Q8WXB METTL2 Protein 20 20 Q2M2I8 AAK1 Protein (kinase) 20 16 Q9NRG SMYD2 Protein 20 20 P55263 ADK Metabolic (kinase)...”
• Germline predictors of androgen deprivation therapy response in advanced prostate cancer.
  Kohli, Mayo Clinic proceedings 2012
  • GeneRIF: SNPs associated with androgen deprivation failure in advanced prostate cancer

M.Fco1691I Type I methyltransferase recognizing GAAGNNNNNNCTA with methylation at 3(6mA),-2(6mA) from Flavobacterium columnare TC 1691
Aligns to 313:481 / 756 (22.4%), covers 59.9% of PF01170, 44.9 bits

Q05B63 tRNA (guanine(10)-N2)-methyltransferase homolog from Bos taurus
Aligns to 189:325 / 460 (29.8%), covers 70.1% of PF01170, 44.8 bits

• Gonadal transcriptomics elucidate patterns of adaptive evolution within marine rockfishes (Sebastes).
  Heras, BMC genomics 2015
  • “...1.518 279 O95807 1.58E-65 O95807 3.27E-37 trna guanosine-2 -o-methyltransferase trm11 homolog 0.036 0.021 1.704 285 Q05B63 2.25E-57 Q7TNK6 7.43E-34 tumor necrosis factor ligand superfamily member 10 0.151 0.127 1.186 309 P50591 2.46E-15 P50591 1.43E-08 tumor necrosis factor receptor superfamily member 0.12 0.105 1.14 309 Q92956 2.24E-28...”

M.BspD4I Type I methyltransferase recognizing AYCNNNNNCTTC with methylation at 1(6mA),-3(6mA) from Bacteroides species L21-Spi-D4
Aligns to 311:481 / 748 (22.9%), covers 60.9% of PF01170, 44.5 bits

M1.PcoRK1I Type II methyltransferase recognizing ACTGGG with methylation at 2(N4mC),-2(N4mC) from Paracoccus contaminans RKI 16-01929T=LMG 29738T=CCM 8701T=CIP 111112T
Aligns to 92:185 / 494 (19.0%), covers 24.9% of PF01170, 43.7 bits

TRM11_YEAST / Q12463 tRNA (guanine(10)-N2)-methyltransferase; tRNA [Gm10] methyltransferase; tRNA guanosine-2'-O-methyltransferase TRM11; tRNA methylase 11; EC 2.1.1.214 from Saccharomyces cerevisiae (strain ATCC 204508 / S288c) (Baker's yeast) (see 3 papers)
Q12463 tRNA (guanine10-N2)-methyltransferase (EC 2.1.1.214) from Saccharomyces cerevisiae (see 2 papers)
TRM11 / Q12463 tRNA (guanine¹⁰-N²)-monomethyltransferase catalytic subunit (EC 2.1.1.214) from Saccharomyces cerevisiae (strain ATCC 204508 / S288c) (see paper)
TRM11 tRNA guanosine-2'-O-methyltransferase TRM11; EC 2.1.1.- from Saccharomyces cerevisiae (see paper)
YOL124C Catalytic subunit of an adoMet-dependent tRNA methyltransferase complex (Trm11p-Trm112p), required for the methylation of the guanosine nucleotide at position 10 (m2G10) in tRNAs; contains a THUMP domain and a methyltransferase domain (RefSeq) from Saccharomyces cerevisiae
NP_014517 tRNA (guanine-N2-)-methyltransferase from Saccharomyces cerevisiae S288C
Aligns to 183:303 / 433 (27.9%), covers 67.0% of PF01170, 43.7 bits

• function: Catalytic subunit of an S-adenosyl-L-methionine-dependent tRNA methyltransferase complex that mediates the methylation of the guanosine nucleotide at position 10 (m2G10) in tRNAs.
  catalytic activity: guanosine(10) in tRNA + S-adenosyl-L-methionine = H(+) + N(2)- methylguanosine(10) in tRNA + S-adenosyl-L-homocysteine (RHEA:43128)
  subunit: Interacts with TRM112.
• Time-resolved NMR monitoring of tRNA maturation
  Barraud, Nature communications 2019
  • “...carrying deletions of the genes for modification enzymes (YML080w, YNL292w, YDR120c, YKR056w, YBL024w, YDL201w, and YOL124c) were obtained from Euroscarf and used for tRNA preparations for MS analysis. The proteinase-deficient S. cerevisiae strain c13-ABYS-86 59 was used for the preparation of yeast extracts used in NMR...”
  • “...Chromosomal deletion of genes coding for modification enzymes (YML080w, YNL292w, YDR120c, YKR056w, YBL024w, YDL201w, and YOL124c) was carried out by homologous recombination in the c13-ABYS-86 genetic background. The kanamycin-resistance cassettes kanMX were amplified by high-fidelity PCR (Phusion, ThermoFisher) from the appropriate YKO collection kanMX strains (Euroscarf)...”
• Activation mode of the eukaryotic m2G10 tRNA methyltransferase Trm11 by its partner protein Trm112
  Bourgeois, Nucleic acids research 2017
  • “...by the Trm11Trm112 enzyme. MATERIALS AND METHODS Cloning, mutagenesis, expression and purification of proteins The YOL124c ORF was amplified by polymerase chain reaction (PCR) from S. cerevisiae (strain S288C) genomic DNA as a template using y-trm11-eag1-poly and y-trm11-not1-poly oligonucleotides ( Supplementary Table S1 ). The PCR...”
• Dissecting the cis and trans elements that regulate adjacent-gene coregulation in Saccharomyces cerevisiae
  Arnone, Eukaryotic cell 2014
  • “...YKL143W YLR002C YLR276C YLR401C YML093W YNL110C YNL132W YNR053C YOL124C YOR091W YPL012W YPL093W YPR143W UTP10 ALB1 RRP14 UTP11 LTV1 NOC3 DBP9 DUS3 UTP14 NOP15...”
  • “...YNL062C YNL110C YNL119W YNL175C YNL247W YNL308C YNR053C YNR054C YOL124C YOR206W YOR243C YOR272W YPL093W YPL146C YPL212C YPL226W TRM2 SRP40 RLP24 YEF3 DUS3 BUD22...”
• Comprehensive structural and substrate specificity classification of the Saccharomyces cerevisiae methyltransferome
  Wlodarski, PloS one 2011
  • “...(TRM4), YDL201W (TRM8), YBR061C (TRM7), YDR120C (TRM1), YHR070W (TRM5), YJL125C (GCD14), YKR056W (TRM2), YML014W (TRM9), YOL124C (TRM11), YOL125W (TRM13), YOL141W (PPM2), YPL030W (TRM44) rRNA YCL054W (SPB1), YCR047C (BUD23), YDL014W (NOP1), YGL136C (MRM2) , YPL266W (DIM1) tRNA/rRNA YDR083W (RRP8) , YNL022C (RCM1) , YNL061W (NOP2) , YBR141C...”
• Selective inhibition of yeast regulons by daunorubicin: a transcriptome-wide analysis
  Rojas, BMC genomics 2008
  • “...RIB1 YGR045C FAS1 CDC33 RPN10 YDR034C-D YOL092W ALD6 HHO1 RIB4 YGR161C GDH1 CDC60 RPO26 YDR060W YOL124C AMS1 HMT1 RIP1 YHL021C GLT1 COP1 RPS11B YDR084C YOR021C ARA1 HOR2 RME1 YHM1 NUP82 CPR6 RPS19A YDR098C-B YOR262W ARG1 HSP104 RNR1 YHR087W PFK1 DIB1 RPS26A YDR154C YOR343C-A ARG4 HSP12 SCM4...”
• Identification of coherent patterns in gene expression data using an efficient biclustering algorithm and parallel coordinate visualization
  Cheng, BMC bioinformatics 2008
  • “...YBR267W, YDR091C, YNL110C, YNL163C, YOR272W, YPL211W tRNA methylation 1.94E-04 6.55E-02 YBL024W, YBR061C, YDR165W, YNR046W, YOL093W, YOL124C processing of 20S pre-rRNA 1.80E-05 6.05E-03 YDL153C, YDL166C, YDR449C, YEL026W, YJL191W, YJR002W, YLR068W, YLR192C, YLR222C, YML093W, YMR093W, YOR056C, YPR137W transcription from RNA polymerase III promoter 1.02E-04 3.45E-02 YBR154C, YDL150W, YDR045C,...”
  • “...YKR060W, YLL008W, YLR186W, YML093W, YMR093W, YMR131C, YMR290C, YNL110C, YNL113W, YNL132W, YNL175C, YNR003C, YNR038W, YNR053C, YOL077C, YOL124C, YOL144W, YOR056C, YOR145C, YOR206W, YOR272W, YPL211W, YPL212C, YPL226W mRNA export from nucleus 3.51E-04 1.18E-01 YBR034C, YDL116W, YDR432W, YER107C, YJL140W, YKL057C, YKL068W, YKR002W, YKR095W, YMR308C, YOR098C 5 nucleotide-excision repair 1.88E-04 1.97E-02...”
• Cophenetic correlation analysis as a strategy to select phylogenetically informative proteins: an example from the fungal kingdom
  Kuramae, BMC evolutionary biology 2007
  • “...(Sce) [19]. Correlation value KOG number Sce Systematic name Systematic deletion Chromosome number 1.00 KOG2671 YOL124c viable XV 0.93 KOG0340 YHR169w inviable VIII 0.91 KOG4089 YDR405w viable IV 0.91 KOG0173 YOR157C inviable XV 0.91 KOG2728 YIL083c inviable IX 0.90 KOG3111 YJL121c viable X 0.89 KOG3800 YDR460w...”
  • “...(Additional file 2 ). This KOG2671 protein (putative RNA methylase KOG annotation) corresponds to ORF YOL124c of S. cerevisiae [Catalytic subunit of an adoMet-dependent tRNA methyltransferase complex (Trm11p-Trm112p), required for the methylation of the guanosine nucleotide at position 10 (m2G10) in tRNAs; contains a THUMP domain...”
• The reacquisition of biotin prototrophy in Saccharomyces cerevisiae involved horizontal gene transfer, gene duplication and gene clustering
  Hall, Genetics 2007
  • “...(BUL1) YMR276W (DSK2) No No SGD description line YOL124C (TRM11) YOL125W (TRM13) No No YOR340C (RPA43) YOR341W (RPA190) -- -- YML058W (SML1) Ubiquitin-binding...”
• More
• The zinc finger protein Ynr046w is plurifunctional and a component of the eRF1 methyltransferase in yeast.
  Heurgué-Hamard, The Journal of biological chemistry 2006 (PubMed)
  • GeneRIF: The Ynr046w eRF1 methyltransferase subunit is shared by the tRNA methyltransferase Trm11p and probably by two other enzymes containing a Rossman fold

PFCIRM129_00525 type I restriction-modification system subunit M from Propionibacterium freudenreichii subsp. freudenreichii
Aligns to 169:352 / 447 (41.2%), covers 65.5% of PF01170, 43.2 bits

• Identification of proteins involved in the anti-inflammatory properties of Propionibacterium freudenreichii by means of a multi-strain study
  Deutsch, Scientific reports 2017
  • “...Layer Homology domain) and were confirmed as being surface exposed by proteomic analysis. The hsdM3 (PFCIRM129_00525), merA (PFCIRM129_03920) and lacI1 (PFCIM129_07765) genes encode predicted cytoplasmic proteins, involved in DNA restriction and modification, coenzyme metabolism and the transcription of regulation, respectively. The eno1 gene (PFCIRM121_10305) encodes a...”
  • “...the chromosomic DNA of the strain. Finally, the slpB (PFCIRM129_00700), slpE (PFCIRM129_05460), slpF (PFCIRM129_01545), hsdM3 (PFCIRM129_00525) and pep (PFCIRM129_10925) genes were successfully inactivated in Pf CIRM129, while the htrA4 (PFCIRM121_07195), eno1 (PFCIRM121_10305) and pouf 08235 (PFCIRM121_08235) genes were successfully inactivated in Pf CIRM 121 ( Fig....”

M.Bau1420I Type I methyltransferase recognizing GATNNNNNNTGGG with methylation at 2(6mA),-4(6mA) from Brevibacterium aurantiacum SMQ-1420
Aligns to 170:354 / 490 (37.8%), covers 66.0% of PF01170, 43.0 bits

2okcB / Q89Z59 Crystal structure of type i restriction enzyme stysji m protein (np_813429.1) from bacteroides thetaiotaomicron vpi-5482 at 2.20 a resolution
Aligns to 150:330 / 426 (42.5%), covers 86.3% of PF01170, 42.9 bits

• Ligand: s-adenosylmethionine (2okcB)

Y3380_DICDI / Q54BW1 Putative uncharacterized protein DDB_G0293380 from Dictyostelium discoideum (Slime mold) (see paper)
Aligns to 249:457 / 561 (37.3%), covers 65.5% of PF01170, 42.8 bits

M.Ssp714I Type I methyltransferase recognizing AAGNNNNNGTCC with methylation at 2(6mA),-3(6mA) from Streptomyces sp. WMMB 714
Aligns to 137:318 / 477 (38.2%), covers 65.5% of PF01170, 42.8 bits

M.PfrJS11I Type I methyltransferase recognizing ACCNNNNNCTTC with methylation at 1(6mA),-3(6mA) from Propionibacterium freudenreichii JS11
M.PfrJS13I Type I methyltransferase recognizing ACCNNNNNCTTC with methylation at 1(6mA),-3(6mA) from Propionibacterium freudenreichii JS13
Aligns to 213:396 / 534 (34.5%), covers 65.5% of PF01170, 42.7 bits

MTV1_VIBS3 / Q03055 Type II methyltransferase M.VspI; M.VspI; Adenine-specific methyltransferase VspI; Modification methylase VspI; EC 2.1.1.72 from Vibrio sp. (strain 343) (see paper)
Aligns to 134:240 / 408 (26.2%), covers 56.3% of PF01170, 42.4 bits

• function: A gamma subtype methylase, recognizes the double-stranded sequence 5'-ATTAAT-3', methylates A-5 on both strands, and protects the DNA from cleavage by the VspI endonuclease.
  catalytic activity: a 2'-deoxyadenosine in DNA + S-adenosyl-L-methionine = an N(6)-methyl-2'-deoxyadenosine in DNA + H(+) + S-adenosyl-L- homocysteine (RHEA:15197)

M.Hma11271I Type I methyltransferase recognizing AACNNNNNNNTCCA with methylation at 2(6mA),-4(6mA) from Hydrogenovibrio marinus DSM 11271
Aligns to 153:283 / 492 (26.6%), covers 60.9% of PF01170, 42.4 bits

M.VspI Type II methyltransferase recognizing ATTAAT with methylation at 5(6mA) from Vibrio species 343
Aligns to 135:242 / 544 (19.9%), covers 56.3% of PF01170, 41.5 bits

M.PfrJS2I Type I methyltransferase recognizing ATCNNNNNGTCG with methylation at 1(6mA),-3(6mA) from Propionibacterium freudenreichii JS2
M.PfrJS14I Type I methyltransferase recognizing ATCNNNNNGTCG with methylation at 1(6mA),-3(6mA) from Propionibacterium freudenreichii JS14
M.PfrJS7I Type I methyltransferase recognizing ATCNNNNNGTCG with methylation at 1(6mA),-3(6mA) from Propionibacterium freudenreichii JS7
M.PfrJS7aI Type I methyltransferase recognizing ATCNNNNNGTCG with methylation at 1(6mA),-3(6mA) from Propionibacterium freudenreichii JS7a
M.PfrJS8I Type I methyltransferase recognizing ATCNNNNNGTCG with methylation at ?(6mA),-3(6mA) from Propionibacterium freudenreichii JS8
Aligns to 240:402 / 561 (29.1%), covers 65.5% of PF01170, 41.3 bits

HMPREF1204_03289 type I restriction-modification system subunit M from Bacteroides fragilis HMW 615
Aligns to 156:336 / 477 (37.9%), covers 82.7% of PF01170, 41.3 bits

• Novel large-scale chromosomal transfer in Bacteroides fragilis contributes to its pan-genome and rapid environmental adaptation.
  Husain, Microbial genomics 2017
  • “...Type I R-M associated genes that are not present in B. fragilis 638R (HMPREF1204_03284, HMPREF1204_03286, HMPREF1204_03289 and HMPREF1204_03290) are evident at the left end of tetQ2 435 ( Fig. 5 , upper panel, arrow c). HMPREF1204_03284 appears to be an S-subunit, so it could potentially replace...”

AT4G28830 methyltransferase/ nucleic acid binding (RefSeq) from Arabidopsis thaliana
Aligns to 27:178 / 208 (73.1%), covers 39.1% of PF01170, 41.3 bits

• Orthologous nuclear markers and new transcriptomes that broadly cover the phylogenetic diversity of Acanthaceae
  Morais, Applications in plant sciences 2019
  • “...LCNGs (except nine that do not have any variable site:AT1G21370, AT1G31500, AT1G79120, AT3G25530, AT4G01030, AT4G18975, AT4G28830, AT4G38370, and AT5G14140)were found have the potential to solve phylogenetic relationships at deeper nodes (see alignments available at https://figshare.com/s/9903aacaaa3c34bc9ed9 ). We observed that exons are more conserved among species of...”
• Synergistic use of plant-prokaryote comparative genomics for functional annotations
  Gerdes, BMC genomics 2011
  • “...very precise functions could be predicted, e.g. methylation of a specific position in ribosomal RNA (At4g28830, case number 31 in Table 3 ) whereas for others the prediction remained more general but testable nonetheless. For instance, we were able to link certain members of the COG0523...”
  • “...195 30 At1g03030 1072 yggC Experimental-yggC Sugar/polyol kinase In progress in E. coli 48 31 At4g28830 2263 rRNA modification Archaea Predicted RNA methylase COG2263 In progress in H. volcanii 49 a Numbers in italics are for members of families for which the prediction has been invalidated...”

M.Pfe45I Type I methyltransferase recognizing AYCNNNNNGTCC with methylation at 1(6mA),-3(6mA) from Pelosinus fermentans JBW45
Aligns to 190:335 / 521 (28.0%), covers 62.4% of PF01170, 41.0 bits

M.CpaAII Type I methyltransferase recognizing AAGNNNNNCTCC with methylation at 2(6mA),-3(6mA) from Clostridium pasteurianum
Aligns to 178:377 / 516 (38.8%), covers 64.5% of PF01170, 41.0 bits

M.Rsp34AI Type I methyltransferase recognizing GACNNNNNNCTGG with methylation at 2(6mA),-3(6mA) from Rhizobium species ACO-34A
Aligns to 153:266 / 484 (23.6%), covers 58.9% of PF01170, 40.6 bits

7wm6A / A0A0C2W699 Crystal structure of sah-bound trmm from mycoplasma capricolum (see paper)
Aligns to 50:177 / 240 (53.3%), covers 29.9% of PF01170, 40.6 bits

• Ligand: s-adenosyl-l-homocysteine (7wm6A)

M.PfrJS9I Type I methyltransferase recognizing GCANNNNNNGTGG with methylation at 3(6mA),-3(6mA) from Propionibacterium freudenreichii JS9
M.PfrJS20III Type I methyltransferase recognizing GCANNNNNNGTGG with methylation at 3(6mA),-3(6mA) from Propionibacterium freudenreichii JS20
M.PfrJS20aIII Type I methyltransferase recognizing GCANNNNNNGTGG with methylation at 3(6mA),-3(6mA) from Propionibacterium freudenreichii JS20a (LT618791)
M.PfrJS9aI Type I methyltransferase recognizing GCANNNNNNGTGG with methylation at 3(6mA),-3(6mA) from Propionibacterium freudenreichii JS9a
Aligns to 213:376 / 534 (30.7%), covers 65.5% of PF01170, 40.5 bits

M.EcoEI Type I methyltransferase recognizing GAGNNNNNNNATGC with methylation at ?(6mA) from Escherichia coli A58
Aligns to 168:340 / 490 (35.3%), covers 59.4% of PF01170, 40.2 bits

M.Ces8809II Type I methyltransferase recognizing CTANNNNNNCTGC with methylation at 3(6mA),-3(6mA) from Clostridium estertheticum subsp. estertheticum
Aligns to 161:361 / 499 (40.3%), covers 65.0% of PF01170, 40.2 bits

M.SspRSPHI Type I methyltransferase recognizing TGANNNNNNNGTCC with methylation at 3(6mA),-3(6mA) from Sphingomonas species FARSPH
Aligns to 151:271 / 490 (24.7%), covers 59.9% of PF01170, 39.5 bits

M.SwoAI Type I methyltransferase recognizing CACNNNNNNNNTTTC with methylation at 2(6mA),-4(6mA) from Shewanella woodyi ATCC 51908
Aligns to 168:343 / 493 (35.7%), covers 59.4% of PF01170, 39.1 bits

M.Eco933I Type I methyltransferase recognizing CACNNNNNNNCTGG with methylation at 2(6mA),-3(6mA) from Escherichia coli O157:H7 EDL933
Aligns to 172:348 / 493 (35.9%), covers 77.7% of PF01170, 38.5 bits

FTA_1029 putative N-6 DNA methylase (RefSeq) from Francisella tularensis subsp. holarctica FTA
Aligns to 271:435 / 775 (21.3%), covers 61.4% of PF01170, 38.5 bits

• Complete genome sequence of Francisella tularensis subspecies holarctica FTNF002-00
  Barabote, PloS one 2009
  • “...FTA_0052 VM 1 transglutaminase-like superfamily protein E FTA_1460 KR 2 putative carbohydrate kinase/YjeF-like protein S FTA_1029 LI 2 putative N-6 DNA methylase V FTA_0143 RK 2 pyruvate phosphate dikinase G FTA_0505 RK 2 glycine dehydrogenase subunit 1 E FTA_1565 YH 2 putative permease, YjgP/YjgQ family protein...”

M.Eco1130I Type I methyltransferase recognizing CACNNNNNNNCTGG with methylation at 2(6mA),-3(6mA) from Escherichia coli O157:H7 1130
Aligns to 168:344 / 489 (36.2%), covers 77.7% of PF01170, 38.5 bits

M.Eco293I Type I methyltransferase recognizing CACNNNNNNNCTGG with methylation at 2(6mA),-3(6mA) from Escherichia coli O157 FDAARGOS_293
M.Eco0398I Type I methyltransferase recognizing CACNNNNNNNCTGG with methylation at 2(6mA),-3(6mA) from Escherichia coli CDC#03-98
M.Eco2149I Type I methyltransferase recognizing CACNNNNNNNCTGG with methylation at 2(6mA),-3(6mA) from Escherichia coli O157:H7 2149
M.Eco2159I Type I methyltransferase recognizing CACNNNNNNNCTGG with methylation at 2(6mA),-3(6mA) from Escherichia coli O157:H7 2159
M.Eco3384I Type I methyltransferase recognizing CACNNNNNNNCTGG with methylation at 2(6mA),-3(6mA) from Escherichia coli O157:H7 3384
M.Eco4276I Type I methyltransferase recognizing CACNNNNNNNCTGG with methylation at 2(6mA),-3(6mA) from Escherichia coli O157:H7 4276
M.Eco4465I Type I methyltransferase recognizing CACNNNNNNNCTGG with methylation at 2(6mA),-3(6mA) from Escherichia coli 2013C-4465
M.Eco8368I Type I methyltransferase recognizing CACNNNNNNNCTGG with methylation at 2(6mA),-3(6mA) from Escherichia coli O157:H7 8368
M.Eco9234I Type I methyltransferase recognizing CACNNNNNNNCTGG with methylation at 2(6mA),-3(6mA) from Escherichia coli O157:H7 9234
Aligns to 168:344 / 489 (36.2%), covers 77.7% of PF01170, 38.5 bits

M2.EcoF6699II Type II methyltransferase recognizing ACTGGG with methylation at 2(N4mC),-2(N4mC) from Escherichia coli O6:H16 F6699
Aligns to 93:183 / 499 (18.2%), covers 24.4% of PF01170, 38.5 bits

M.Eco644II Type I methyltransferase recognizing CACNNNNNNNCTGG with methylation at 2(6mA),-3(6mA) from Escherichia coli O157 644-PT8
M.EcoPT54II Type I methyltransferase recognizing CACNNNNNNNCTGG with methylation at 2(6mA),-3(6mA) from Escherichia coli O157 180-PT54
Aligns to 180:356 / 501 (35.3%), covers 77.7% of PF01170, 38.4 bits

M.Cau700975I Type I methyltransferase recognizing CGANNNNNNGTCY with methylation at 3(6mA),-3(6mA) from Corynebacterium aurimucosum ATCC 700975
Aligns to 227:414 / 590 (31.9%), covers 80.2% of PF01170, 38.4 bits

M.Pst87II Type I methyltransferase recognizing GGANNNNNNNNATGC with methylation at 3(6mA),-3(6mA) from Providencia stuartii FDAARGOS_87
Aligns to 168:340 / 490 (35.3%), covers 59.4% of PF01170, 38.4 bits

M.Cin379I Type II methyltransferase recognizing GAGNNNNTCR with methylation at 2(6mA),-3(6mA) from Chryseobacterium indologenes FDAARGOS_379
Aligns to 327:437 / 670 (16.6%), covers 44.2% of PF01170, 38.0 bits

M.DfeI Type II methyltransferase recognizing CTNNAG with methylation at 5(6mA) from Dyadobacter fermentans DSM 18053
Aligns to 35:156 / 493 (24.7%), covers 53.8% of PF01170, 37.8 bits

M.MfoCT6I Type I methyltransferase recognizing ACCNNNNNCTGC with methylation at 1(6mA),-3(6mA) from Mycobacterium fortuitum CT6
Aligns to 185:367 / 506 (36.2%), covers 66.0% of PF01170, 37.7 bits

TDE2746 type I restriction-modification system, M subunit (NCBI) from Treponema denticola ATCC 35405
Aligns to 159:337 / 480 (37.3%), covers 64.5% of PF01170, 37.0 bits

• Prevalence of phase variable epigenetic invertons among host-associated bacteria
  Huang, Nucleic acids research 2020
  • “.... d enticola i nvertase A or TdiA), in addition to hsdR (TDE2747) and hsdM (TDE2746) (Figure 5A ) ( 50 ). The three hsdS genes were designated as Td- hsdS A (TDE2744), Td- hsdS B (TDE2743) and Td- hsdS C (TDE2740). Td- hsdS A (1599...”

ARSM_METAC / Q8TJK1 Arsenite methyltransferase; As(III) methyltransferase; EC 2.1.1.137 from Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A) (see paper)
Aligns to 87:170 / 249 (33.7%), covers 26.4% of PF01170, 36.8 bits

• function: Catalyzes the transfer of a methyl group from AdoMet to arsenite, producing methylated arsenicals. Involved in the conversion of As(III) to a number of methylated products. Reduces the arsenic toxicity in the cell and may contribute to the global arsenic cycling.
  catalytic activity: [thioredoxin]-dithiol + arsenic triglutathione + 2 H2O + S- adenosyl-L-methionine = [thioredoxin]-disulfide + 3 glutathione + H(+) + methylarsonous acid + S-adenosyl-L-homocysteine (RHEA:69460)
  catalytic activity: 2 [thioredoxin]-dithiol + arsenic triglutathione + H2O + 2 S- adenosyl-L-methionine = 2 [thioredoxin]-disulfide + dimethylarsinous acid + 3 glutathione + 2 H(+) + 2 S-adenosyl-L-homocysteine (RHEA:69464)
  catalytic activity: 3 [thioredoxin]-dithiol + arsenic triglutathione + 3 S- adenosyl-L-methionine = 3 [thioredoxin]-disulfide + 3 glutathione + 3 H(+) + 3 S-adenosyl-L-homocysteine + trimethylarsine (RHEA:69432)

M.Sfl670I Type I methyltransferase recognizing GTANNNNNNNNGTCY with methylation at 3(6mA),-3(6mA) from Shigella flexneri 1a 0670
Aligns to 168:344 / 489 (36.2%), covers 77.7% of PF01170, 36.7 bits

M.Eco06I Type I methyltransferase recognizing TTCANNNNNNNNCTGG with methylation at 4(6mA),-3(6mA) from Escherichia coli 06-00048
M.Eco09I Type I methyltransferase recognizing CCANNNNNNNNNTTGG with methylation at 3(6mA) from Escherichia coli 09-00049
M.Eco119I Type I methyltransferase recognizing CCANNNNNNNNNTTGG with methylation at 3(6mA),-4(6mA) from Escherichia coli AR_0119
M.Eco18748I Type I methyltransferase recognizing GAGNNNNNNNNTCGC with methylation at 2(6mA),-4(6mA) from Escherichia coli CFSAN018748
M.Eco2747AI Type I methyltransferase recognizing CACNNNNNNNGTTG with methylation at 2(6mA),-3(6mA) from Escherichia coli ST2747A
M.Eco2747ANI Type I methyltransferase recognizing CACNNNNNNNGTTG with methylation at 2(6mA),-3(6mA) from Escherichia coli ST2747AN
M.Eco2747I Type I methyltransferase recognizing CACNNNNNNNGTTG with methylation at 2(6mA),-3(6mA) from Escherichia coli ST2747
M.Eco348I Type I methyltransferase recognizing RTCANNNNNNNNGTGG with methylation at 4(6mA),-3(6mA) from Escherichia coli O104:H4 FDAARGOS_348
M.Eco349I Type I methyltransferase recognizing RTCANNNNNNNNGTGG with methylation at 4(6mA),-3(6mA) from Escherichia coli O104:H4 FDAARGOS_349
M.Eco401I Type I methyltransferase recognizing RTCANNNNNNNNGTGG with methylation at 4(6mA),-3(6mA) from Escherichia coli FDAARGOS_401
M.Eco403I Type I methyltransferase recognizing RTCANNNNNNNNGTGG with methylation at 4(6mA),-3(6mA) from Escherichia coli FDAARGOS_403
M.Eco591I Type I methyltransferase recognizing CCANNNNNNNNNTTGG with methylation at 3(6mA),-4(6mA) from Escherichia coli CREC-591
M.EcoG089II Type I methyltransferase recognizing CCANNNNNNNNNTTGG with methylation at 3(6mA),-4(6mA) from Escherichia coli GB089
M.EcoHBII Type I methyltransferase recognizing CCANNNNNNNNNTTGG with methylation at 3(6mA),-4(6mA) from Escherichia coli HB-Coli0
M.Sfl1508I Type I methyltransferase recognizing GTANNNNNNNNGTCY with methylation at 3(6mA),-3(6mA) from Shigella flexneri 2a 1508
M.Sfl394I Type I methyltransferase recognizing GTANNNNNNNNGTCY with methylation at 3(6mA),-3(6mA) from Shigella flexneri 1c Y394
M.Sfl74I Type I methyltransferase recognizing GTANNNNNNNNGTCY with methylation at 3(6mA),-3(6mA) from Shigella flexneri FDAARGOS_74
M.Sfl877I Type I methyltransferase recognizing GTANNNNNNNNGTCY with methylation at 3(6mA),-3(6mA) from Shigella flexneri 2016AM-0877
Aligns to 168:344 / 489 (36.2%), covers 77.7% of PF01170, 36.7 bits

M.EcoAI Type I methyltransferase recognizing GAGNNNNNNNGTCA with methylation at 2(6mA),-3(6mA) from Escherichia coli 15T-
Aligns to 168:344 / 489 (36.2%), covers 77.7% of PF01170, 36.7 bits

M.Sen954I Type I methyltransferase recognizing CGAYNNNNNNNRTRTC with methylation at 3(6mA) from Salmonella enterica subsp. enterica serovar Montevideo CDC 07-0954
M.Sen1544I Type I methyltransferase recognizing CGAYNNNNNNNRTRTC with methylation at 3(6mA),-4(6mA) from Salmonella enterica subsp. enterica serovar Montevideo CDC 2012K-1544
M.Sen1900I Type I methyltransferase recognizing CGAYNNNNNNNRTRTC with methylation at 3(6mA),-4(6mA) from Salmonella enterica subsp. enterica serovar Montevideo USMARC-1900
M.Sen1901I Type I methyltransferase recognizing CGAYNNNNNNNRTRTC with methylation at 3(6mA),-4(6mA) from Salmonella enterica subsp. enterica serovar Montevideo USMARC-1901
M.Sen1903II Type I methyltransferase recognizing CGAYNNNNNNNRTRTC with methylation at 3(6mA),-4(6mA) from Salmonella enterica subsp. enterica serovar Montevideo USDA-ARS-USMARC-1903
M.Sen1904I Type I methyltransferase recognizing CGAYNNNNNNNRTRTC with methylation at 3(6mA),-4(6mA) from Salmonella enterica subsp. enterica serovar Montevideo USMARC-1904
M.Sen1912I Type I methyltransferase recognizing CGAYNNNNNNNRTRTC with methylation at 3(6mA),-4(6mA) from Salmonella enterica subsp. enterica serovar Montevideo USMARC-1912
M.Sen1921I Type I methyltransferase recognizing CGAYNNNNNNNRTRTC with methylation at 3(6mA),-4(6mA) from Salmonella enterica subsp. enterica serovar Montevideo USDA-ARS-USMARC-1921
M.Sen45764III Type I methyltransferase recognizing CGAYNNNNNNNRTRTC with methylation at ?(6mA),-4(6mA) from Salmonella enterica CFSAN045764
M.Sen51296II Type I methyltransferase recognizing CGAYNNNNNNNRTRTC with methylation at 3(6mA),-4(6mA) from Salmonella enterica subsp. enterica serovar Montevideo CFSAN051296
M.Sen531954II Type I methyltransferase recognizing CGAYNNNNNNNRTRTC with methylation at 3(6mA),-4(6mA) from Salmonella enterica subsp. enterica serovar Montevideo 531954
M.SenK1674I Type I methyltransferase recognizing CGAYNNNNNNNRTRTC with methylation at 3(6mA),-4(6mA) from Salmonella enterica subsp. enterica serovar Montevideo CDC 2011K-1674
Aligns to 172:348 / 493 (35.9%), covers 77.7% of PF01170, 36.6 bits

M.Sbo2708I Type I methyltransferase recognizing RTCANNNNNNNNRTRTC with methylation at 4(6mA),-4(6mA) from Shigella boydii 59-2708
M.Sbo35964I Type I methyltransferase recognizing RTCANNNNNNNNRTRTC with methylation at 4(6mA),-4(6mA) from Shigella boydii ATCC 35964
M.Sbo9733I Type I methyltransferase recognizing RTCANNNNNNNNRTRTC with methylation at 4(6mA),-4(6mA) from Shigella boydii NCTC 9733
M.Sbo9734I Type I methyltransferase recognizing RTCANNNNNNNNRTRTC with methylation at 4(6mA),-4(6mA) from Shigella boydii NCTC 9734
M.Sdy10954I Type I methyltransferase recognizing RTCANNNNNNNNRTRTC with methylation at 4(6mA),-4(6mA) from Shigella dysenteriae CFSAN010954
M.Sdy49345I Type I methyltransferase recognizing RTCANNNNNNNNRTRTC with methylation at 4(6mA),-4(6mA) from Shigella dysenteriae E670/74
Aligns to 180:356 / 501 (35.3%), covers 77.7% of PF01170, 36.6 bits

M.EcoGIV Type I methyltransferase recognizing RTCANNNNNNNNGTGG with methylation at 4(6mA),-3(6mA) from Escherichia coli O104:H4 C227-11
M.Sbo1621I Type I methyltransferase recognizing GTANNNNNNNNGTCY with methylation at 3(6mA),-3(6mA) from Shigella boydii 54-1621
M.Sfl29903I Type I methyltransferase recognizing GTANNNNNNNNGTCY with methylation at ?(6mA),-3(6mA) from Shigella flexneri 2a
M.Sfl3008I Type I methyltransferase recognizing GTANNNNNNNNGTCY with methylation at 3(6mA),-3(6mA) from Shigella flexneri 95-3008
M.Sfl3063I Type I methyltransferase recognizing GTANNNNNNNNGTCY with methylation at 3(6mA),-3(6mA) from Shigella flexneri Y 93-3063
M.Sfl3193I Type I methyltransferase recognizing GTANNNNNNNNGTCY with methylation at 3(6mA),-3(6mA) from Shigella flexneri 98-3193
M.Sfl43145I Type I methyltransferase recognizing GTANNNNNNNNGTCY with methylation at 3(6mA),-3(6mA) from Shigella flexneri 04-3145
M.Sfl614982I Type I methyltransferase recognizing GTANNNNNNNNGTCY with methylation at 3(6mA),-3(6mA) from Shigella flexneri 61-4982
M.Sfl735612I Type I methyltransferase recognizing GTANNNNNNNNGTCY with methylation at 3(6mA),-3(6mA) from Shigella flexneri 73-5612
M.Sfl741170I Type I methyltransferase recognizing GTANNNNNNNNGTCY with methylation at ?(6mA),-3(6mA) from Shigella flexneri 74-1170
M.Sfl9728I Type I methyltransferase recognizing GTANNNNNNNNGTCY with methylation at 3(6mA),-3(6mA) from Shigella flexneri NCTC 9728
Aligns to 180:356 / 501 (35.3%), covers 77.7% of PF01170, 36.6 bits

M.Eco10386I Type I methyltransferase recognizing TACNNNNNNNRTRTC with methylation at 2(6mA),-4(6mA) from Escherichia coli O26 RM10386
M.Eco3274I Type I methyltransferase recognizing TACNNNNNNNRTRTC with methylation at 2(6mA),-4(6mA) from Escherichia coli O26:H11 2011C-3274
M.Eco3763I Type I methyltransferase recognizing TACNNNNNNNRTRTC with methylation at 2(6mA),-4(6mA) from Escherichia coli O69:H11 07-3763
M.Eco4255II Type I methyltransferase recognizing TACNNNNNNNRTRTC with methylation at 2(6mA),-4(6mA) from Escherichia coli O118:H16 07-4255
M.Eco8385I Type I methyltransferase recognizing TACNNNNNNNRTRTC with methylation at 2(6mA),-4(6mA) from Escherichia coli O103 RM8385
M.Eco8426I Type I methyltransferase recognizing TACNNNNNNNRTRTC with methylation at 2(6mA),-4(6mA) from Escherichia coli O26 RM8426
ECO26_5541 type I restriction-modification enzyme M subunit (RefSeq) from Escherichia coli O26:H11 str. 11368
Aligns to 172:348 / 493 (35.9%), covers 77.7% of PF01170, 36.6 bits

• The Mobilome; A Major Contributor to Escherichia coli stx2-Positive O26:H11 Strains Intra-Serotype Diversity
  Delannoy, Frontiers in microbiology 2017
  • “...Barbagallo et al., 2011 ; Campilongo et al., 2014 ), and several restriction endonucleases (ECO26_5540, ECO26_5541, ECO26_5542) involved in defense mechanisms were absent from strains 36493, 34870, 34827, 36293, and 36348. The speG gene (ECO26_2286), also involved in oxidative stress response (Kawano et al., 2007 ;...”

M.KoxNIH5I Type I methyltransferase recognizing CCANNNNNNNNCTCC with methylation at 3(6mA),-3(6mA) from Klebsiella oxytoca KONIH5
Aligns to 168:344 / 489 (36.2%), covers 77.7% of PF01170, 36.6 bits

D4GYB0 Putative rRNA methyltransferase from Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
HVO_1475 predicted DNA methylase (RefSeq) from Haloferax volcanii DS2
Aligns to 24:160 / 208 (65.9%), covers 39.6% of PF01170, 36.6 bits

• Evolutionary insights into Trm112-methyltransferase holoenzymes involved in translation between archaea and eukaryotes
  van, Nucleic acids research 2018
  • “...C-methyltransferase Not tested Class III 17 HVO_0475 D4GS15 0.0064 Unknown YES Class I 18 HVO_1475 D4GYB0 0.0064 DNA methylase Not tested Class I 33 CbiT D4GP64 0.0051 cobalt-precorrin-6B C(15)-methyltransferase Not tested Class I 38 CbiH2 D4GP59 0.0045 Precorrin-3B C17-methyltransferase Not tested Class III 41 HVO_1032 D4GVK8...”
• The human 18S rRNA m6A methyltransferase METTL5 is stabilized by TRMT112
  van, Nucleic acids research 2019
  • “...to RNA but not DNA ( 40 ). On the basis of phylogenetic analyses, the HVO_1475 gene encoding the Haloferax volcanii METTL5 ortholog is proposed to be responsible for m 6 A formation at position 1432 on archaeal 16S rRNA ( 41 , 42 ), corresponding...”
• Evolutionary insights into Trm112-methyltransferase holoenzymes involved in translation between archaea and eukaryotes
  van, Nucleic acids research 2018
  • “...Uroporphyrin-III C-methyltransferase Not tested Class III 17 HVO_0475 D4GS15 0.0064 Unknown YES Class I 18 HVO_1475 D4GYB0 0.0064 DNA methylase Not tested Class I 33 CbiT D4GP64 0.0051 cobalt-precorrin-6B C(15)-methyltransferase Not tested Class I 38 CbiH2 D4GP59 0.0045 Precorrin-3B C17-methyltransferase Not tested Class III 41 HVO_1032...”
• Towards a systems approach in the genetic analysis of archaea: Accelerating mutant construction and phenotypic analysis in Haloferax volcanii
  Blaby, Archaea (Vancouver, B.C.) 2010
  • “...HVO_0390 2016 0.0066 0.0064 Severe growth defect HVO_2478 0042 0.0243 0.0075 Defined media growth defect HVO_1475 2263 0.0266 0.0177 HVO_1105 1374 0.0216 0.0124 HVO_2008 1549 0.0245 0.0154 HVO_1105 1374, 0.025 0.0127 HVO_0574 2226 Not deleted Predicted essential HVO_0339 1571 Not deleted Deleted only when gene present...”
• RNomics and Modomics in the halophilic archaea Haloferax volcanii: identification of RNA modification genes
  Grosjean, BMC genomics 2008
  • “...C* = N330 ? ? See text 1432 (1500) m 6 A Prediction this work HVO_1475 2263 See text, 1QAN 1450+1451 (1518+1519) m 6 2 A Homology with M. jannaschii RsmA* [ 137 ] HVO_2746 0030 23S Data From H. marismortui D 628 (571) m 1...”

M.EcoJA17PI Type I methyltransferase recognizing GAGNNNNNNNGTCA with methylation at 2(6mA),-3(6mA) from Escherichia coli UCD_JA17_pb
M.EcoJA23PI Type I methyltransferase recognizing GAGNNNNNNNGTCA with methylation at 2(6mA),-3(6mA) from Escherichia coli UCD_JA23_pb
Aligns to 180:356 / 501 (35.3%), covers 77.7% of PF01170, 36.6 bits

M.Eco299I Type I methyltransferase recognizing CGAYNNNNNNNRTDCC with methylation at 3(6mA),-4(6mA) from Escherichia coli STEC299
Aligns to 180:356 / 501 (35.3%), covers 77.7% of PF01170, 36.6 bits

M.CfrMH17I Type I methyltransferase recognizing RAACNNNNNNNCTGG with methylation at 3(6mA),-3(6mA) from Citrobacter pasteurii UMH17
Aligns to 168:344 / 489 (36.2%), covers 77.7% of PF01170, 36.6 bits

M.EcoCFTI Type I methyltransferase recognizing GAGNNNNNNNGTCA with methylation at 2(6mA),-3(6mA) from Escherichia coli CFT073
c5424 Putative restriction modification enzyme M subunit (NCBI ptt file) from Escherichia coli CFT073
Aligns to 186:362 / 507 (34.9%), covers 77.7% of PF01170, 36.6 bits

• Antimicrobial activity of CHIR-090, an inhibitor of lipopolysaccharide biosynthesis, against the Burkholderia cepacia complex
  Bodewits, Antimicrobial agents and chemotherapy 2010

M.Sfl89141I Type I methyltransferase recognizing GTANNNNNNNNGTCY with methylation at 3(6mA),-3(6mA) from Shigella flexneri 89-141
Aligns to 180:356 / 501 (35.3%), covers 77.7% of PF01170, 36.6 bits

M.Cis15098I Type I methyltransferase recognizing GCANNNNNNCCT with methylation at 3(6mA),-1(6mA) from Clostridium isatidis
Aligns to 188:316 / 495 (26.1%), covers 57.4% of PF01170, 36.5 bits

M.Sen51958I Type I methyltransferase recognizing CTANNNNNNNNRTDCC with methylation at 3(6mA),-4(6mA) from Salmonella enterica subsp. enterica serovar Mbandaka ATCC 51958
Aligns to 168:344 / 489 (36.2%), covers 77.7% of PF01170, 36.5 bits

M.Sen218II Type I methyltransferase recognizing GCATNNNNNNNRTCG with methylation at 3(6mA),-3(6mA) from Salmonella enterica subsp. enterica serovar Montevideo CDC 2013K-0218
M.Sen1942III Type I methyltransferase recognizing CGAYNNNNNNNATGC with methylation at 3(6mA),-3(6mA) from Salmonella enterica subsp. enterica serovar Montevideo CDC 08-1942
Aligns to 172:348 / 493 (35.9%), covers 77.7% of PF01170, 36.5 bits

B9MK94 site-specific DNA-methyltransferase (cytosine-N4-specific) (EC 2.1.1.113) from Caldicellulosiruptor bescii (see paper)
Aligns to 30:98 / 416 (16.6%), covers 23.4% of PF01170, 36.4 bits

M.Rgi145I Type I methyltransferase recognizing GAACNNNNNNNTCGC with methylation at 3(6mA),-4(6mA) from Roseomonas gilardi U14-5
Aligns to 158:335 / 487 (36.6%), covers 81.2% of PF01170, 36.4 bits

M.Fpr95bI Type I methyltransferase recognizing GAYNNNNNCTGG with methylation at 2(6mA),-3(6mA) from Faecalibacterium prausnitzii APC918/95b
Aligns to 178:359 / 499 (36.5%), covers 60.4% of PF01170, 36.3 bits

M.EcoNIH2I Type I methyltransferase recognizing GGANNNNNNNNATGC with methylation at 3(6mA),-3(6mA) from Escherichia coli ECONIH2
Aligns to 168:344 / 489 (36.2%), covers 77.7% of PF01170, 36.2 bits

M.MfoCT6III Type II methyltransferase recognizing ATCGAT with methylation at 5(6mA) from Mycobacterium fortuitum CT6
Aligns to 37:163 / 581 (21.9%), covers 60.4% of PF01170, 36.1 bits

M.Sen10729II Type I methyltransferase recognizing CGAYNNNNNNNRTRTC with methylation at 3(6mA),-4(6mA) from Salmonella enterica subsp. enterica serovar Pomona
Aligns to 168:344 / 489 (36.2%), covers 59.9% of PF01170, 36.1 bits

M.Ror24724II Type I methyltransferase recognizing AAGNNNNNNNNTRGG with methylation at 2(6mA),-4(6mA) from Raoultella ornithinolytica Ro24724
Aligns to 168:344 / 489 (36.2%), covers 59.9% of PF01170, 36.1 bits

M.EcoAO83I Type I methyltransferase recognizing GGANNNNNNNNATGC with methylation at ?(6mA) from Escherichia coli strain A0 34/86
Aligns to 180:356 / 501 (35.3%), covers 77.7% of PF01170, 36.1 bits

M.Ecl884AI Type I methyltransferase recognizing RTCANNNNNNNNNTRGG with methylation at 4(6mA),-4(6mA) from Enterobacter cloacae MS7884A
M.Eho16691I Type I methyltransferase recognizing RTCANNNNNNNNNTRGG with methylation at 4(6mA),-4(6mA) from Enterobacter hormaechei subsp. steigerwaltii
Aligns to 168:340 / 490 (35.3%), covers 59.4% of PF01170, 35.8 bits

M.Cwe364I Type I methyltransferase recognizing RAACNNNNNNNGTCY with methylation at 3(6mA),-3(6mA) from Citrobacter werkmanii FDAARGOS_364
Aligns to 168:344 / 489 (36.2%), covers 59.9% of PF01170, 35.8 bits

M.Kox28I Type I methyltransferase recognizing AACNNNNNNNRTGAC with methylation at 2(6mA),-4(6mA) from Klebsiella oxytoca AR_0028
Aligns to 168:344 / 489 (36.2%), covers 59.9% of PF01170, 35.7 bits

M.CfrMH15I Type I methyltransferase recognizing CACNNNNNNNRTANYC with methylation at 2(6mA),-5(6mA) from Citrobacter freundii UMH15
Aligns to 168:344 / 489 (36.2%), covers 59.9% of PF01170, 35.7 bits

M.KoxNIH2III Type I methyltransferase recognizing AACNNNNNNNRTGAC with methylation at 2(6mA),-4(6mA) from Klebsiella oxytoca KONIH2
Aligns to 168:344 / 489 (36.2%), covers 59.9% of PF01170, 35.7 bits

M.PbaD4II Type II methyltransferase recognizing CCWGG with methylation at 2(N4mC) from Phycisphaerae bacterium ST-PulAB-D4
Aligns to 21:103 / 418 (19.9%), covers 23.9% of PF01170, 35.7 bits

HI0423 conserved hypothetical protein (NCBI ptt file) from Haemophilus influenzae Rd KW20
Aligns to 29:192 / 240 (68.3%), covers 49.7% of PF01170, 35.7 bits

• Functional annotation of conserved hypothetical proteins from Haemophilus influenzae Rd KW20
  Shahbaaz, PloS one 2013
  • “...949402 Q57392 Porin, opacity type 67. HP HI0420 949520 P43995 Ribbon-helix-helix superfamily protein 68. HP HI0423 949527 P44702 tRNA (adenine-N6)-methyltransferase 69. HP HI0441 949523 P31777 S-adenosyl-L-methionine-dependent methyltransferases 70. HP HI0442 950773 P44711 YbaB/EbfC DNA-binding protein 71. HP HI0449 949746 P43997 Prokaryotic membrane lipoprotein lipid attachment site...”
• PerPlot & PerScan: tools for analysis of DNA curvature-related periodicity in genomic nucleotide sequences
  Mrázek, Microbial informatics and experimentation 2011
  • “...protease HI0420 443031 443330 + hypothetical protein HI0422 444029 445348 - ATP-dependent RNA helicase SrmB HI0423 445394 446116 + hypothetical protein HI0424 446149 447204 - rRNA methylase HI0425 447351 448718 + phosphatidylserine synthase PssA HI0426 448763 449488 - fatty acid metabolism regulator FadR HI0427 449613 451157...”

M.Sen76213I Type I methyltransferase recognizing CACNNNNNNNRTRTC with methylation at 2(6mA),-4(6mA) from Salmonella enterica subsp. enterica serovar Mbandaka CFSAN076213
Aligns to 168:344 / 489 (36.2%), covers 59.9% of PF01170, 35.7 bits

M.KoxNIH1I Type I methyltransferase recognizing CAGNNNNNNNGTTC with methylation at 2(6mA),-3(6mA) from Klebsiella oxytoca KONIH1
M.KoxNIH4I Type I methyltransferase recognizing CAGNNNNNNNGTTC with methylation at 2(6mA),-3(6mA) from Klebsiella oxytoca KONIH4
Aligns to 168:344 / 489 (36.2%), covers 59.9% of PF01170, 35.6 bits

M.CfrHM38I Type I methyltransferase recognizing GAAYNNNNNNNGTTG with methylation at 3(6mA),-3(6mA) from Citrobacter freundii HM38
Aligns to 168:344 / 489 (36.2%), covers 59.9% of PF01170, 35.6 bits

M.Cla11845IV Type I methyltransferase recognizing CAYNNNNNNRTG with methylation at 2(6mA) from Campylobacter lari
Aligns to 306:469 / 750 (21.9%), covers 60.9% of PF01170, 35.6 bits

P44702 tRNA1(Val) (adenine(37)-N6)-methyltransferase from Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Aligns to 21:184 / 232 (70.7%), covers 49.7% of PF01170, 35.6 bits

• Functional annotation of conserved hypothetical proteins from Haemophilus influenzae Rd KW20
  Shahbaaz, PloS one 2013
  • “...Porin, opacity type 67. HP HI0420 949520 P43995 Ribbon-helix-helix superfamily protein 68. HP HI0423 949527 P44702 tRNA (adenine-N6)-methyltransferase 69. HP HI0441 949523 P31777 S-adenosyl-L-methionine-dependent methyltransferases 70. HP HI0442 950773 P44711 YbaB/EbfC DNA-binding protein 71. HP HI0449 949746 P43997 Prokaryotic membrane lipoprotein lipid attachment site profile 72....”

M.StySKI Type I methyltransferase recognizing CGATNNNNNNNGTTA with methylation at ?(6mA) from Salmonella kaduna CDC-388
Aligns to 172:348 / 493 (35.9%), covers 59.9% of PF01170, 35.6 bits

M.Sen038I Type I methyltransferase recognizing RAACNNNNNNNGTGG with methylation at 3(6mA),-3(6mA) from Salmonella enterica FORC_038
M.Sen0537II Type I methyltransferase recognizing TACNNNNNNNGTTC with methylation at 2(6mA),-3(6mA) from Salmonella enterica subsp. enterica serovar Tennessee PIR00537
M.Sen10722II Type I methyltransferase recognizing TACNNNNNNNGTTC with methylation at 2(6mA),-3(6mA) from Salmonella enterica subsp. enterica serovar Tennessee ATCC 10722
M.Sen76210I Type I methyltransferase recognizing TACNNNNNNNGTTC with methylation at 2(6mA),-3(6mA) from Salmonella enterica subsp. enterica serovar Tennessee CFSAN076210
Aligns to 168:344 / 489 (36.2%), covers 59.9% of PF01170, 35.6 bits

M.SenPU131III Type I methyltransferase recognizing GAYANNNNNNNNGTGG with methylation at 4(6mA),-3(6mA) from Salmonella enterica subsp. enterica serovar Kentucky PU131
Aligns to 168:344 / 489 (36.2%), covers 59.4% of PF01170, 35.5 bits

M.VmeT6III Type I methyltransferase recognizing GAGNNNNNNTGCT with methylation at 2(6mA),-4(6mA) from Vibrio mediterranei 117-T6
Aligns to 164:372 / 525 (39.8%), covers 61.9% of PF01170, 35.4 bits

M.AspRAC01I Type I methyltransferase recognizing GTANNNNNNGTCG with methylation at 3(6mA),-3(6mA) from Acidovorax species RAC01
Aligns to 177:360 / 520 (35.4%), covers 65.5% of PF01170, 35.4 bits

M.Aba0088I Type I methyltransferase recognizing TCANNNNNNCTGG with methylation at 3(6mA),-3(6mA) from Acinetobacter baumannii AR_0088
Aligns to 167:351 / 493 (37.5%), covers 63.5% of PF01170, 35.3 bits

M.Sen2159III Type I methyltransferase recognizing GACNNNNNNNRTCC with methylation at 2(6mA),-3(6mA) from Salmonella enterica subsp. enterica serovar Newport CDC 2010K-2159
M.Sen14882I Type I methyltransferase recognizing GACNNNNNNNRTCC with methylation at 2(6mA),-3(6mA) from Salmonella enterica subsp. enterica serovar Newport WA_14882
M.Sen18486II Type I methyltransferase recognizing GACNNNNNNNRTCC with methylation at 2(6mA),-3(6mA) from Salmonella enterica subsp. enterica serovar Newport CVM N18486
M.Sen21554II Type I methyltransferase recognizing GACNNNNNNNRTCC with methylation at 2(6mA),-3(6mA) from Salmonella enterica subsp. enterica serovar Newport CVM 21554
M.Sen22425II Type I methyltransferase recognizing GACNNNNNNNRTCC with methylation at 2(6mA),-3(6mA) from Salmonella enterica subsp. enterica serovar Newport CVM 22425
M.Sen22462II Type I methyltransferase recognizing GACNNNNNNNRTCC with methylation at 2(6mA),-3(6mA) from Salmonella enterica subsp. enterica serovar Newport CVM 22462
M.Sen3124II Type I methyltransferase recognizing GACNNNNNNNRTCC with methylation at 2(6mA),-3(6mA) from Salmonella enterica subsp. enterica serovar Newport USMARC-S3124.1
M.Sen3890I Type I methyltransferase recognizing GACNNNNNNNRTCC with methylation at 2(6mA),-3(6mA) from Salmonella enterica subsp. enterica serovar Newport CFSAN003890
Aligns to 168:344 / 489 (36.2%), covers 59.4% of PF01170, 35.1 bits

M.Sen0738I Type I methyltransferase recognizing AGANNNNNNNNCTGG with methylation at 3(6mA),-3(6mA) from Salmonella enterica subsp. enterica serovar Thompson CFSAN000738
M.Sen8391I Type I methyltransferase recognizing AGANNNNNNNNCTGG with methylation at 3(6mA),-3(6mA) from Salmonella enterica subsp. enterica serovar Thompson
Aligns to 168:344 / 489 (36.2%), covers 59.4% of PF01170, 35.1 bits

M.Ano129I Type I methyltransferase recognizing CGANNNNNGRTG with methylation at 3(6mA),-2(6mA) from Acinetobacter nosocomialis FDAARGOS_129
Aligns to 167:351 / 493 (37.5%), covers 63.5% of PF01170, 35.1 bits

M.Sen18747III Type I methyltransferase recognizing TACNNNNNNNGTTC with methylation at 2(6mA),-3(6mA) from Salmonella enterica subsp. enterica serovar Concord CFSAN018747
Aligns to 168:344 / 489 (36.2%), covers 59.4% of PF01170, 35.1 bits

M.Sen64033II Type I methyltransferase recognizing GTANNNNNNNNGTTC with methylation at 3(6mA),-3(6mA) from Salmonella enterica CFSAN064033
Aligns to 168:344 / 489 (36.2%), covers 59.4% of PF01170, 35.1 bits

O93645 site-specific DNA-methyltransferase (cytosine-N4-specific) (EC 2.1.1.113) from Pyrococcus sp. (see paper)
M.PspGI Type II methyltransferase recognizing CCWGG with methylation at ?(N4mC) from Pyrococcus species G1H
Aligns to 41:126 / 433 (19.9%), covers 17.3% of PF01170, 35.0 bits

MSMEG_1771 methylase, putative (NCBI) from Mycobacterium smegmatis str. MC2 155
A0QTA5 Methylase, putative from Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
MSMEG_1771 class I SAM-dependent methyltransferase from Mycolicibacterium smegmatis
Aligns to 19:108 / 222 (40.5%), covers 55.8% of PF01170, 35.0 bits

• S-Adenosylmethionine (SAM)-Dependent Methyltransferase MftM is Responsible for Methylation of the Redox Cofactor Mycofactocin
  Ellerhorst, ACS chemical biology 2022
  • “...(aa) protein family/UniProt annotation criterion 1 MSMEG_1650 WP_011727800.1 A0QSY9 245 PF08241/methyltransferase type 11 1 2 MSMEG_1771 WP_011727889.1 A0QTA5 222 No PFAM domain annotated/methylase,putative 1 3 MSMEG_5176 WP_011730362.1 A0R2N4 216 PF08241/methyltransferase type 11 1 4 MSMEG_5354 WP_003896752.1 A0R360 341 PF00891/ O -methyltransferase,familyprotein 2 2 5 MSMEG_6235 WP_029104596.1...”
  • “...Genetic Manipulation of M. smegmatis The gene deletion mutants MSMEG_1650 ::Hyg r ( MSMEG_1650 ), MSMEG_1771 ::Hyg r ( MSMEG_1771 ), MSMEG_5176 ::Hyg r ( MSMEG_5176 ), MSMEG_6235 ::Hyg r ( MSMEG_5354 ), MSMEG_6237 , and MSMEG_6663 ::Hyg r ( MSMEG_6663 ) were obtained using the...”
• The SigF regulon in Mycobacterium smegmatis reveals roles in adaptation to stationary phase, heat, and oxidative stress
  Hümpel, Journal of bacteriology 2010
  • “...MSMEG_1076 MSMEG_1097 MSMEG_1558 MSMEG_1758 MSMEG_1770 MSMEG_1771 MSMEG_1772 MSMEG_1773 MSMEG_1774 MSMEG_1777 MSMEG_1782 MSMEG_1788 MSMEG_1789 MSMEG_1790...”
  • “...AL. HU MSMEG_1758 MSMEG_1766 MSMEG_1770d MSMEG_1771 MSMEG_1773 MSMEG_1774 MSMEG_1775 MSMEG_1777 MSMEG_1782 MSMEG_1787 MSMEG_1792 MSMEG_1794 MSMEG_1801...”
• Gene Expression, Bacteria Viability and Survivability Following Spray Drying of Mycobacterium smegmatis
  Lauten, Materials (Basel, Switzerland) 2010
  • “...MSMEG_1769 UsfY protein 1.3 9.6 0.002 100% MSMEG_1770 conserved hypothetical protein 1.7 10.7 0.001 100% MSMEG_1771 methylase, putative 1.3 10.9 0.006 95% MSMEG_1772 conserved hypothetical protein 1.5 9.9 0.005 99% MSMEG_1773 conserved hypothetical protein 1.1 10.7 0.007 95% MSMEG_1774 conserved hypothetical protein 1.2 11.5 0.020 76%...”
  • “...protein GATCACGTTTCGGAACCCGGAATACCGGGCAT 71 2.1 1.5 97% 1.7 1.6 100% 2.1 2.7 6% 0.3 5.5 1% MSMEG_1771 methylase, putative TCGGAAGGTTTGCGCGCCCGCGAGATGGGTAC 36 1.1 2.5 1% 1.3 1.8 95% 1.6 2.8 11% 0.6 4.8 11% MSMEG_1773 conserved hypothetical protein GTTTGAGGTTTACCGCAGGCACAAATGGGAAT 18 0.9 1.9 0% 1.1 1.6 95% 1.1 1.7...”
• S-Adenosylmethionine (SAM)-Dependent Methyltransferase MftM is Responsible for Methylation of the Redox Cofactor Mycofactocin
  Ellerhorst, ACS chemical biology 2022
  • “...family/UniProt annotation criterion 1 MSMEG_1650 WP_011727800.1 A0QSY9 245 PF08241/methyltransferase type 11 1 2 MSMEG_1771 WP_011727889.1 A0QTA5 222 No PFAM domain annotated/methylase,putative 1 3 MSMEG_5176 WP_011730362.1 A0R2N4 216 PF08241/methyltransferase type 11 1 4 MSMEG_5354 WP_003896752.1 A0R360 341 PF00891/ O -methyltransferase,familyprotein 2 2 5 MSMEG_6235 WP_029104596.1 A0R5L6 226...”

M.Ple25539I Type I methyltransferase recognizing GCANNNNNNCTTC with methylation at 3(6mA),-3(6mA) from Paenibacillus lentus DSM 25539
Aligns to 169:351 / 489 (37.4%), covers 66.0% of PF01170, 34.9 bits

M2.Mma5219I Type I methyltransferase recognizing TCYNNNNNNTCG with methylation at 2(N4mC) from Methanohalophilus mahii DSM 5219
Aligns to 176:287 / 499 (22.4%), covers 58.4% of PF01170, 34.9 bits

GK0343 type I restriction modification system M subunit (site-specific DNA-methyltransferase subunit) (NCBI) from Geobacillus kaustophilus HTA426
Aligns to 165:347 / 484 (37.8%), covers 65.0% of PF01170, 34.8 bits

• A novel method for transforming the thermophilic bacterium Geobacillus kaustophilus
  Miyano, Microbial cell factories 2018
  • “...modification (RM) systems are reported to be functional in HTA426: system one composed of genes GK0343 (M subunit), GK0344 (S subunit) and GK0346 (R subunit); system two composed of genes GK1380 (M subunit), GK1381 (S subunit) and GK1382 (R subunit); and system three comprised by genes...”
  • “...rpsO dam ble ) pLS20cat oriT pGK1 This study G. kaustophilus MK244 pyrFR GK1378 GK1390 GK0343 GK0346 [ 17 ] MK72 pyrFR [ 18 ] Plasmid pGK1 pGR16B containing the replication origin of pUCG18T and kan (thermostable) This study pGK2 pGR16B containing kan (thermostable) This study...”
• Genetic transformation of Geobacillus kaustophilus HTA426 by conjugative transfer of host-mimicking plasmids
  Suzuki, Journal of microbiology and biotechnology 2012 (PubMed) (secret)

M.MmoTt01I Type I methyltransferase recognizing GACNNNNNNNGTTG with methylation at 2(6mA),-3(6mA) from Morganella morganii KC-Tt-01
Aligns to 168:342 / 490 (35.7%), covers 59.4% of PF01170, 34.8 bits

M.Mmo172I Type I methyltransferase recognizing CYYANNNNNNNNGTTG with methylation at 4(6mA),-3(6mA) from Morganella morganii FDAARGOS_172
Aligns to 168:342 / 490 (35.7%), covers 59.4% of PF01170, 34.8 bits

M.Aba401I Type I methyltransferase recognizing GYAYNNNNGRTG with methylation at 3(6mA),-2(6mA) from Acinetobacter baumannii AF-401
Aligns to 167:351 / 493 (37.5%), covers 64.5% of PF01170, 34.7 bits

M.Sen313III Type I methyltransferase recognizing CACNNNNNNNRTANYC with methylation at 2(6mA),-5(6mA) from Salmonella enterica FDAARGOS_313
Aligns to 168:344 / 489 (36.2%), covers 59.4% of PF01170, 34.7 bits

M.Csp16704I Type I methyltransferase recognizing ACANNNNNNNNTCG with methylation at 3(6mA),-3(6mA) from Campylobacter species RM16704
Aligns to 180:368 / 497 (38.0%), covers 90.4% of PF01170, 34.7 bits

O52711 site-specific DNA-methyltransferase (cytosine-N4-specific) (EC 2.1.1.113) from Saccharopolyspora sp. (see paper)
Aligns to 35:142 / 376 (28.7%), covers 24.9% of PF01170, 34.7 bits

M.Asp31YI Type I methyltransferase recognizing TGANNNNNNGTCG with methylation at 3(6mA),-3(6mA) from Arthrobacter sp. 31Y
Aligns to 188:369 / 508 (35.8%), covers 65.0% of PF01170, 34.6 bits

M1.SmoLVII Type II methyltransferase recognizing GATC with methylation at 2(6mA) from Streptobacillus moniliformis DSM 12112
Aligns to 49:195 / 249 (59.0%), covers 66.5% of PF01170, 34.6 bits

M.Rba9517I Type I methyltransferase recognizing GAGNNNNNRTAC with methylation at 2(6mA),-3(6mA) from Rhodothermaceae bacterium MEBiC09517
Aligns to 170:393 / 576 (38.9%), covers 82.7% of PF01170, 34.5 bits

M.Vha43516I Type I methyltransferase recognizing GAGNNNNNCTTC with methylation at 2(6mA),-3(6mA) from Vibrio harveyi
Aligns to 166:319 / 512 (30.1%), covers 61.9% of PF01170, 34.4 bits

SL003B_0710 type I restriction-modification system subunit M from Polymorphum gilvum SL003B-26A1
Aligns to 171:354 / 512 (35.9%), covers 65.5% of PF01170, 34.4 bits

• The genome sequence of Polymorphum gilvum SL003B-26A1(T) reveals its genetic basis for crude oil degradation and adaptation to the saline soil
  Nie, PloS one 2012
  • “...genes encoding proteins in a type I restriction modification system for responding to phage infection (SL003B_0710 and SL003B_0711, with 75% and 46% maximum identities with those of Thalassiobium sp. R2A62 and Rhodopseudomonas palustris TIE-1, respectively). The high identity of these predicted genes with those from different...”

M.PinP72I Type I methyltransferase recognizing CCANNNNNNNTGGG with methylation at 3(6mA),-4(6mA) from Phaeobacter inhibens P72
Aligns to 184:365 / 522 (34.9%), covers 66.0% of PF01170, 34.3 bits

M.XbaD13I Type I methyltransferase recognizing CTANNNNNNNNRTGG with methylation at 3(6mA),-3(6mA) from Xanthomonadales bacterium D13
Aligns to 168:287 / 491 (24.4%), covers 57.4% of PF01170, 34.3 bits

M.Sth20745II Type I methyltransferase recognizing TCANNNNNNNGTGC with methylation at 3(6mA),-3(6mA) from Sphaerobacter thermophilus DSM 20745
Aligns to 157:283 / 507 (25.0%), covers 59.4% of PF01170, 34.2 bits

SPBC16D10.02 tRNA (guanosine) methyltransferase Trm11 (RefSeq) from Schizosaccharomyces pombe
Aligns to 211:333 / 452 (27.2%), covers 69.0% of PF01170, 34.2 bits

• Novel Links between TORC1 and Traditional Non-Coding RNA, tRNA.
  Otsubo, Genes 2020
  • “...rpc11 DNA-directed RNA polymerase III complex subunit inviable SPAC57A10.10c sla1 La protein, tRNA chaperone viable SPBC16D10.02 trm11 tRNA (guanine-N2-)-methyltransferase catalytic subunit viable SPAC31A2.02 trm112 eRF1 methyltransferase complex and tRNA (m2G10) methyltransferase complex regulatory subunit viable SPCPB16A4.04c trm8 tRNA (guanine-N7-)-methyltransferase catalytic subunit viable SPCC18.13 trm82 tRNA (guanine-N7-)-methyltransferase...”

M.Sen3387I Type I methyltransferase recognizing GAGNNNNNNNRTCC with methylation at 2(6mA),-3(6mA) from Salmonella enterica subsp. enterica serovar Newport CFSAN003387
Aligns to 168:338 / 489 (35.0%), covers 58.9% of PF01170, 34.2 bits

M.Pfl300I Type I methyltransferase recognizing GAGNNNNNNGTTC with methylation at 2(6mA),-3(6mA) from Pseudomonas fluorescens FW300-N2E3
Aligns to 149:322 / 471 (36.9%), covers 64.0% of PF01170, 34.1 bits

M.Cco9557II Type I methyltransferase recognizing CRAANNNNNNNRTTG with methylation at 4(6mA),-3(6mA) from Campylobacter coli BFR-CA-9557
M.Cco54106I Type I methyltransferase recognizing CRAANNNNNNNRTAG with methylation at 4(6mA),-3(6mA) from Campylobacter coli CFSAN054106
Aligns to 180:368 / 495 (38.2%), covers 89.8% of PF01170, 34.1 bits

M.Van425I Type I methyltransferase recognizing TGANNNNNNNNTTGG with methylation at 3(6mA),-4(6mA) from Vibrio anguillarum 425
M.Van68554I Type I methyltransferase recognizing TGANNNNNNNNTTGG with methylation at 3(6mA),-4(6mA) from Vibrio anguillarum ATCC-68554
Aligns to 159:306 / 519 (28.5%), covers 59.9% of PF01170, 34.1 bits

M.Kpn46II Type I methyltransferase recognizing GAAYNNNNNNNCTGG with methylation at 3(6mA),-3(6mA) from Klebsiella pneumoniae AR_0046
M.Kpn0138II Type I methyltransferase recognizing GAAYNNNNNNNCTGG with methylation at 3(6mA),-3(6mA) from Klebsiella pneumoniae AR_0138
M.Kpn1215I Type I methyltransferase recognizing GAAYNNNNNNNCTGG with methylation at 3(6mA),-3(6mA) from Klebsiella pneumoniae CRKP-1215
M.Kpn145II Type I methyltransferase recognizing GAAYNNNNNNNCTGG with methylation at 3(6mA),-3(6mA) from Klebsiella pneumoniae AR_0145
M.Kpn149473I Type I methyltransferase recognizing GAAYNNNNNNNCTGG with methylation at 3(6mA),-3(6mA) from Klebsiella pneumoniae Kp_Goe_149473
M.Kpn149832I Type I methyltransferase recognizing GAAYNNNNNNNCTGG with methylation at 3(6mA),-3(6mA) from Klebsiella pneumoniae Kp_Goe_149832
M.Kpn152021I Type I methyltransferase recognizing GAAYNNNNNNNCTGG with methylation at 3(6mA),-3(6mA) from Klebsiella pneumoniae Kp_Goe_152021
M.Kpn152II Type I methyltransferase recognizing GAAYNNNNNNNCTGG with methylation at 3(6mA),-3(6mA) from Klebsiella pneumoniae AR_0152
M.Kpn154414I Type I methyltransferase recognizing GAAYNNNNNNNRTDCC with methylation at 3(6mA),-4(6mA) from Klebsiella pneumoniae Kp_Goe_154414
M.Kpn223I Type I methyltransferase recognizing GAAYNNNNNNNCTGG with methylation at 3(6mA),-3(6mA) from Klebsiella pneumoniae Kpn223
M.Kpn2297I Type I methyltransferase recognizing GAAYNNNNNNNCTGG with methylation at 3(6mA),-3(6mA) from Klebsiella pneumoniae CRKP-2297
M.Kpn439II Type I methyltransferase recognizing GAAYNNNNNNNCTGG with methylation at 3(6mA),-3(6mA) from Klebsiella pneumoniae FDAARGOS_439
M.Kpn442II Type I methyltransferase recognizing GAAYNNNNNNNCTGG with methylation at 3(6mA),-3(6mA) from Klebsiella pneumoniae FDAARGOS_442
M.Kpn6671I Type I methyltransferase recognizing GAAYNNNNNNNCTGG with methylation at 3(6mA),-3(6mA) from Klebsiella pneumoniae MS6671
M.Kpn822579I Type I methyltransferase recognizing GAAYNNNNNNNCTGG with methylation at 3(6mA),-3(6mA) from Klebsiella pneumoniae Kp_Goe_822579
M.Kpn825795I Type I methyltransferase recognizing GAAYNNNNNNNCTGG with methylation at 3(6mA),-3(6mA) from Klebsiella pneumoniae Kp_Goe_825795
M.Kpn827024I Type I methyltransferase recognizing GAAYNNNNNNNCTGG with methylation at 3(6mA),-3(6mA) from Klebsiella pneumoniae Kp_Goe_827024
M.Kpn827026I Type I methyltransferase recognizing GAAYNNNNNNNCTGG with methylation at 3(6mA),-3(6mA) from Klebsiella pneumoniae Kp_Goe_827026
M.Kpn828304I Type I methyltransferase recognizing GAAYNNNNNNNCTGG with methylation at 3(6mA),-3(6mA) from Klebsiella pneumoniae Kp_Goe_828304
M.KpnAATI Type I methyltransferase recognizing GAAYNNNNNNNCTGG with methylation at 3(6mA),-3(6mA) from Klebsiella pneumoniae AATZP
M.KpnGH01I Type I methyltransferase recognizing GAAYNNNNNNNCTGG with methylation at 3(6mA),-3(6mA) from Klebsiella pneumoniae SKGH01
M.KpnNH54III Type I methyltransferase recognizing GAAYNNNNNNNCTGG with methylation at 3(6mA),-3(6mA) from Klebsiella pneumoniae NH54
Aligns to 168:344 / 489 (36.2%), covers 77.7% of PF01170, 34.0 bits

TRM11_SCHPO / O94636 tRNA (guanine(10)-N2)-methyltransferase; tRNA guanosine-2'-O-methyltransferase TRM11; tRNA methylase 11; EC 2.1.1.214 from Schizosaccharomyces pombe (strain 972 / ATCC 24843) (Fission yeast) (see paper)
Aligns to 211:333 / 469 (26.2%), covers 69.0% of PF01170, 34.0 bits

• function: Catalytic subunit of an S-adenosyl-L-methionine-dependent tRNA methyltransferase complex that mediates the methylation of the guanosine nucleotide at position 10 (m2G10) in tRNAs.
  catalytic activity: guanosine(10) in tRNA + S-adenosyl-L-methionine = H(+) + N(2)- methylguanosine(10) in tRNA + S-adenosyl-L-homocysteine (RHEA:43128)
  subunit: Interacts with trm112.

M.Kpn0080II Type I methyltransferase recognizing GAAYNNNNNNNRTTC with methylation at 3(6mA) from Klebsiella pneumoniae AR_0080
Aligns to 168:344 / 489 (36.2%), covers 77.7% of PF01170, 34.0 bits

M.Cco14983I Type I methyltransferase recognizing CRAANNNNNNNNTAYC with methylation at 4(6mA),-4(6mA) from Campylobacter coli 14983A
Aligns to 180:368 / 495 (38.2%), covers 89.8% of PF01170, 34.0 bits

M.Hal5920I Type I methyltransferase recognizing GAAYNNNNNNNRTTTC with methylation at 3(6mA),-4(6mA) from Hafnia alvei HUMV-5920
Aligns to 168:340 / 490 (35.3%), covers 59.4% of PF01170, 33.9 bits

M.AspNIH5II Type I methyltransferase recognizing CAAGNNNNNNNCTGC with methylation at 3(6mA),-3(6mA) from Aeromonas species ASNIH5
Aligns to 169:337 / 495 (34.1%), covers 59.4% of PF01170, 33.9 bits

M.HvoDSII Type I methyltransferase recognizing GCABNNNNNNVTGC with methylation at 3(6mA) from Haloferax volcanii DS2
HVO_RS20260 type I restriction-modification system subunit M from Haloferax volcanii DS2
HVO_2270 type I restriction-modification system methylation subunit (RefSeq) from Haloferax volcanii DS2
Aligns to 157:339 / 464 (39.4%), covers 64.5% of PF01170, 33.8 bits

• Insights into gene expression changes under conditions that facilitate horizontal gene transfer (mating) of a model archaeon
  Makkay, Scientific reports 2020
  • “...0-h time point for the gene in the rmeRMS operon (consisting of the genes HVO_RS15605, HVO_RS20260, and HVO_RS20265) encoding the specificity unit (HVO_RS20265) (Fig. 6 C). The transcription of the genes HVO_RS01890 and HVO_RS02905, predicted methyltransferases, are increased in response to mating, although HVO_RS02905 sees an...”
• Characterizing the DNA Methyltransferases of Haloferax volcanii via Bioinformatics, Gene Deletion, and SMRT Sequencing.
  Ouellette, Genes 2018
  • “...the adenine motif in the genome (GCA m6 BN 6 VTGC). Alignments of the MTase (HVO_2270) and site specificity subunit (HVO_2271) demonstrate homology with other characterized Type I MTases and site specificity subunits, indicating that the rmeRMS operon is responsible for adenine methylation in H. volcanii...”

M.AspNIH3II Type I methyltransferase recognizing GAGNNNNNNNNTCGC with methylation at 2(6mA),-4(6mA) from Aeromonas species ASNIH3
Aligns to 169:335 / 495 (33.7%), covers 58.9% of PF01170, 33.5 bits

M.Nbr352I Type II methyltransferase recognizing ATCGAT with methylation at 5(6mA) from Nocardia brasiliensis FDAARGOS_352
Aligns to 16:147 / 590 (22.4%), covers 38.1% of PF01170, 33.4 bits

gbs0486 Unknown (NCBI ptt file) from Streptococcus agalactiae NEM316
Aligns to 22:114 / 251 (37.1%), covers 26.4% of PF01170, 33.4 bits

• Computational bacterial genome-wide analysis of phylogenetic profiles reveals potential virulence genes of Streptococcus agalactiae
  Lin, PloS one 2011
  • “...(absent) neu , fbsA filamentation induced by cAMP protein Fic; (Fic family domain, ) C2042 GBS0486 scpB , lmb Methyltransferase (Methyltransf_11 domain, ) ? methyltransferase This table lists the genes encoding hypothetical proteins from the top-10 genes of all 15 functional category listed in Table S1...”

Q9F8B8 Methyltransferase from Streptococcus agalactiae
Aligns to 25:117 / 254 (36.6%), covers 26.4% of PF01170, 33.4 bits

• Microcin C51 plasmid genes: possible source of horizontal gene transfer
  Fomenko, Antimicrobial agents and chemotherapy 2003
  • “...agalactiae 31/48 (48-180) 25/45 (22-191) Q9CKD6 Q9F8B8 Diaminopimelate decarboxylase LysA protein RimL RimJ Bacillus methanolicus Listeria monocytogenes E....”

M.Llu27648I Type I methyltransferase recognizing GAAGNNNNNNCTCA with methylation at 3(6mA),-3(6mA) from Labilithrix luteola
Aligns to 149:323 / 472 (37.1%), covers 81.2% of PF01170, 33.4 bits

SCLAV_5482 N-6 DNA methylase from Streptomyces clavuligerus
Aligns to 143:262 / 666 (18.0%), covers 60.9% of PF01170, 33.4 bits

• Discovering the potential of S. clavuligerus for bioactive compound production: cross-talk between the chromosome and the pSCL4 megaplasmid
  Álvarez-Álvarez, BMC genomics 2017
  • “...and iv) genes located in the 303kb stretch of the right arm of the chromosome (SCLAV_5482, 5485, 5487, 5491, 5521, 5580, 5585, 5692, 5719 and the right telomere (nt 6,760,214 to 6,760,380) To determine the origin of this downregulation, the following genes were analyzed by qPCR...”
  • “...10 genes located in the underexpressed region of the right end of the chromosome (between SCLAV_5482 and the right telomere), ii) genes located in the central region of the chromosome (SCLAV_5146, SCLAV_5308) or located in plasmid pSCL2 ( parA pSCL2 ), and iii) genes, such as...”

XP_047299971 rRNA N6-adenosine-methyltransferase METTL5 isoform X1 from Homo sapiens
Aligns to 25:180 / 186 (83.9%), covers 54.8% of PF01170, 33.4 bits

• The potential role of methyltransferase-like 5 in deficient mismatch repair of uterine corpus endometrial carcinoma.
  Liu, Bioengineered 2022
  • GeneRIF: The potential role of methyltransferase-like 5 in deficient mismatch repair of uterine corpus endometrial carcinoma.
• Analysis of the role of METTL5 as a hub gene in lung adenocarcinoma based on a weighted gene co-expression network.
  Yan, Mathematical biosciences and engineering : MBE 2021 (PubMed)
  • GeneRIF: Analysis of the role of METTL5 as a hub gene in lung adenocarcinoma based on a weighted gene co-expression network.
• Ribosome 18S m6A Methyltransferase METTL5 Promotes Translation Initiation and Breast Cancer Cell Growth.
  Rong, Cell reports 2020 (PubMed)
  • GeneRIF: Ribosome 18S m(6)A Methyltransferase METTL5 Promotes Translation Initiation and Breast Cancer Cell Growth.
• The human 18S rRNA m6A methyltransferase METTL5 is stabilized by TRMT112.
  van, Nucleic acids research 2019
  • GeneRIF: METTL5-TRMT112 partners act by extruding the adenosine to be modified from a double-stranded nucleic acid.
• Enzymatic characterization of three human RNA adenosine methyltransferases reveals diverse substrate affinities and reaction optima.
  Yu, The Journal of biological chemistry
  • GeneRIF: Enzymatic characterization of three human RNA adenosine methyltransferases reveals diverse substrate affinities and reaction optima.

LAR_1347 type I restriction-modification system M subunit (RefSeq) from Lactobacillus reuteri JCM 1112
Aligns to 196:375 / 517 (34.8%), covers 65.0% of PF01170, 33.3 bits

• Genome alterations associated with improved transformation efficiency in Lactobacillus reuteri
  Ortiz-Velez, Microbial cell factories 2018
  • “...for the restriction unit ( hsd R, LAR_1343) and the methyltransferase unit ( hsd M, LAR_1347), respectively (Fig. 5 b). Two genes encode for the specificity subunit of the system ( hsd S A , LAR_1344; hsd S B , LAR_1346), which are separated by a...”

M.PciP3B5I Type I methyltransferase recognizing GTABNNNNNNTAC with methylation at 3(6mA) from Pseudomonas citronellolis P3B5
Aligns to 174:375 / 527 (38.3%), covers 62.9% of PF01170, 33.3 bits

M1.AgoG2I Type II methyltransferase recognizing ACTGG with methylation at 2(N4mC),-1(N4mC) from Anoxybacillus gonensis G2
Aligns to 31:108 / 381 (20.5%), covers 13.7% of PF01170, 33.3 bits

M.TcoKWC4IV Type I methyltransferase recognizing CCANNNNNNCTC with methylation at 3(6mA),-2(6mA) from Thermobacillus composti KWC4
Aligns to 170:352 / 489 (37.4%), covers 66.0% of PF01170, 33.2 bits

M.PaeLWI Type I methyltransferase recognizing GCANNNNNNGTAG with methylation at 3(6mA),-3(6mA) from Pseudomonas aeruginosa LW
Aligns to 174:371 / 524 (37.8%), covers 62.9% of PF01170, 33.2 bits

APL_0762 hypothetical protein (NCBI) from Actinobacillus pleuropneumoniae L20
Aligns to 28:114 / 251 (34.7%), covers 29.4% of PF01170, 33.2 bits

• Comparative profiling of the transcriptional response to iron restriction in six serotypes of Actinobacillus pleuropneumoniae with different virulence potential
  Klitgaard, BMC genomics 2010
  • “...1.81 APL_1046 lysE Lysine exporter protein E 1.84 APL_1045 + rarD Predicted permease R 0.66 APL_0762 - SAM-dependent methyltransferase Q 0.29 APL_0716 - Iron(III) ABC transporter, permease protein P 0.40 APL_0715 - Iron(III) transport system permease protein P 0.43 APL_0714 + FatB ABC-type enterochelin transport system,...”

M.TspPM5II Type I methyltransferase recognizing CCANNNNNNNCTTC with methylation at 3(6mA),-3(6mA) from Thermogemmatispora sp. PM5
Aligns to 157:281 / 521 (24.0%), covers 59.4% of PF01170, 33.1 bits

M.RbaNRL2II Type I methyltransferase recognizing ACGANNNNNNGRTC with methylation at 4(6mA),-2(6mA) from Rhizobiales bacterium NRL2
Aligns to 194:309 / 512 (22.7%), covers 20.3% of PF01170, 33.0 bits

M.Sen18747II Type I methyltransferase recognizing GACNNNNNNTGCG with methylation at 2(6mA),-4(6mA) from Salmonella enterica subsp. enterica serovar Concord CFSAN018747
Aligns to 168:334 / 544 (30.7%), covers 60.9% of PF01170, 33.0 bits

METL5_CAEEL / Q18511 rRNA N6-adenosine-methyltransferase metl-5; Methyltransferase-like protein 5; EC 2.1.1.- from Caenorhabditis elegans (see paper)
NP_497990 rRNA N6-adenosine-methyltransferase metl-5 from Caenorhabditis elegans
Aligns to 24:139 / 214 (54.2%), covers 31.0% of PF01170, 32.9 bits

• function: Catalytic subunit of a heterodimer with TRMT112/C04H5.1, which specifically methylates the 6th position of adenine in position 1717 of 18S rRNA.
  catalytic activity: adenosine in rRNA + S-adenosyl-L-methionine = H(+) + N(6)- methyladenosine in rRNA + S-adenosyl-L-homocysteine (RHEA:58728)
  subunit: Heterodimer; heterodimerizes with TRMT112/C04H5.1.
  disruption phenotype: Worms are viable and do not display obvious developmental defects; they however exhibit significantly longer lifespan and heat resistance (PubMed:33357433). Cells show reduced N6- methylation of adenine(1717) in 18S rRNA (PubMed:33357433).
• Domain selection combined with improved cloning strategy for high throughput expression of higher eukaryotic proteins
  Chen, BMC biotechnology 2007
  • “...not soluble not F 4 NP_493382 1 210 210 Y87G2A.10 high medium Yes F 5 NP_497990 1 214 214 C38D4.9 high high Yes F 10 NP_498391 1 217 217 C56G2.15 high high Yes G 2 NP_493230 1 183 183 W02A11.2 high not soluble Yes G 3...”

M.Osp894I Type I methyltransferase recognizing GAGNNNNNNGATG with methylation at 2(6mA),-2(6mA) from Ottowia species oral taxon 894 W10237
Aligns to 214:333 / 614 (19.5%), covers 58.4% of PF01170, 32.9 bits

METL5_HUMAN / Q9NRN9 rRNA N6-adenosine-methyltransferase METTL5; Methyltransferase-like protein 5; EC 2.1.1.- from Homo sapiens (Human) (see 7 papers)
Aligns to 25:174 / 209 (71.8%), covers 53.8% of PF01170, 32.9 bits

• function: Catalytic subunit of a heterodimer with TRMT112, which specifically methylates the 6th position of adenine in position 1832 of 18S rRNA (PubMed:31328227, PubMed:32217665, PubMed:33357433, PubMed:33428944, PubMed:35033535). N6-methylation of adenine(1832) in 18S rRNA resides in the decoding center of 18S rRNA and is required for translation and embryonic stem cells (ESCs) pluripotency and differentiation (PubMed:33357433).
  catalytic activity: adenosine(1832) in 18S rRNA + S-adenosyl-L-methionine = H(+) + N(6)-methyladenosine(1832) in 18S rRNA + S-adenosyl-L-homocysteine (RHEA:62612)
  subunit: Heterodimer; heterodimerizes with TRMT112.
• The 18S ribosomal RNA m⁶ A methyltransferase Mettl5 is required for normal walking behavior in Drosophila
  Leismann, EMBO reports 2020 (secret)
• Chemical Proteomic Profiling of Human Methyltransferases.
  Horning, Journal of the American Chemical Society 2016
  • “...Q86X55 CARM1 Protein 15 20 Q8N6R0 METTL1 Uncharacterized 20 20 Q99873 PRMT1 Protein 20 20 Q9NRN9 METTL5 Uncharacterized 20 12 O60678 PRMT3 Prortein 15 20 Q9H8H3 METTL7 Uncharacterized 20 20 Q96LA8 PRMT6 Protein 20 20 Q9H1A3 METTL9 Uncharacterized 20 20 Q96G04 EEF2KM Protein 20 20 Q7Z4G4...”

6h2vA / Q9NRN9 Crystal structure of human mettl5-trmt112 complex, the 18s rrna m6a1832 methyltransferase at 2.5a resolution (see paper)
Aligns to 24:173 / 210 (71.4%), covers 53.8% of PF01170, 32.8 bits

• Ligand: s-adenosylmethionine (6h2vA)

M.Pae1380I Type I methyltransferase recognizing CYYANNNNNNCTTC with methylation at 4(6mA),-3(6mA) from Pseudomonas aeruginosa NCAIM B.001380
ACG06_22805 type I restriction-modification system subunit M from Pseudomonas aeruginosa
Aligns to 174:371 / 527 (37.6%), covers 62.9% of PF01170, 32.7 bits

• Comparative genome and transcriptome analysis reveals distinctive surface characteristics and unique physiological potentials of Pseudomonas aeruginosa ATCC 27853
  Cao, BMC genomics 2017
  • “...ACG06_19215 ACG06_19245 Integrase and dehydrogenase 4,345,306 4,358,424 13,118 ACG06_20250- ACG06_20300 - 4,855,376 4,892,053 36,677 ACG06_22680- ACG06_22805 TetR family Transcriptional regulator 4,899,363 4,906,116 6753 ACG06_22830- ACG06_22850 Hypothetical protein 5,064,552 5,079,564 15,012 ACG06_23610- ACG06_23680 PFGI-1-like_cluster_1 5,089,064 5,097,821 8757 ACG06_23720- ACG06_23755 Peptidase and Thioredoxin 5,506,547 5,511,513 4966 ACG06_25640- ACG06_25670...”

M.PinDOK11I Type I methyltransferase recognizing GACNNNNNNCTGG with methylation at 2(6mA),-3(6mA) from Phaeobacter inhibens DOK1-1
Aligns to 149:318 / 472 (36.0%), covers 81.7% of PF01170, 32.7 bits

M.Tal28II Type I methyltransferase recognizing GAGNNNNNNTTA with methylation at 2(6mA),-3(6mA) from Tumebacillus algifaecis THMBR28
Aligns to 197:312 / 513 (22.6%), covers 56.9% of PF01170, 32.5 bits

M.FtnUI Type I methyltransferase recognizing CTANNNNNNNTDCC with methylation at 3(6mA),-4(6mA) from Francisella tularensis subsp. novicida U112
FTN_0704 type I restriction-modification system, subunit M (methyltransferase) (NCBI) from Francisella tularensis subsp. novicida U112
Aligns to 186:308 / 495 (24.8%), covers 58.4% of PF01170, 32.5 bits

• Molecular complexity orchestrates modulation of phagosome biogenesis and escape to the cytosol of macrophages by Francisella tularensis
  Asare, Environmental microbiology 2010
  • “...DNA topoisomerase IV subunit A 2 # tnfn1_pw060510p04q168 FTN_0666 uvrA excinuclease ABC, subunit A 2 FTN_0704 type I restriction-modification system, subunit M (methyltransferase) 5 tnfn1_pw060510p02q180 FTN_0704 type I restriction-modification system, subunit M (methyltransferase) 2 tnfn1_pw060510p03q158 FTN_1294 rRNA methylase, SpoU family 2 tnfn1_pw060510p02q176 FTN_1413 ATPase, AAA family,...”
• Molecular bases of proliferation of Francisella tularensis in arthropod vectors
  Asare, Environmental microbiology 2010
  • “...DNA topoisomerase IV subunit A 2 tnfn1_pw060510p04q168 FTN_0666 uvrA excinuclease ABC, subunit A 2 tnfn1_pw060328p06q140 FTN_0704 type I restriction-modification system, subunit M (methyltransferase) 5 tnfn1_pw060510p02q180 FTN_0704 type I restriction-modification system, subunit M (methyltransferase) 2 tnfn1_pw060510p03q158 FTN_1294 rRNA methylase, SpoU family 2 tnfn1_pw060510p02q176 FTN_1413 ATPase, AAA family,...”
• Genetic dissection of the Francisella novicida restriction barrier
  Gallagher, Journal of bacteriology 2008
  • “...2; a type I R-M system), hsdSAI (FTN_0703), hsdMI (FTN_0704), hsdSBI (FTN_0707), and hsdRI (FTN_ 0710); for FtnUII (locus 3; type I), hsdMII (FTN_1152), hsdSII...”

M.Gel16401I Type I methyltransferase recognizing CYAAYNNNNNNCTC with methylation at 4(6mA),-2(6mA) from Geopsychrobacter electrodiphilus DSM 16401
Aligns to 153:274 / 496 (24.6%), covers 60.4% of PF01170, 32.4 bits

M.MprAceLI Type I methyltransferase recognizing GTANNNNNNNNTGGC with methylation at 3(6mA),-4(6mA) from Marinomonas primoryensis AceL
Aligns to 154:276 / 506 (24.3%), covers 58.9% of PF01170, 32.4 bits

M.PgaP129IV Type II methyltransferase recognizing CACNNNGTG with methylation at 2(6mA) from Phaeobacter gallaeciensis P129
Aligns to 137:256 / 630 (19.0%), covers 60.9% of PF01170, 32.4 bits

M.Cbr290I Type I methyltransferase recognizing CCANNNNNNGTTC with methylation at 3(6mA),-3(6mA) from Citrobacter braakii FDAARGOS_290
Aligns to 167:342 / 544 (32.4%), covers 62.4% of PF01170, 32.3 bits

M.Mva1261III Type I methyltransferase recognizing CTANNNNNNRTTC with methylation at 3(6mA),-3(6mA) from Mannheimia varigena USDA-ARS-USMARC-1261
Aligns to 168:371 / 518 (39.4%), covers 61.4% of PF01170, 32.3 bits

M.Ftu2015II Type I methyltransferase recognizing TCANNNNNNNTGAA with methylation at 3(6mA),-4(6mA) from Francisella tularensis subsp. novicida TCH2015
Aligns to 187:307 / 495 (24.4%), covers 58.4% of PF01170, 32.2 bits

M.Cje266II Type I methyltransferase recognizing CYAANNNNNNNRTAG with methylation at 4(6mA),-3(6mA) from Campylobacter jejuni subsp. jejuni FDAARGOS_266
Aligns to 179:366 / 494 (38.1%), covers 76.6% of PF01170, 32.1 bits

CJM1_1494 type I restriction-modification system subunit M from Campylobacter jejuni subsp. jejuni M1
Aligns to 179:366 / 496 (37.9%), covers 76.6% of PF01170, 32.0 bits

• Genomic characterization of Campylobacter jejuni strain M1
  Friis, PloS one 2010
  • “...restriction modification genes hsdR and hsdS (CJM1_1490 and CJM1_1493) and the associated DNA methylase, hsdM, (CJM1_1494). This restriction/modification (R/M) region has been shown to be involved in a hsd type I restrictionmodification system of C. jejuni but is not present in C. jejuni strain NCTC 11168...”

M.MavHJWI Type I methyltransferase recognizing GAGNNNNNNGCTG with methylation at 2(6mA),-2(6mA) from Mycobacterium avium HJW
MAV_5027 type I restriction-modification system, M subunit (NCBI) from Mycobacterium avium 104
Aligns to 186:304 / 495 (24.0%), covers 57.9% of PF01170, 31.9 bits

• Adaptive Changes in Mycobacterium avium Gene Expression Profile Following Infection of Genetically Susceptible and Resistant Mice
  Ignatov, Acta naturae 2010
  • “...gene rearrangements. Also, in sample B6, we detected an increased expression of the MAV_5024 and MAV_5027 genes coding for type II restriction-modification enzymes that protect cells from foreign DNA. The increased expression of the MAV_0382 (subunits of DNA-polymerase III) and MAV_4450 (ribosomal protein) genes in sample...”

M.PspR2A2I Type I methyltransferase recognizing CACNNNNNNNNTGCT with methylation at 2(6mA),-4(6mA) from Pseudomonas species R2A2
Aligns to 170:289 / 488 (24.6%), covers 57.4% of PF01170, 31.8 bits

CNAG_02583 tRNA (guanine10-N2)-methyltransferase from Cryptococcus neoformans var. grubii H99
Aligns to 187:315 / 475 (27.2%), covers 69.5% of PF01170, 31.7 bits

• Microevolution of Serial Clinical Isolates of Cryptococcus neoformans var. grubii and C. gattii.
  Chen, mBio 2017
  • “...genes are located in this region, including an oxygenase (CNAG_02580), Cas33 lipase (CNAG_02581), a methyltransferase (CNAG_02583), and an ARID domain protein (CNAG_02579). A recent study of one pair of serial isolates found a single mutation of the ARID domain protein that may contribute to multiple phenotypic...”
  • “...0 CNAG_02581 CAS33 CAS33 capsule-associated protein 3 1.00 0 CNAG_02582 Hypothetical protein 3 1.00 0 CNAG_02583 tRNA (guanine10-N2)-methyltransferase 3 1.00 0 CNAG_02584 Serine/threonine-protein phosphatase 2A activator 1 3 1.00 0 CNAG_07981 Hypothetical protein 5 1.91 1.00 CNAG_01229 l -Mandelate dehydrogenase 5 1.91 1.00 CNAG_01230 Cda2 Chitin...”

SPD_0907 HemK protein (NCBI) from Streptococcus pneumoniae D39
Aligns to 107:208 / 279 (36.6%), covers 39.1% of PF01170, 31.6 bits

• Dynamic Pneumococcal Genetic Adaptations Support Bacterial Growth and Inflammation during Coinfection with Influenza
  Smith, Infection and immunity 2021
  • “...isomerase A SPD_0822 proB Glutamate 5-kinase SPD_0823 proA Gamma-glutamyl phosphate reductase SPD_0824 proC Pyrroline-5-carboxylate reductase SPD_0907 hemK HemK protein SPD_0994 ribF Riboflavin biosynthesis protein RibF SPD_1087 fhs Formate-tetrahydrofolate ligase SPD_1090 Membrane protein, putative SPD_1098 Amino acid ABC transporter, amino acid-binding protein/permease protein SPD_1099 Amino acid ABC...”

MM_2243 putative methyltransferase (NCBI ptt file) from Methanosarcina mazei Goe1
Aligns to 87:172 / 248 (34.7%), covers 26.9% of PF01170, 31.6 bits

• Connection between multimetal(loid) methylation in methanoarchaea and central intermediates of methanogenesis
  Thomas, Applied and environmental microbiology 2011
  • “...analyses of four selected genes (MM_1070, MM_2962, MM_2243, and MM_3188). Specific transcripts were detected and quantified after hybridization with...”

lpp2419 hypothetical protein (NCBI) from Legionella pneumophila str. Paris
Aligns to 45:174 / 212 (61.3%), covers 33.5% of PF01170, 31.6 bits

• Regulation, integrase-dependent excision, and horizontal transfer of genomic islands in Legionella pneumophila
  Lautner, Journal of bacteriology 2013
  • “...lpw25801, putative Dot/Icm T4SS effector Similar to lpp2419 Similar to lpc0225, SidC (llo_p0059) homolog Legionella longbeachae NSW150 Transposase (IS652),...”
• Extensive recombination events and horizontal gene transfer shaped the Legionella pneumophila genomes
  Gomez-Valero, BMC genomics 2011
  • “...lpl2109 98.55 lpc1642 100 lpo2253 99.60 lpv2436 100 lpg2182 96.27 Conserved protein of unknown function lpp2419 99.84 lpl2298 99.37 lpc2129 100 Leucine rich repeat protein lpp2459 98.98 lpl2316 86.85 lpc2085 90.48 lpo2572 99.43 lpv2704 99.32 lpg2392* 97.28 Putative unspecific monooxygenase lpp2468 99.47 lpl2326 99.01 lpc2075 98.88...”

lpl2298 hypothetical protein (NCBI) from Legionella pneumophila str. Lens
Aligns to 44:143 / 212 (47.2%), covers 34.0% of PF01170, 31.6 bits

• Extensive recombination events and horizontal gene transfer shaped the Legionella pneumophila genomes
  Gomez-Valero, BMC genomics 2011
  • “...lpc1642 100 lpo2253 99.60 lpv2436 100 lpg2182 96.27 Conserved protein of unknown function lpp2419 99.84 lpl2298 99.37 lpc2129 100 Leucine rich repeat protein lpp2459 98.98 lpl2316 86.85 lpc2085 90.48 lpo2572 99.43 lpv2704 99.32 lpg2392* 97.28 Putative unspecific monooxygenase lpp2468 99.47 lpl2326 99.01 lpc2075 98.88 lpo2586 98.15...”

M.Pps5344II Type I methyltransferase recognizing GAGNNNNNNCTGG with methylation at 2(6mA),-3(6mA) from Pseudomonas pseudoalcaligenes CECT 5344
M.PspNIH3I Type I methyltransferase recognizing GAGNNNNNNCTGG with methylation at 2(6mA),-3(6mA) from Pseudomonas species PONIH3
Aligns to 149:316 / 471 (35.7%), covers 79.7% of PF01170, 31.5 bits

M1.Sgr13350III Type II methyltransferase recognizing GCTCTTC with methylation at 2(N4mC),-5(6mA) from Streptomyces griseus subsp. griseus NBRC 13350
Aligns to 66:177 / 407 (27.5%), covers 29.9% of PF01170, 31.3 bits

M.Cbo67071II Type I methyltransferase recognizing TAGNNNNNNCTTGY with methylation at 2(6mA),-4(6mA) from Clostridium botulinum CDC_67071
Aligns to 162:324 / 486 (33.5%), covers 62.9% of PF01170, 31.3 bits

M.Vpa17802I Type I methyltransferase recognizing CGANNNNNNNGTAG with methylation at 3(6mA),-3(6mA) from Vibrio parahaemolyticus
Aligns to 221:359 / 635 (21.9%), covers 60.9% of PF01170, 31.2 bits

M.Vvu61306I Type I methyltransferase recognizing CAAANNNNNNGTCY with methylation at 4(6mA),-3(6mA) from Vibrio vulnificus ATL 6-1306
Aligns to 166:319 / 512 (30.1%), covers 61.9% of PF01170, 31.1 bits

T4BA_WEICA / Q07605 Type II restriction enzyme and methyltransferase RM.BcgI; Restriction enzyme BgcI subunit A; EC 3.1.21.4; EC 2.1.1.72 from Weizmannia coagulans (Bacillus coagulans) (see 2 papers)
BcgI Type IIG restriction enzyme/methyltransferase recognizing CGANNNNNNTGC, 24; GCANNNNNNTCG, -10; with methylation at 3(6mA),-3(6mA) from Bacillus coagulans
bcgIA / AAA16626.1 restriction endonuclease alpha subunit from Bacillus coagulans (see 2 papers)
Aligns to 330:503 / 637 (27.3%), covers 87.3% of PF01170, 30.8 bits

• function: A B, G, H and S subtype restriction enzyme that recognizes the double-stranded sequence 5'-CGAN(6)TGC-3' and cleaves bilaterally and symmetrically 10 base pairs upstream and 12 base pairs downstream of the sequence to release a 34-base pair fragment. Methylation of the recognition sequence occurs on the adenine in either one or both strands; seems to methylate restricted DNA (PubMed:8451198, PubMed:8276869, PubMed:12654995). This subunit has no methylation or DNA restriction activity on its own (PubMed:8276869).
  catalytic activity: Endonucleolytic cleavage of DNA to give specific double- stranded fragments with terminal 5'-phosphates.
  catalytic activity: a 2'-deoxyadenosine in DNA + S-adenosyl-L-methionine = an N(6)-methyl-2'-deoxyadenosine in DNA + H(+) + S-adenosyl-L- homocysteine (RHEA:15197)
  cofactor: Mg(2+)
  subunit: Heterotrimer of two A and one B subunit. Both subunits are necessary for DNA-binding, which is sequence non-specific.

Cj0722c putative DNA methylase (NCBI ptt file) from Campylobacter jejuni subsp. jejuni NCTC 11168
Aligns to 115:183 / 271 (25.5%), covers 28.4% of PF01170, 30.7 bits

• Transcriptional regulation of the CmeABC multidrug efflux pump and the KatA catalase by CosR in Campylobacter jejuni
  Hwang, Journal of bacteriology 2012
  • “...Posttranslational modification, protein turnover, and chaperones Cj0722c Cj1365c Cj0722c Cj1365c Putative DNA methylase Putative secreted serine protease 2.036...”
• In vivo and in silico determination of essential genes of Campylobacter jejuni
  Metris, BMC genomics 2011
  • “...cj1652c FBA & transposon mutagenesis of Stahl and Stintzi cj0132, cj0147c, cj0308c, cj0356c, cj0451, cj0503c, cj0722c, cj0845c, cj0861c, cj0925, cj1201, cj1239, cj1290c, cj1291c, cj1531, cj1535c FBA & the 2 transposon mutagenesis methods cj0231c, cj0545, cj0707, cj0810, cj0855, cj0895c, cj1644, cj1676 The "metabolic genes" refer to the...”

M.Sma36365I Type I methyltransferase recognizing AAGNNNNNGTTC with methylation at 2(6mA),-3(6mA) from Serratia marcescens U36365
Aligns to 168:334 / 544 (30.7%), covers 60.9% of PF01170, 30.7 bits

Additional hits are not shown.

Or search for genetic data about PF01170 in the Fitness Browser