Family Search for PF01205 (UPF0029)

April 2024: See Interactive Tools for Functional Annotation of Bacterial Genomes for advice on using these tools.

PF01205 hits 45 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.

BC5199 Xaa-Pro dipeptidase from Bacillus cereus ATCC 14579
Aligns to 19:124 / 211 (50.2%), covers 99.1% of PF01205, 143.0 bits

• Cysteine Proteome Reveals Response to Endogenous Oxidative Stress in Bacillus cereus
  Hamitouche, International journal of molecular sciences 2021
  • “...and metabolism BC1182 Oligopeptide transport ATP-binding protein (OppD) VVIAMALAC 172 NPK 1.7 1.2 Function unknown BC5199 Xaa-Pro dipeptidase FIC 25 YISR 1.6 1.1 BC4341 GTP pyrophosphokinase ITC 88 C 89 FVEDIYHLK BC3302 Pentapeptide repeat containing protein SC 78 NLEEIHIADC 88 R 1.8 2.1 ASFFDC 68 DFEFADFR...”

BSU35510 hypothetical protein from Bacillus subtilis subsp. subtilis str. 168
P32437 IMPACT family member YvyE from Bacillus subtilis (strain 168)
Aligns to 19:124 / 217 (48.8%), covers 98.1% of PF01205, 141.0 bits

• Secondary structural entropy in RNA switch (Riboswitch) identification
  Manzourolajdad, BMC bioinformatics 2015
  • “...nt 3640353 3640552 forward BSU35210 yvkA -19956 -52.60 - 0.3600 121.8539963 - 0.4250 6302 yvyE BSU35510 0.8399478197 200 nt 3686112 3686311 forward BSU35770 tagC -1247 -51.99 - 0.3750 122.5879974 - 0.4300 2602 gerBA BSU35800 0.8393257856 200 nt 3686112 3686311 forward BSU35770 tagC -1247 -51.99 - 0.3750...”
  • “...nt 3640453 3640652 forward BSU35210 yvkA -20056 -45.52 - 0.3450 123.6029968 - 0.4400 6202 yvyE BSU35510 0.8211722970 200 nt 530787 530986 forward BSU_tRNA_51 trnS-Leu2 -1266 -47.10 - 0.3350 122.6100006 - 0.3850 902 sacV BSU04830 0.8206871748 200 nt 4139260 4139459 forward BSU40240 yycS -3397 -60.10 - 0.5050...”
• Screening for imprinted genes by allelic message display: identification of a paternally expressed gene impact on mouse chromosome 18
  Hagiwara, Proceedings of the National Academy of Sciences of the United States of America 1997
  • “...no. P44842), B. subtilis YVYE (Swiss-Prot no. P32437), and T. aquaticus YPOL (Swiss-Prot no. P32438). Amino acid residues similarly conserved between...”

lmo2516 similar to conserved hypothetical proteins from Listeria monocytogenes EGD-e
Aligns to 19:124 / 211 (50.2%), covers 99.1% of PF01205, 140.9 bits

• Survival of Listeria monocytogenes in Soil Requires AgrA-Mediated Regulation
  Vivant, Applied and environmental microbiology 2015
  • “...lmo0361 lmo1293 lmo1440 lmo2142 lmo0220 lmo2304 lmo2321 lmo2321 lmo2516 lmo0518 lmo0762 5.277 2.532 4.109 3.457 2.851 2.676 4.911 4.911 2.309 3.351 4.516 ncRNAs...”
• Deciphering the intracellular metabolism of Listeria monocytogenes by mutant screening and modelling
  Schauer, BMC genomics 2010
  • “...no 9.9 2.5 lmo1920 unknown protein 16.5 1.0 lmo2586 formate dehydrogenase -chain possible 2.4 2.2 lmo2516 conserved hypothetical protein possible 3.6 1.2 6 lmo2660 Transketolase rf 3.0 2.6 lmo2639 unknown protein, contains DUF1312 domain possible 5.5 1.0 lmo2764 xylose operon regulatory protein and to glucose kinase...”

LLKF_1118 hypothetical protein from Lactococcus lactis subsp. lactis KF147
Aligns to 16:121 / 209 (50.7%), covers 100.0% of PF01205, 140.8 bits

• Strain-Dependent Transcriptome Signatures for Robustness in Lactococcus lactis
  Dijkstra, PloS one 2016
  • “...positive 0.9 LLKF_1417 yngB fibronectin-binding protein A positive 1.9 LLKF_1270 ilvA threonine dehydratase negative 2.9 LLKF_1118 ykjI hypothetical protein positive 0.7 LLKF_1265 ymeB ABC transporter ATP-binding protein negative 0.3 LLKF_0493 pyrG CTP synthase positive 7.4 LLKF_0849 trmU tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase positive 10.2 LLKF_0664 scrK fructokinase positive 0.7...”

USA300HOU_0775 hypothetical membrane protein from Staphylococcus aureus subsp. aureus USA300_TCH1516
SAUSA300_0732 hypothetical protein from Staphylococcus aureus subsp. aureus USA300_FPR3757
Aligns to 19:124 / 213 (49.8%), covers 99.1% of PF01205, 140.2 bits

• Pre-epidemic evolution of the MRSA USA300 clade and a molecular key for classification
  Bianco, Frontiers in cellular and infection microbiology 2023
  • “...1 (445217) , set21 (452762) , thiD (638407) , mnhD1 (697737 , intergenic (737821) , USA300HOU_0775 (826842) , USA300HOU_0937 (982232) , abH2 (986803) , oppB3 (997946) USA300HOU_1022 (1089485) , isdE (1141794) , cfxE (1235660) , dnaE1 (1284408) , miaB (1319259) , sbcC O1377590) , intergenic (1414153)...”
• Novel Regulation of Alpha-Toxin and the Phenol-Soluble Modulins by Peptidyl-Prolyl cis/trans Isomerase Enzymes in Staphylococcus aureus
  Keogh, Toxins 2019
  • “...Unknown function SAUSA300_1861 0.24 Conserved hypothetical protein SAUSA300_1007 0.24 Unknown function SAUSA300_0329 0.24 Unknown function SAUSA300_0732 0.23 Conserved hypothetical protein SAUSA300_0538 0.23 Energy metabolism SAUSA300_2251 0.22 Energy metabolism SAUSA300_2025 RsbU 0.22 Cellular processes (includes toxins and virulence factors) SAUSA300_2525 0.21 Conserved hypothetical protein SAUSA300_2510 0.20 Conserved...”

SA0703 hypothetical protein from Staphylococcus aureus subsp. aureus N315
Aligns to 19:124 / 213 (49.8%), covers 99.1% of PF01205, 140.2 bits

• Characterizing the effects of inorganic acid and alkaline shock on the Staphylococcus aureus transcriptome and messenger RNA turnover
  Anderson, FEMS immunology and medical microbiology 2010
  • “...5 SA0629 hypothetical protein sa_c7859s6850_at 3.5 2.5 2.5 SA0662 hypothetical protein sa_c7985s6972_at 2.4 2.5 2.5 SA0703 hypothetical protein sa_c8013s6998_a_at 26.8 2.5 2.5 SA0711 hypothetical protein sa_c8905s7823_a_at * 2.5 2.5 2.5 SA0721 hypothetical protein sa_c8079s7064_a_at 2.4 2.5 5 SA0734 hypothetical protein sa_c8131s7116_a_at 2.1 2.5 2.5 SA0749 hypothetical...”
• Characterization of the Staphylococcus aureus heat shock, cold shock, stringent, and SOS responses and their effects on log-phase mRNA turnover
  Anderson, Journal of bacteriology 2006
  • “...SA0427 SA0436 SA0445 SA0480 SA0625 SA0639 SA0641 SA0692 SA0703 SA0730 SA0755 SA0768 SA0785 SA0821 SA0822 SA0870 SA0871 SA0920 SA1033 SA1044 SA1101 SA1117 SA1191...”

spr2014 Conserved hypothetical protein from Streptococcus pneumoniae R6
Aligns to 17:122 / 211 (50.2%), covers 99.1% of PF01205, 139.7 bits

• Search for genes essential for pneumococcal transformation: the RADA DNA repair protein plays a role in genomic recombination of donor DNA
  Burghout, Journal of bacteriology 2007
  • “...been linked to the competence regulon, and one, spr2014, was located adjacent to the essential competence gene comFA. Directed mutants of seven of the...”
  • “...an AluI fragment. The same holds true for spr2014, which shares an AluI restriction fragment with comFA. Interestingly, several genes we selected, namely radA...”

G7SDH9 Xaa-Pro dipeptidase from Streptococcus suis D12
Aligns to 18:123 / 210 (50.5%), covers 100.0% of PF01205, 139.6 bits

• Sub-MIC Tylosin Inhibits Streptococcus suis Biofilm Formation and Results in Differential Protein Expression
  Wang, Frontiers in microbiology 2016
  • “...List of differentially expressed proteins in tylosin treated cells . Accession Description Fold change a G7SDH9 Putative uncharacterized protein 0.555777 A4W1G9 Phosphotransferase system cellobiose-specific component IIC 0.521547 G7SA24 Cold-shock DNA-binding domain protein 0.394546 F4EDP5 Putative uncharacterized protein 0.568016 R4NL31 MF3-like protein 0.63094 E9NQ29 CPS16V 0.452748 G5KZ73...”

CD630_07910 YigZ family protein from Clostridioides difficile 630
Aligns to 18:123 / 214 (49.5%), covers 96.2% of PF01205, 139.4 bits

• Clostridioides difficile Phosphoproteomics Shows an Expansion of Phosphorylated Proteins in Stationary Growth Phase
  Smits, mSphere 2022
  • “...throughout growth. Exponential-growth-phase phosphorylation is not observed for all cell division proteins; for instance, ZapA (CD630_07910) and FtsZ (CD630_26460) are predominantly phosphorylated in stationary growth phase ( TableS1 ). FtsZ is also phosphorylated in other bacteria ( 47 49 ). We were interested to see if...”

BH3630 hypothetical protein from Bacillus halodurans C-125
Aligns to 19:124 / 213 (49.8%), covers 98.1% of PF01205, 137.8 bits

• Computational identification of the Spo0A-phosphate regulon that is essential for the cellular differentiation and development in Gram-positive spore-forming bacteria
  Liu, Nucleic acids research 2003
  • “...yuxHII yvyEII ywcIII abrBI BH2351 (yneE ortholog)II BH3630 (yvyE ortholog)II kinCI spo0AI spo0FI spoIIEI spoIIGAI abrBI kinCI spo0AI spo0AI spo0FI spoIIEI...”

X276_04450 YigZ family protein from Clostridium beijerinckii NRRL B-598
Aligns to 17:122 / 215 (49.3%), covers 99.1% of PF01205, 137.7 bits

• Phenotypic and Genomic Analysis of Clostridium beijerinckii NRRL B-598 Mutants With Increased Butanol Tolerance
  Vasylkivska, Frontiers in bioengineering and biotechnology 2020
  • “...10 5053669 C T X276_04620 Hypothetical protein 5053325 5055736 D N 11 5083112 C T X276_04450 YigZ family protein 5082972 5083619 V I 12 5084395 C T X276_04445 PLP-dependent aminotransferase family protein 5083996 5085438 M I 13 5275399 G A X276_03630 Carboxynorspermidine decarboxylase 5274563 5275702 H...”

SPy1617 conserved hypothetical protein from Streptococcus pyogenes M1 GAS
M5005_Spy_1328 Xaa-Pro dipeptidase from Streptococcus pyogenes MGAS5005
Aligns to 18:123 / 210 (50.5%), covers 100.0% of PF01205, 137.0 bits

• Optimization of Nuclear Localization Signal Composition Improves CRISPR-Cas12a Editing Rates in Human Primary Cells
  Luk, GEN biotechnology 2022 (secret)
• Genome-wide analysis of in vivo CcpA binding with and without its key co-factor HPr in the major human pathogen group A Streptococcus
  DebRoy, Molecular microbiology 2021
  • “...Yes ORF CTGCAATCGTTTACTT M5005_Spy_1323 Hypothetical protein L No NA 50 Yes Yes Yes Prom CTTGAAGCGCTTACTT M5005_Spy_1328 YigZ family protein S Yes Independent 50 Yes Yes Yes Prom CTTGAAGCGCTTACTT M5005_Spy_1325 Ribosomeassociated factor Y J Yes Fully dependent 51 Yes No No M5005_Spy_1366 Penicillinbinding protein 2X M No...”

SCO1302 hypothetical protein from Streptomyces coelicolor A3(2)
Aligns to 19:124 / 208 (51.0%), covers 99.1% of PF01205, 126.6 bits

• Cloning and engineering of the cinnamycin biosynthetic gene cluster from Streptomyces cinnamoneus cinnamoneus DSM 40005
  Widdick, Proceedings of the National Academy of Sciences of the United States of America 2003
  • “...627 bp. The encoded protein is 79% identical to SCO1302 of S. coelicolor (11). CinZ shares 40% identity with PepQ, a proline dipeptidase from E. coli (GenBank...”

PG0124 conserved hypothetical protein from Porphyromonas gingivalis W83
Aligns to 20:125 / 206 (51.5%), covers 100.0% of PF01205, 126.0 bits

• The nucleoid-associated protein HUβ affects global gene expression in Porphyromonas gingivalis
  Priyadarshini, Microbiology (Reading, England) 2013
  • “...inserted into a unique BmgBI site located between PG0123 and PG0124 in the non-coding region. The insertion of the Tcr was oriented such that it does not affect...”

ERH_0029 YigZ family protein from Erysipelothrix rhusiopathiae str. Fujisawa
Aligns to 20:122 / 202 (51.0%), covers 97.2% of PF01205, 124.8 bits

• Proteomic and Transcriptomic Analyses of Swine Pathogen Erysipelothrix rhusiopathiae Reveal Virulence Repertoire
  Li, PloS one 2016
  • “...Unknown gi|336065271 hypothetical protein 51 2 1.635 ABC-type metal ion transport system, ATPase component up ERH_0029 gi|322463387 LPXTG-motif cell wall anchor domain protein 16.6 1 2.225 Uncharacterized conserved protein up ERH_1687 gi|322463680 ABC transporter, permease protein 2.3 1 17.319 Unknown down ERH_1245 gi|336066678 glycosyltransferase family protein...”

FTN_0466 hypothetical protein from Francisella tularensis subsp. novicida U112
Aligns to 19:123 / 200 (52.5%), covers 99.1% of PF01205, 124.4 bits

• Molecular bases of proliferation of Francisella tularensis in arthropod vectors
  Asare, Environmental microbiology 2010
  • “...hypothetical protein 2 tnfn1_pw060419p03q186 FTN_0375 hypothetical protein 3 tnfn1_pw060420p02q163 FTN_0398 hypothetical membrane protein 3 tnfn1_pw060420p04q104 FTN_0466 conserved hypothetical protein 4 tnfn1_pw060328p08q148 FTN_0548 conserved hypothetical protein 2 # tnfn1_pw060418p04q176 FTN_0548 conserved hypothetical protein 2 # tnfn1_pw060328p06q164 FTN_0630 hypothetical protein 5 tnfn1_pw060328p05q141 FTN_0701 conserved hypothetical protein 5 tnfn1_pw060418p02q152...”
  • “...hypothetical protein 6 5 22% 2.3E+01 tnfn1_pw060419p03q187 FTN_1123 conserved hypothetical protein 3 20% 1.0E-01 tnfn1_pw060420p04q104 FTN_0466 conserved hypothetical protein 4 20% 1.3E+00 tnfn1_pw060328p06q185 FTN_0709 hypothetical protein 7 3 20% 1.3E+00 tnfn1_pw060510p04q192 FTN_1098 conserved hypothetical membrane protein 6 7 11% 2.7E-02 tnfn1_pw060510p01q184 FTN_1299 hypothetical protein 5 10%...”
• Molecular complexity orchestrates modulation of phagosome biogenesis and escape to the cytosol of macrophages by Francisella tularensis
  Asare, Environmental microbiology 2010
  • “...hypothetical protein 2 tnfn1_pw060419p03q186 FTN_0375 hypothetical protein 3 tnfn1_pw060420p02q163 FTN_0398 hypothetical membrane protein 3 tnfn1_pw060420p04q104 FTN_0466 conserved hypothetical protein 4 tnfn1_pw060328p08q148 FTN_0548 conserved hypothetical protein 2 # tnfn1_pw060418p04q176 FTN_0548 conserved hypothetical protein 2 # tnfn1_pw060328p06q164 FTN_0630 hypothetical protein 5 tnfn1_pw060328p05q141 FTN_0701 conserved hypothetical protein 5 tnfn1_pw060418p02q152...”

TM1713 proline dipeptidase, putative from Thermotoga maritima MSB8
Aligns to 17:121 / 191 (55.0%), covers 99.1% of PF01205, 122.8 bits

• Proteolysis in hyperthermophilic microorganisms
  Ward, Archaea (Vancouver, B.C.) 2002
  • “...TM0772 TM1048 TM1049 TM1050 TM0042 TM0365 TM1713 TM1478 Oligoendopeptidase, putative Conserved hypothetical protein Conserved hypothetical protein Signal...”

HI0722 hypothetical protein from Haemophilus influenzae Rd KW20
Aligns to 22:129 / 210 (51.4%), covers 100.0% of PF01205, 122.2 bits

• Functional annotation of conserved hypothetical proteins from Haemophilus influenzae Rd KW20
  Shahbaaz, PloS one 2013
  • “...P44041 Plasmid stabilisation system protein RelE/ParE 116 HP HI0719 949739 P44839 Endoribonuclease L-PSP 117. HP HI0722 949742 P44842 Translation elongation factor EFG, V domain 118. HP HI0725 949753 P44043 coproporphyrinogen III oxidase 119. HP HI0744 949771 P44854 rhodanese-related sulfurtransferase 120. HP HI0755 949515 P44863 Polysaccharide deacetylase...”

P44842 IMPACT family member HI_0722 from Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Aligns to 18:125 / 206 (52.4%), covers 100.0% of PF01205, 122.2 bits

• Functional annotation of conserved hypothetical proteins from Haemophilus influenzae Rd KW20
  Shahbaaz, PloS one 2013
  • “...stabilisation system protein RelE/ParE 116 HP HI0719 949739 P44839 Endoribonuclease L-PSP 117. HP HI0722 949742 P44842 Translation elongation factor EFG, V domain 118. HP HI0725 949753 P44043 coproporphyrinogen III oxidase 119. HP HI0744 949771 P44854 rhodanese-related sulfurtransferase 120. HP HI0755 949515 P44863 Polysaccharide deacetylase 121. HP...”
• Screening for imprinted genes by allelic message display: identification of a paternally expressed gene impact on mouse chromosome 18
  Hagiwara, Proceedings of the National Academy of Sciences of the United States of America 1997
  • “...(Swiss-Prot no. P27862), H. influenzae YIGZ (Swiss-Prot no. P44842), B. subtilis YVYE (Swiss-Prot no. P32437), and T. aquaticus YPOL (Swiss-Prot no. P32438)....”

FTA_0467 hypothetical protein from Francisella tularensis subsp. holarctica FTA
Aligns to 19:123 / 200 (52.5%), covers 99.1% of PF01205, 121.4 bits

• Complete genome sequence of Francisella tularensis subspecies holarctica FTNF002-00
  Barabote, PloS one 2009
  • “...LF 0 drug resistance transporter, Bcr/CflA family protein G FTA_1589 TA 0 transposase ISFtu1 L FTA_0467 VA 0 hypothetical protein S FTA_0469 AS 1 FMN reductase, NADPH-dependent R FTA_1106 AS 1 D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase M FTA_1611 AS 1 phosphopyruvate hydratase G FTA_0592 DN 1 hypothetical protein FTA_0900...”

Q9JXA1 Impact N-terminal domain-containing protein from Neisseria meningitidis serogroup B (strain MC58)
Aligns to 19:124 / 203 (52.2%), covers 100.0% of PF01205, 121.3 bits

• Towards New Drug Targets? Function Prediction of Putative Proteins of Neisseria meningitidis MC58 and Their Virulence Characterization
  Shahbaaz, Omics : a journal of integrative biology 2015
  • “...103. 104. 105. 106. 107. 108. 109. 110. 111. Q9JXA1 Q9JXA4 Q9JXJ0 Q9JXP8 Q9JY81 Q9JYN7 Q9K1C4 Q9JYZ4 Q9K020 112. 113. Q9JXD4 Q9K0K0 Fe-S oxidoreductase of MoaA...”
  • “...against oxidative stresses (Reffuveille et al., 2012). HP Q9JXA1 was predicted to be a thymidylate synthase. It may be involved in the catalytic conversion...”

YigZ / b3848 IMPACT family member YigZ from Escherichia coli K-12 substr. MG1655 (see 7 papers)
YIGZ_ECOLI / P27862 IMPACT family member YigZ from Escherichia coli (strain K12) (see paper)
yigZ / RF|NP_418290 IMPACT family member yigZ from Escherichia coli K12 (see paper)
Aligns to 18:125 / 204 (52.9%), covers 100.0% of PF01205, 119.3 bits

• subunit: Monomer.
• Screening for imprinted genes by allelic message display: identification of a paternally expressed gene impact on mouse chromosome 18
  Hagiwara, Proceedings of the National Academy of Sciences of the United States of America 1997
  • “...Resource no. S61035), E. coli YIGZ (Swiss-Prot no. P27862), H. influenzae YIGZ (Swiss-Prot no. P44842), B. subtilis YVYE (Swiss-Prot no. P32437), and T....”
• Yeast chromosome III: new gene functions
  Koonin, The EMBO journal 1994
  • “...ND-DGEPSGTAGVPI4LEVLKKRRLKDTCAVVTRYFGGIKLGAG 93 67 X66105G P27862 A30191P - --LYYEVGEKLLHCDPGHPIYQKWIGTYGG 2 P25052 Fig. 3. Detecting...”

Z5370 orf, hypothetical protein from Escherichia coli O157:H7 EDL933
Aligns to 19:126 / 205 (52.7%), covers 100.0% of PF01205, 118.8 bits

• Engineering Escherichia coli for succinate production from hemicellulose via consolidated bioprocessing
  Zheng, Microbial cell factories 2012
  • “...pB-E 3 X 7 AD was constructed and transformed into BL21 (DE3) to obtain strain Z5370, in which abf 2 (coding an -arabinofuranosidase originated from Bacillus subtilis 168 [ 38 ]), E3, X7 and dsbA genes were co-expressed. The effect of -arabinofuranosidase on the improvement of...”
  • “...and unhydrolyzed sugars during cultivation of the engineered strains . Circle, Z3000; square, Z4370; triangle, Z5370; the solid symbols indicate OD 600 and the hollow ones indicate unhydrolyzed sugars. Forty-eight hours after induction, the degree of xylan hydrolysis was improved from 66% to 79% with -arabinofuranosidase...”

SMc01701 CONSERVED HYPOTHETICAL PROTEIN from Sinorhizobium meliloti 1021
Aligns to 15:115 / 194 (52.1%), covers 99.1% of PF01205, 117.4 bits

• The Sinorhizobium meliloti fur gene regulates, with dependence on Mn(II), transcription of the sitABCD operon, encoding a metal-type transporter
  Chao, Journal of bacteriology 2004
  • “...as hypothetical proteins (smc01637, sma1413, smc04431, smb20335, smc01701, smb21403, and smb20532). An updated annotation of these hypothetical proteins did not...”
  • “...(sitC) smc02506 (sitD) smc02474 smc02416 smc02025 smc01821 smc01701 smc01666 (mdeA) smc01664 smc01637 smc01124 (glnD) smb21403 smb20532 smb20335 sma2137 sma1413...”

VC2757 conserved hypothetical protein from Vibrio cholerae O1 biovar eltor str. N16961
Aligns to 20:127 / 210 (51.4%), covers 100.0% of PF01205, 116.0 bits

• Impact of Gene Repression on Biofilm Formation of Vibrio cholerae
  Pombo, Frontiers in microbiology 2022
  • “...VC2723-2732 VC2732 General secretion pathway protein E (GspE) 1 VC2750 GGDEF family protein 2 VC2754-2757 VC2757 Hypothetical protein 2 VC2760 DNA-Binding transcriptional regulator 1 VCA0011 Transcriptional regulator MalT 1 VCA0036 Serine/threonine transporter SstT 1 VCA0105-106 VCA0106 Hypothetical protein 1 VCA0107-120 VCA0114 Hypothetical protein 1 VCA0115 Hypothetical...”

MHO_1400 hypothetical protein from Mycoplasma hominis
Aligns to 21:127 / 132 (81.1%), covers 98.1% of PF01205, 115.6 bits

• Validation of a novel Mho microarray for a comprehensive characterisation of the Mycoplasma hominis action in HeLa cell infection
  Henrich, PloS one 2017
  • “...3.82 thrS 1 threonyl-tRNA synthetase MHO_1390 3.76 2 hypothetical protein MHO_2040 3.67 1 hypothetical protein MHO_1400 3.66 3 hypothetical protein MHO_4930 3.49 1 hypothetical protein MHO_3300 3.43 rnhB 2 ribonuclease HII MHO_3470 3.41 vaa 2 Vaa surface lipoprotein adhesin F807_00050 3.33 2 MLBD4_01025; hypothetical protein MHO_1860...”

PP0593 conserved hypothetical protein TIGR00257 from Pseudomonas putida KT2440
Aligns to 16:116 / 194 (52.1%), covers 100.0% of PF01205, 114.9 bits

• UEG Week 2023 Poster Presentations
  , United European gastroenterology journal 2023

IMPCT_XENLA / Q9W625 Protein IMPACT; Imprinted and ancient gene protein homolog; Ximpact from Xenopus laevis (African clawed frog) (see paper)
Aligns to 179:286 / 312 (34.6%), covers 100.0% of PF01205, 109.4 bits

• function: Translational regulator that ensures constant high levels of translation upon a variety of stress conditions, such as amino acid starvation, UV-C irradiation, proteasome inhibitor treatment and glucose deprivation. Plays a role as a negative regulator of the EIF2AK4/GCN2 kinase activity; impairs GCN1-mediated EIF2AK4/GCN2 activation, and hence EIF2AK4/GCN2-mediated eIF-2-alpha phosphorylation and subsequent down-regulation of protein synthesis. Plays a role in differentiation of neuronal cells by stimulating neurite outgrowth.
  subunit: Interacts with GCN1; prevents the interaction of GCN1 with EIF2AK4/GCN2 and inhibits EIF2AK4/GCN2 kinase activity. Interaction with RPL39; this interaction occurs in a GCN1-independent manner. Associates with ribosomes; this interaction occurs in a GCN1- independent manner. Associates with actin; this interaction occurs in a GCN1-independent manner.

XP_011245152 protein IMPACT isoform X1 from Mus musculus
Aligns to 163:270 / 300 (36.0%), covers 100.0% of PF01205, 106.6 bits

• The GCN2 inhibitor IMPACT contributes to diet-induced obesity and body temperature control.
  Pereira, PloS one 2019
  • GeneRIF: results indicate that IMPACT contributes to GCN2-dependent and -independent mechanisms involved in the regulation of autonomic functions in response to energy availability.
• Evolutionarily conserved IMPACT impairs various stress responses that require GCN1 for activating the eIF2 kinase GCN2.
  Cambiaghi, Biochemical and biophysical research communications 2014 (PubMed)
  • GeneRIF: This study extends our understanding of the roles played by GCN1 in GCN2 activation induced by a variety of stress arrangements and suggests that IMPACT and YIH1 use similar mechanisms for regulating this eIF2alpha kinase.
• IMPACT is a developmentally regulated protein in neurons that opposes the eukaryotic initiation factor 2α kinase GCN2 in the modulation of neurite outgrowth.
  Roffé, The Journal of biological chemistry 2013
  • GeneRIF: the participation of the GCN2-IMPACT module of translational regulation in a highly controlled step in the development of the nervous system.
• IMPACT, a protein preferentially expressed in the mouse brain, binds GCN1 and inhibits GCN2 activation.
  Pereira, The Journal of biological chemistry 2005 (PubMed)
  • GeneRIF: IMPACT ensures constant high levels of translation and low levels of CREB-2 and GADD53 in specific neuronal cells under amino acid starvation conditions.
• An evolutionary scenario for genomic imprinting of Impact lying between nonimprinted neighbors.
  Okamura, DNA research : an international journal for rapid publication of reports on genes and genomes 2004 (PubMed)
  • GeneRIF: segmental duplication followed by enhancement of the promoter activity is responsible for the species-specific imprinting of Impact

IMPCT_HUMAN / Q9P2X3 Protein IMPACT; Imprinted and ancient gene protein homolog from Homo sapiens (Human) (see 2 papers)
NP_060909 protein IMPACT from Homo sapiens
Aligns to 182:289 / 320 (33.8%), covers 100.0% of PF01205, 106.6 bits

• function: Translational regulator that ensures constant high levels of translation upon a variety of stress conditions, such as amino acid starvation, UV-C irradiation, proteasome inhibitor treatment and glucose deprivation. Plays a role as a negative regulator of the EIF2AK4/GCN2 kinase activity; impairs GCN1-mediated EIF2AK4/GCN2 activation, and hence EIF2AK4/GCN2-mediated eIF-2-alpha phosphorylation and subsequent down-regulation of protein synthesis. May be required to regulate translation in specific neuronal cells under amino acid starvation conditions by preventing GCN2 activation and therefore ATF4 synthesis. Through its inhibitory action on EIF2AK4/GCN2, plays a role in differentiation of neuronal cells by stimulating neurite outgrowth.
  subunit: Interacts with GCN1; prevents the interaction of GCN1 with EIF2AK4/GCN2 and inhibits EIF2AK4/GCN2 kinase activity. Interaction with RPL39; this interaction occurs in a GCN1-independent manner. Associates with ribosomes; this interaction occurs in a GCN1- independent manner. Associates with actin; this interaction occurs in a GCN1-independent manner.
• New genetic associations detected in a host response study to hepatitis B vaccine.
  Davila, Genes and immunity 2010 (PubMed)
  • GeneRIF: Observational study of gene-disease association. (HuGE Navigator)
• High expression of IMPACT protein promotes resistance to indoleamine 2,3-dioxygenase-induced cell death.
  Habibi, Journal of cellular physiology 2010 (PubMed)
  • GeneRIF: Data suggest that high expression of protein IMPACT homolog in non-immune cells acts as a protective mechanism against indoleamine 2,3-dioxygenase (IDO)-induced GCN2 activation, making them resistant to the amino acid-deprived environment caused by IDO.
• Comparative genomics approach toward critical determinants for the imprinting of an evolutionarily conserved gene Impact.
  Okamura, Biochemical and biophysical research communications 2005 (PubMed)
  • GeneRIF: It thus seems that lineage-specific enhancement of gene expression rather than the tandem repeat per se played a critical role in the evolution of imprinting of Impact.
• An evolutionary scenario for genomic imprinting of Impact lying between nonimprinted neighbors.
  Okamura, DNA research : an international journal for rapid publication of reports on genes and genomes 2004 (PubMed)
  • GeneRIF: segmental duplication followed by enhancement of the promoter activity is responsible for the species-specific imprinting of Impact
• Quantitative proteomics analysis of glioblastoma cell lines after lncRNA HULC silencing.
  Ye, Scientific reports 2021
  • “...of PRMT1 protein CHTOP 26.396 1.221 0.000080975 P50579 Methionine aminopeptidase 2 METAP2 52.891 1.221 0.000102665 Q9P2X3 Protein IMPACT IMPACT 36.476 1.22 0.00085821 Q9Y2E5 Epididymis-specific alpha-mannosidase MAN2B2 113.98 1.22 0.00092274 Q96L93 Kinesin-like protein KIF16B KIF16B 152.01 1.22 0.035896 P09471 Guanine nucleotide-binding protein G(o) subunit alpha GNAO1 40.05...”
• Quantitative proteomic analysis for high-throughput screening of differential glycoproteins in hepatocellular carcinoma serum
  Gao, Cancer biology & medicine 2015
  • “...axonemal OS=Homo sapiens GN=DNAH2 PE=1 SV=3 - [DYH2_HUMAN] 0.36 1 2 2 4,427 507.4 6.37 Q9P2X3 Protein IMPACT OS=Homo sapiens GN=IMPACT PE=1 SV=2 - [IMPCT_HUMAN] 8.75 1 2 2 320 36.5 4.97 O60333 Kinesin-like protein KIF1B OS=Homo sapiens GN=KIF1B PE=1 SV=5 - [KIF1B_HUMAN] 1.98 6 2...”

IMPCT_MOUSE / O55091 Protein IMPACT; Imprinted and ancient gene protein from Mus musculus (Mouse) (see 6 papers)
Aligns to 181:288 / 318 (34.0%), covers 100.0% of PF01205, 106.5 bits

• function: Translational regulator that ensures constant high levels of translation upon a variety of stress conditions, such as amino acid starvation, UV-C irradiation, proteasome inhibitor treatment and glucose deprivation. Plays a role as a negative regulator of the EIF2AK4/GCN2 kinase activity; impairs GCN1-mediated EIF2AK4/GCN2 activation, and hence EIF2AK4/GCN2-mediated eIF-2-alpha phosphorylation and subsequent down-regulation of protein synthesis (PubMed:15937339, PubMed:23447528, PubMed:24333428). May be required to regulate translation in specific neuronal cells under amino acid starvation conditions by preventing GCN2 activation and therefore ATF4 synthesis (PubMed:15937339, PubMed:23447528). Through its inhibitory action on EIF2AK4/GCN2, plays a role in differentiation of neuronal cells by stimulating neurite outgrowth (PubMed:23447528).
  subunit: Interacts with GCN1; prevents the interaction of GCN1 with EIF2AK4/GCN2 and inhibits EIF2AK4/GCN2 kinase activity (PubMed:15937339, PubMed:22404850). Interaction with RPL39; this interaction occurs in a GCN1-independent manner (PubMed:22404850). Associates with ribosomes; this interaction occurs in a GCN1- independent manner (PubMed:22404850). Associates with actin; this interaction occurs in a GCN1-independent manner (PubMed:22404850).
• Histological and Top-Down Proteomic Analyses of the Visual Pathway in the Cuprizone Demyelination Model
  Almuslehi, Journal of molecular neuroscience : MN 2022
  • “...47.9/8.8 193 7 6 II - - - - MP15 (1.68/ 0.001) Impact Protein IMPACT O55091 36.7/4.8 46.3/ 4.8 268 18 6 I - - - - Rp2 Protein XRP2 Q9EPK2 40.3/4.9 233 17 6 II - - - - Dpysl2 Dihydropyrimidinase-related protein 2 O08553 62.7/6.0...”
• Proteomic Assessment of C57BL/6 Hippocampi after Non-Selective Pharmacological Inhibition of Nitric Oxide Synthase Activity: Implications of Seizure-like Neuronal Hyperexcitability Followed by Tauopathy
  Hendrickx, Biomedicines 2022
  • “...Snx3 Sorting nexin-3 0.575 0.0465 P61222 Abce1 ATP-binding cassette sub-family E member 1 0.705 0.0478 O55091 Impact Protein IMPACT 0.575 0.0481 P15532 Nme1 Nucleoside diphosphate kinase A 0.62 0.0481 O70456 Sfn 14-3-3 protein sigma 1.02 0.0481 B0V2N1 Ptprs Receptor-type tyrosine-protein phosphatase S 0.667 0.0497 Q9WV55 Vapa...”
• A Neuroprotective Dose of Isatin Causes Multilevel Changes Involving the Brain Proteome: Prospects for Further Research.
  Medvedev, International journal of molecular sciences 2020
  • “...Involved in maintenance of the structural organization of the nuclear envelope and DNA binding 27 O55091 IMPCT 2.85 10 5 2.608 Protein IMPACT Translational regulator that helps to maintain constant high levels of translation under stress conditions 28 P35235 PTN11 2.89 10 5 2,467 Tyrosine-protein phosphatase...”
• Pyridazine-derivatives Enhance Structural and Functional Plasticity of Tripartite Synapse Via Activation of Local Translation in Astrocytic Processes.
  Foster, Neuroscience 2018
  • “...Sortilin 2.87 1.89 3.191 Q9D4I9 RAB23 1.54 1.61 2.709 P61164 Alpha-centractin 2.63 2.66 2.528 Translation O55091 Protein IMPACT 1.60 8.67 3.437 P62274 40S ribosomal protein S29 2.63 3.25 3.500 Vacuolar Proton Pump Q3TG21 ATPase, H+ transporting, lysosomal V1 subunit A 1.67 6.85 3.087 P50516 ATPase, H+...”
• Sex-Specific Differences in Oxytocin Receptor Expression and Function for Parental Behavior.
  Mitre, Gender and the genome 2017
• Alterations in the cerebellar (Phospho)proteome of a cyclic guanosine monophosphate (cGMP)-dependent protein kinase knockout mouse
  Corradini, Molecular & cellular proteomics : MCP 2014
  • “...Q80TL4 O89026 O08532 Q5RJG7 O35633 Q8BLE7 Q9EQF6 A2ALU4 O55091 Q61599 P36552 Q3UUG6 Q66L44 Q922J6 Q8BR92 Q9CX80 Q8BYJ6 Q99JP6 Q69ZX8 Q8BYR5 P08414 Q8R071 Q6NSW3...”

P32438 IMPACT family member in pol 5'region (Fragment) from Thermus thermophilus
Aligns to 3:102 / 179 (55.9%), covers 99.1% of PF01205, 106.3 bits

• Screening for imprinted genes by allelic message display: identification of a paternally expressed gene impact on mouse chromosome 18
  Hagiwara, Proceedings of the National Academy of Sciences of the United States of America 1997
  • “...P32437), and T. aquaticus YPOL (Swiss-Prot no. P32438). Amino acid residues similarly conserved between putative Impact product and other hypothetical proteins...”

Q5GFD9 Protein IMPACT from Rattus norvegicus
Aligns to 180:287 / 317 (34.1%), covers 100.0% of PF01205, 105.6 bits

• Proteomic Analysis of the Spatio-temporal Based Molecular Kinetics of Acute Spinal Cord Injury Identifies a Time- and Segment-specific Window for Effective Tissue Repair
  Devaux, Molecular & cellular proteomics : MCP 2016
  • “...AP180 Q07266-2 Drebrin Q07310-14 Neurexin-3 Q5GFD9 Protein IMPACT Q5HZA6-2 Prolylendopeptidase-like Q5XIT1 Microtubule-associatedprotein RP/EB familymember 3...”
  • “...RNA-binding motif protein, X chromosome Q5GFD9 Protein IMPACT Q5HZA6-2Prolylendopeptidase-like Q5XIT1 Microtubule-associatedprotein RP/EB familymember 3 Q62717...”
• Neuroproteomics: a biochemical means to discriminate the extent and modality of brain injury.
  Ottens, Journal of neurotrauma 2010

YIH1_YEAST / P25637 Protein IMPACT homolog from Saccharomyces cerevisiae (strain ATCC 204508 / S288c) (Baker's yeast) (see 7 papers)
NP_009985 Yih1p from Saccharomyces cerevisiae S288C
YCR059C Protein that inhibits activation of Gcn2p, an eIF2 alpha subunit protein kinase, by competing for Gcn1p binding, thus impacting gene expression in response to starvation; has sequence and functional similarity to the mouse IMPACT gene from Saccharomyces cerevisiae
Aligns to 144:251 / 258 (41.9%), covers 100.0% of PF01205, 105.5 bits

• function: Translational regulator that ensures constant high levels of translation under amino acid starvation. Plays a role as a negative regulator of the GCN2 kinase activity; impairs GCN1-mediated GCN2 activation, and hence GCN2-mediated eIF-2-alpha phosphorylation in amino acid-starved cells and subsequent down-regulation of protein synthesis (PubMed:15126500, PubMed:15937339, PubMed:24333428). In normal conditions, it resides in a actin complex and has no activity (PubMed:15126500).
  subunit: Interacts (via N-terminus) with GCN1 (via C-terminus); this interaction reduces the GCN1-GCN20 complex formation and prevents the interaction of GCN1 with GCN2 protein kinase and GCN2 activation in amino acid-starved cells (PubMed:15126500, PubMed:21239490). Interacts (via C-terminus) with ACT1; this interaction occurs in a GCN1- independent manner (PubMed:15126500, PubMed:21239490). Interacts with RPL39; this interaction occurs in a GCN1-independent manner (PubMed:22404850). Associates (via middle region) with ribosomes; this association occurs in a GCN1-independent manner and persists under amino acid starvation conditions (PubMed:22404850).
• Experimentally based structural model of Yih1 provides insight into its function in controlling the key translational regulator Gcn2.
  Harjes, FEBS letters 2021 (PubMed)
  • GeneRIF: Experimentally based structural model of Yih1 provides insight into its function in controlling the key translational regulator Gcn2.
• Asp56 in actin is critical for the full activity of the amino acid starvation-responsive kinase Gcn2.
  Ramesh, FEBS letters 2021 (PubMed)
  • GeneRIF: Asp56 in actin is critical for the full activity of the amino acid starvation-responsive kinase Gcn2.
• The Gcn2 Regulator Yih1 Interacts with the Cyclin Dependent Kinase Cdc28 and Promotes Cell Cycle Progression through G2/M in Budding Yeast.
  Silva, PloS one 2015
  • GeneRIF: Yih1 modulates the function of Cdc28 in specific stages of the cell cycle.
• Evidence that Yih1 resides in a complex with ribosomes.
  Waller, The FEBS journal 2012 (PubMed)
  • GeneRIF: Yih1 associates with ribosomes and that these ribosomes may simultaneously carry Gcn1 and Gcn2.
• Gcn1 and actin binding to Yih1: implications for activation of the eIF2 kinase GCN2.
  Sattlegger, The Journal of biological chemistry 2011
  • GeneRIF: Yih1 binds with different requirements to distinct populations of Gcn1 molecules, and its ability to disrupt Gcn1-Gcn2 complexes is dependent on a complete RWD and hindered by actin binding.
• Screening for imprinted genes by allelic message display: identification of a paternally expressed gene impact on mouse chromosome 18
  Hagiwara, Proceedings of the National Academy of Sciences of the United States of America 1997
  • “...proteins, including Saccharomyces cerevisiae YCR059C (Swiss-Prot no. P25637), S. cerevisiae YDL177C (Protein Identification Resource no. S61035), E. coli YIGZ...”
• Large-scale genomic rearrangements boost SCRaMbLE in Saccharomyces cerevisiae
  Cheng, Nature communications 2024
  • “...was found in JDY550 mediated by IV-6 and loxPsym site 73, located between YCR057C and YCR059C on synIII. Read alignments revealed that IV-6-Up was combined with segment 74 on synIII, and IV-6-Down combined with segment 73 (Fig. 4c ). A rearrangement between synIII and chrIII, in...”
• A large accessory protein interactome is rewired across environments
  Liu, eLife 2020
  • “...0 1 0 0 YDL093W 1 0 0 0 0 0 0 1 0 0 YCR059C 1 0 0 0 0 0 0 1 0 0 YOL081W 1 0 0 0 0 0 0 1 0 0 YGR140W 1 0 0 0 0 0 0 1...”
• A New Method for Identifying Essential Proteins Based on Network Topology Properties and Protein Complexes
  Qin, PloS one 2016
  • “...YHR004C 0.333 0.024 13528 Nonessential YJR112W 0.279 0.027 13528 Essential YCL031C 0.500 0.119 8765 Essential YCR059C 0.500 0.007 8765 Nonessential YDR160W 0.667 0.400 8764 Essential YNR019W 0.667 0.250 8764 Nonessential YAL025C 0.667 0.116 4383 Essential YAL042W 0.667 0.076 4383 Nonessential YDR380W 0.667 0.667 1 Nonessential YER009W...”
• H2A.Z marks antisense promoters and has positive effects on antisense transcript levels in budding yeast
  Gu, BMC genomics 2015
  • “...are shown, along with Htz1 occupancy over the same regions for the protein coding genes YCR059C, YBR128C, YJR096W, YBR019C and YBR020W . Antisense (AS) transcripts are coloured dark blue and sense (S) transcripts light blue. Htz1 ChIP peaks at the 3' ends of protein-coding transcripts are...”
• Identification of coherent patterns in gene expression data using an efficient biclustering algorithm and parallel coordinate visualization
  Cheng, BMC bioinformatics 2008
  • “...YBL016W, YBL024W, YBL054W, YBL093C, YBR034C, YBR066C, YBR090C, YBR112C, YBR160W, YBR173C, YCL011C, YCL031C, YCL054W, YCR036W, YCR051W, YCR059C, YCR060W, YCR090C, YDL002C, YDL006W, YDL047W, YDL051W, YDL070W, YDL076C, YDL153C, YDL166C, YDR006C, YDR091C, YDR098C, YDR143C, YDR155C, YDR162C, YDR165W, YDR260C, YDR296W, YDR305C, YDR361C, YDR365C, YDR390C, YDR432W, YDR465C, YDR477W, YEL007W, YER012W, YER042W, YER148W,...”
• Localizing proteins in the cell from their phylogenetic profiles
  Marcotte, Proceedings of the National Academy of Sciences of the United States of America 2000
  • “...gene in the yeast genome (9): YBL060W, YCR059C, YDL001W, YDL201W, YDR196C, YDR282C, YDR336W, YDR539W, YER057C, YFR006W, YFR048W, YGR021W, YIL051C, YIL145C,...”
• Separate domains in GCN1 for binding protein kinase GCN2 and ribosomes are required for GCN2 activation in amino acid-starved cells
  Sattlegger, The EMBO journal 2000
  • “...domain of a yeast protein encoded by the ORF YCR059c, dubbed YIH1 for yeast homolog of Impact, a mouse imprinted gene of unknown function. Mutations in GCN2...”
• Screening for imprinted genes by allelic message display: identification of a paternally expressed gene impact on mouse chromosome 18
  Hagiwara, Proceedings of the National Academy of Sciences of the United States of America 1997
  • “...yeast hypothetical protein encoded by a putative ORF, YCR059C, which was identified by the genomic sequencing of chromosome III (26). The predicted products of...”
  • “...other hypothetical proteins, including Saccharomyces cerevisiae YCR059C (Swiss-Prot no. P25637), S. cerevisiae YDL177C (Protein Identification Resource no....”

Cj0429c hypothetical protein Cj0429c from Campylobacter jejuni subsp. jejuni NCTC 11168
Aligns to 15:119 / 194 (54.1%), covers 100.0% of PF01205, 105.2 bits

• Survival of Campylobacter jejuni 11168H in Acanthamoebae castellanii Provides Mechanistic Insight into Host Pathogen Interactions
  Nasher, Microorganisms 2022
  • “...1.882962 1.65 10 23 Cj1107 clpS ATP-dependent Clp protease adapter protein 1.869786 1.03 10 6 Cj0429c Uncharacterized protein 1.863965 2.77 10 12 Cj1464 flgM Flagellar biosynthesis protein 1.844621 7.16 10 11 Cj0580c hemN Heme chaperone 1.842605 8.88 10 3 Cj0922c PEB1C Aspartate/glutamate/glutamine transport system ATP-binding protein...”
• Survival of Campylobacter jejuni in Acanthamoebae castellanii provides mechanistic insight into host pathogen interactions
  Nasher, 2022

SPAC27E2.02 IMPACT homolog from Schizosaccharomyces pombe
Aligns to 153:259 / 280 (38.2%), covers 100.0% of PF01205, 102.0 bits

• Checkpoint independence of most DNA replication origins in fission yeast
  Mickle, BMC molecular biology 2007
  • “...(signals stronger at four hours than two hours) at approximately 4.005 Mbp, close to probe SPAC27E2.02. Hayashi et al. [ 15 ] identified a pre-RC close to 4.010 Mb (dark blue dot), but did not detect significant BrdU incorporation at this position in the presence of...”
  • “...strong 3993040 3997640 SPAPB15E9.02c SPAPB15E9.03c AT1129 strong strong strong 1149 1 strong 4003300 4005680 SPAC27E2.01 SPAC27E2.02 medium 4007292 4010577 SPAC27E2.03c SPAC27E2.11c 1150 0 weak 4017870 4021600 SPAC27E2.06c pvg2 AT1130 strong strong strong Ori1130 31 1151 1 strong This table displays a small subset (only the information...”

T551_03102 uncharacterized protein from Pneumocystis jirovecii RU7
Aligns to 143:249 / 267 (40.1%), covers 100.0% of PF01205, 97.0 bits

• Diversity and Complexity of the Large Surface Protein Family in the Compacted Genomes of Multiple Pneumocystis Species
  Ma, mBio 2020
  • “...in all four species, except that P. jirovecii has an inversion (from genes T551_03089 to T551_03102) relative to the right side of the P. murina tandem cluster, as indicated by the dashed black line. Arrows indicate the orientations of genes, with the numbers above arrows representing...”

HP1485 conserved hypothetical protein from Helicobacter pylori 26695
Aligns to 15:118 / 190 (54.7%), covers 97.2% of PF01205, 95.5 bits

• Regulation of Helicobacter pylori Urease and Acetone Carboxylase Genes by Nitric Oxide and the CrdRS Two-Component System
  Allen, Microbiology spectrum 2023
  • “...ns 1.76 ** HP_RS02285 HP0462 Restriction endonuclease subunit S 2 crdR ns 2.38 * HP_RS07355 HP1485 YigZ family protein 2 crdR ns 1.25 * HP_RS00470 HP0092 DNA methylase N-4 2 crdR ns 2.05 *** HP_RS04725 HP0966 GTPase 2 crdR ns 1.77 ** HP_RS04110 HP0842 Hypothetical protein...”

HPYLSS1_01411 YigZ family protein from Helicobacter pylori SS1
Aligns to 15:118 / 190 (54.7%), covers 96.2% of PF01205, 95.2 bits

• Helicobacter pylori Biofilm Involves a Multigene Stress-Biased Response, Including a Structural Role for Flagella
  Hathroubi, mBio 2018
  • “...L33 2.02 fusA (HPYLSS1_01139) Elongation factor G 2.23 tufA (HPYLSS1_01152) Elongation factor Tu 2.14 yigZ (HPYLSS1_01411) Elongation factor 2.05 Amino acid biosynthesis trpB (HPYLSS1_01240) Tryptophan synthase chain 2.68 Fatty acid and phospholipid metabolism acpP_2 (HPYLSS1_00944) Acyl carrier protein 2.96 plsX (HPYLSS1_00190) Phosphate acyltransferase 2.71 scoB (HPYLSS1_00895)...”

YD177_YEAST / Q12257 IMPACT family member YDL177C from Saccharomyces cerevisiae (strain ATCC 204508 / S288c) (Baker's yeast) (see paper)
YDL177C Putative protein of unknown function; similar to the mouse IMPACT gene; YDL177C is not an essential gene from Saccharomyces cerevisiae
Aligns to 21:163 / 170 (84.1%), covers 99.1% of PF01205, 95.2 bits

• State of the art of fuzzy methods for gene regulatory networks inference
  Al, TheScientificWorldJournal 2015
  • “...YAR047C is downregulated by genes YIR0317C and YMR317W (1 on the arrow); upregulated by genes YDL177C and YMR318C (1 on the arrow). 7. Conclusion Fuzzy approach provides useful means for GRNs inference as reported in the diversified methods described in this paper. This is due to...”
• From complete genome sequence to 'complete' understanding?
  Galperin, Trends in biotechnology 2010
  • “...role in RNA processing Mitochondrial localization, role in spermiogenesis and oogenesis [ 47 ] yigZ YDL177c IMPACT PF01205 1739 1VI7 Imprinted gene in mouse, but not in human, a candidate gene for bipolar affective disorder. In fungi, fused with UDP-glucose 4-epimerase, suggesting that it could be...”
• Regulators of cellular levels of histone acetylation in Saccharomyces cerevisiae
  Peng, Genetics 2008
  • “...SEC28, SIC1, SPC72, THP1, TYR1, UBA4, VMA2b, VMA13b, VMA22b, VPS34, YDL177C, YPR099Cb 1 2 3 a The IF intensity was scored on a scale of 1-4, with 1 showing...”
• 'Conserved hypothetical' proteins: prioritization of targets for experimental study
  Galperin, Nucleic acids research 2004
  • “...essentialityc YOR289w AMMECR1 01871 2078 EMI5 YKR088c -- YDL177c YNL200c -- NIF3 YGR021w PRO0477 Human (153) (152) (151) (150) (149) (148) (122,123,147)...”
• Cluster analysis of mass spectrometry data reveals a novel component of SAGA
  Powell, Molecular and cellular biology 2004
  • “...YPR142Cbf YNL078Wa YAR066Wa YPL189Wd YJL169W YBR099Cc YPL163Cac YPR130C YDL177C YBL040Ca YOL135C Gene Fold change 7257 7258 POWELL ET AL. MOL. CELL. BIOL. TABLE...”
• Screening for imprinted genes by allelic message display: identification of a paternally expressed gene impact on mouse chromosome 18
  Hagiwara, Proceedings of the National Academy of Sciences of the United States of America 1997
  • “...cerevisiae YCR059C (Swiss-Prot no. P25637), S. cerevisiae YDL177C (Protein Identification Resource no. S61035), E. coli YIGZ (Swiss-Prot no. P27862), H....”

PNEG_03438 hypothetical protein from Pneumocystis murina B123
Aligns to 143:249 / 270 (39.6%), covers 100.0% of PF01205, 94.7 bits

• Diversity and Complexity of the Large Surface Protein Family in the Compacted Genomes of Multiple Pneumocystis Species
  Ma, mBio 2020
  • “...wakefieldiae (mixed with P. carinii reads) to assemble the P. wakefieldiae homologues of PNEG_03432 and PNEG_03438, which are flanking the 6-gene cluster in P. murina . Subsequently, we designed a primer set (3432.f1 and 3438.r1) ( TableS2 ) specific for these two genes in P. wakefieldiae...”

cgd2_2430 ximpact ortholog conserved protein seen in bacteria and eukaryotes from Cryptosporidium parvum Iowa II
Aligns to 145:265 / 290 (41.7%), covers 99.1% of PF01205, 93.1 bits

• Multi-locus analysis of human infective Cryptosporidium species and subtypes using ten novel genetic loci
  Bouzid, BMC microbiology 2010
  • “...other Cryptosporidium species. C. meleagridis DNA was amplified by PCR for 8/10 genes (80%), only, Cgd2_2430 and Chro.20156 PCR reactions were negative (Table 3 ). Table 1 List of Cryptosporidium genes selected for this study. Primer name Gene function (CryptoDB) Sequence Tm (C) Annealing temperature (C)...”
  • “...CT 60.4 57 271 bp cgd6_5020 R ACA TTG TGC CAT TCC AAG GT 58.35 cgd2_2430 F Ximpact ortholog conserved protein seen in bacteria and eukaryotes GTA ACG CAT GGC GAA CCT AT 60.4 57 389 bp cgd2_2430 R AAG ATC AGC CTT GCA GCA TT...”

MELLADRAFT_110829 uncharacterized protein from Melampsora larici-populina 98AG31
Aligns to 59:176 / 283 (41.7%), covers 99.1% of PF01205, 85.0 bits

• Multinuclei Occurred Under Cryopreservation and Enhanced the Pathogenicity of Melampsora larici-populina
  Zheng, Frontiers in microbiology 2021
  • “...55 MELLADRAFT_33683 Response to stimulus, GTPase CTCAGCAGGCGAGAAGGTCGTGACAAGCGTCTGGATT 104 55 MELLADRAFT_73904 adenylate cyclase GCAAGCAATGACACGGATGAGCAAGCAATGACACGGATGA 156 56 MELLADRAFT_110829 Cyclin-dependent kinase GGTATGGAGGCGTGTTATTAGGGGCTTGCTGAGGTTCTGAA 195 55 MELLADRAFT_112356 DNA damage stimulus GATGCGAAGCCTGTGAAGAAGCGGTATAGACGAGATGATGATTG 155 56 BGI_novel_G000377 DNA damage stimulus CTCGGTCTGATTGCGTTGTGACTGAGCCTCGTATGAATCTG 175 55 Alpha-tubulin ( aTUB ) Reference genes ATCTGTAACGAACCTCCTGCTACCTCCTCCATACCTTCTCCAA 168 55 Elongation factor-1-alpha...”
  • “...as the temperature lowered and time increased, the expression became higher. The expression levels of MELLADRAFT_110829 (Sak2) in both Two20 and One20 were significantly higher than those in CK20, and the expressions in Two80 and One80 were also significantly higher than that in CK80, indicating that...”

SPO0940 YigZ family protein from Ruegeria pomeroyi DSS-3
Aligns to 14:115 / 122 (83.6%), covers 99.1% of PF01205, 77.6 bits

• Experimental Identification of Small Non-Coding RNAs in the Model Marine Bacterium Ruegeria pomeroyi DSS-3
  Rivers, Frontiers in microbiology 2016
  • “...Lipid metabolism 0.001 SPO0568 2-oxoacid ferredoxin oxidoreductase Amino acid metabolism 0.001 SPO2180 Hypothetical protein 0.002 SPO0940 Hypothetical protein 0.005 SPO3617 Peptidoglycan-binding protein, putative Cell-cell interaction 0.005 SPO1609 Polyamine ABC transporter, ATP-binding Transport 0.008 SPO0831 Xanthine dehydrogenase family, medium subunit Nucleic acid metabolism 0.009 SPO0937 Hypothetical protein...”
• Transcriptional changes underlying elemental stoichiometry shifts in a marine heterotrophic bacterium
  Chan, Frontiers in microbiology 2012
  • “...I 8.4 1.3 SPO0911 proC Pyrroline-5-carboxylate reductase 3.2 3.2 SPO0939 M48 family peptidase 1.1 8.5 SPO0940 Hypothetical protein 3.4 SPO0970 apqZ Aquaporin Z 3.1 1.3 SPO0988 YeeE/YedE family protein 1.1 3.0 SPO0999 soxD Diheme cytochrome c 1.4 3.8 SPO1001 soxF Sulfur oxidation F protein 3.2 SPO1063...”

SPBC14C8.09c conserved fungal protein from Schizosaccharomyces pombe
Aligns to 37:138 / 144 (70.8%), covers 93.4% of PF01205, 66.3 bits

• Augmented annotation of the Schizosaccharomyces pombe genome reveals additional genes required for growth and viability
  Bitton, Genetics 2011
  • “...mug166 SPBC25H2.11c, spt7 SPAC29A4.03c, mrps9 SPBC14C8.09c SPBC14C8.09c SPCC4G3.12c, not2 SPCC4G3.12c, not2 SPCC4G3.12c, not2 SPCC1322.16, phb2 SPCC1442.04c...”

Or search for genetic data about PF01205 in the Fitness Browser