Family Search for PF01458 (UPF0051)
PF01458.17 hits 167 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.
RAYM_06507 Fe-S cluster assembly protein SufD from Riemerella anatipestifer RA-YM
Aligns to 171:396 / 427 (52.9%), covers 99.5% of PF01458, 256.3 bits
- The Role of the Regulator Fur in Gene Regulation and Virulence of Riemerella anatipestifer Assessed Using an Unmarked Gene Deletion System
Guo, Frontiers in cellular and infection microbiology 2017 - “...the HesB_IscA_SufA family 1.53 2.58 1.04 RAYM_06467 Cysteine desulfurase activator complex subunit SufB 1.87 1.85 RAYM_06507 FeS assembly protein SufD 1.56 1.78 RAYM_03082 Protein-(glutamine-N5) methyltransferase, release factor-specific 1.27 1.99 RAYM_03087 tRNA methyltransferase 1.42 1.63 PURINES, PYRIMIDINES, NUCLEOSIDES, AND NUCLEOTIDES RAYM_03724 Orotate phosphoribosyltransferase 2.10 3.30 RAYM_06492 5-hydroxyisourate...”
- “...a nitrogen-fixing NifU domain protein ( RAYM_01100 ), SUF system protein ( RAYM_01495, RAYM_06457, RAYM_06467, RAYM_06507 ). Similar changes of NIF and SUF systems have been confirmed in E. coli in previous studies (Outten et al., 2004 ). Moreover, the genes Phosphoserine aminotransferase ( RAYM_04219 ),...”
A0QWZ9 FeS assembly protein SufB from Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Aligns to 222:448 / 477 (47.6%), covers 99.5% of PF01458, 255.6 bits
SPD_0766 FeS assembly protein SufB (NCBI) from Streptococcus pneumoniae D39
Aligns to 215:441 / 470 (48.3%), covers 99.5% of PF01458, 254.5 bits
Dgeo_0473 FeS assembly protein SufB (NCBI) from Deinococcus geothermalis DSM 11300
Aligns to 212:438 / 467 (48.6%), covers 99.5% of PF01458, 253.9 bits
T303_02095 Fe-S cluster assembly protein SufB from Streptococcus thermophilus ASCC 1275
Aligns to 217:443 / 472 (48.1%), covers 99.5% of PF01458, 253.1 bits
- Functional Genomic Analyses of Exopolysaccharide-Producing Streptococcus thermophilus ASCC 1275 in Response to Milk Fermentation Conditions
Wu, Frontiers in microbiology 2019 - “...0.56 Trigger factor T303_01640 0.47 ATP-dependent Clp protease ATP-binding protein T303_02240 3.24 Molecular chaperone GroES T303_02095 2.38 FeS cluster assembly protein SufB T303_08905 1.49 ATP-dependent Clp protease ATP-binding protein Translation, ribosomal structure and biogenesis T303_07405 0.69 Phenylalanyl-tRNA synthase subunit alpha T303_01735 0.65 30S ribosomal protein S9...”
- “...respiration process in ST1275 as evidenced by up-regulation of FeS cluster assembly proteins T303_02075 and T303_02095. There are several differentially expressed proteins involved in the other processes including translation and posttranslational modifications, but we did not have a unified conclusion on these processes because both up-...”
DR2106 conserved hypothetical protein (NCBI ptt file) from Deinococcus radiodurans R1
Aligns to 213:439 / 468 (48.5%), covers 99.5% of PF01458, 252.7 bits
SCO1925 hypothetical protein (NCBI) from Streptomyces coelicolor A3(2)
Q9XAD1 Uncharacterized protein from Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Aligns to 218:444 / 473 (48.0%), covers 99.5% of PF01458, 252.6 bits
Teth39_0117 FeS assembly protein SufB (RefSeq) from Thermoanaerobacter ethanolicus ATCC 33223
Aligns to 212:438 / 467 (48.6%), covers 99.5% of PF01458, 251.8 bits
SERP0500 FeS assembly protein SufB (NCBI) from Staphylococcus epidermidis RP62A
SERP_RS02575 Fe-S cluster assembly protein SufB from Staphylococcus epidermidis RP62A
Aligns to 210:436 / 465 (48.8%), covers 99.5% of PF01458, 251.6 bits
SAR0880 conserved hypothetical protein (NCBI) from Staphylococcus aureus subsp. aureus MRSA252
Aligns to 210:436 / 465 (48.8%), covers 99.5% of PF01458, 250.7 bits
SACOL0918 FeS assembly protein SufB (NCBI) from Staphylococcus aureus subsp. aureus COL
SA0778 hypothetical protein (NCBI) from Staphylococcus aureus subsp. aureus N315
SAUSA300_0822 FeS assembly protein SufB (NCBI) from Staphylococcus aureus subsp. aureus USA300_FPR3757
MW0799 conserved hypothetical protein (NCBI ptt file) from Staphylococcus aureus subsp. aureus MW2
NWMN_0789 FeS assembly protein SufB (RefSeq) from Staphylococcus aureus subsp. aureus str. Newman
USA300HOU_0875 ABC superfamily ATP binding cassette transporter, membrane protein (RefSeq) from Staphylococcus aureus subsp. aureus USA300_TCH1516
Aligns to 210:436 / 465 (48.8%), covers 99.5% of PF01458, 250.3 bits
- Transcriptomic Adjustments of Staphylococcus aureus COL (MRSA) Forming Biofilms Under Acidic and Alkaline Conditions
Efthimiou, Frontiers in microbiology 2019 - “...SACOL2430 502776-1 Predicted CDS, ABC transporter with ABC transporter transmembrane region family 3.24 0.0075 sufB SACOL0918 ref | NP_3498S3.1 Iron-regulated ABC-type transporter membrane component (SufB) 3.22 0.0001 The genes have been ranked according to their log 2 fold change (pH9/pH7) value in each functional category. TABLE...”
- Aureolib - a proteome signature library: towards an understanding of staphylococcus aureus pathophysiology
Fuchs, PloS one 2013 - “...of the SACOL0917 encoding operon ( SACOL0914 , SACOL0915 , SACOL0916 , SACOL0917 , and SACOL0918 ) ( http://www.aureolib.de/?m10 ), demonstrating the power of this integrative approach. In B. subtilis , a homologous system is involved in FeS center assembly [58] . Inspection of the regulatory...”
- Genetic changes that correlate with the pine-oil disinfectant-reduced susceptibility mechanism of Staphylococcus aureus
Lamichhane-Khadka, Journal of applied microbiology 2008 - “...1.97 SACOL2148 PTS system, mannitol-specific IIA component 1.92 SACOL2147 transcriptional antiterminator, bglG family 1.88 sufB SACOL0918 FeS assembly protein, SufB 1.83 pgm SACOL0841 phosphoglycerate mutase 1.71 clpL SACOL2563 ATP-dependent Clp protease 1.69 clfA SACOL0856 clumping factor A 1.64 nifU SACOL0917 NifU domain protein 1.61 fabG SACOL2482...”
- Characterization of RNA Helicase CshA and Its Role in Protecting mRNAs and Small RNAs of Staphylococcus aureus Strain Newman
Kim, Infection and immunity 2016 - “...sa1142 65,443 64,361 22.6 23.0 sa1751 65,443 10.7 sa0778 sa1118 (rnjB) sa1097 52,458 62,473 52,556 9.3 4.8 5.4 Putative function(s) Glycosyl transferase group 2...”
- The C-terminal region of the RNA helicase CshA is required for the interaction with the degradosome and turnover of bulk RNA in the opportunistic pathogen Staphylococcus aureus
Giraud, RNA biology 2015 - “...secretory antigen ssaA2 29kDa 4 (3) femX Lipid II:glycine glycyltransferase 49kDa 8 (9) 8 (7) SA0778 UPF0051 protein 53kDa 2 SA1727 UPF0316 protein 23kDa 2 SA1560 UPF0478 protein 19kDa 2 (2) Intriguingly we were so far unable to demonstrate an in vitro interaction of individually prepared...”
- An RpoB mutation confers dual heteroresistance to daptomycin and vancomycin in Staphylococcus aureus
Cui, Antimicrobial agents and chemotherapy 2010 - “...Nitrogen metabolism SA0008 SA0171 SA0774 SA0775 SA0776 SA0777 SA0778 SA0779 SA0819 SA1241 SA1310 Gene hutH fdh sufB gudB Phylloquinone (vitamin K1) and...”
- Characterizing the effects of inorganic acid and alkaline shock on the Staphylococcus aureus transcriptome and messenger RNA turnover
Anderson, FEMS immunology and medical microbiology 2010 - “...domain protein sa_c7959s6944_a_at 2.1 2.5 2.5 SA0694 teichoic acids export protein sa_c8942s7857_a_at 2.4 2.5 2.5 SA0778 sulfatase family protein sa_c8964s7875_a_at 4.5 2.5 2.5 SA0810 glycosyl transferase sa_c8344s7317_a_at 4.8 2.5 5 SA0820 LysM domain protein sa_c524s9582cv_s_at 14.4 2.5 ND SA1043 glycosyl transferase, group 1 family protein sa_c2175s1875_a_at...”
- Pan-genomic perspective on the evolution of the Staphylococcus aureus USA300 epidemic
Jamrozy, Microbial genomics 2016 - “...downstream of the iron-sulphur cluster assembly protein gene sufB (between coding sequences corresponding to USA300_FPR3757 SAUSA300_0822 and SAUSA300_0823), and the heme transport protein gene isdB (between coding sequences corresponding to USA300_FPR3757 SAUSA300_1027 and SAUSA300_1028), respectively. In contrast, prophage Sa5 were found inserted within a coding sequence...”
- Nfu facilitates the maturation of iron-sulfur proteins and participates in virulence in Staphylococcus aureus
Mashruwala, Molecular microbiology 2015 - “..., Selbach et al. , 2014 )), and the SufBCD Fe-S cluster biosynthetic scaffold machinery (SAUSA300_0822, 0818, 0819, respectively ( Takahashi & Tokumoto, 2002 )). We were unable to identify operons in S. aureus genomes with similarity to operons encoding for the E. coli Isc or...”
- “...( sufA ) chromosomal deletion pJB38_ sufU SAUSA300_0821 ( sufU ) chromosomal deletion pJB38_ sufB SAUSA300_0822 ( sufB ) chromosomal deletion pJB38_ dps SAUSA300_2092 ( dps ) chromosomal deletion pJB38_ nfu::tetM Allelic replacement pJB38_ nfu::kanR Allelic replacement pJB39_ sufA::tetM Allelic replacement pJB38_ sufU::tetM Allelic replacement pJB38_...”
- A secreted bacterial protease tailors the Staphylococcus aureus virulence repertoire to modulate bone remodeling during osteomyelitis
Cassat, Cell host & microbe 2013 - “...0.0000 6.3333 6.3333 0.0381 Putative uncharacterized protein; SAUSA300_1336 Q2FIF6|Y822_STAA3 1.0000 6.0000 6.0000 0.0307 UPF0051 protein; SAUSA300_0822 Q2FJ32|Q2FJ32_STAA3 0.0000 5.6667 5.6667 0.0131 Putative uncharacterized protein; SAUSA300_0593 Q2FIM8|Y748_STAA3 0.0000 5.6667 5.6667 0.0279 UPF0042 nucleotide-binding protein; SAUSA300_0748 Q2FFY6|Q2FFY6_STAA3 0.0000 5.3333 5.3333 0.0049 Putative uncharacterized protein; SAUSA300_1698 Q2FEY5|Q2FEY5_STAA3 0.0000 5.3333...”
- Global analysis of community-associated methicillin-resistant Staphylococcus aureus exoproteins reveals molecules produced in vitro and during infection
Burlak, Cellular microbiology 2007 - “...51 6,7-Dimethyl-8-ribityllumazine synthase (RibH) B1,D1 49242141 16412 5.7 7 73 342 ABC transporter-associated protein, SufB (MW0799) D1 49483078 52512 5.1 7 18 139 Amylase (MalA) D1 18145251 77435 5.9 1 1 54 Aldo/keto reductase family protein (MW2127) D1 49482959 32339 5.2 4 12 114 Arsenate reductase...”
- Thioredoxin Profiling of Multiple Thioredoxin-Like Proteins in Staphylococcus aureus
Peng, Frontiers in microbiology 2018 - “...Buried 2XEX Sau NWMN_0510 tuf Elongation factor Tu 82 Y 1 Y Solvated 1EFC Eco NWMN_0789 sufB Fe-S assembly protein SufB 302 Y 3 Y/N Buried 5AWF Eco a Those entries in bold were observed in multiple Trx profiling experiments carried out with different FLAG-tagged Trx....”
- Characterization of RNA Helicase CshA and Its Role in Protecting mRNAs and Small RNAs of Staphylococcus aureus Strain Newman
Kim, Infection and immunity 2016 - “...from mass spectrometry analysis (Table 2), genes encoding NWMN_0789, NWMN_1184, and NWMN_1985 from S. aureus strain Newman were cloned into pET15b or pET22b and...”
- Protein S-Bacillithiolation Functions in Thiol Protection and Redox Regulation of the Glyceraldehyde-3-Phosphate Dehydrogenase Gap in Staphylococcus aureus Under Hypochlorite Stress
Imber, Antioxidants & redox signaling 2018 - “...Ironsulfur (Fe-S) cluster formation protein IscU Cys41 a B 11.1 26.30 17.85 0.09 44.15 0.15 USA300HOU_0875 sufB Ironsulfur (Fe-S) cluster formation protein SufB Cys302 B 3.7 6.48 13.74 0.19 20.22 0.08 USA300HOU_2257 moaB Molybdopterin cofactor biosynthesis protein MoaB Cys34 B 20.8 13.81 9.42 0.06 23.23 0.13...”
llmg_1969 hypothetical protein (NCBI) from Lactococcus lactis subsp. cremoris MG1363
LLKF_1961 cysteine desulfurase activator complex subunit SufB (RefSeq) from Lactococcus lactis subsp. lactis KF147
Aligns to 215:441 / 470 (48.3%), covers 99.5% of PF01458, 250.2 bits
- Interaction between the genomes of Lactococcus lactis and phages of the P335 species
Kelly, Frontiers in microbiology 2013 - “...(4) Between llmg_1514 ( rex ) and llmg_1515 ( rad C). (5) Between llmg_1968 and llmg_1969 ( suf B). This site is not present in subsp. lactis strains. (6) Between llmg_2081 ( sun L) and llmg_2143. Location of phage MG-3. (7) Between llmg_2406 ( com GC)...”
- Strain-Dependent Transcriptome Signatures for Robustness in Lactococcus lactis
Dijkstra, PloS one 2016 - “...choS glycine betaine ABC transporter permease/substrate-binding protein positive 2.7 LLKF_0999 yjjH calcineurin-like phosphoesterase positive 1.0 LLKF_1961 sufB cysteine desulfurase activator complex subunit SufB positive 13.9 LLKF_0443 noxE NADH oxidase positive 29.5 LLKF_0020 tilS tRNA(Ile)-lysidine synthetase positive 2.3 LLKF_0802 cysK cysteine synthase positive 2.2 LLKF_0898 pnuC nicotinamide...”
YPTB2311 hypothetical protein (NCBI) from Yersinia pseudotuberculosis IP 32953
Aligns to 186:411 / 441 (51.2%), covers 99.1% of PF01458, 249.7 bits
EF2390 conserved hypothetical protein (NCBI ptt file) from Enterococcus faecalis V583
Aligns to 209:435 / 464 (48.9%), covers 99.5% of PF01458, 249.6 bits
- Genes Contributing to the Unique Biology and Intrinsic Antibiotic Resistance of Enterococcus faecalis
Gilmore, mBio 2020 (no snippet) - Oxidative stress enhances the expression of sulfur assimilation genes: preliminary insights on the Enterococcus faecalis iron-sulfur cluster machinery regulation
Riboldi, Memorias do Instituto Oswaldo Cruz 2014 - “...sequences for primer design for sufC (GenBank EF2394), sufD (EF2393), sufS (EF2392), sufU (EF2391), sufB (EF2390), kat (EF1597), fur (EF1525), oxyR (EF2958), 23S rRNA (EF23SD), elongation factor for transporter RNA ( tuf ) (EF0201), RNA polymerase beta chain ( rpoB ) (EF3238) and gyrase beta chain...”
- Structural studies of the Enterococcus faecalis SufU [Fe-S] cluster protein
Riboldi, BMC biochemistry 2009 - “...ORFs possibly related to [Fe-S] cluster biosynthetic machinery found in E. faecalis are denoted as: EF2390, harbouring 37% identity with SufB from E. coli ; EF2391, encoding the putative scaffold NifU-like protein, homologous to IscU, the N-terminal module of NifU, which will be referred to in...”
Dgeo_0472 FeS assembly protein SufD (NCBI) from Deinococcus geothermalis DSM 11300
Aligns to 197:422 / 450 (50.2%), covers 99.1% of PF01458, 249.3 bits
BSU32670 FeS cluster formation protein (RefSeq) from Bacillus subtilis subsp. subtilis str. 168
Aligns to 210:436 / 465 (48.8%), covers 99.5% of PF01458, 249.3 bits
- The Blueprint of a Minimal Cell: MiniBacillus
Reuß, Microbiology and molecular biology reviews : MMBR 2016 - “...sufD sufS sufC fra yutI BSU02870 No BSU03950 No BSU32670 BSU32680 BSU32700 BSU32690 BSU32710 BSU05750 BSU32220 Yes Yes Yes Yes Yes No No BSU28390 Yes Metals and...”
YPO2401 cysteine desulfurase activator complex subunit SufD (RefSeq) from Yersinia pestis CO92
y1937 hypothetical protein (NCBI ptt file) from Yersinia pestis KIM
Aligns to 186:411 / 441 (51.2%), covers 99.1% of PF01458, 249.1 bits
Cbei_1849 FeS assembly protein SufB (RefSeq) from Clostridium beijerincki NCIMB 8052
Aligns to 214:440 / 469 (48.4%), covers 99.5% of PF01458, 248.2 bits
- Transcriptional analysis of Clostridium beijerinckii NCIMB 8052 to elucidate role of furfural stress during acetone butanol ethanol fermentation
Zhang, Biotechnology for biofuels 2013 - “...treatment is the iron-sulfur cluster. The expression of genes encoding iron-sulfur cluster assembly proteins (Cbei_1848, Cbei_1849, Cbei_1850, Cbei_1851 and Cbei_1852) increased by up to fivefold (Figure 1 A and Additional file 1 : Table S4A); these genes are classified into the cofactor biosynthetic process (GO:0051188) (Additional...”
- “...solventogenesis (Figure 1 A and Additional file 1 : Table S4C), and those genes (Cbei_1848, Cbei_1849, Cbei_1850, Cbei_1851 and Cbei_1852) were up-regulated in furfural-challenged cultures by up to 54-fold compared to no more than fivefold during acidogenesis (Figure 1 A and Additional file 1 : Table...”
UC7_RS13855 Fe-S cluster assembly protein SufB from Enterococcus caccae ATCC BAA-1240
Aligns to 209:435 / 464 (48.9%), covers 99.5% of PF01458, 247.8 bits
- Apigenin Impacts the Growth of the Gut Microbiota and Alters the Gene Expression of Enterococcus
Wang, Molecules (Basel, Switzerland) 2017 - “...cluster assembly scaffold protein 1.6 Iron-sulfur cluster formation UC7_RS14795 deoxycytidine triphosphate deaminase 1.6 Nucleotide metabolism UC7_RS13855 FeS assembly protein SufB 1.6 Iron-sulfur cluster formation UC7_RS13455 hypothetical protein 1.6 Unknown UC7_RS11040 hypothetical protein 1.6 Unknown UC7_RS12130 hypothetical protein 1.6 Unknown UC7_RS13465 hypothetical protein 1.5 Unknown UC7_RS12125 hypothetical...”
Q97E27 Iron-regulated ABC-type transporter membrane component (SufB) from Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / LMG 5710 / VKM B-1787)
CAC3289 Iron-regulated ABC-type transporter membrane component (SufB) (NCBI ptt file) from Clostridium acetobutylicum ATCC 824
Aligns to 213:439 / 466 (48.7%), covers 99.5% of PF01458, 247.4 bits
PPA1549 conserved protein, UPF0051 (NCBI) from Propionibacterium acnes KPA171202
Aligns to 227:453 / 482 (47.1%), covers 99.5% of PF01458, 247.3 bits
- Comparative genomics and transcriptomics of Propionibacterium acnes
Brzuszkiewicz, PloS one 2011 - “...to eliminate NO produced by the host immune system; PPA1548-1550, encoding proteins similar to SufB (PPA1549) and SufD (PPA1548), which are part of the iron-sulfur cluster scaffold complex SufBCD, which functions under iron starvation and oxidative stress conditions [41] . Growth phase-dependent expression of putative virulence...”
Hlac_0175 FeS assembly protein SufB (RefSeq) from Halorubrum lacusprofundi ATCC 49239
Aligns to 221:447 / 476 (47.7%), covers 99.5% of PF01458, 246.0 bits
- Morphological and proteomic analysis of biofilms from the Antarctic archaeon, Halorubrum lacusprofundi
Liao, Scientific reports 2016 - “...the cysteine biosynthesis protein CysK (Hlac_1763), proteins involved in the assembly of iron-sulfur (FeS) clusters (Hlac_0175, Hlac_0176), chromosomal protein MC1 (Hlac_0021), and a predicted DNA helicase (Hlac_3022), and the lower abundance of catalase/peroxidase (HPI; Hlac_1548). Proteins that decreased in biofilms were mainly involved in protein synthesis...”
- “...Hlac_1619 NAD (P)-binding oxidoreductase domain 1.5 1.5 Hlac_1837 alcohol dehydrogenase, zinc-dependent 2.3 2.5 Oxidative stress Hlac_0175 FeS assembly protein SufB 1.3 ns 1.6 ns Hlac_0176 FeS assembly ATPase SufC 1.3 ns 1.5 ns Hlac_1548 catalase/peroxidase (HPI) 0.61 ns 0.50 0.50 Hlac_1677 alkyl hydroperoxide reductase (Ahp)/peroxiredoxin 1.5...”
cg1764 component of an uncharacterized iron-regulated ABC-type transporter (RefSeq) from Corynebacterium glutamicum ATCC 13032
NCgl1503 Fe-S cluster assembly protein SufB from Corynebacterium glutamicum ATCC 13032
Aligns to 226:452 / 481 (47.2%), covers 99.5% of PF01458, 245.8 bits
- Understanding the high L-valine production in Corynebacterium glutamicum VWB-1 using transcriptomics and proteomics
Zhang, Scientific reports 2018 - “...1443.52 0.00 1.8 60 NCgl2682 cg3079 clpB ATP-dependent protease 5.00/93231.58 1852.55 0.00 NC 65 NCgl1503 cg1764 sufB Component iron-regulated ABC-type transporter 4.85/53492.94 5255.30 1074.54 NC None module 3 NCgl1529 cg1794 Uncharacterised P-loop ATPase protein 6.01/34710.37 877.68 329.25 2.4 9 NCgl0335 cg0412 Membrane protein 4.98/40789.73 0.00 2259.05...”
- Exploring the role of sigma factor gene expression on production by Corynebacterium glutamicum: sigma factor H and FMN as example
Taniguchi, Frontiers in microbiology 2015 - “...cg1709 mshC Putative 1- D -myo-inosityl-2-amino-2-deoxy-alpha- D -glucopyranoside- L -cysteine ligase 2.9 1.9 1.2E-4 1.5E-3 cg1764 sufB FeS assembly membrane protein, SufB-family 1.2 1.0 1.8E-3 9.1E-3 cg1776 tal Transaldolase 1.0 1.7 1.6E-2 1.2E-3 cg1778 zwf Glucose-6-phosphate 1-dehydrogenase 1.2 2.0 4.1E-3 4.6E-3 cg1779 opcA Glucose-6-phosphate 1-dehydrogenase subunit...”
- Functional genomics of pH homeostasis in Corynebacterium glutamicum revealed novel links between pH response, oxidative stress, iron homeostasis and methionine synthesis
Follmann, BMC genomics 2009 - “...0 0.81 1.51 3.7 3.4 4.6 3.4 4.4 4.1 0.1 2.9 2.1 SufR, SigM 25 cg1764 x sufB Suf related ABC-type transporter SufB, permease component 0 0.93 1.81 2.8 3.4 5.0 3.4 3.4 3.8 0.1 0.4 1.6 SufR, SigM 26 cg1765 x sufR transcriptional regulator SufR...”
- Acetohydroxyacid synthase, a novel target for improvement of L-lysine production by Corynebacterium glutamicum
Blombach, Applied and environmental microbiology 2009 - “...0.39 0.29 0.37 0.46 0.35 sufC sufD cg1764 0.35 sufB cg2445 cg3404 0.45 0.25 DtxR/iron-regulated lipoprotein ABC-type cobalamin/Fe3-siderophore transport system...”
- The extracytoplasmic function-type sigma factor SigM of Corynebacterium glutamicum ATCC 13032 is involved in transcription of disulfide stress-related genes
Nakunst, Journal of bacteriology 2007 - “...of California, Berkeley Disulfide stress-related genes cg1765 cg1764 cg1763 cg1762 cg1761 cg1760 cg1759 cg3299 cg3422 cg3423 cg3424 m valuea Gene VOL....”
- Global gene expression during stringent response in Corynebacterium glutamicum in presence and absence of the rel gene encoding (p)ppGpp synthase
Brockmann-Gretza, BMC genomics 2006 - “...cysteine desulfhydrase E cg1763 1.72 6.59 sufD components of an uncharacterized iron-regulated ABC-type transporter O cg1764 1.79 2.43 sufB component of an uncharacterized iron-regulated ABC-type transporter O cg2409 2.31 1.61 ctaC cytochrome C oxidase chain II C cg2644 1.83 2.93 clpP2 ATP-dependent Clp protease, proteolytic subunit...”
- Understanding the high L-valine production in Corynebacterium glutamicum VWB-1 using transcriptomics and proteomics
Zhang, Scientific reports 2018 - “...5.16/42280.10 1443.52 0.00 1.8 60 NCgl2682 cg3079 clpB ATP-dependent protease 5.00/93231.58 1852.55 0.00 NC 65 NCgl1503 cg1764 sufB Component iron-regulated ABC-type transporter 4.85/53492.94 5255.30 1074.54 NC None module 3 NCgl1529 cg1794 Uncharacterised P-loop ATPase protein 6.01/34710.37 877.68 329.25 2.4 9 NCgl0335 cg0412 Membrane protein 4.98/40789.73 0.00...”
- The DtxR regulon of Corynebacterium glutamicum
Wennerhold, Journal of bacteriology 2006 - “...NCgl0773 NCgl0774 NCgl0776 NCgl0779 NCgl1200 NCgl1209 NCgl1502 NCgl1503 NCgl1959 NCgl2146 NCgl2439 NCgl2897 NCgl2969 NCgl2970 VOL. 188, 2006 THE DtxR REGULON OF...”
- Global expression profiling and physiological characterization of Corynebacterium glutamicum grown in the presence of L-valine
Lange, Applied and environmental microbiology 2003 - “...2453b NCgl1918 NCgl2086 (2274263-2274442) NCgl1482 NCgl1502 2455b NCgl1503 b 2456 NCgl1504 2736 2790b 2791b 2792b 2793b NCgl1263 NCgl1224 (1340543-1340725)...”
Rv1461 hypothetical protein (NCBI) from Mycobacterium tuberculosis H37Rv
Aligns to 596:817 / 846 (26.2%), covers 89.9% of PF01458, 244.8 bits
- Discovery of a Natural Product That Binds to the Mycobacterium tuberculosis Protein Rv1466 Using Native Mass Spectrometry
Elnaas, Molecules (Basel, Switzerland) 2020 - “...(FeS) cluster (2.1 M) [ 40 ]. A high-density mutagenesis study confirmed that six genes, Rv1461 to Rv1466, were required for in vitro mycobacterial growth [ 41 ]. It was reported that the SUF system plays an essential function for Mtb survival due to its role...”
- “...bacterial resistance to iron limitation and oxidative stress [ 42 ]. Interruptions of individual proteins (Rv1461, Rv1462 or Rv1463) led to impeding mycobacterial growth [ 38 ], suggesting the high possibility that inhibiting a component of the multiprotein SUF complex would affect the whole SUF system,...”
- Targeting redox heterogeneity to counteract drug tolerance in replicating Mycobacterium tuberculosis
Mishra, Science translational medicine 2019 (secret) - Correction: Rv1460, a SufR homologue, is a repressor of the suf operon in Mycobacterium tuberculosis
PLOS, PloS one 2018 - “...upstream of Rv1460 , while a 5-UTR containing a ribosome binding site regulates translation of Rv1461 . The intein within Rv1461 must be resolved before it is functional and may represent an additional level of regulation of the system. Rv1460 is predicted to bind within the...”
- Rv1460, a SufR homologue, is a repressor of the suf operon in Mycobacterium tuberculosis
Willemse, PloS one 2018 - “...Rv1460 protein are impaired for growth under standard culture conditions. Elevated expression of Rv1460 and Rv1461 was observed in the mutant, implicating Rv1460 in the regulation of the suf operon. Binding of an Fe-S cluster to purified recombinant Rv1460 was confirmed by UV-visible spectroscopy and circular...”
- “...de novo Fe-S cluster assembly [ 23 26 ] and in M . tuberculosis , Rv1461 , Rv1462 and Rv1463 encode the SufB, SufC and SufD homologues respectively [ 16 ]. A role for SufD in iron acquisition [ 27 ] and SufC in providing energy...”
- Iron homeostasis in Mycobacterium tuberculosis is essential for persistence
Pandey, Scientific reports 2018 - “...single-crossover strain used in M. smegmatis study had an insertion at the 5 end of rv1461 gene with both sufR gene and the downstream ISC operon completely intact. The data observed may have been independent of SufR protein and could be due to the polar effect...”
- Precision methylome characterization of Mycobacterium tuberculosis complex (MTBC) using PacBio single-molecule real-time (SMRT) technology
Zhu, Nucleic acids research 2016 - “...bound polyketide synthase NA NA +/+ -/- -/- -/- -/- -/+ NA NA -/- NA Rv1461 Essential Fe-S cluster assembly protein SufB NA NA -/- -/- -/+ -/- +/+ -/+ NA NA -/- NA Rv2130c Essential D-glucopyranoside ligase NA NA -/- -/- +/+ -/- +/+ +/+...”
- “...No-data malto-oligosyltrehalose trehalohydrolase -/- -/- +/+ -/+ +/+ -/- NA NA -/+ -/- -/- -/- Rv1461 Essential Fe-S cluster assembly protein SufB -/- -/- +/+ -/+ +/+ -/- NA NA -/- -/- +/+ -/- Rv2501c No-data acetyl-/propionyl-CoA carboxylase subunit alpha +/+ +/+ -/+ -/+ +/+ -/+...”
- Conserved hypothetical protein Rv1977 in Mycobacterium tuberculosis strains contains sequence polymorphisms and might be involved in ongoing immune evasion
Jiang, International journal of clinical and experimental pathology 2015 (secret) - Mycobacterium tuberculosis Lsr2 is a global transcriptional regulator required for adaptation to changing oxygen levels and virulence
Bartek, mBio 2014 - “...in the absence of exogenous H 2 O 2 , such as the operon comprising Rv1461 to Rv1466 ( Rv1461-Rv1466 ), involved in iron-sulfur cluster repair, sigB (an alternate stress sigma factor), Rv2729 , and Rv3018 ( 12 ). Some of these genes, such as Rv1460...”
- More
Francci3_1660 FeS assembly protein SufB (NCBI) from Frankia sp. CcI3
Aligns to 215:441 / 470 (48.3%), covers 99.5% of PF01458, 244.6 bits
FRAAL4563 Transport protein associated with Fe-S cluster assembly (NCBI) from Frankia alni ACN14a
Aligns to 215:441 / 470 (48.3%), covers 99.5% of PF01458, 244.4 bits
- The PEG-responding desiccome of the alder microsymbiont Frankia alni
Ghedira, Scientific reports 2018 - “...Shc2 2.17 FRAAL6797 Ferredoxin 2.00 FRAAL6799 2-oxoglutarate ferredoxinoxidoreductase beta-subunit KorA 1.74 FRAAL1432 Squalene-hopenecyclase Shc1 1.62 FRAAL4563 Transport protein associated with Fe-S cluster assembly SufB 1.60 Respiration and energy production and conversion FRAAL4147 Cytochrome c oxidase polypeptide I (AA3 subunit 1) CtaD 3.70 FRAAL5625 Poly(3-hydroxybutyrate) depolymerasePha 2.83...”
TM1369 conserved hypothetical protein (NCBI ptt file) from Thermotoga maritima MSB8
Aligns to 209:435 / 464 (48.9%), covers 99.5% of PF01458, 244.0 bits
TTE2672 predicted membrane components of an uncharacterized iron-regulated ABC-type transporter SufB (NCBI ptt file) from Thermoanaerobacter tengcongensis MB4
Aligns to 212:438 / 467 (48.6%), covers 99.5% of PF01458, 243.9 bits
- The temperature dependent proteomic analysis of Thermotoga maritima
Wang, PloS one 2012 - “...(TTE1551), histidinol phosphatase (TTE1963), signal recognition GTPase (TTE1462), HSP10 (TTE0579), HSP60 (TTE0580), ABC-type transporter SufB (TTE2672) and a hypothetical protein (TTE0418) [13] . However, only one protein, HSP60, was shared with the up-regulated proteins of T. maritima . We also compared the three typically temperature-dependent proteins...”
HVO_0860 FeS assembly protein SufB (RefSeq) from Haloferax volcanii DS2
Aligns to 221:447 / 476 (47.7%), covers 99.5% of PF01458, 243.6 bits
Alvin_0741 FeS assembly protein SufD (RefSeq) from Allochromatium vinosum DSM 180
Aligns to 182:407 / 433 (52.2%), covers 99.1% of PF01458, 243.1 bits
KCA1_1250 Fe-S cluster assembly protein SufB from Lactobacillus pentosus KCA1
Aligns to 213:439 / 468 (48.5%), covers 99.5% of PF01458, 242.9 bits
lp_1472 ABC transporter component, iron regulated (putative) (NCBI ptt file) from Lactobacillus plantarum WCFS1
Aligns to 213:439 / 468 (48.5%), covers 99.5% of PF01458, 242.8 bits
AM1_1222 FeS assembly protein SufD (RefSeq) from Acaryochloris marina MBIC11017
Aligns to 183:408 / 434 (52.1%), covers 98.6% of PF01458, 241.9 bits
- The Complex Transcriptional Response of Acaryochloris marina to Different Oxygen Levels
Hernández-Prieto, G3 (Bethesda, Md.) 2017 - “...B12 (cobalamin) synthetic pathway, was significantly reduced under microoxic conditions. Another group of genes ( AM1_1222 , AM1_1223 , and AM1_1224 ) in which expression was reduced under microoxic conditions, was the operon (SufBCD) coding for the proteins involved in the assembly of iron-sulfur clusters (...”
- “...4241 38,036 2.33 0.83 AM1_3366 High light inducible protein, HLIP 2 16 2 2.50 0.00 AM1_1222 FeS assembly protein, SufD 123 17 273 2.78 1.14 AM1_1223 FeS assembly ATPase, SufC 416 80 2067 2.36 2.31 AM1_1224 FeS assembly protein, SufB 177 30 745 2.52 2.07 AM1_5239...”
DIP1295 Conserved hypothetical protein (NCBI) from Corynebacterium diphtheriae NCTC 13129
Aligns to 204:430 / 459 (49.5%), covers 99.5% of PF01458, 241.0 bits
LMOf2365_2382 FeS assembly protein SufB (NCBI) from Listeria monocytogenes str. 4b F2365
lmo2411 similar to conserved hypothetical proteins (NCBI ptt file) from Listeria monocytogenes EGD-e
Aligns to 209:435 / 464 (48.9%), covers 99.5% of PF01458, 240.8 bits
- The Arsenic Resistance-Associated Listeria Genomic Island LGI2 Exhibits Sequence and Integration Site Diversity and a Propensity for Three Listeria monocytogenes Clones with Enhanced Virulence
Lee, Applied and environmental microbiology 2017 - “...198 intergenic region between the LMOf2365_2381 and LMOf2365_2382 homologs, encoding a 199 hypothetical protein and FeS assembly protein SufB, respectively...”
- “...ND, not determined g Intergenic region between LMOf2365_2381 and LMOf2365_2382 4b J4434 4b RM1655 0 CA, USA 2012 E/F CC4 LMOf23 65_2679 1/2c 2008911* NC, USA...”
- An update on the transport and metabolism of iron in Listeria monocytogenes: the role of proteins involved in pathogenicity
Lechowicz, Biometals : an international journal on the role of metal ions in biology, biochemistry, and medicine 2015 - “...system is the sole pathway for the biosynthesis of FeS clusters and is encoded by lmo2411 - lmo2415 genes which are homologues for sufCDSUB present in other Gram-positive genera (Riboldi et al. 2009 ). Fe 2+ ions present in the cell participate also indirectly in the...”
- Transcriptomic and phenotypic responses of Listeria monocytogenes strains possessing different growth efficiencies under acidic conditions
Bowman, Applied and environmental microbiology 2010 - “...putative FeS cluster assembly genes (lmo0800, lmo2397, and lmo2411 to -2415), fatty acid biosynthesis (lmo2201 to -2202), regulation of iron uptake (fur), and,...”
cg1763 components of an uncharacterized iron-regulated ABC-type transporter (RefSeq) from Corynebacterium glutamicum ATCC 13032
NCgl1502 Fe-S cluster assembly protein SufD from Corynebacterium glutamicum ATCC 13032
Aligns to 133:362 / 392 (58.7%), covers 98.2% of PF01458, 239.6 bits
- Understanding the high L-valine production in Corynebacterium glutamicum VWB-1 using transcriptomics and proteomics
Zhang, Scientific reports 2018 - “...5.18/58708.85 0.00 2119.04 3.3 45 NCgl0251 cg0310 katA Catalase 5.18/58708.85 733.63 0.00 3.3 47 NCgl1502 cg1763 sufD Components iron-regulated ABC-type transporter 5.16/42280.10 1443.52 0.00 1.8 60 NCgl2682 cg3079 clpB ATP-dependent protease 5.00/93231.58 1852.55 0.00 NC 65 NCgl1503 cg1764 sufB Component iron-regulated ABC-type transporter 4.85/53492.94 5255.30 1074.54...”
- Acetohydroxyacid synthase, a novel target for improvement of L-lysine production by Corynebacterium glutamicum
Blombach, Applied and environmental microbiology 2009 - “...repressor Iron metabolism cg0771 cg0924 cg0926 cg0927 cg0928 cg1762 cg1763 0.34 0.20 0.39 0.29 0.37 0.46 0.35 sufC sufD cg1764 0.35 sufB cg2445 cg3404 0.45 0.25...”
- The global repressor SugR controls expression of genes of glycolysis and of the L-lactate dehydrogenase LdhA in Corynebacterium glutamicum
Engels, Journal of bacteriology 2008 - “...of sugar metabolism cg0812 cg0957 cg2116 cg1290 cg3218 cg1763 cg1112 cg0791 cg0634 cg2430 cg1111 cg3227 cg2419 cg1379 cg0604 cg1977 cg1537 cg1673 cg2425 cg3368...”
- The extracytoplasmic function-type sigma factor SigM of Corynebacterium glutamicum ATCC 13032 is involved in transcription of disulfide stress-related genes
Nakunst, Journal of bacteriology 2007 - “...of California, Berkeley Disulfide stress-related genes cg1765 cg1764 cg1763 cg1762 cg1761 cg1760 cg1759 cg3299 cg3422 cg3423 cg3424 m valuea Gene VOL. 189, 2007...”
- Global gene expression during stringent response in Corynebacterium glutamicum in presence and absence of the rel gene encoding (p)ppGpp synthase
Brockmann-Gretza, BMC genomics 2006 - “...3.30 glutamine amidotransferase (involved in pyridoxine biosynthesis) H cg1761 1.55 3.81 nifS2 cysteine desulfhydrase E cg1763 1.72 6.59 sufD components of an uncharacterized iron-regulated ABC-type transporter O cg1764 1.79 2.43 sufB component of an uncharacterized iron-regulated ABC-type transporter O cg2409 2.31 1.61 ctaC cytochrome C oxidase...”
- Adaptation of Corynebacterium glutamicum to ammonium limitation: a global analysis using transcriptome and proteome techniques
Silberbach, Applied and environmental microbiology 2005 - “...NCgl0075 NCgl2716 NCgl0754 cg2429 cg1267 cg2429 cg1267 cg3237 cg2830 cg1763 cg0104 cg3115 cg0898 Gene name serA aroA carA fum gpmA pepC metY murA mqo purH glnA...”
- Understanding the high L-valine production in Corynebacterium glutamicum VWB-1 using transcriptomics and proteomics
Zhang, Scientific reports 2018 - “...Catalase 5.18/58708.85 0.00 2119.04 3.3 45 NCgl0251 cg0310 katA Catalase 5.18/58708.85 733.63 0.00 3.3 47 NCgl1502 cg1763 sufD Components iron-regulated ABC-type transporter 5.16/42280.10 1443.52 0.00 1.8 60 NCgl2682 cg3079 clpB ATP-dependent protease 5.00/93231.58 1852.55 0.00 NC 65 NCgl1503 cg1764 sufB Component iron-regulated ABC-type transporter 4.85/53492.94 5255.30...”
- The DtxR regulon of Corynebacterium glutamicum
Wennerhold, Journal of bacteriology 2006 - “...NCgl0639 NCgl0773 NCgl0774 NCgl0776 NCgl0779 NCgl1200 NCgl1209 NCgl1502 NCgl1503 NCgl1959 NCgl2146 NCgl2439 NCgl2897 NCgl2969 NCgl2970 VOL. 188, 2006 THE DtxR...”
- Characterization of a Corynebacterium glutamicum lactate utilization operon induced during temperature-triggered glutamate production
Stansen, Applied and environmental microbiology 2005 - “...NCgl0943 NCgl1170 NCgl1262 NCgl1263 NCgl1470 NCgl1472 NCgl1502 NCgl1646 NCgl1647 NCgl2248 NCgl2319 NCgl2353 NCgl2450 NCgl2451 NCgl2657 NCgl2713 NCgl2719...”
- Adaptation of Corynebacterium glutamicum to ammonium limitation: a global analysis using transcriptome and proteome techniques
Silberbach, Applied and environmental microbiology 2005 - “...cg0984 NCgl2133 NCgl1071 NCgl2133 NCgl1071 NCgl2826 NCgl2471 NCgl1502 NCgl0075 NCgl2716 NCgl0754 cg2429 cg1267 cg2429 cg1267 cg3237 cg2830 cg1763 cg0104 cg3115...”
- Global expression profiling and physiological characterization of Corynebacterium glutamicum grown in the presence of L-valine
Lange, Applied and environmental microbiology 2003 - “...2281b 2425 2453b NCgl1918 NCgl2086 (2274263-2274442) NCgl1482 NCgl1502 2455b NCgl1503 b 2456 NCgl1504 2736 2790b 2791b 2792b 2793b NCgl1263 NCgl1224...”
Alvin_0739 FeS assembly protein SufB (RefSeq) from Allochromatium vinosum DSM 180
Aligns to 218:452 / 481 (48.9%), covers 99.5% of PF01458, 239.2 bits
BBMN68_612 Fe-S cluster assembly protein SufB from Bifidobacterium longum subsp. longum BBMN68
Aligns to 229:455 / 484 (46.9%), covers 99.5% of PF01458, 239.1 bits
- Transcriptomic analysis of Bifidobacterium longum subsp. longum BBMN68 in response to oxidative shock
Zuo, Scientific reports 2018 - “...csdB ( sufS ) NS 1.78 BBMN68_609 FeS cluster assembly protein SufB sufB2 NS 1.49 BBMN68_612 FeS cluster assembly protein SufD sufB1 1.10 2.12 BBMN68_611 Iron complex transport system ATP-binding protein modF NS 1.46 BBMN68_569 P-type ATPase zntA1 NS 1.01 BBMN68_1149 Protein repair/chaperones Heat-shock molecular chaperone...”
- “...in response to oxidative stress. Expression of genes encoding FeS cluster-assembly proteins, including sufB ( BBMN68_612 ), sufD ( BBMN68_611 ), csdB ( BBMN68_609 , also known as sufS ), was upregulated in BBMN68 exposed to oxygen for 60min (Table 2 ). CsdB, an IscS/Nifs homolog,...”
Bbr_0907 Fe-S cluster assembly protein SufB from Bifidobacterium breve UCC2003
Aligns to 229:455 / 484 (46.9%), covers 99.5% of PF01458, 239.1 bits
- The essential genomic landscape of the commensal Bifidobacterium breve UCC2003
Ruiz, Scientific reports 2017 - “...iron-sulfur clusters ( IscS, IscU, sufB, sufC, fdx , represented by locus tags Bbr_0910, Bbr_0911, Bbr_0907, Bbr_0909, Bbr_1664), which have not been previously characterized in bifidobacteria, were also found essential in our analysis. The corresponding protein complexes are known to sense oxygen and metal availability and...”
BL0872 possible ABC transporter component (NCBI) from Bifidobacterium longum NCC2705
Aligns to 244:470 / 499 (45.5%), covers 99.5% of PF01458, 239.0 bits
TTHA1839 SufB protein (membrane protein) (NCBI) from Thermus thermophilus HB8
Aligns to 213:439 / 468 (48.5%), covers 99.5% of PF01458, 238.9 bits
- Determination and Dissection of DNA-Binding Specificity for the Thermus thermophilus HB8 Transcriptional Regulator TTHB099
Moncja, International journal of molecular sciences 2020 - “...+4.423 1.52 10 4 1 TTHA1838 SufC protein, ATP-binding protein 2.465 1.06 10 3 2 TTHA1839 SufB protein, membrane protein 2.593 9.53 10 4 3 TTHA1840 SufD protein, membrane protein 2.630 6.25 10 4 4 TTHA1841 Dioxygenase ferredoxin subunit 2.419 2.59 10 3 1 TTHA1133 ba3-type...”
- Lysine propionylation is a prevalent post-translational modification in Thermus thermophilus
Okanishi, Molecular & cellular proteomics : MCP 2014 - “...181; TTHA1535, Spot No. 47; TTHA1838, Spot No. 150; TTHA1839, Spot Nos. 24 and 25; TTHA1840, Spot Nos. 60 and 61. DISCUSSION Lysine propionylation, a...”
TTC1488 No description from Thermus thermophilus HB27
Aligns to 213:439 / 468 (48.5%), covers 99.5% of PF01458, 238.9 bits
CYB_1405 FeS assembly protein SufB (NCBI) from Synechococcus sp. JA-2-3B'a(2-13)
Aligns to 215:449 / 478 (49.2%), covers 99.5% of PF01458, 237.2 bits
SCO1924 hypothetical protein (NCBI) from Streptomyces coelicolor A3(2)
Aligns to 141:364 / 394 (56.9%), covers 98.6% of PF01458, 237.1 bits
MAP1188 hypothetical protein (NCBI) from Mycobacterium avium subsp. paratuberculosis str. k10
Aligns to 132:361 / 396 (58.1%), covers 98.6% of PF01458, 236.4 bits
KPNJ2_02282 Fe-S cluster assembly protein SufD from Klebsiella pneumoniae 30684/NJST258_2
Aligns to 169:394 / 424 (53.3%), covers 99.1% of PF01458, 236.1 bits
DIP1294 Conserved hypothetical protein (NCBI) from Corynebacterium diphtheriae NCTC 13129
Aligns to 128:357 / 391 (58.8%), covers 99.1% of PF01458, 235.9 bits
PGN_0359 putative ABC transporter permease protein (RefSeq) from Porphyromonas gingivalis ATCC 33277
Aligns to 183:408 / 447 (50.6%), covers 99.1% of PF01458, 234.9 bits
PG0259 conserved hypothetical protein (NCBI) from Porphyromonas gingivalis W83
Aligns to 183:408 / 447 (50.6%), covers 99.1% of PF01458, 234.8 bits
- Metabolome variations in the Porphyromonas gingivalis vimA mutant during hydrogen peroxide-induced oxidative stress
McKenzie, Molecular oral microbiology 2015 - “...family protein PG0227 2.8909848 DNA repair protein RadA PG0248 2.2419755 Translation initation factor SUI1, putative PG0259 3.0020967 Conserved hypothetical protein PG0277 2.4539853 ISPg2, transposase PG0326 5.3249413 Hypothetical protein PG0423 3.3248539 Hypothetical protein PG0454 3.0034393 Hypothetical protein PG0523 2.3294317 Inosine-5-monophosphate dehydrogenase PG0543 2.2128535 Transcriptional regulator, putative PG0556...”
- Role of the Porphyromonas gingivalis extracytoplasmic function sigma factor, SigH
Yanamandra, Molecular oral microbiology 2012 - “...protein 1.062350 0.478851 7.263607 0.000047 10 PG1625 hypothetical protein 1.031446 0.489220 38.348483 0.000000 (4.6E-13) 12 PG0259 conserved hypothetical protein 1.017716 0.493898 17.708272 0.000000 (1.9E-09) 12 PG1556 conserved hypothetical protein 1.010324 0.496435 5.421035 0.000421 10 PG0047 Cell division protein FtsH, putative 1.002205 0.499237 12.419474 0.000000 (8.2E-08) 12...”
STM1372 required for stability of iron-sulfur component of FhuF (NCBI ptt file) from Salmonella typhimurium LT2
Aligns to 168:393 / 423 (53.4%), covers 99.1% of PF01458, 233.9 bits
BMEI1042 ABC TRANSPORTER-ASSOCIATED PROTEIN (NCBI ptt file) from Brucella melitensis 16M
Aligns to 244:478 / 507 (46.4%), covers 99.5% of PF01458, 233.7 bits
- ATP-Binding Cassette Systems of Brucella
Jenner, Comparative and functional genomics 2009 - “...ISB (ABCX) Iron/sulphur centre biogenesis CYTP BMEI1040 BruAb10941 BR0931 ISB (ABCX) Iron/sulphur centre biogenesis CYTP BMEI1042 BruAb10940 BR0933 ISB (ABCX) Iron/sulphur centre biogenesis ABC BMEI1041 BruAb10942 BR0932 32 ISVH Iron-siderophores, VB12 and Hemin import ABC BMEI0660 BruAb11342 BR1344 BOV_1302 BCAN_A1371 ISVH Iron-siderophores, VB12 and Hemin import...”
- “...BMEII0976 + + + CYTP BMEI1040 + + 31 ISB (ABCX) Iron/sulphur centre biogenesis CYTP BMEI1042 + + ABC BMEI1041 + + ABC BMEI0964 + + + 36 MKL Involved in toluene tolerance IM BMEI0965, ttg2B + + + SS BMEI0963, ttg2C + + + IM...”
BR0931 hypothetical protein (NCBI) from Brucella suis 1330
Aligns to 244:478 / 507 (46.4%), covers 99.5% of PF01458, 233.7 bits
- ATP-Binding Cassette Systems of Brucella
Jenner, Comparative and functional genomics 2009 - “...acids IM BruAb20808 BRA0393 BOV_A0336 BCAN_B0397 31 ISB (ABCX) Iron/sulphur centre biogenesis CYTP BMEI1040 BruAb10941 BR0931 ISB (ABCX) Iron/sulphur centre biogenesis CYTP BMEI1042 BruAb10940 BR0933 ISB (ABCX) Iron/sulphur centre biogenesis ABC BMEI1041 BruAb10942 BR0932 32 ISVH Iron-siderophores, VB12 and Hemin import ABC BMEI0660 BruAb11342 BR1344 BOV_1302...”
BAB1_0948 Protein of unknown function UPF0051 (NCBI) from Brucella melitensis biovar Abortus 2308
Aligns to 244:478 / 507 (46.4%), covers 99.5% of PF01458, 233.7 bits
YnhC / b1681 Fe-S cluster scaffold complex subunit SufD from Escherichia coli K-12 substr. MG1655 (see 19 papers)
SUFD_ECOLI / P77689 FeS cluster assembly protein SufD from Escherichia coli (strain K12) (see 3 papers)
sufD / RF|NP_416196.1 protein sufD from Escherichia coli K12 (see 6 papers)
b1681 component of SufBCD complex (NCBI) from Escherichia coli str. K-12 substr. MG1655
NP_416196 Fe-S cluster scaffold complex subunit SufD from Escherichia coli str. K-12 substr. MG1655
Aligns to 168:393 / 423 (53.4%), covers 99.1% of PF01458, 233.1 bits
- function: The SufBCD complex acts synergistically with SufE to stimulate the cysteine desulfurase activity of SufS. The SufBCD complex contributes to the assembly or repair of oxygen-labile iron-sulfur clusters under oxidative stress. May facilitate iron uptake from extracellular iron chelators under iron limitation. Required for the stability of the FhuF protein.
subunit: Part of the SufBCD complex that contains SufB, SufC and SufD. Can form homodimers. - Generation and Characterization of Acid Tolerant Fibrobacter succinogenes S85
Wu, Scientific reports 2017 - “...in Fe-S cluster assembly, permease component + 514 C T 61 151 63.04 Arg172Cys JW1671 (b1681) 2 1396377 Fisuc_1133 yidE Predicted permease, may bind an unidentified ligand 462 G 200 200 100 Frameshift. Stop codon at the 18th codon after the shift. JW3662 (b3685) 3 2230314...”
- Global transcriptomic responses of Escherichia coli K-12 to volatile organic compounds
Yung, Scientific reports 2016 - “...1.21 1.21 1.35 0.28 0.36 0.91 Cysteine desulfurase, SufE induced SUF b cp dma dms b1681 sufD 1.72 0.88 1.46 1.11 1.14 0.33 0.16 0.71 Component of SufBCD Fe-S cluster assembly scaffold SUF b cp dms b1682 sufC 1.77 0.99 1.97 1.11 1.30 0.42 0.67 0.92...”
- The sulfur carrier protein TusA has a pleiotropic role in Escherichia coli that also affects molybdenum cofactor biosynthesis
Dahl, The Journal of biological chemistry 2013 - “...subunit FeS cluster biosynthesis b2527 b2528 b1679 b1680 b1681 b1682 b1683 b1684 hscB iscA sufE sufS sufD sufC sufB sufA Molecular chaperone for IscU...”
- 18th Congress of the European Hematology Association, Stockholm, Sweden, June 13–16, 2013
, Haematologica 2013 - Enhancing E. coli tolerance towards oxidative stress via engineering its global regulator cAMP receptor protein (CRP)
Basak, PloS one 2012 - “...2.755 b4376 osmY 3.062 b1896 otsA * 2.996 OxyR b1684 sufA 3.336 b1683 sufB 3.483 b1681 sufD 3.140 b1680 sufE 2.551 b1679 sufS 2.771 * - Analyzed by qRT-PCR ( Table S4 ). 10.1371/journal.pone.0051179.t003 Table 3 DNA microarray data of certain endogenous genes in OM3 (...”
- COLOMBOS: access port for cross-platform bacterial expression compendia
Engelen, PloS one 2011 - “...novel Fur targets a case study. Locus tag Name Description Operon Known COLOMBOS Meta-analysis Evidence b1681 sufD SufBCD Fe-S cluster scaffold sufABCDSE + + Fur, OxyR, IHF, lscR b1683 sufB SufBCD Fe-S cluster scaffold sufABCDSE + + Fur, OxyR, IHF, lscR b2392 mntH Manganese transport protein...”
- Remaining flexible in old alliances: functional plasticity in constrained mutualisms
Wernegreen, DNA and cell biology 2009 - “...WGLp359 - - - Component of SufBCD complex sufD (ynhC) b1681 Bpen372 Bfl361 WGLp358 - - - Component of SufBCD complex sufE b1679 Bpen374 Bfl363 WGLp356 - - -...”
- Effect of RyhB small RNA on global iron use in Escherichia coli
Massé, Journal of bacteriology 2005 - “...exbD exbB bfrc bfd feoA feoB sodA fecE b1019 b1679 b1680 b1681 b1682 b1683 b1684 b2211 b3005 b3006 b3336 b3337 b3408 b3409 b3908 b4287 1.3 1.9 7.1 2.4 2.3 3.2...”
- More
- SufD and SufC ATPase activity are required for iron acquisition during in vivo Fe-S cluster formation on SufB.
Saini, Biochemistry 2010 - GeneRIF: SufB, SufC, and SufD, coexpressed with the SufS-SufE sulfur transfer pair, purify as two distinct complexes (SufBC(2)D and SufB(2)C(2)) that contain Fe-S clusters and FADH(2)
- A Sinorhizobium meliloti RpoH-Regulated Gene Is Involved in Iron-Sulfur Protein Metabolism and Effective Plant Symbiosis under Intrinsic Iron Limitation
Sasaki, Journal of bacteriology 2016 - “...conserved (29% identity; RefSeq accession numbers CAC46312 and P77689 for the sequences in S. meliloti and E. coli, respectively) than SufB (59%; CAC46314 and...”
MAE_RS10065 Fe-S cluster assembly protein SufB from Microcystis aeruginosa NIES-843
Aligns to 217:451 / 480 (49.0%), covers 99.5% of PF01458, 232.8 bits
- FurA-Dependent Microcystin Synthesis under Copper Stress in Microcystis aeruginosa
Chen, Microorganisms 2020 - “...cluster response MAE_RS10070 transcriptional regulator sufR 7.06 10 31 MAE_RS16045 cysteine desufuration protein SufE 0.00048425 MAE_RS10065 FeS cluster assembly protein SufB 0.00015271 MAE_RS00015 (2Fe2S)-binding protein 0.00012458 MAE_RS23065 (FeS)-binding protein 9.8206 10 26 MAE_RS25860 photosystem I ironsulfur center 0.001504 MAE_RS06030 (2Fe2S)-binding protein 0.0010832 MAE_RS07140 ferredoxin:protochlorophyllide reductase (ATP-dependent)...”
ZMO0423 cysteine desulfurase activator complex subunit SufB (RefSeq) from Zymomonas mobilis subsp. mobilis ZM4
Aligns to 227:461 / 490 (48.0%), covers 99.5% of PF01458, 232.5 bits
- Model-driven analysis of mutant fitness experiments improves genome-scale metabolic models of Zymomonas mobilis ZM4
Ong, PLoS computational biology 2020 - “..., MEOHtrpp_r , OGMEACPD_f , OGMEACPR_f, OGMEACPS_f, OPMEACPD_f, OPMEACPR_f, OPMEACPS_f, PMEACPE_f , S2FE2SR_f 13 ZMO0094, ZMO0423, ZMO0425, ZMO0426, ZMO0427, ZMO1067, ZMO1146, ZMO1222, ZMO1278, ZMO1692, ZMO1915, ZMO1917, ZMO1918, Biotin biosynthesis Modules with average cofitness scores below the significance threshold M45 0.497 5 E4PD_f , OHPBAT_f, PDX5PS_f, PERD_f...”
- Characterization of a Dimeric Arginase From Zymomonas mobilis ZM4
Hwangbo, Frontiers in microbiology 2019 - “...1A ). FIGURE 1 Characterization of the recombinant zmARG. (A) The arginase activity of recombinant ZMO0423 (zmARG). Left: Comparison of the arginase activity obtained in endpoint assays of the recombinant ZMO0423 protein, the recombinant ZMO1605 (pyruvate dehydrogenase E1 component beta subunit), and the ZMO0684 protein (CRISPR-associated...”
ECs2388 hypothetical protein (NCBI ptt file) from Escherichia coli O157:H7 str. Sakai
Aligns to 168:393 / 423 (53.4%), covers 99.1% of PF01458, 232.0 bits
TDE0667 FeS assembly protein SufB (NCBI) from Treponema denticola ATCC 35405
Aligns to 233:459 / 488 (46.5%), covers 99.5% of PF01458, 231.7 bits
STM14_RS07705 Fe-S cluster assembly protein SufB from Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S
Aligns to 233:466 / 495 (47.3%), covers 99.5% of PF01458, 231.4 bits
SSA_1269 hypothetical protein (NCBI) from Streptococcus sanguinis SK36
Aligns to 205:431 / 460 (49.3%), covers 99.5% of PF01458, 231.3 bits
VDA_000771 Fe-S cluster assembly protein SufB from Photobacterium damselae subsp. damselae CIP 102761
Aligns to 229:463 / 492 (47.8%), covers 99.5% of PF01458, 231.2 bits
Q55790 UPF0051 protein slr0074 from Synechocystis sp. (strain PCC 6803 / Kazusa)
slr0074 ABC transporter subunit (NCBI ptt file) from Synechocystis sp. PCC 6803
Aligns to 217:451 / 480 (49.0%), covers 99.5% of PF01458, 231.2 bits
- A plastidic ABC protein involved in intercompartmental communication of light signaling
Møller, Genes & development 2001 - “...Synechocystis sp. strain PCC6803 ABC (Accession number Q55790) and to chloroplast-encoded ABC-like proteins from unicellular organisms such as the cryptophyte...”
- Iron-Sulfur Cluster Biogenesis and Iron Homeostasis in Cyanobacteria
Gao, Frontiers in microbiology 2020 - “...Morimoto et al., 2002 ; Wollenberg et al., 2003 ; Balasubramanian et al., 2006 SufB Slr0074 Fe-S cluster assembly scaffold Lethal Balasubramanian et al., 2006 ; Zang et al., 2017 SufC slr0075 Fe-S cluster assembly component, provide energy Lethal Balasubramanian et al., 2006 ; Zang et...”
- Regulation of Iron Homeostasis and Use in Chloroplasts
Kroh, International journal of molecular sciences 2020 - “...Diatoms 27 (CGLD27) AT5G67370 Cre05.g237050.t1.1 WP_010873853 Suf FeS assembly SUFB AT4G04770 Cre15.g643600.t1.2 [ 128 ] slr0074 [ 128 ] SUFC AT3G10670 Cre07.g339700.t1.2 [ 128 ] slr0075 [ 128 ] SUFD AT5G44316 Cre12.g513950.t1.2 * [ 128 ] slr0076 [ 128 ] SUFS AT1G08490 Cre12.g525650.t1.2 [ 128 ]...”
- Finding novel relationships with integrated gene-gene association network analysis of Synechocystis sp. PCC 6803 using species-independent text-mining
Kreula, PeerJ 2018 - “...petF ferredoxin I Iron sulfur cluster metabolism sll0088 sufR hypothetical protein (transcriptional regulator, suf ) slr0074 sufB ABC transporter subunit slr0075 sufC ABC transporter ATP-binding protein slr0076 sufD hypothetical protein (FeS assembly protein) slr0077 sufS/nifS cysteine desulfurase slr1417 sufA hypothetical protein YCF57 (FeS assembly protein) Alkane...”
- UpCoT: an integrated pipeline tool for clustering upstream DNA sequences of orthologous genes in prokaryotic genomes
Arun, 3 Biotech 2016 - “...testing UpCoT. From the output generated by UpCoT, the text files with names Slr2075 , Slr0074 and Slr0898 were selected from tu_upstreams directory and submitted for the prediction of cis -regulatory elements using stand alone versions of MEME, Gibbs Motif Sampler, MDScan and Bioprospector. Results and...”
- “...), it is clear that the orthologs identified by UpCoT for the proteins Slr2075 (GroES), Slr0074 (Ycf24), Slr0898 (NirA), Ssl2598 (PsbH), Smr0009 (PsbN), Sll0851 (PsbC) andSll0894 (PsbD) are accurate because their annotations are same as given in NCBI genome database. Table1 Orthologs identified by UpCoT for...”
- Comparative analysis of the primary transcriptome of Synechocystis sp. PCC 6803
Kopf, DNA research : an international journal for rapid publication of reports on genes and genomes 2014 - “...system substrate-binding protein TU288 ga 26,880 8.4 slr1295 Iron transport protein TU3030 ga 59,402 8.3 slr0074, slr0075, slr0076, slr0077 ABC transporter subunit | ABC transporter ATP-binding protein | HP | cysteine desulphurase TU19 g 3,311 8.3 slr1316 Iron(III) dicitrate ABC transporter permease TU3083 ga 5,331 6.7...”
- Global transcriptional profiles of the copper responses in the cyanobacterium Synechocystis sp. PCC 6803
Giner-Lamia, PloS one 2014 - “...sufS 14.92 Probable cysteine desulfurase slr0075 sufC 13.11 ABC transporter ATP-binding protein slr0076 sufD 11.16 slr0074 sufB 9.28 ABC transporter unit sll0088 sufR 8.41 slr1419 sufE 3.98 slr1846 grxC 3.25 Glutaredoxin C sll1112 aroQ 4.82 3-dehydroquinate dehydratase sll1470 leuC 3.50 3-isopropylmalate dehydratase slr0958 cysS 2.98 Cysteinyl-tRNA...”
- Iron deprivation in Synechocystis: inference of pathways, non-coding RNAs, and regulatory elements from comprehensive expression profiling
Hernández-Prieto, G3 (Bethesda, Md.) 2012 - “...protein (FRP) involved in phycobilisome-dependent non-photochemical quenching ( Boulay et al. 2010 ); and (iv) slr0074 , encoding SufB, involved in assembly of [Fe-S] clusters ( Shen et al. 2007 ). Possibly, the distinct expression profiles of these genes and their 5UTR indicate existence of riboswitches,...”
- “...2.55 2.89 1.6010 9 sll0834 Low-affinity sulfate transporter 2.13 2.38 1.45 1.57 1.50 3.8510 8 slr0074 ABC transporter subunit 0.92 1.91 1.23 1.75 2.08 2.1310 8 slr0044 Bicarbonate transport system ATP-binding protein 3.29 3.35 3.16 2.89 3.00 1.3010 7 slr0040 Bicarbonate transport system substrate-binding protein 3.88...”
- Gene expression patterns of sulfur starvation in Synechocystis sp. PCC 6803
Zhang, BMC genomics 2008 - “...)) 6 sll1165( mutS ), slr1511( fabH ), sll1076( ziaA ) 7 sll0306( rpoD ), slr0074( ycf24 ) 9 sll1459, sll1621, slr0143, slr1041, slr0537, sll0856( rpoE ), slr0853( rimI ) CO 2 fixation slr0436( ccmK ), Soluble electron carriers sll1245( cytM ) 10 sll1958( hisC ),...”
- More
ECs2390 hypothetical protein (NCBI) from Escherichia coli O157:H7 str. Sakai
Aligns to 233:466 / 495 (47.3%), covers 99.5% of PF01458, 231.1 bits
c2078 SufB protein (NCBI ptt file) from Escherichia coli CFT073
Aligns to 246:479 / 508 (46.1%), covers 99.5% of PF01458, 231.1 bits
YnhE / b1683 Fe-S cluster scaffold complex subunit SufB from Escherichia coli K-12 substr. MG1655 (see 22 papers)
SUFB_ECOLI / P77522 FeS cluster assembly protein SufB from Escherichia coli (strain K12) (see paper)
sufB / RF|NP_416198.2 protein sufB from Escherichia coli K12 (see 5 papers)
NP_416198 Fe-S cluster scaffold complex subunit SufB from Escherichia coli str. K-12 substr. MG1655
b1683 orf, hypothetical protein (VIMSS) from Escherichia coli str. K-12 substr. MG1655
Aligns to 233:466 / 495 (47.3%), covers 99.5% of PF01458, 231.1 bits
- function: The SufBCD complex acts synergistically with SufE to stimulate the cysteine desulfurase activity of SufS. The SufBCD complex contributes to the assembly or repair of oxygen-labile iron-sulfur clusters under oxidative stress. May facilitate iron uptake from extracellular iron chelators under iron limitation.
subunit: Part of the SufBCD complex that contains SufB, SufC and SufD. - A Sinorhizobium meliloti RpoH-Regulated Gene Is Involved in Iron-Sulfur Protein Metabolism and Effective Plant Symbiosis under Intrinsic Iron Limitation
Sasaki, Journal of bacteriology 2016 - “...and E. coli, respectively) than SufB (59%; CAC46314 and P77522) and SufC (58%; CAC46313 and P77499) between these organisms. Since SufD was shown to contribute...”
- Metabolomic and proteomic insights into carbaryl catabolism by Burkholderia sp. C3 and degradation of ten N-methylcarbamates
Seo, Biodegradation 2013 - “...chaperonin 1 (GroL) 46/6 Q00767 Stress Chaperone protein (DnaK) 54/7 Q9L7P1 Stress Protein SufB 14/3 P77522 Stress, detoxification Peroxidase/catalase HPI (KatG) 47/7 Q8Z303 Stress, detoxification ATPase ravA (RavA) 19/4 P31473 Stress UvrABC system protein A (UvrA) 41/5 Q8X5U9 Stress, detoxification Glutathione synthetase (GshB) 31/5 P58580 Stress,...”
- AtNAP1 represents an atypical SufB protein in Arabidopsis plastids
Xu, The Journal of biological chemistry 2005 - “...(SufB Erw. CAC17125) and E. coli (SufB E. coli P77522). The degenerate Walker A and Walker B motifs are indicated. RESULTS Sequence Analysis of AtNAP1--We...”
- An in vivo method for characterization of protein interactions within sulfur trafficking systems of E. coli.
Bolstad, Journal of proteome research 2010 (PubMed)- GeneRIF: Studies identified SufE-SufS and SufE-SufB interactions.
- AtNAP1 represents an atypical SufB protein in Arabidopsis plastids.
Xu, The Journal of biological chemistry 2005 - GeneRIF: SufB homolog AtNAP1 can complement SufB deficiency in Escherichia coli during oxidative stress. AtNAP1 represents an atypical plastidic SufB-like protein important for Fe-S cluster assembly and for regulating iron homeostasis in Arabidopsis.
- Global transcriptomic responses of Escherichia coli K-12 to volatile organic compounds
Yung, Scientific reports 2016 - “...0.92 SufBCD Fe-S cluster assembly scaffold protein SUF b chp cp dma dms nmp t b1683 sufB 2.71 1.54 3.12 1.87 2.02 1.44 0.11 1.77 Component of SufBCD Fe-S cluster assembly scaffold SUF b cp dma dms t b1684 sufA 3.01 1.57 4.06 2.12 2.30 1.73...”
- The sulfur carrier protein TusA has a pleiotropic role in Escherichia coli that also affects molybdenum cofactor biosynthesis
Dahl, The Journal of biological chemistry 2013 - “...FeS cluster biosynthesis b2527 b2528 b1679 b1680 b1681 b1682 b1683 b1684 hscB iscA sufE sufS sufD sufC sufB sufA Molecular chaperone for IscU FeS assembly...”
- 18th Congress of the European Hematology Association, Stockholm, Sweden, June 13–16, 2013
, Haematologica 2013 - Enhancing E. coli tolerance towards oxidative stress via engineering its global regulator cAMP receptor protein (CRP)
Basak, PloS one 2012 - “...3.801 b1482 osmC 2.755 b4376 osmY 3.062 b1896 otsA * 2.996 OxyR b1684 sufA 3.336 b1683 sufB 3.483 b1681 sufD 3.140 b1680 sufE 2.551 b1679 sufS 2.771 * - Analyzed by qRT-PCR ( Table S4 ). 10.1371/journal.pone.0051179.t003 Table 3 DNA microarray data of certain endogenous genes...”
- COLOMBOS: access port for cross-platform bacterial expression compendia
Engelen, PloS one 2011 - “...Meta-analysis Evidence b1681 sufD SufBCD Fe-S cluster scaffold sufABCDSE + + Fur, OxyR, IHF, lscR b1683 sufB SufBCD Fe-S cluster scaffold sufABCDSE + + Fur, OxyR, IHF, lscR b2392 mntH Manganese transport protein mntH + + + Fur, MntR b2673 nrdH Glutaredoxin-like protein nrdHIEF + +...”
- Remaining flexible in old alliances: functional plasticity in constrained mutualisms
Wernegreen, DNA and cell biology 2009 - “...- Transcriptional regulator for cryptic hemolysin sufB (ynhE) b1683 Bpen370 Bfl359 WGLp360 - - - SufBCD complex activates the cysteine desulfurase; secondary...”
- Effect of RyhB small RNA on global iron use in Escherichia coli
Massé, Journal of bacteriology 2005 - “...bfrc bfd feoA feoB sodA fecE b1019 b1679 b1680 b1681 b1682 b1683 b1684 b2211 b3005 b3006 b3336 b3337 b3408 b3409 b3908 b4287 1.3 1.9 7.1 2.4 2.3 3.2 1.4 14.5...”
- Elucidation of the antibacterial mechanism of the Curvularia haloperoxidase system by DNA microarray profiling
Hansen, Applied and environmental microbiology 2004 - “...b0849 b0606 b2582 b0605 b0683 b3500 b0604 b2000 b4367 b0475 b1684 b1683 b1682 b1681 b1680 b1679 b0006 b0389 b0848 b0881 3.3 5.2 4.7 3.3 4.8 2.3 1.0 1.4 0.2 3.1...”
- More
Bd0188 Transport protein involved in the [Fe-S] cluster assembly. (NCBI) from Bdellovibrio bacteriovorus HD100
Aligns to 162:387 / 419 (53.9%), covers 99.5% of PF01458, 231.1 bits
RSP_0440 putative SufB (NCBI) from Rhodobacter sphaeroides 2.4.1
Aligns to 246:484 / 513 (46.6%), covers 99.5% of PF01458, 230.9 bits
- IscR of Rhodobacter sphaeroides functions as repressor of genes for iron-sulfur metabolism and represents a new type of iron-sulfur-binding protein
Remes, MicrobiologyOpen 2015 - “...Gene log 2 FC Description RSP_0437 sufC 0.68 Suf C, ATPase RSP_0439 0.67 Hypothetical protein RSP_0440 sufB 0.67 Putative SufB RSP_0442 iscS 1.00 Putative aminotransferase RSP_0443 iscR 1.15 Rrf2 family transcriptional regulator RSP_0920 exbB 1.98 Biopolymer transport protein, ExbB RSP_0921 exbD 1.59 Biopolymer transport protein, ExbD...”
- Role of oxygen and the OxyR protein in the response to iron limitation in Rhodobacter sphaeroides
Remes, BMC genomics 2014 - “...sufC, iron-regulated ABC transporter 1.75 -0.83*** -1.35 -0.66 RSP_0439 hypothetical protein 1.49 -0.76** -0.72 -0.38 RSP_0440 sufB , iron-regulated ABC transporter 2.60 -1.04* 0.01 0.44 RSP_0443 iscR, iron sulfur cluster regulator 2.45 0.28* -0.76 0.47 RSP_0906 sitC, ABC Mn 2+ transporter 2.91 0.95* 0.50 -0.35 RSP_3568...”
- Role of the Irr protein in the regulation of iron metabolism in Rhodobacter sphaeroides
Peuser, PloS one 2012 - “...sufC 1.46 2.42 4.22 1.93 Fe-S cluster assembly/repair RSP_0439 1.50 2.86 3.42 1.81 Hypothetical protein RSP_0440 sufB 1.72 2.74 3.69 1.63 Fe-S cluster assembly/repair RSP_0442 (0.74) 1.39 (3.92) 1.56 Putative aminotransferase RSP_0443 (0.62) 1.34 (4.67) 1.77 Rrf2 family transcriptional regulator RSP_2395 ccpA 0.90 1.80 2.32 0.78...”
Z2711 orf, hypothetical protein (NCBI ptt file) from Escherichia coli O157:H7 EDL933
Aligns to 246:479 / 508 (46.1%), covers 99.5% of PF01458, 230.7 bits
slr0076 hypothetical protein (NCBI ptt file) from Synechocystis sp. PCC 6803
Aligns to 194:427 / 453 (51.7%), covers 99.5% of PF01458, 230.6 bits
- Iron-Sulfur Cluster Biogenesis and Iron Homeostasis in Cyanobacteria
Gao, Frontiers in microbiology 2020 - “...assembly component, provide energy Lethal Balasubramanian et al., 2006 ; Zang et al., 2017 SufD slr0076 Fe-S cluster assembly component Lethal Balasubramanian et al., 2006 ; Zang et al., 2017 SufS Slr0077 Cysteine desulphurase sulphur donor Lethal Seidler et al., 2001 ; Tirupati et al., 2004...”
- Regulation of Iron Homeostasis and Use in Chloroplasts
Kroh, International journal of molecular sciences 2020 - “...Cre07.g339700.t1.2 [ 128 ] slr0075 [ 128 ] SUFD AT5G44316 Cre12.g513950.t1.2 * [ 128 ] slr0076 [ 128 ] SUFS AT1G08490 Cre12.g525650.t1.2 [ 128 ] slr0077 [ 128 ] SUFE AT4G26500 Cre06.g309717.t1.1 [ 128 ] slr1419 [ 128 ] SUFA AT1G10500 Cre07.g349600.t1.2 [ 128 ] slr1417...”
- Finding novel relationships with integrated gene-gene association network analysis of Synechocystis sp. PCC 6803 using species-independent text-mining
Kreula, PeerJ 2018 - “...(transcriptional regulator, suf ) slr0074 sufB ABC transporter subunit slr0075 sufC ABC transporter ATP-binding protein slr0076 sufD hypothetical protein (FeS assembly protein) slr0077 sufS/nifS cysteine desulfurase slr1417 sufA hypothetical protein YCF57 (FeS assembly protein) Alkane biosynthesis sll0209 aar acyl-ACP reductase sll0208 ado aldehyde deformylating oxygenase sll0207...”
- Comparative analysis of the primary transcriptome of Synechocystis sp. PCC 6803
Kopf, DNA research : an international journal for rapid publication of reports on genes and genomes 2014 - “...protein TU288 ga 26,880 8.4 slr1295 Iron transport protein TU3030 ga 59,402 8.3 slr0074, slr0075, slr0076, slr0077 ABC transporter subunit | ABC transporter ATP-binding protein | HP | cysteine desulphurase TU19 g 3,311 8.3 slr1316 Iron(III) dicitrate ABC transporter permease TU3083 ga 5,331 6.7 sll0477, sll0478,...”
- Global transcriptional profiles of the copper responses in the cyanobacterium Synechocystis sp. PCC 6803
Giner-Lamia, PloS one 2014 - “...cluster response slr0077 sufS 14.92 Probable cysteine desulfurase slr0075 sufC 13.11 ABC transporter ATP-binding protein slr0076 sufD 11.16 slr0074 sufB 9.28 ABC transporter unit sll0088 sufR 8.41 slr1419 sufE 3.98 slr1846 grxC 3.25 Glutaredoxin C sll1112 aroQ 4.82 3-dehydroquinate dehydratase sll1470 leuC 3.50 3-isopropylmalate dehydratase slr0958...”
- Genome analysis of Chlamydomonas reinhardtii reveals the existence of multiple, compartmentalized iron-sulfur protein assembly machineries of different evolutionary origins
Godman, Genetics 2008 - “...-2 S. cerevisiae Isa1, -2 Slr1417 Slr0074 Slr0075 Slr0076 Slr1419 Slr0387 Synechocystis IscA IscU IscS E. coli Orthologs of Fe-S cluster assembly proteins in...”
- Regulatory roles for IscA and SufA in iron homeostasis and redox stress responses in the cyanobacterium Synechococcus sp. strain PCC 7002
Balasubramanian, Journal of bacteriology 2006 - “...SufD SufS SufE sll0088 slr1417 slr0074 slr0075 slr0076 slr0077 slr1419 Regulatory repressor Assembly scaffold ABC transporter? ATPase? Iron mobilization?...”
- DNA microarray analysis of redox-responsive genes in the genome of the cyanobacterium Synechocystis sp. strain PCC 6803
Hihara, Journal of bacteriology 2003 - “...subunit slr0075, ycf16, ABC transporter subunit slr0076 slr0093, dnaJ slr0095, O-methyltransferase slr0272 slr0898, nirA, ferredoxin-nitrite reductase slr1285,...”
Rv1462 hypothetical protein (NCBI) from Mycobacterium tuberculosis H37Rv
Aligns to 131:360 / 397 (57.9%), covers 98.2% of PF01458, 229.8 bits
- Discovery of a Natural Product That Binds to the Mycobacterium tuberculosis Protein Rv1466 Using Native Mass Spectrometry
Elnaas, Molecules (Basel, Switzerland) 2020 - “...resistance to iron limitation and oxidative stress [ 42 ]. Interruptions of individual proteins (Rv1461, Rv1462 or Rv1463) led to impeding mycobacterial growth [ 38 ], suggesting the high possibility that inhibiting a component of the multiprotein SUF complex would affect the whole SUF system, and...”
- Rv1460, a SufR homologue, is a repressor of the suf operon in Mycobacterium tuberculosis
Willemse, PloS one 2018 - “...Fe-S cluster assembly [ 23 26 ] and in M . tuberculosis , Rv1461 , Rv1462 and Rv1463 encode the SufB, SufC and SufD homologues respectively [ 16 ]. A role for SufD in iron acquisition [ 27 ] and SufC in providing energy for conformational...”
- “...Rv1461 contains an intein [ 28 30 ], which must be spliced before interaction with Rv1462 and Rv1463 can occur [ 28 ]. Intein splicing is sensitive to oxidative and nitrosative stress and may function to regulate cluster assembly in response to the environment [ 30...”
- Hypoxia Is Not a Main Stress When Mycobacterium tuberculosis Is in a Dormancy-Like Long-Chain Fatty Acid Environment
Del, Frontiers in cellular and infection microbiology 2018 - “...sigma factor SigE Rv1224 tatB 6.27E-17 3.37E-45 Sec-independent translocase R1460 1.63E-05 8.00E-03 Transcriptional regulatory protein Rv1462 2.49E-30 6.42E-07 Hypothetical protein Rv1535 4.06E-05 4.17E-05 Hypothetical protein Rv1801 PPE29 8.55E-05 7.07E-08 PPE family protein Rv1806 PE20 2.03E-09 3.01E-17 PPE family protein Rv1807 PPE31 1.19E-18 3.40E-25 2.66E-04 PPE family...”
- Non-replicating Mycobacterium tuberculosis elicits a reduced infectivity profile with corresponding modifications to the cell wall and extracellular matrix
Bacon, PloS one 2014 - “...Sulfate adenylyltransferase 75 days starvation [10] Rv1461 15 Conserved hypothetical protein 75 days starvation [10] Rv1462 3 Conserved hypothetical protein 75 days starvation [10] Rv2497c pdhA 2 Pyruvate dehydrogenase 75 days starvation [10] Rv2642 14 Transcriptional regulator, arsR Human granuloma v in vitro culture in 7H9...”
- Osmosensory signaling in Mycobacterium tuberculosis mediated by a eukaryotic-like Ser/Thr protein kinase
Hatzios, Proceedings of the National Academy of Sciences of the United States of America 2013 - “...PE_PGRS10 adhB rpfA Rv0950c Rv0952 Rv1072 Rv1078 Rv1297 Rv1462 Rv1463 Rv1464 Rv1466 Rv1641 Rv1642 Rv1643 Rv1652 Rv1653 Rv1654 Rv1655 Rv1656 Rv1657 Rv1658 Rv1659...”
- The response of mycobacterium tuberculosis to reactive oxygen and nitrogen species
Voskuil, Frontiers in microbiology 2011 - “...3.0 3.1 P. cysteine synthase B Rv1461 2.1 8.7 9.9 2.0 0.6 2.1 14 CHP Rv1462 1.8 5.9 7.3 2.4 5.1 2.7 4.9 5.9 10 CHP Rv1463 1.8 5.0 5.3 3.6 6.6 3.4 9.1 8.9 2.5 12 P. ABC-type transporter Rv1464 csd 1.9 6.8 6.8 2.2...”
- Contrasting transcriptional responses of a virulent and an attenuated strain of Mycobacterium tuberculosis infecting macrophages
Li, PloS one 2010 - “...synthesis ( mbtB , mbtD - J ), and [Fe-S] cluster biosynthesis ( Rv1461 , Rv1462 , csd , Rv1465 ) were present in both lists. Additionally, both virulent strains induced a multidrug transporter ( Rv1348 / Rv1349 ) which a recent study suggested is involved...”
- Whole genome identification of Mycobacterium tuberculosis vaccine candidates by comprehensive data mining and bioinformatic analyses
Zvi, BMC medical genomics 2008 - “...For example, of the 69 antigens which were re-annotated in this study, proteins Rv1461 and Rv1462, originally marked as hypothetical proteins, were found (both by domain analysis and literature search) to be part of the SUF machinery (mycobacterial system of [Fe-S] cluster assembly) identified by Huet...”
- “...necessary for in-vitro mycobacterial growth. Of this locus, our selection disclosed 5 components (Rv1461 (SufB), Rv1462 (SufD), Rv1464 (SufS), Rv1465 (NifU) and Rv1466. Rv1466 presents no homology with any documented suf gene but probably acts as a predicted metal-sulfur biosynthesis enzyme. Consistently, Rv1461 to Rv1466 are...”
- More
tlr1905 ORF_ID:tlr1905~hypothetical protein (NCBI ptt file) from Thermosynechococcus elongatus BP-1
Aligns to 177:402 / 432 (52.3%), covers 99.1% of PF01458, 229.5 bits
RAYM_06467 Fe-S cluster assembly protein SufB from Riemerella anatipestifer RA-YM
Aligns to 219:452 / 481 (48.6%), covers 99.5% of PF01458, 228.6 bits
- The Role of the Regulator Fur in Gene Regulation and Virulence of Riemerella anatipestifer Assessed Using an Unmarked Gene Deletion System
Guo, Frontiers in cellular and infection microbiology 2017 - “...protein 1.27 1.71 RAYM_06457 Probable iron binding protein from the HesB_IscA_SufA family 1.53 2.58 1.04 RAYM_06467 Cysteine desulfurase activator complex subunit SufB 1.87 1.85 RAYM_06507 FeS assembly protein SufD 1.56 1.78 RAYM_03082 Protein-(glutamine-N5) methyltransferase, release factor-specific 1.27 1.99 RAYM_03087 tRNA methyltransferase 1.42 1.63 PURINES, PYRIMIDINES, NUCLEOSIDES,...”
- “...of a nitrogen-fixing NifU domain protein ( RAYM_01100 ), SUF system protein ( RAYM_01495, RAYM_06457, RAYM_06467, RAYM_06507 ). Similar changes of NIF and SUF systems have been confirmed in E. coli in previous studies (Outten et al., 2004 ). Moreover, the genes Phosphoserine aminotransferase ( RAYM_04219...”
Npun_F4822 cysteine desulfurase activator complex subunit SufB (RefSeq) from Nostoc punctiforme
Aligns to 216:450 / 479 (49.1%), covers 99.5% of PF01458, 228.2 bits
SYNPCC7002_A1814 FeS assembly protein SufB (RefSeq) from Synechococcus sp. PCC 7002
Aligns to 216:450 / 479 (49.1%), covers 99.5% of PF01458, 228.0 bits
Tery_4355 FeS assembly protein SufB (NCBI) from Trichodesmium erythraeum IMS101
Aligns to 215:449 / 478 (49.2%), covers 99.5% of PF01458, 228.0 bits
XF1476 ABC transporter membrane protein (NCBI ptt file) from Xylella fastidiosa 9a5c
Aligns to 222:456 / 485 (48.5%), covers 99.5% of PF01458, 228.0 bits
- Xylella fastidiosa gene expression analysis by DNA microarrays
Travensolo, Genetics and molecular biology 2009 - “...Periplasmic iron-binding protein -0.99 XF2685 sppA Protease IV -0.94 XF1172 secY Preprotein translocase SecY -0.93 XF1476 ynhE ABC tranporter membrane -0.84 XF1520 xpsH General secretory pathway protein H precursor -0.81 XF2133 yheS ABC transporter ATP-binding protein -0.77 Membrane components and surface structure XF0343 mopB Outer membrane...”
TTHA1840 SufD protein (membrane protein) (NCBI) from Thermus thermophilus HB8
Aligns to 179:404 / 431 (52.4%), covers 97.7% of PF01458, 228.0 bits
y1935 hypothetical protein (NCBI ptt file) from Yersinia pestis KIM
YPO2403 conserved hypothetical protein (NCBI ptt file) from Yersinia pestis CO92
Aligns to 241:474 / 503 (46.5%), covers 99.5% of PF01458, 227.8 bits
YPTB2313 hypothetical protein (NCBI) from Yersinia pseudotuberculosis IP 32953
Aligns to 241:474 / 503 (46.5%), covers 99.5% of PF01458, 227.8 bits
PGN_0357 ABC transporter membrane protein (RefSeq) from Porphyromonas gingivalis ATCC 33277
Aligns to 218:452 / 481 (48.9%), covers 99.5% of PF01458, 227.3 bits
- Insights into Dynamic Polymicrobial Synergy Revealed by Time-Coursed RNA-Seq
Hendrickson, Frontiers in microbiology 2017 - “...240 360 PGN_1401 PGN_1535 PGN_0798 PGN_0458 PGN_0458 PGN_0273 PGN_0273 PGN_0458 PGN_0798 PGN_0798 PGN_0182 fimB PGN_1534 PGN_0357 sufB PGN_1227 TPR motif PGN_0357 sufB PGN_1906 hagC PGN_1639 PGN_0802 PGN_0357 sufB PGN_0388 PGN_1904 hagB PGN_0802 PGN_1238 PGN_1238 PGN_1413 PGN_0184 fimD PGN_0798 PGN_0856 PGN_0856 PGN_1507 PGN_1535 PGN_1541 PGN_1227 TPR motif...”
- “...S16 1.62 1.47 1.49 1.43 0.66 PGN_0301 conserved hypothetical protein 0.20 0.59 0.86 0.68 0.83 PGN_0357 ABC transporter membrane protein 1.05 0.91 2.62 2.48 2.38 PGN_0373 putative thioredoxin 1.39 0.23 1.66 1.35 1.67 PGN_0564 superoxide dismutase Fe-Mn 1.13 0.04 1.03 1.33 1.76 PGN_0567 prtC , collagenase...”
PG0257 conserved hypothetical protein (NCBI) from Porphyromonas gingivalis W83
Aligns to 218:452 / 481 (48.9%), covers 99.5% of PF01458, 227.3 bits
wcw_0087 Fe-S cluster assembly protein SufD from Waddlia chondrophila WSU 86-1044
Aligns to 175:400 / 421 (53.7%), covers 99.1% of PF01458, 226.9 bits
- Interactions Screenings Unearth Potential New Divisome Components in the Chlamydia-Related Bacterium, Waddlia chondrophila
Bayramova, Microorganisms 2019 - “...identity of the closest homolog of WCW_0106 ( secA ), WCW_0685 ( ftsH ), and WCW_0087 ( sufD ) that are the focus of this study. The identity was calculated based on multiple sequence alignment made with MAFFT (version 7.058b), as implemented on the chlamdb.ch website...”
- “...of B. subtilis [ 53 ]. Deletion of ftsH causes filamentous growth [ 54 ]. wcw_0087 SufD Belongs to the SufBCD complex, responsible for Fe-S cluster biogenesis [ 55 ]. Deletion of SufD abolishes Suf function in vivo and reduces bacteria survival [ 56 ]. Iron...”
SMc00530 CONSERVED HYPOTHETICAL PROTEIN (NCBI ptt file) from Sinorhizobium meliloti 1021
Aligns to 226:460 / 489 (48.1%), covers 99.5% of PF01458, 226.8 bits
- Role of the regulatory gene rirA in the transcriptional response of Sinorhizobium meliloti to iron limitation
Chao, Applied and environmental microbiology 2005 - “...regulation. For instance, a cluster of genes (SMc00530, SMc00531, SMc00532, SMc00533, SMc00302, and SMc00301), including a putative nifS gene, was derepressed...”
- “...renewed annotation showed that the products of SMc00301, SMc00530, SMc00531, SMc00532, and SMc00533 exhibited homology to the E. coli SufA, SufB, SufC, SufD,...”
- Proteomic analysis of wild-type Sinorhizobium meliloti responses to N-acyl homoserine lactone quorum-sensing signals and the transition to stationary phase
Chen, Journal of bacteriology 2003 - “...SMc00335 SMc00335 SMc00347 SMc00357 SMc00488 SMc00488 SMc00530 SMc00565 SMc00595 SMc00943 SMc01002 SMc01017 SMc01032 SMc01101 SMc01215 SMc01312 SMc01318...”
KPNJ2_02280 Fe-S cluster assembly protein SufB from Klebsiella pneumoniae 30684/NJST258_2
Aligns to 233:466 / 495 (47.3%), covers 99.5% of PF01458, 226.6 bits
tll0490 ABC transporter subunit (NCBI ptt file) from Thermosynechococcus elongatus BP-1
Aligns to 215:449 / 478 (49.2%), covers 99.5% of PF01458, 226.6 bits
AM1_1224 FeS assembly protein SufB (RefSeq) from Acaryochloris marina MBIC11017
Aligns to 215:449 / 478 (49.2%), covers 99.5% of PF01458, 225.4 bits
- The Complex Transcriptional Response of Acaryochloris marina to Different Oxygen Levels
Hernández-Prieto, G3 (Bethesda, Md.) 2017 - “...significantly reduced under microoxic conditions. Another group of genes ( AM1_1222 , AM1_1223 , and AM1_1224 ) in which expression was reduced under microoxic conditions, was the operon (SufBCD) coding for the proteins involved in the assembly of iron-sulfur clusters ( Shen et al. 2007 )...”
- “...123 17 273 2.78 1.14 AM1_1223 FeS assembly ATPase, SufC 416 80 2067 2.36 2.31 AM1_1224 FeS assembly protein, SufB 177 30 745 2.52 2.07 AM1_5239 Copper/Zinc superoxide dismutase, SodCC 38 100 27 1.37 0.48 AM1_2962 Mn/Fe-containing superoxide dismutase, Sod 98 168 126 0.77 0.36 AM1_3669...”
- UpCoT: an integrated pipeline tool for clustering upstream DNA sequences of orthologous genes in prokaryotic genomes
Arun, 3 Biotech 2016 - “...photosystem II CP43 protein Sll0849 (PsbD) photosystem II D2 protein Acaryochloris marina MBIC 11017 Am1_4412 Am1_1224 Am1_2984 Am1_1677 Am1_5511 Am1_1084 Am1_4084 Anabaena variabilis ATCC 29413 Ava_3627 Ava_0424 Ava_4539 Ava_2220 Ava_4451 Ava_1243 Ava_2512 Cyanothece PCC 7424 Pcc7424_1789 Pcc7424_4729 Pcc7424_1683 Pcc7424_1517 Pcc7424_4233 Pcc7424_0578 Pcc7424_2974 Gloeobacter violaceus PCC 7421...”
CC1864, CC_1864 conserved hypothetical protein (NCBI ptt file) from Caulobacter crescentus CB15
CCNA_01940 ABC transporter-associated protein sufB (RefSeq) from Caulobacter crescentus NA1000
Aligns to 225:460 / 489 (48.3%), covers 99.5% of PF01458, 224.7 bits
- Global transcriptional response of Caulobacter crescentus to iron availability
da, BMC genomics 2013 - “...CC_1861 CCNA_01937 SufD protein 5.90 CC_1862 CCNA_01938 ATP-dependent transporter sufC 7.89 CC_1863 CCNA_01939 ADP-ribosylglycohydrolase 8.30 CC_1864 CCNA_01940 ABC transporter-associated protein sufB 7.81 CC_1865 CCNA_01941 Cysteine desulfhydrase/Selenocysteine lyase 7.09 CC_1866 b CCNA_01942 Rrf2 family transcriptional regulator 7.98 Oxidative stress CC_0141 CCNA_00140 Glutathione synthetase 2.55 CC_0993 CCNA_01045 Conserved...”
- Global transcriptional response of Caulobacter crescentus to iron availability
da, BMC genomics 2013 - “...CCNA_01937 SufD protein 5.90 CC_1862 CCNA_01938 ATP-dependent transporter sufC 7.89 CC_1863 CCNA_01939 ADP-ribosylglycohydrolase 8.30 CC_1864 CCNA_01940 ABC transporter-associated protein sufB 7.81 CC_1865 CCNA_01941 Cysteine desulfhydrase/Selenocysteine lyase 7.09 CC_1866 b CCNA_01942 Rrf2 family transcriptional regulator 7.98 Oxidative stress CC_0141 CCNA_00140 Glutathione synthetase 2.55 CC_0993 CCNA_01045 Conserved hypothetical...”
gvip196 hypothetical protein (NCBI) from Gloeobacter violaceus PCC 7421
Aligns to 219:453 / 482 (48.8%), covers 99.5% of PF01458, 223.5 bits
TP0612 conserved hypothetical protein (NCBI ptt file) from Treponema pallidum subsp. pallidum str. Nichols
TPASS_0612 hypothetical protein (RefSeq) from Treponema pallidum subsp. pallidum SS14
Aligns to 224:450 / 479 (47.4%), covers 99.5% of PF01458, 223.1 bits
- Biophysical and bioinformatic analyses implicate the Treponema pallidum Tp34 lipoprotein (Tp0971) in transition metal homeostasis
Brautigam, Journal of bacteriology 2012 - “...a few genes that encode iron-requiring proteins: tp0152, tp0612, tp0613, tp0615, tp0972, tp0991, and tp1038 (from UniProtKB annotations), as well as tp0053,...”
- Correction: Identification of Functional Candidates amongst Hypothetical Proteins of Treponema pallidum ssp. pallidum
Naqvi, PloS one 2018 - “...121. HP TPASS_0608 6333867 B2S3J8 ARM repeat containing protein(intracellular signalling and cytoskeletal regulation) 122. HP TPASS_0612 6333155 B2S3K2 Fe-S cluster assembly protein SufB 123. HP TPASS_0613 6333336 B2S3K3 Fe-S cluster assembly protein SufB 124. HP TPASS_0622 6332909 B2S3L2 Tetratricopeptide repeat containing protein 125. HP TPASS_0624 6332843...”
- Identification of functional candidates amongst hypothetical proteins of Treponema pallidum ssp. pallidum
Naqvi, PloS one 2015 - “...6333138 B2S3I3 D-alanyl-D-alanine carboxypeptidase HP TPASS_0608 6333867 B2S3I9 Zinc finger domain containing protein(DNA binding) HP TPASS_0612 6333155 B2S3J8 ARM repeat containing protein(intracellular signalling and cytoskeletal regulation) HP TPASS_0613 6333336 B2S3K2 Fe-S cluster assembly protein SufB HP TPASS_0622 6332909 B2S3K3 Fe-S cluster assembly protein SufB HP TPASS_0624...”
- “...B2S3A6 Virulent Non Virulent HP TPASS_0515 B2S3A9 Virulent Virulent HP TPASS_0534 B2S3C6 Virulent Virulent HP TPASS_0612 B2S3K2 Virulent Non Virulent HP TPASS_0622 B2S3L2 Virulent Virulent HP TPASS_0675 B2S3R4 Virulent Virulent HP TPASS_0706 B2S3U5 Virulent Non Virulent HP TPASS_0710 B2S3U9 Virulent Non Virulent HP TPASS_0782 B2S421 Virulent...”
AB8I_ARATH / Q9ZS97 UPF0051 protein ABCI8, chloroplastic; ABC transporter I family member 8; ABC transporter ABCI.8; AtABCI8; Non-intrinsic ABC protein 1; Protein ABC1; Plastid sufB-like protein; Protein LONG AFTER FAR-RED 6 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
AT4G04770 ATABC1 (ATP BINDING CASSETTE PROTEIN 1); ATPase, coupled to transmembrane movement of substances / protein binding / transporter (RefSeq) from Arabidopsis thaliana
NP_192386 ATP binding cassette protein 1 from Arabidopsis thaliana
Aligns to 294:528 / 557 (42.2%), covers 99.5% of PF01458, 222.9 bits
- function: Involved in light signaling, probably by mediating the transport and correct distribution of protoporphyrin IX, a chlorophyll precursor, in response to far-red light.
disruption phenotype: Plant have an enhanced hypocotyl elongation in far-red light, and accumulates protoporphyrin IX. - A Global Proteomic Approach Sheds New Light on Potential Iron-Sulfur Client Proteins of the Chloroplastic Maturation Factor NFU3
Berger, International journal of molecular sciences 2020 - “...4Fe4S Siroheme biosynthesis Sirohydrochlorin ferrochelatase B At1g10500 SUFA1 n.d. n.q. 4Fe4S Fe-S cluster transfer SUFA1 At4g04770 SUFB1 n.v. n.q. 4Fe4S Fe-S cluster assembly SUFB1 At5g50210 SUFE3 n.d. n.q. 4Fe4S NAD biosynthesis Sulfur E3 At2g29630 THIC absent n.q. 4Fe4S Thiamin biosynthesis Thiamin C At2g24820 TIC55 +0.90 **...”
- Regulation of Iron Homeostasis and Use in Chloroplasts
Kroh, International journal of molecular sciences 2020 - “...Conserved in Green Linage and Diatoms 27 (CGLD27) AT5G67370 Cre05.g237050.t1.1 WP_010873853 Suf FeS assembly SUFB AT4G04770 Cre15.g643600.t1.2 [ 128 ] slr0074 [ 128 ] SUFC AT3G10670 Cre07.g339700.t1.2 [ 128 ] slr0075 [ 128 ] SUFD AT5G44316 Cre12.g513950.t1.2 * [ 128 ] slr0076 [ 128 ] SUFS...”
- Identifying Early Warning Signals for the Sudden Transition from Mild to Severe Tobacco Etch Disease by Dynamical Network Biomarkers
Tarazona, Viruses 2019 - “...thus with enhanced susceptibility to infection [ 60 ] PPIN DNB-175 is composed by genes At4g04770 ( NUCLEOSOME ASSEMBLY PROTEIN 1 , NAP1 ) and At3g10670 ( ABC TRANSPORTER I FAMILY MEMBER 6 , ABCI6 ). Both proteins belong to the ATP-binding cassette (ABC) superfamily [...”
- Transcriptomic response of Arabidopsis thaliana exposed to hydroxylated polychlorinated biphenyls (OH-PCBs)
Subramanian, International journal of phytoremediation 2019 - “...2.61 At5g25130 Cytochrome P450 71B12 Iron binding/homeostasis 2.03 At3g48310 Cytochrome P450 71A22 Iron binding/homeostasis 2.31 At4g04770 ATP binding cassette protein Response to iron 2.43 At5g17170 Rubredoxin family protein Iron binding/homeostasis 4.28 At4g08950 Phosphate-responsive 1 family protein Response to brassinosteroid 2.55 2.35 2.80 At1g21910 Ethylene-responsive transcription factor...”
- Cytokinin at the Crossroads of Abiotic Stress Signalling Pathways
Pavlů, International journal of molecular sciences 2018 - “...1/1 [ 193 , 195 ] FER1 AT5G01600 Ferritin-1 [ 193 , 194 ] ABCI8 AT4G04770 UPF0051 protein ABCI8 [ 193 , 194 ] At2g36885 AT2G36885 Translation initiation factor 0/1 [ 193 , 194 , 195 ] APXS AT4G08390 Stromal ascorbate peroxidase 1/1 [ 193 ,...”
- Assembly and Transfer of Iron-Sulfur Clusters in the Plastid
Lu, Frontiers in plant science 2018 - “...mutant Embryo lethal Katoh et al., 2006 ; Murthy et al., 2007 Scaffold complex SufB At4g04770 ATPase activity; complements E. coli SufB mutant Embryo lethal (strong alleles); pale green and growth retardation (weak alleles) Mller et al., 2001 ; Ahn et al., 2005 ; Xu et...”
- The Understanding of the Plant Iron Deficiency Responses in Strategy I Plants and the Role of Ethylene in This Process by Omic Approaches
Li, Frontiers in plant science 2017 - “...0.5 0.6 Misc AT3G09220 LAC7, LACCASE 7 1.2 1.3 0.3 0.2 0.3 0.3 0.3 Protein AT4G04770 ABC1, ARABIDOPSIS THALIANA NUCLEOSOME ASSEMBLY PROTEIN 1 0.9 0.7 0.4 0.4 0.4 0.4 0.6 Transport AT1G60960 IRT3, IRON REGULATED TRANSPORTER 3 0.8 0.6 0.3 0.3 0.4 0.5 0.3 AT2G32270 ZIP3,...”
- Iron homeostasis in Arabidopsis thaliana: transcriptomic analyses reveal novel FIT-regulated genes, iron deficiency marker genes and functional gene networks
Mai, BMC plant biology 2016 - “...AT5G01600 -1 0 -1 -1 -1 -1 -1 -1 -1 -1 -1 0 -0.83 ATABC1 AT4G04770 -1 0 -1 -1 -1 -1 -1 -1 0 -1 -1 0 -0.75 unknown AT2G36885 -1 0 0 0 -1 -1 -1 -1 -1 -1 -1 0 -0.67 PSAF AT1G31330...”
- “...or GLP5 over-expression mutants. The three topmost ranked down-regulated genes are AT5G01600 ( FER1 ), AT4G04770 ( ATABC1 ) and AT2G36885 (unknown protein) (Table 3 ). However, since their rank absolute value is lower than the five topmost induced genes they are less suitable as robust...”
- More
- Involvement of AtNAP1 in the regulation of chlorophyll degradation in Arabidopsis thaliana.
Nagane, Planta 2010 (PubMed)- GeneRIF: Data show involvement of AtNAP1 in the regulation of chlorophyll degradation in Arabidopsis thaliana.
- A truncated Arabidopsis NUCLEOSOME ASSEMBLY PROTEIN 1, AtNAP1;3T, alters plant growth responses to abscisic acid and salt in the Atnap1;3-2 mutant.
Liu, Molecular plant 2009 (PubMed)- GeneRIF: Study uncovered AtNAP1 proteins as positive regulators and AtNAP1;3T as a negative regulator in ABA signaling pathways, providing a novel link of chromatin remodeling to hormonal and stress responses.
- AtNAP1 represents an atypical SufB protein in Arabidopsis plastids.
Xu, The Journal of biological chemistry 2005 - GeneRIF: results show that AtNAP1 is an iron-stimulated ATPase and is capable of forming homodimers, and suggest that AtNAP1 represents an atypical plastidic SufB-like protein important for Fe-S cluster assembly and for regulating iron homeostasis (AtNAP1)
Bfl359 putative ABC transporter sufB (NCBI) from Candidatus Blochmannia floridanus
Aligns to 236:471 / 500 (47.2%), covers 99.5% of PF01458, 222.9 bits
t1238 conserved hypothetical protein (NCBI ptt file) from Salmonella enterica subsp. enterica serovar Typhi Ty2
Aligns to 233:466 / 495 (47.3%), covers 99.5% of PF01458, 222.8 bits
MCHK_1838 Fe-S cluster assembly protein SufD from Mesorhizobium huakuii 7653R
Aligns to 170:393 / 422 (53.1%), covers 99.1% of PF01458, 222.7 bits
Dda3937_03668 Fe-S cluster assembly protein SufB from Dickeya dadantii 3937
Aligns to 237:470 / 499 (46.9%), covers 99.5% of PF01458, 222.5 bits
SAR11_0739 FeS assembly protein SufB (NCBI) from Candidatus Pelagibacter ubique HTCC1062
Aligns to 217:451 / 480 (49.0%), covers 99.5% of PF01458, 221.8 bits
alr2492 probable ABC transporter membrane protein (ycf24) (NCBI ptt file) from Nostoc sp. PCC 7120
Aligns to 216:450 / 479 (49.1%), covers 99.5% of PF01458, 221.6 bits
sync_2483 FeS assembly protein SufB (NCBI) from Synechococcus sp. CC9311
Aligns to 216:450 / 479 (49.1%), covers 99.5% of PF01458, 220.9 bits
Ava_0424 FeS assembly protein SufB (NCBI) from Anabaena variabilis ATCC 29413
Aligns to 216:450 / 479 (49.1%), covers 99.5% of PF01458, 220.9 bits
AZC_1044 FeS assembly SufB protein (RefSeq) from Azorhizobium caulinodans ORS 571
Aligns to 230:464 / 493 (47.7%), covers 99.5% of PF01458, 219.8 bits
blr4339 blr4339 (NCBI ptt file) from Bradyrhizobium japonicum USDA 110
Aligns to 235:469 / 498 (47.2%), covers 99.5% of PF01458, 219.2 bits
- A bacterial iron exporter for maintenance of iron homeostasis
Sankari, The Journal of biological chemistry 2014 - “...approximately 2-fold in the mutant, and bll0466 was 3-fold higher. blr4339 mRNA did not increase further in the mutant upon an iron increase from 20 to 100 M,...”
- “...FeCl3. The steady-state transcript levels of leuC, bfr, blr4339, bll0466, and blr0512 were analyzed by qualitative real-time PCR. The data are expressed as...”
P9303_03021 ABC transporter, membrane component (VIMSS_AUTO) from Prochlorococcus marinus str. MIT 9303
Aligns to 217:451 / 480 (49.0%), covers 99.5% of PF01458, 218.4 bits
SYNW0319 ABC transporter, membrane component (VIMSS) from Synechococcus sp. WH 8102
Aligns to 216:450 / 479 (49.1%), covers 99.5% of PF01458, 217.9 bits
- Operon prediction by comparative genomics: an application to the Synechococcus sp. WH8102 genome
Chen, Nucleic acids research 2004 - “...Prediction result Likelihood score (SYNW0211, (SYNW0319, (SYNW0708, (SYNW0840, (SYNW0969, (SYNW1086, (SYNW1111, (SYNW1168, (SYNW1270, (SYNW1283, (SYNW1340,...”
- “...(SYNW1915, (SYNW2393, (SYNW2438, (SYNW2479, (SYNW2485, Exactly found (SYNW0319, 0320, 0321, 0322) Exactly found (SYNW0840, 0841); (SYNW0842, 0843) Exactly found...”
HVO_0861 FeS assembly protein SufD (RefSeq) from Haloferax volcanii DS2
Aligns to 149:376 / 402 (56.7%), covers 99.1% of PF01458, 217.3 bits
PF1286 hypothetical protein (NCBI ptt file) from Pyrococcus furiosus DSM 3638
Aligns to 218:444 / 475 (47.8%), covers 99.5% of PF01458, 216.8 bits
Ta0203 conserved hypothetical protein (NCBI ptt file) from Thermoplasma acidophilum DSM 1728
Aligns to 224:450 / 481 (47.2%), covers 99.5% of PF01458, 216.7 bits
- An Adaptation To Life In Acid Through A Novel Mevalonate Pathway
Vinokur, Scientific reports 2016 - “...WP_010901303 0.4% 4 51.1 4 Glutamine Synthetase (Ta1498) WP_010901897 0.6% 5 55.0 1 Hypothetical Protein (Ta0203) WP_010900630 0.2% 6 45.0 1 Hypothetical Protein (Ta0204) WP_010900631 0.1% 7 35.5 1 DNA Repair Protein RadA (Ta1104) WP_010901514 0.0% NanoLC/MS/MS identified seven proteins which were present in the entire...”
SMc00532 CONSERVED HYPOTHETICAL PROTEIN (NCBI ptt file) from Sinorhizobium meliloti 1021
Aligns to 170:395 / 425 (53.2%), covers 98.6% of PF01458, 215.8 bits
- Robustness encoded across essential and accessory replicons of the ecologically versatile bacterium Sinorhizobium meliloti
diCenzo, PLoS genetics 2018 - “...protein 0.011 2.586 fpr ferredoxinNADP reductase 0.002 0.248 nuoK1 NADH dehydrogenase subunit K 0.006 1.330 smc00532 hypothetical protein 0.002 0.203 folD2 5,10-methylene-THF dehydrogenase 0.018 3.110 ubiE ubiquinone biosynthesis methyltransferase 0.002 0.209 coaA pantothenate kinase 0.004 0.595 asd aspartate-semialdehyde dehydrogenase 0.002 0.157 argF1 ornithine carbamoyltransferase 0.012 1.776...”
- An integrated approach to functional genomics: construction of a novel reporter gene fusion library for Sinorhizobium meliloti
Cowie, Applied and environmental microbiology 2006 - “...sensor histidine kinase SMc00532 ................................Conserved hypothetical protein SMc00611 ................................Hypothetical...”
- Role of the regulatory gene rirA in the transcriptional response of Sinorhizobium meliloti to iron limitation
Chao, Applied and environmental microbiology 2005 - “...For instance, a cluster of genes (SMc00530, SMc00531, SMc00532, SMc00533, SMc00302, and SMc00301), including a putative nifS gene, was derepressed in the S....”
- “...showed that the products of SMc00301, SMc00530, SMc00531, SMc00532, and SMc00533 exhibited homology to the E. coli SufA, SufB, SufC, SufD, and SufS proteins,...”
SSO0927 Conserved hypothetical protein (NCBI ptt file) from Sulfolobus solfataricus P2
Aligns to 221:448 / 479 (47.6%), covers 99.5% of PF01458, 215.6 bits
TON_0850 hypothetical protein (RefSeq) from Thermococcus onnurineus NA1
Aligns to 218:444 / 475 (47.8%), covers 99.5% of PF01458, 215.4 bits
AL01_02560 Fe-S cluster assembly protein SufD from Bombella intestini
Aligns to 151:374 / 399 (56.1%), covers 99.1% of PF01458, 213.9 bits
- Whole-Genome Sequence Analysis of Bombella intestini LMG 28161T, a Novel Acetic Acid Bacterium Isolated from the Crop of a Red-Tailed Bumble Bee, Bombus lapidarius
Li, PloS one 2016 - “.... Gene product Locus tag ABC transporter AL01_07240, AL01_02455 ABC transporter permease AL01_07235, AL01_07895, AL01_01955, AL01_02560, AL01_04765, AL01_08515 ABC transporter substrate-binding protein AL01_03865 ABC transporter ATP-binding protein AL01_06795, AL01_00180, AL01_00230, AL01_01625, AL01_01630, AL01_01950 Multidrug ABC transporter AL01_08210, AL01_08950 Multidrug ABC transporter substrate-binding protein AL01_02460 Multidrug ABC...”
lmo2414 similar to aminotransferase (NCBI ptt file) from Listeria monocytogenes EGD-e
Aligns to 182:407 / 433 (52.2%), covers 98.6% of PF01458, 213.9 bits
ST1200 479aa long conserved hypothetical protein (NCBI ptt file) from Sulfolobus tokodaii str. 7
Aligns to 221:448 / 479 (47.6%), covers 99.5% of PF01458, 212.8 bits
BSU32700 FeS assembly protein SufD (RefSeq) from Bacillus subtilis subsp. subtilis str. 168
Aligns to 184:411 / 437 (52.2%), covers 99.1% of PF01458, 210.8 bits
- The Blueprint of a Minimal Cell: MiniBacillus
Reuß, Microbiology and molecular biology reviews : MMBR 2016 - “...sufC fra yutI BSU02870 No BSU03950 No BSU32670 BSU32680 BSU32700 BSU32690 BSU32710 BSU05750 BSU32220 Yes Yes Yes Yes Yes No No BSU28390 Yes Metals and...”
PPA1548 conserved protein, UPF0051 (NCBI) from Propionibacterium acnes KPA171202
Aligns to 163:386 / 424 (52.8%), covers 99.1% of PF01458, 210.8 bits
- Comparative genomics and transcriptomics of Propionibacterium acnes
Brzuszkiewicz, PloS one 2011 - “...produced by the host immune system; PPA1548-1550, encoding proteins similar to SufB (PPA1549) and SufD (PPA1548), which are part of the iron-sulfur cluster scaffold complex SufBCD, which functions under iron starvation and oxidative stress conditions [41] . Growth phase-dependent expression of putative virulence factors Two machineries...”
RBAM_029780 YurX (RefSeq) from Bacillus amyloliquefaciens FZB42
Aligns to 184:411 / 437 (52.2%), covers 99.1% of PF01458, 209.9 bits
- Differential proteomics analysis of Bacillus amyloliquefaciens and its genome-shuffled mutant for improving surfactin production
Zhao, International journal of molecular sciences 2014 - “...+34.7 222 Hypothetical protein KSO_14324 gi|363725374 EHM05512 6927/4.56 6843/4.49 120 70 +2.7 310 Hypothetical protein RBAM_029780 gi|154687379 YP_001422540 yurX 48,265/5.30 48,965/5.33 109 32 +29.1 316 GroEL gene product gi|311067075 YP_003971998 groEL 57,385/4.75 56,789/4.78 190 43 +6. 6 622 Response regulator DegU gi|157693950 YP_003974978 degU 25,893/5.65 27,124/5.67...”
- “...cofactor linkage, porphyrin-containing compound biosynthetic process Hydroxymethylbilane synthase activity General Function Prediction 310 Hypothetical protein RBAM_029780 R Unknown Iron-sulfur cluster assembly Unknown 1019 Hypothetical protein RBAM_026720 R Cytoplasmic Unknown Hydrolase activity, acting on glycosyl bonds 1021 Hypothetical protein RBAM_008040 R Cytoplasmic Unknown Hydrolase activity, acting on...”
Q9HRV5 SufB domain protein from Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
Aligns to 151:378 / 404 (56.4%), covers 99.1% of PF01458, 208.8 bits
EF2393 conserved hypothetical protein (NCBI ptt file) from Enterococcus faecalis V583
Aligns to 174:401 / 428 (53.3%), covers 99.1% of PF01458, 207.8 bits
- Genes Contributing to the Unique Biology and Intrinsic Antibiotic Resistance of Enterococcus faecalis
Gilmore, mBio 2020 (no snippet) - Oxidative stress enhances the expression of sulfur assimilation genes: preliminary insights on the Enterococcus faecalis iron-sulfur cluster machinery regulation
Riboldi, Memorias do Instituto Oswaldo Cruz 2014 - “...primers (Invitrogen). E. faecalis V583 reference sequences for primer design for sufC (GenBank EF2394), sufD (EF2393), sufS (EF2392), sufU (EF2391), sufB (EF2390), kat (EF1597), fur (EF1525), oxyR (EF2958), 23S rRNA (EF23SD), elongation factor for transporter RNA ( tuf ) (EF0201), RNA polymerase beta chain ( rpoB...”
BBMN68_611 Fe-S cluster assembly protein SufD from Bifidobacterium longum subsp. longum BBMN68
Aligns to 149:371 / 411 (54.3%), covers 98.2% of PF01458, 207.0 bits
- Transcriptomic analysis of Bifidobacterium longum subsp. longum BBMN68 in response to oxidative shock
Zuo, Scientific reports 2018 - “...for RT-PCR. Gene (Locus tag) Primer sequence (53) Size of product (bp) Forward Reverse sufB1 (BBMN68_611) ACGACGGTGACGCACGACT AGATGCCGAGCATGTTGAGGT 243 glycerate kinase (BBMN68_585) GCCCTCGGCGTTCGTCTTCT CAATGTGGCGACATCATCTTTGGA 225 grxC2 (BBMN68_1397) GCAGTGCGATGCCACCAAG CAGGAGTTGTCCGGCGTGAT 147 tatC (BBMN68_1285) GGAGCCGGACTGGCATGGTATCT CGTTGCGAGACGCCACTGCTT 228 hcaD (BBMN68_1524) ACGCCAGAACCCTCACCTACC CCGATCACCACTGCCGACTT 217 16S rRNA (BBMN68_rRNA7) CGTAGGGTGCAAGCGTTATC GCCTTCGCCATTGGTGTT 197...”
- “...assembly protein SufB sufB2 NS 1.49 BBMN68_612 FeS cluster assembly protein SufD sufB1 1.10 2.12 BBMN68_611 Iron complex transport system ATP-binding protein modF NS 1.46 BBMN68_569 P-type ATPase zntA1 NS 1.01 BBMN68_1149 Protein repair/chaperones Heat-shock molecular chaperone ibpA 2.91 2.77 BBMN68_1305 Molecular chaperone DnaJ dnaJ1 NS...”
CT684 ABC Transporter (NCBI ptt file) from Chlamydia trachomatis D/UW-3/CX
Aligns to 219:454 / 483 (48.9%), covers 99.5% of PF01458, 206.8 bits
BC4982 ABC transporter-associated protein (NCBI ptt file) from Bacillus cereus ATCC 14579
Aligns to 179:404 / 430 (52.6%), covers 99.1% of PF01458, 206.0 bits
- The PlcR virulence regulon of Bacillus cereus
Gohar, PloS one 2008 - “...this microarray analysis, either at t 0 (BC4986) or at t 2 (BC0069, BC1736, BC3520, BC4982, BC4983). 10.1371/journal.pone.0002793.g001 Figure 1 plcR-wt expression ratios as determined by microarray experiments. Ratios of expression between the wildtype strain and the delta plcR strain as determined by microarrays. The log2...”
MMP1169 conserved hypothetical protein (NCBI) from Methanococcus maripaludis S2
Aligns to 155:380 / 418 (54.1%), covers 99.5% of PF01458, 204.6 bits
BR0933 hypothetical protein (NCBI) from Brucella suis 1330
Aligns to 173:396 / 425 (52.7%), covers 98.2% of PF01458, 204.4 bits
- ATP-Binding Cassette Systems of Brucella
Jenner, Comparative and functional genomics 2009 - “...Iron/sulphur centre biogenesis CYTP BMEI1040 BruAb10941 BR0931 ISB (ABCX) Iron/sulphur centre biogenesis CYTP BMEI1042 BruAb10940 BR0933 ISB (ABCX) Iron/sulphur centre biogenesis ABC BMEI1041 BruAb10942 BR0932 32 ISVH Iron-siderophores, VB12 and Hemin import ABC BMEI0660 BruAb11342 BR1344 BOV_1302 BCAN_A1371 ISVH Iron-siderophores, VB12 and Hemin import IM BMEI0659...”
BMEI1040 ABC TRANSPORTER ATP-BINDING PROTEIN (NCBI ptt file) from Brucella melitensis 16M
Aligns to 173:396 / 425 (52.7%), covers 98.2% of PF01458, 204.3 bits
- Comparative Transcriptome Analysis of Artificially Induced Rough-Mutant Brucella Strain RM57 and Its Parent Strain Brucella melitensis M1981
Peng, Frontiers in veterinary science 2019 - “...). Among these, the highest ranked upregulated genes included BMEI1041 , BMEII0642 , BMEII1003 , BMEI1040 , BMEII0987 , BMEII0105 , BMEI1362 , BMEII0988 , BMEII0353 , and BMEII0321 while BMEI0427 , BMEI1313 , BMEI0877 , BMEII0948 , BMEII0759 , BMEI0422 , BMEI0386 , BMEII0758 ,...”
- “...subunit 2 BMEI0454 1.73 3.75 Outer membrane protein W BMEII0987 2.41 4.63 Uncharacterized conserved protein BMEI1040 8.93 4.65 ABC-type transport system involved in Fe-S cluster assembly, permease component BMEII1003 5.00 4.65 Membrane protein involved in the export of O-antigen and teichoic acid BMEII0642 2.33 4.77 Transcriptional...”
- Transcriptomic Analysis of the Brucella melitensis Rev.1 Vaccine Strain in an Acidic Environment: Insights Into Virulence Attenuation
Salmon-Divon, Frontiers in microbiology 2019 - “...we conducted a real-time qPCR analysis of five selected genes (BMEII0027, BMEII0591, BMEI1980, BMEII1116, and BMEI1040), from both strains (16M and Rev.1), grown under either low- or normal-pH conditions. The mRNA levels of all genes obtained by the RT-qPCR were in high accordance with those obtained...”
- ATP-Binding Cassette Systems of Brucella
Jenner, Comparative and functional genomics 2009 - “...Branched-chain amino acids IM BruAb20808 BRA0393 BOV_A0336 BCAN_B0397 31 ISB (ABCX) Iron/sulphur centre biogenesis CYTP BMEI1040 BruAb10941 BR0931 ISB (ABCX) Iron/sulphur centre biogenesis CYTP BMEI1042 BruAb10940 BR0933 ISB (ABCX) Iron/sulphur centre biogenesis ABC BMEI1041 BruAb10942 BR0932 32 ISVH Iron-siderophores, VB12 and Hemin import ABC BMEI0660 BruAb11342...”
- “...BMEI1743 IM-ABC BMEI1742 + 22 FAE Fatty acid export IM-ABC BMEII0976 + + + CYTP BMEI1040 + + 31 ISB (ABCX) Iron/sulphur centre biogenesis CYTP BMEI1042 + + ABC BMEI1041 + + ABC BMEI0964 + + + 36 MKL Involved in toluene tolerance IM BMEI0965, ttg2B...”
CAC3290 Iron-regulated ABC-type transporter membrane component (SufB) (NCBI ptt file) from Clostridium acetobutylicum ATCC 824
Aligns to 113:338 / 366 (61.7%), covers 98.2% of PF01458, 203.0 bits
- The role of PerR in O2-affected gene expression of Clostridium acetobutylicum
Hillmann, Journal of bacteriology 2009 - “...11, 2017 by University of California, Berkeley CAC3289 CAC3290 CAC3291 CAC3292 CAC3624 CAC3625 Gene 6088 HILLMANN ET AL. FIG. 2. PerR consensus-like conserved...”
- The transcriptional program underlying the physiology of clostridial sporulation
Jones, Genome biology 2008 - “...the iron permease CAC0788, feoA , feoB , fhuC , and two iron-regulated transporters (CAC3288, CAC3290), which is consistent with the earlier, more limited data [ 7 ]. Significantly, iron-limitation has been found to promote solventogenesis [ 20 ]. Solventogenesis, clostridial form, stress proteins, and early...”
Teth39_0118 SufBD protein (RefSeq) from Thermoanaerobacter ethanolicus ATCC 33223
Aligns to 98:321 / 349 (64.2%), covers 98.2% of PF01458, 202.7 bits
AB7I_ARATH / Q9LQK7 Protein ABCI7, chloroplastic; ABC transporter I family member 7; ABC transporter ABCI.7; AtABCI7; Non-intrinsic ABC protein 6; Plastid SufD-like protein from Arabidopsis thaliana (Mouse-ear cress) (see paper)
AT1G32500 non-intrinsic ABC protein 6 from Arabidopsis thaliana
Aligns to 223:450 / 475 (48.0%), covers 99.5% of PF01458, 202.2 bits
- subunit: Interacts with NAP7.
- Assembly and Transfer of Iron-Sulfur Clusters in the Plastid
Lu, Frontiers in plant science 2018 - “...al., 2010 ; Wollers et al., 2010 ; Hu et al., 2017a Scaffold complex SufD At1g32500 Fe acquisition Seed abortion; reduced chlorophyll content; defects in plastid morphology Xu and Mller, 2004 ; Hjorth et al., 2005 ; Saini et al., 2010 ; Wollers et al., 2010...”
- Dissecting the subcellular membrane proteome reveals enrichment of H+ (co-)transporters and vesicle trafficking proteins in acidic zones of Chara internodal cells
Pertl-Obermeyer, PloS one 2018 - “...3 (NAP3) 1 1 0 at1g67940 V non-intrinsic ABC protein 6 (NAP6) 27 12 15 at1g32500 P non-intrinsic ABC protein 8 (NAP8) 56 20 36 at4g25450 P P-glycoprotein 9 (PGP9) 8 6 2 at4g18050 PM, V P-glycoprotein 11 (PGP11) 2 1 1 at1g02520 PM protein kinase...”
- Transcriptome-wide high-throughput deep m(6)A-seq reveals unique differential m(6)A methylation patterns between three organs in Arabidopsis thaliana
Wan, Genome biology 2015 - “...AT3G20560, AT1G56290 [ 18 , 54 , 55 ] RNA post-transcriptional processing AT1G24050, AT1G24706, AT1G31870, AT1G32500, AT1G64572, AT3G11540, AT1G35470, AT1G73720, AT3G11960, AT3G19670, [ 18 , 56 59 ] AT3G47890, AT3G53500, AT3G53500, AT5G51660, AT3G56825, AT3G57570, AT3G19515, AT3G19630, AT3G13290, AT5G10370, AT4G02970, AT5G62600, AT3G55220, AT3G10070 Proteolysis or protein synthesis...”
- “...AT2G01010, AT2G43375, AT3G56825, AT2G46192, AT5G06165, AT1G61275, AT4G39363, AT3G41979, AT1G12013 RNA post-transcriptional processing AT1G24050, AT1G24706, AT1G31870, AT1G32500, AT1G64572, AT3G11540, AT1G35470, AT1G73720, AT3G11960, AT3G19670, [ 18 , 56 59 ] AT3G47890, AT3G53500, AT3G53500, AT5G51660, AT3G56825, AT3G57570, AT3G19515, AT3G19630, AT3G13290, AT5G10370, AT4G02970, AT5G62600, AT3G55220, AT3G10070 a Suggests the function...”
- Post-Transcriptional Coordination of the Arabidopsis Iron Deficiency Response is Partially Dependent on the E3 Ligases RING DOMAIN LIGASE1 (RGLG1) and RING DOMAIN LIGASE2 (RGLG2)
Pan, Molecular & cellular proteomics : MCP 2015 - “...At1g01410 At1g28060 At5g20320 At5g22880 At5g01770 At1g32500 At3g10670 At5g57030 At4g31560 At5g51720 At1g55140 At1g44446 At4g14890 At1g59760 At3g55460 At5g09230...”
- Whole-transcriptome survey of the putative ATP-binding cassette (ABC) transporter family genes in the latex-producing laticifers of Hevea brasiliensis
Zhiyi, PloS one 2015 - “...AtABCI1 86 NAP; ISB HbABCI6 KM035313 335 NBD At3g10670 AtABCI6 82 HbABCI7 KM035314 492 CYT At1g32500 AtABCI7 62 HbABCI8 KM035315 553 CYT At4g04770 AtABCI8 81 NAP; CBY(Y179) HbABCI10 KM035316 261 NBD At4g33460 AtABCI10 71 HbABCI11 KM035317 277 NBD At5g14100 AtABCI11 72 NAP; MKL; TGD HbABCI13 KM035318...”
- The iron-sulfur cluster assembly machineries in plants: current knowledge and open questions
Couturier, Frontiers in plant science 2013 - “...Nagane et al., 2010 SUFC/ NAP7 At3g10670 Embryo lethal Xu and Moller, 2004 SUFD/ NAP6 At1g32500 Bleached plants with reduced root growth, defects in plastid morphology and in seed germination Hjorth et al., 2005 SUFA1/CpISCA At1g10500 No phenotype Yabe and Nakai, 2006 NFU1 At4g01940 None yet...”
- Genome analysis of Chlamydomonas reinhardtii reveals the existence of multiple, compartmentalized iron-sulfur protein assembly machineries of different evolutionary origins
Godman, Genetics 2008 - “...Mit Mit Mit At1g10500 At4g04770 At3g10670 At1g32500 At4g26500, At1g67810, At5g50210 At1g08490 At4g01940, At5g49940, At4g25910 At5g50960 At4g16440 At2g26060...”
LIMLP_05960 Fe-S cluster assembly protein SufB from Leptospira interrogans serovar Manilae
Aligns to 207:432 / 471 (48.0%), covers 99.5% of PF01458, 200.2 bits
- The transcriptional response of pathogenic Leptospira to peroxide reveals new defenses against infection-related oxidative stress
Zavala-Alvarado, PLoS pathogens 2020 - “...P 4.764 * 5.31e-43 38.900 LIMLP_05955 (LIC11219/LA2809) ahpC Peroxiredoxin/alkylperoxiredoxin reductase O 3.145 * 3.63e-20 11.742 LIMLP_05960 (LIC11220/LA2808) sufB Fe-S cluster assembly protein O 1.056 * 1.60e-08 1.880 LIMLP_10145 (LIC12032/LA1859) katE Catalase P 1.786 2.11e-08 3.477 LIMLP_10150 (LIC12033/LA1858) Ankyrin repeat-containing protein S 2.051 * 2.30e-11 4.183 LIMLP_10155...”
- “...that reduces H 2 O 2 and tert -Butyl hydroxyperoxide [ 22 ]. The SufB-encoding LIMLP_05960 located in the vicinity of ahpC was also up-regulated with a 2-fold. SufB encodes a polypeptide involved in Fe-S cluster assembly proteins. In bacteria such as Escherichia coli , SufB...”
RSP_0434 SufD family Fe-S cluster assembly protein from Rhodobacter sphaeroides 2.4.1
Aligns to 176:397 / 427 (52.0%), covers 98.2% of PF01458, 199.8 bits
- Role of oxygen and the OxyR protein in the response to iron limitation in Rhodobacter sphaeroides
Remes, BMC genomics 2014 - “...-1.06** 1.80 1.61 RSP_3567 znuB , ABC zinc transporter 0.08 0.03 -0.57 -0.13 Cluster VI RSP_0434 sufD , iron-regulated ABC transporter 3.40 -1.47*** 0.40 0.69 RSP_0437 sufC, iron-regulated ABC transporter 1.75 -0.83*** -1.35 -0.66 RSP_0439 hypothetical protein 1.49 -0.76** -0.72 -0.38 RSP_0440 sufB , iron-regulated ABC...”
- Role of the Irr protein in the regulation of iron metabolism in Rhodobacter sphaeroides
Peuser, PloS one 2012 - “...0.67 0.77 1.76 1.51 Ferredoxin II RSP_3342 bfr 0.54 0.70 0.90 1.01 Bacterioferritin Iron utilization RSP_0434 sufD 1.48 2.60 4.32 2.46 Fe-S cluster assembly/repair RSP_0437 sufC 1.46 2.42 4.22 1.93 Fe-S cluster assembly/repair RSP_0439 1.50 2.86 3.42 1.81 Hypothetical protein RSP_0440 sufB 1.72 2.74 3.69 1.63...”
- “...used to investigate the relative expression of hemB (RSP_2848), hemH (RSP_1197), mbfA (RSP_0850) and sufD (RSP_0434) under iron limitation in R. sphaeroides 2.4.1 irr (light gray bars) and wild type (dark gray bars) under microaerobic conditions (non-striped bars) and aerobic conditions (striped bars). Values were normalized...”
Cbei_1850 FeS assembly protein SufD (RefSeq) from Clostridium beijerincki NCIMB 8052
Aligns to 112:337 / 365 (61.9%), covers 97.7% of PF01458, 198.7 bits
- Transcriptional analysis of Clostridium beijerinckii NCIMB 8052 to elucidate role of furfural stress during acetone butanol ethanol fermentation
Zhang, Biotechnology for biofuels 2013 - “...is the iron-sulfur cluster. The expression of genes encoding iron-sulfur cluster assembly proteins (Cbei_1848, Cbei_1849, Cbei_1850, Cbei_1851 and Cbei_1852) increased by up to fivefold (Figure 1 A and Additional file 1 : Table S4A); these genes are classified into the cofactor biosynthetic process (GO:0051188) (Additional file...”
- “...(Figure 1 A and Additional file 1 : Table S4C), and those genes (Cbei_1848, Cbei_1849, Cbei_1850, Cbei_1851 and Cbei_1852) were up-regulated in furfural-challenged cultures by up to 54-fold compared to no more than fivefold during acidogenesis (Figure 1 A and Additional file 1 : Table S4C)....”
SSA_1955 ABC-type Fe-S cluster assembly transporter, permease component, putative (NCBI) from Streptococcus sanguinis SK36
Aligns to 165:392 / 420 (54.3%), covers 99.1% of PF01458, 197.2 bits
SGO_1721 FeS assembly protein SufD (RefSeq) from Streptococcus gordonii str. Challis substr. CH1
Aligns to 165:392 / 420 (54.3%), covers 99.1% of PF01458, 196.7 bits
SP_0868 hypothetical protein (RefSeq) from Streptococcus pneumoniae TIGR4
Aligns to 165:392 / 420 (54.3%), covers 99.1% of PF01458, 196.1 bits
- Multi-omic profiling to assess the effect of iron starvation in Streptococcus pneumoniae TIGR4
Jiménez-Munguía, PeerJ 2018 - “...SP_0623, SP_0624 3/4 Upregulated 38595 SP_0627, SP_0628 2/3 Upregulated 38600 SP_0661, SP_0662 2/2 Upregulated 38642 SP_0868, SP_0869 2/5 Upregulated 38672 SP_0999, SP_1000 2/2 Upregulated 38738 SP_1340, SP_1341, SP_1342, SP_1343, SP_1344 5/5 Upregulated 38776 SP_1509, SP_1510, SP_1511, SP_1512, SP_1513 5/8 Upregulated 38789 SP_1566, SP_1569 2/6 Upregulated 38795...”
- Physiological and molecular characterization of genetic competence in Streptococcus sanguinis
Rodriguez, Molecular oral microbiology 2011 - “...SSA_1027 SGO_0799 SP_1162 SSA_1175 acoC SGO_1131 sucB SP_1263 topA SSA_1184 * topA * SGO_1197 topA SP_0868 SSA_1955 SGO_1721 sufD SP_2000 SSA_1972 SGO_1731 SP_2001 SSA_1973 SGO_1732 SP_2002 SSA_1974 SGO_1733 SP_0338 SSA_2096 clpL SGO_1856 SP_1722 SSA_0456 scrA SGO_1857 --- SSA_0860 SGO_2013 --- --- SGO_2086 --- --- SGO_2088 SP_0054...”
SAG0142 conserved hypothetical protein (NCBI ptt file) from Streptococcus agalactiae 2603V/R
Aligns to 165:392 / 420 (54.3%), covers 99.1% of PF01458, 195.8 bits
SA0775 hypothetical protein (NCBI) from Staphylococcus aureus subsp. aureus N315
Aligns to 182:408 / 435 (52.2%), covers 99.1% of PF01458, 195.1 bits
SACOL0915 FeS assembly protein SufD (NCBI) from Staphylococcus aureus subsp. aureus COL
SAR0877 conserved hypothetical protein (NCBI) from Staphylococcus aureus subsp. aureus MRSA252
Aligns to 182:408 / 435 (52.2%), covers 99.1% of PF01458, 195.1 bits
SAR11_0741 FeS assembly protein sufD (NCBI) from Candidatus Pelagibacter ubique HTCC1062
Aligns to 165:389 / 414 (54.3%), covers 99.1% of PF01458, 194.8 bits
PAP_02350 SufD family Fe-S cluster assembly protein from Palaeococcus pacificus DY20341
Aligns to 190:414 / 442 (50.9%), covers 99.5% of PF01458, 192.6 bits
LLKF_1965 SUF system FeS cluster assembly protein SufD (RefSeq) from Lactococcus lactis subsp. lactis KF147
Aligns to 164:391 / 418 (54.5%), covers 99.1% of PF01458, 190.5 bits
- Strain-Dependent Transcriptome Signatures for Robustness in Lactococcus lactis
Dijkstra, PloS one 2016 - “...LLKF_0663 scrA PTS system sucrose-specific transporter subunit IIABC positive 0.5 LLKF_2232 hypothetical protein negative 0.9 LLKF_1965 sufD SUF system FeS cluster assembly protein SufD positive 11.3 LLKF_0510 adaA methylphosphotriester-DNA alkyltransferase positive 0.1 LLKF_1352 gltB glutamate synthase large subunit negative 5.1 LLKF_1018 ribH riboflavin synthase subunit beta...”
Bfl361 required for stability of iron-sulfur component of FhuF (NCBI) from Candidatus Blochmannia floridanus
Aligns to 174:401 / 433 (52.7%), covers 98.6% of PF01458, 189.8 bits
SPy0287 conserved hypothetical protein (NCBI ptt file) from Streptococcus pyogenes M1 GAS
Aligns to 165:392 / 420 (54.3%), covers 99.1% of PF01458, 189.7 bits
llmg_1973 hypothetical protein (NCBI) from Lactococcus lactis subsp. cremoris MG1363
Aligns to 164:391 / 418 (54.5%), covers 99.1% of PF01458, 188.4 bits
KCA1_1247 Fe-S cluster assembly protein SufD from Lactobacillus pentosus KCA1
Aligns to 178:402 / 433 (52.0%), covers 98.6% of PF01458, 186.6 bits
B7GB73 FeS assembly protein suf from Phaeodactylum tricornutum (strain CCAP 1055/1)
Aligns to 381:642 / 690 (38.0%), covers 99.1% of PF01458, 183.4 bits
CCNA_01937 SufD protein (RefSeq) from Caulobacter crescentus NA1000
CC_1861 conserved hypothetical protein (NCBI ptt file) from Caulobacter crescentus CB15
Aligns to 89:313 / 342 (65.8%), covers 98.6% of PF01458, 182.9 bits
- Global transcriptional response of Caulobacter crescentus to iron availability
da, BMC genomics 2013 - “...CC_1859 CCNA_01935 FeS assembly SUF system protein 5.50 CC_1860 CCNA_01936 Cysteine desulfurase/Selenocysteine lyase 7.58 CC_1861 CCNA_01937 SufD protein 5.90 CC_1862 CCNA_01938 ATP-dependent transporter sufC 7.89 CC_1863 CCNA_01939 ADP-ribosylglycohydrolase 8.30 CC_1864 CCNA_01940 ABC transporter-associated protein sufB 7.81 CC_1865 CCNA_01941 Cysteine desulfhydrase/Selenocysteine lyase 7.09 CC_1866 b CCNA_01942 Rrf2...”
- Global transcriptional response of Caulobacter crescentus to iron availability
da, BMC genomics 2013 - “...5.66 CC_1859 CCNA_01935 FeS assembly SUF system protein 5.50 CC_1860 CCNA_01936 Cysteine desulfurase/Selenocysteine lyase 7.58 CC_1861 CCNA_01937 SufD protein 5.90 CC_1862 CCNA_01938 ATP-dependent transporter sufC 7.89 CC_1863 CCNA_01939 ADP-ribosylglycohydrolase 8.30 CC_1864 CCNA_01940 ABC transporter-associated protein sufB 7.81 CC_1865 CCNA_01941 Cysteine desulfhydrase/Selenocysteine lyase 7.09 CC_1866 b CCNA_01942...”
lp_1469 ABC transporter component (putative) (NCBI ptt file) from Lactobacillus plantarum WCFS1
Aligns to 178:402 / 433 (52.0%), covers 98.6% of PF01458, 181.4 bits
TON_0531 ABC-type transport system involved in Fe-S cluster assembly, permease component (RefSeq) from Thermococcus onnurineus NA1
Aligns to 193:417 / 445 (50.6%), covers 99.5% of PF01458, 181.4 bits
- Metabolic Adaptation to Sulfur of Hyperthermophilic Palaeococcus pacificus DY20341T from Deep-Sea Hydrothermal Sediments
Zeng, International journal of molecular sciences 2020 - “...ironsulfur cluster biogenesis were also upregulated including SipA (TON_0919), SipB (TON_0916), SufC (TON_0530), SufBD-related proteins (TON_0531 and TON_0849-0850), and the FeS cluster carrier protein Mrp/Nbp35 family ATP-binding protein (TON_1843) [ 10 ]. In Pa. pacificus , ABC-type iron (III)-siderophore transporter (PAP_06035-06040) and ferrous iron transporter (feoAB,...”
- Proteomic Insights into Sulfur Metabolism in the Hydrogen-Producing Hyperthermophilic Archaeon Thermococcus onnurineus NA1
Moon, International journal of molecular sciences 2015 - “...Y 0.92 0.85 Y 0.40 0.41 ABC-type transport system involved in FeS cluster assembly (SufBD) TON_0531 0.74 0.84 Y 0.27 0.35 Y Hypothetical protein TON_0849 (SufBD-domain containing protein) TON_0849 4.26 2.29 0.37 1.00 1.00 0.00 Hypothetical protein TON_0850 (SufBD-domain containing protein) TON_0850 Y Y 0.38 Y...”
- “...biogenesis were also found to be up-regulated to some extent, including SufC (TON_0530), SufBD-related proteins (TON_0531 and TON_0849-0850), and FeS cluster carrier protein Mrp/Nbp35 family ATP-binding protein (TON_1843). Such archaeal Suf proteins constitute the iron sulfur cluster assembly machinery [ 2 ]. These results indicate that...”
OENOO_57012 ABC-type Fe-S cluster assembly transport system, permease component (NCBI) from Oenococcus oeni ATCC BAA-1163
Aligns to 166:392 / 426 (53.3%), covers 98.6% of PF01458, 179.3 bits
- A partial proteome reference map of the wine lactic acid bacterium Oenococcus oeni ATCC BAA-1163
Mohedano, Open biology 2014 - “...(OENOO_65021). In addition, we identified subunits of the ABC transporters associated with iron (OENOO_57011 and OENOO_57012), cobalt (OENOO_44010) and phosphate (OENOO_58021, OENOO_58023 and OENOO_58024) metabolism. We detected three proteins, namely UTP-glucose-1-phosphate uridylyltransferase (OENOO_59028), dTDP glucose 4,6-dehydratase (OENOO_59030) and dTDP-4-dehydrorhamnose reductase (OENOO_59032), whose coding genes are probably...”
FTN_0853 sufS activator complex, sufD subunit (NCBI) from Francisella tularensis subsp. novicida U112
Aligns to 128:349 / 381 (58.3%), covers 89.9% of PF01458, 178.2 bits
CT686 ABC Transporter Membrane Protein (NCBI ptt file) from Chlamydia trachomatis D/UW-3/CX
Aligns to 153:374 / 395 (56.2%), covers 99.1% of PF01458, 172.5 bits
- Genome-wide profiling of humoral immunity and pathogen genes under selection identifies immune evasion tactics of Chlamydia trachomatis during ocular infection
Pickering, Scientific reports 2017 - “...Purifying CT674 yscC 51 1.30 2.85 0 Purifying CT681 ompA 25 0.46 2.20 13 Purifying CT686 sufD 20 19.50 1.78 21 Positive CT688 parB 7 5.71 1.96 3 Positive CT694 14 6.89 2.21 6 Positive CT868 Dub1 19 9.36 2.48 0 Positive CT872 pmpH 68 1.99...”
- Systematic analysis of bacterial effector-postsynaptic density 95/disc large/zonula occludens-1 (PDZ) domain interactions demonstrates Shigella OspE protein promotes protein kinase C activation via PDLIM proteins
Yi, The Journal of biological chemistry 2014 - “...FolP CT469 CT387 CT618 CT138 MutL CT686 Ppa BrnQ DnaE MQAEARSLEEHC IWAFLLKNSSPV WAQKAGVQSSSI LPDLHALGMYHL IERKLEELASLL PMLSLEMLVSRL AHCCGSSHQIEI SNSLSCGGYVGF...”
- Interplay of recombination and selection in the genomes of Chlamydia trachomatis
Joseph, Biology direct 2011 - “...(CT580, CT838), inclusion membrane protein D genes (CT115, CT288) and ABC transporter membrane protein gene (CT686). The complete list of genes that showed evidence for gene conversion based on substitution analysis in this study is shown in Table 2 and Additional File 1 . Figure 3...”
- “...PHI CT675 karG ATP:guanido phosphotransferase GeneCon, NSS, MaxChi CT682 pbpB penicillin-binding protein GeneCon, NSS, MaxChi CT686 - hypothetical protein NSS, MaxChi, PHI CT456 - Translocated actin-recruiting phosphoprotein (tarp protein) NSS, MaxChi, GeneCon CT619 - hypothetical protein NSS, MaxChi, GeneCon CT640 recC exodeoxyribonuclease V gamma chain NSS,...”
- Microarray-based genomic surveying of gene polymorphisms in Chlamydia trachomatis
Brunelle, Genome biology 2004 - “...( pmpH ) CT293 ( accD ) CT675 ( karG ) CT312 ( fer ) CT686 CT618 CT688 ( parB ) CT664 CT690 ( dppD ) CT696 CT694 CT760 ( ftsW ) CT792 ( mutS ) CT860 CT874 ( pmpI ) *Ocular strains A/Har1, B/TW-5, Ba/Apache-2,...”
Fisuc_0527 SufBD protein (RefSeq) from Fibrobacter succinogenes subsp. succinogenes S85
Aligns to 100:323 / 344 (65.1%), covers 99.5% of PF01458, 172.0 bits
- Generation and Characterization of Acid Tolerant Fibrobacter succinogenes S85
Wu, Scientific reports 2017 - “...remaining six variations are single nucleotide substitutions, resulting in six residue changes in five genes, Fisuc_0527, Fisuc_1804, Fisuc_1945, Fisuc_2074 and Fisuc_2957, encoding SufD, XylE, RlmM, MscL and DosC, respectively. Table 2 Sequence variations between the acid tolerant strain and wild type of F . succinogenes S85....”
- “...this study Count Coverage Frequency residue change Gene homolog in E . coli 1 612124 Fisuc_0527 sufD ABC-type transport system involved in Fe-S cluster assembly, permease component + 514 C T 61 151 63.04 Arg172Cys JW1671 (b1681) 2 1396377 Fisuc_1133 yidE Predicted permease, may bind an...”
CTL0055 hypothetical protein (RefSeq) from Chlamydia trachomatis 434/Bu
Aligns to 153:374 / 395 (56.2%), covers 99.1% of PF01458, 170.2 bits
ZMO0426 SufBD protein (RefSeq) from Zymomonas mobilis subsp. mobilis ZM4
Aligns to 123:342 / 371 (59.3%), covers 96.8% of PF01458, 165.3 bits
- Model-driven analysis of mutant fitness experiments improves genome-scale metabolic models of Zymomonas mobilis ZM4
Ong, PLoS computational biology 2020 - “..., OGMEACPD_f , OGMEACPR_f, OGMEACPS_f, OPMEACPD_f, OPMEACPR_f, OPMEACPS_f, PMEACPE_f , S2FE2SR_f 13 ZMO0094, ZMO0423, ZMO0425, ZMO0426, ZMO0427, ZMO1067, ZMO1146, ZMO1222, ZMO1278, ZMO1692, ZMO1915, ZMO1917, ZMO1918, Biotin biosynthesis Modules with average cofitness scores below the significance threshold M45 0.497 5 E4PD_f , OHPBAT_f, PDX5PS_f, PERD_f , SINK_pydx5p_f...”
- Transcriptomic Profiles of Zymomonas mobilis 8b to Furfural Acute and Long-Term Stress in Both Glucose and Xylose Conditions
Yang, Frontiers in microbiology 2020 - “...shared with different carbon sources ( Figure 2 ). Within 15 min after furfural shock, ZMO0426 and ZMO0427 were the two up-regulated genes with at least twofold changes shared between those in RMG8 and RMX8 ( Figure 2 and Supplementary Tables S3-4 , S3-6 ). ZMO0426...”
- Proteomic and metabolomic analysis of the cellular biomarkers related to inhibitors tolerance in Zymomonas mobilis ZM4
Chang, Biotechnology for biofuels 2018 - “...electron transfer, in redox and non-redox catalysis, and in gene regulation. SufC ZMO0425 and SufBD ZMO0426, which constitute the SufBCD complex that can contribute to the assembly or repair of oxygen-labile FeS clusters under oxidative stress and the uptake of iron from extracellular iron chelators, were...”
- Transcriptome profiling of Zymomonas mobilis under ethanol stress
He, Biotechnology for biofuels 2012 - “...ZMO1069) and GrpE (ZMO0016) of the HSP-70 chaperone complex, GroES-GroEL (ZMO1928 and ZMO1929), HSP-33 (ZMO0410), ZMO0426, ZMO0427, ZMO0949 and ZMO1424, etc. However, these universal stress genes were not affected significantly under ethanol stress (Data not shown). On the other hand, sigma factors which are responsible for...”
Ta0204 conserved hypothetical protein (NCBI ptt file) from Thermoplasma acidophilum DSM 1728
Aligns to 147:372 / 394 (57.4%), covers 99.1% of PF01458, 163.3 bits
- An Adaptation To Life In Acid Through A Novel Mevalonate Pathway
Vinokur, Scientific reports 2016 - “...WP_010901897 0.6% 5 55.0 1 Hypothetical Protein (Ta0203) WP_010900630 0.2% 6 45.0 1 Hypothetical Protein (Ta0204) WP_010900631 0.1% 7 35.5 1 DNA Repair Protein RadA (Ta1104) WP_010901514 0.0% NanoLC/MS/MS identified seven proteins which were present in the entire region of MBD activity (gel fragments 1316, Fig....”
TDE0668 FeS assembly protein SufD (NCBI) from Treponema denticola ATCC 35405
Aligns to 116:345 / 375 (61.3%), covers 98.2% of PF01458, 160.5 bits
CAETHG_0774 SufD family Fe-S cluster assembly protein from Clostridium autoethanogenum DSM 10061
Aligns to 77:304 / 306 (74.5%), covers 99.1% of PF01458, 160.3 bits
CAETHG_1630 SufD family Fe-S cluster assembly protein from Clostridium autoethanogenum DSM 10061
Aligns to 77:304 / 306 (74.5%), covers 99.1% of PF01458, 158.7 bits
TP0613 conserved hypothetical protein (NCBI ptt file) from Treponema pallidum subsp. pallidum str. Nichols
TPASS_0613 hypothetical protein (RefSeq) from Treponema pallidum subsp. pallidum SS14
Aligns to 106:348 / 382 (63.6%), covers 97.7% of PF01458, 154.5 bits
- Biophysical and bioinformatic analyses implicate the Treponema pallidum Tp34 lipoprotein (Tp0971) in transition metal homeostasis
Brautigam, Journal of bacteriology 2012 - “...genes that encode iron-requiring proteins: tp0152, tp0612, tp0613, tp0615, tp0972, tp0991, and tp1038 (from UniProtKB annotations), as well as tp0053, tp0080,...”
- Correction: Identification of Functional Candidates amongst Hypothetical Proteins of Treponema pallidum ssp. pallidum
Naqvi, PloS one 2018 - “...and cytoskeletal regulation) 122. HP TPASS_0612 6333155 B2S3K2 Fe-S cluster assembly protein SufB 123. HP TPASS_0613 6333336 B2S3K3 Fe-S cluster assembly protein SufB 124. HP TPASS_0622 6332909 B2S3L2 Tetratricopeptide repeat containing protein 125. HP TPASS_0624 6332843 B2S3L4 Outer membrane protein, OmpA 126. HP TPASS_0625 6333262 B2S3L5...”
- Identification of functional candidates amongst hypothetical proteins of Treponema pallidum ssp. pallidum
Naqvi, PloS one 2015 - “...protein(DNA binding) HP TPASS_0612 6333155 B2S3J8 ARM repeat containing protein(intracellular signalling and cytoskeletal regulation) HP TPASS_0613 6333336 B2S3K2 Fe-S cluster assembly protein SufB HP TPASS_0622 6332909 B2S3K3 Fe-S cluster assembly protein SufB HP TPASS_0624 6332843 B2S3L2 Tetratricopeptide repeat containing protein HP TPASS_0625 6333262 B2S3L4 Outer membrane...”
CSP5_0664 SufD family Fe-S cluster assembly protein from Cuniculiplasma divulgatum
Aligns to 150:377 / 403 (56.6%), covers 98.6% of PF01458, 153.0 bits
PF3D7_1103400 FeS cluster assembly protein SufD from Plasmodium falciparum 3D7
Aligns to 1203:1429 / 1462 (15.5%), covers 99.1% of PF01458, 152.0 bits
PBANKA_094350 FeS cluster assembly protein SufD from Plasmodium berghei ANKA
Aligns to 1073:1299 / 1340 (16.9%), covers 99.1% of PF01458, 146.2 bits
SSO0928 Conserved hypothetical protein (NCBI ptt file) from Sulfolobus solfataricus P2
Aligns to 144:366 / 389 (57.3%), covers 98.6% of PF01458, 142.5 bits
TM1370 hypothetical protein (NCBI ptt file) from Thermotoga maritima MSB8
Aligns to 129:344 / 368 (58.7%), covers 98.2% of PF01458, 140.9 bits
PF1285 hypothetical protein (NCBI ptt file) from Pyrococcus furiosus DSM 3638
Aligns to 108:336 / 363 (63.1%), covers 98.2% of PF01458, 128.6 bits
ST1199 384aa long conserved hypothetical protein (NCBI ptt file) from Sulfolobus tokodaii str. 7
Aligns to 111:357 / 384 (64.3%), covers 97.7% of PF01458, 128.6 bits
MJ0034 conserved hypothetical protein (NCBI ptt file) from Methanocaldococcus jannaschii DSM 2661
Aligns to 87:312 / 316 (71.5%), covers 98.2% of PF01458, 122.5 bits
- Messenger RNA processing in Methanocaldococcus (Methanococcus) jannaschii
Zhang, RNA (New York, N.Y.) 2009 - “...RT-PCR analyses (Fig. 5) show that the RNAs for MJ0034 and MJ0112 (downstream from processing sites) are 4.2- and 2.6-fold more abundant than their preceding...”
- “...desired genes (all are 59 to 39: MJ0034, TCCTCAGTGATTCCAAAGCA; MJ0035, CCC TCAAATCTTGCAGGTTC; MJ0112, ACCTCG FIGURE 5. Comparison of mRNA abundances upstream...”
TM1416 conserved hypothetical protein (NCBI ptt file) from Thermotoga maritima MSB8
Aligns to 90:316 / 318 (71.4%), covers 97.2% of PF01458, 113.3 bits
TON_0849 hypothetical protein (RefSeq) from Thermococcus onnurineus NA1
Aligns to 115:344 / 371 (62.0%), covers 97.7% of PF01458, 102.5 bits
AT5G44316 Stabilizer of iron transporter SufD superfamily protein from Arabidopsis thaliana
2 alignments in 281:441 / 470 (34.3%), covering up to 43.1% of PF01458, 99.2 bits
Or search for genetic data about PF01458 in the Fitness Browser
by Morgan Price,
Arkin group
Lawrence Berkeley National Laboratory