Family Search for PF01595 (CNNM)
PF01595 hits 217 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.
Q8XPD3 Probable hemolysin-related protein from Clostridium perfringens (strain 13 / Type A)
CPE0030 probable hemolysin-related protein (NCBI ptt file) from Clostridium perfringens str. 13
Aligns to 9:188 / 421 (42.8%), covers 99.4% of PF01595, 204.2 bits
- Immunoinformatic analysis of the whole proteome for vaccine design: An application to Clostridium perfringens
Soto, Frontiers in immunology 2022 - “...ERFVLISTDK B*27:05 VLISTDKAV A*02:01 Ep_4 IKENEFVVDGSTRLSDL IKENEFVVDGSTRLS DRB1*04:01, DRB3*01:01, DRB3*02:02, DRB1*03:01, DRB1*13:02 Probable hemolysin-related protein Q8XPD3 339 FVVDGSTRL A*02:01, A*26:01 41/41 KENEFVVDGSTRLSD DRB1*04:01, DRB3*01:01, DRB3*02:02, DRB1*03:01, DRB1*13:02 340 FVVDGSTRL A*02:01, A*26:01 ENEFVVDGSTRLSDL DRB1*13:02, DRB3*02:02, DRB1*03:01, DRB3*01:01, DRB1*04:01 341 FVVDGSTRL A*02:01, A*26:01 DGSTRLSDL B*08:01 Ep_5 RHKDKIYIDTSPVNNLI RHKDKIYIDTSPVNN...”
- “...the Polysaccharide synthase 2 domain-containing protein (UniProt ID: Q8XN75), the probable hemolysin-related protein (UniProt ID: Q8XPD3), the TraG-D C domain-containing protein (UniProt ID: Q93M96), the spore germination protein KA (UniProt ID: Q8XMP0) and CPE0011 (UniProt ID: Q8XPF2). Our prediction indicates that all of them are membrane...”
- Role of RNase Y in Clostridium perfringens mRNA Decay and Processing.
Obana, Journal of bacteriology 2017 - “...with increased expression under RNase Y-depleted condition CPE0030 CPE0452 CPE1234 CPE1279 Loci with decreased expression under RNase Y-depleted condition...”
- Complete genome sequence of Clostridium perfringens, an anaerobic flesh-eater
Shimizu, Proceedings of the National Academy of Sciences of the United States of America 2002 - “...importers. Other classes of Shimizu et al. Gene name CPE0030 hlyA CPE0036 plc CPE0163 pfoA CPE0173 colA CPE0191 nagH CPE0378 CPE0437 hlyB CPE0452 entC CPE0553...”
EBL75_20695, EBQ27_20700 hemolysin family protein from Clostridium butyricum
Aligns to 10:189 / 427 (42.2%), covers 99.4% of PF01595, 203.5 bits
- Epidemiological and genetic characterization of Clostridium butyricum cultured from neonatal cases of necrotizing enterocolitis in China
Dong, Infection control and hospital epidemiology 2020 - “...et al 9 2015 tlyB EBL75_04805 EBQ27_04805 Hemolysin B Cassir et al 9 2015 tlyC EBL75_20695 EBQ27_20700 Hemolysin C Cassir et al 9 2015 EBL75_04095 EBQ27_04095 Hemolysin III family protein Cassir et al 9 2015 hylA EBL75_16000 EBQ27_16000 -Hemolysin Cassir et al 9 2015 EBL75_11210 EBQ27_11215...”
- “...al 9 2015 tlyB EBL75_04805 EBQ27_04805 Hemolysin B Cassir et al 9 2015 tlyC EBL75_20695 EBQ27_20700 Hemolysin C Cassir et al 9 2015 EBL75_04095 EBQ27_04095 Hemolysin III family protein Cassir et al 9 2015 hylA EBL75_16000 EBQ27_16000 -Hemolysin Cassir et al 9 2015 EBL75_11210 EBQ27_11215 Enterotoxin...”
FTL_0951 hypothetical protein (NCBI) from Francisella tularensis subsp. holarctica
Aligns to 8:196 / 419 (45.1%), covers 96.1% of PF01595, 187.7 bits
- Twin RNA polymerase-associated proteins control virulence gene expression in Francisella tularensis
Charity, PLoS pathogens 2007 - “...used, as a control, cells of a mutant containing a mariner transposon in the gene FTL_0951 (LVS:: FTL0951 ); this strain has a more severe growth defect than either the mglA or sspA mutant strain (with a corresponding culture doubling time of ~285 min). Cells of...”
- “...contains a mariner transposon conferring resistance to kanamycin integrated into the LVS chromosome at the FTL_0951 locus; the presence of a single transposon in this strain was confirmed by Southern blotting, and the location of the transposon was determined by sequencing of the chromosomal DNA. Complementation...”
FTN_1006 transporter-associated protein, HlyC/CorC family (NCBI) from Francisella tularensis subsp. novicida U112
Aligns to 8:196 / 419 (45.1%), covers 96.1% of PF01595, 187.6 bits
- Genome sequence and phenotypic analysis of a first German Francisella sp. isolate (W12-1067) not belonging to the species Francisella tularensis
Rydzewski, BMC microbiology 2014 - “...743 Lecithinase/hemolysin FTN_0436 (75%) Lysophospholipase 167 Lysophospholipase Fphi_1625 (67%) HlyC/CorC 182 CBS domain, putative hemolysin FTN_1006 (80%) ClpB 1114 ClpB chaperone domain FTN_1743 (89%) Chitinase 1 (372 aa) 490 GH18_chitinase-like superfamily Fphi_0209 (83%) Chitinase 2 (590 aa) 816 Chitinase_glyco-hydro_19 domain, PP location, CBM Fphi_0512 (69%) Chitinase...”
- Francisella-arthropod vector interaction and its role in patho-adaptation to infect mammals
Akimana, Frontiers in microbiology 2011 - “...ABC transporter, ATP-binding protein FTN_0997 Proton-dependent oligopeptide transporter (POT) family protein, di- or tripeptide:H+ symporter FTN_1006 Transporter-associated protein, HlyC/CorC family FTN_1014 Nicotinamide mononucleotide transport (NMT) family protein FTN_1016 Hypothetical protein FTN_1026 Major facilitator superfamily (MFS) transport protein, pseudogene FTN_1027 Holliday junction endodeoxyribonuclease ruvC FTN_1034 Iron-sulfur cluster-binding...”
- Molecular bases of proliferation of Francisella tularensis in arthropod vectors
Asare, Environmental microbiology 2010 - “...FTN_0910 sugar:cation symporter family protein 2 # tnfn1_pw060419p01q175 FTN_0984 ABC transporter, ATP-binding protein 2 tnfn1_pw060419p01q170 FTN_1006 transporter-associated protein, HlyC/CorC family 4 tnfn1_pw060418p02q160 FTN_1010 major facilitator superfamily (MFS) transport protein 2 tnfn1_pw060419p01q133 FTN_1014 nicotinamide ribonucleoside (NR) uptake permease (PnuC) family protein 2 tnfn1_pw060328p02q109 FTN_1107 metlQ methionine uptake...”
- “...protein of unknown function tnfn1_pw060420p02q181 FTN_0933 protein of unknown function tnfn1_pw060323p04q134 FTN_0938 hypothetical protein tnfn1_pw060419p01q170 FTN_1006 transporter-associated protein, HlyC/CorC family tnfn1_pw060323p08q141 FTN_1015 isochorismatase family protein tnfn1_pw060418p01q153 FTN_1055 lon DNA-binding, ATP-dependent protease La tnfn1_pw060510p01q114 FTN_1073 DNA/RNA endonuclease G tnfn1_pw060419p04q168 FTN_1091 aroA 3-phosphoshikimate 1- carboxyvinyltransferase tnfn1_pw060328p08q188 FTN_1098 conserved...”
- Molecular complexity orchestrates modulation of phagosome biogenesis and escape to the cytosol of macrophages by Francisella tularensis
Asare, Environmental microbiology 2010 - “...FTN_0910 sugar:cation symporter family protein 2 # tnfn1_pw060419p01q175 FTN_0984 ABC transporter, ATP-binding protein 2 tnfn1_pw060419p01q170 FTN_1006 transporter-associated protein, HlyC/CorC family 4 tnfn1_pw060418p02q160 FTN_1010 major facilitator superfamily (MFS) transport protein 2 tnfn1_pw060419p01q133 FTN_1014 nicotinamide ribonucleoside (NR) uptake permease (PnuC) family protein 2 tnfn1_pw060328p02q109 FTN_1107 metlQ methionine uptake...”
- “...protein of unknown function tnfn1_pw060420p02q181 FTN_0933 protein of unknown function tnfn1_pw060323p04q134 FTN_0938 hypothetical protein tnfn1_pw060419p01q170 FTN_1006 transporter-associated protein, HlyC/CorC family tnfn1_pw060323p08q141 FTN_1015 isochorismatase family protein tnfn1_pw060418p01q153 FTN_1055 lon DNA-binding, ATP-dependent protease La tnfn1_pw060510p01q114 FTN_1073 DNA/RNA endonuclease G tnfn1_pw060419p04q168 FTN_1091 aroA 3-phosphoshikimate 1-carboxyvinyltransferase tnfn1_pw060328p08q188 FTN_1098 conserved hypothetical...”
- Working toward the future: insights into Francisella tularensis pathogenesis and vaccine development
Pechous, Microbiology and molecular biology reviews : MMBR 2009 - “...FTN_0881 ruvB FTN_0918 FTN_0925 FTN_0933 FTN_0938 FTN_0998 FTN_1006 FTN_1015 FTN_1016 FTN_1029 lipA FTN_1038 lon FTN_1063 phoH FTN_1066 FTN_1090 FTN_1098 metIQ...”
- “...FTN_0891 FTN_0918 FTN_0925 FTN_0933 FTN_0938 FTN_0998 FTN_1006 FTN_1015 FTN_1016 FTN_1029 FTN_1030 FTN_1038 FTN_1055 FTN_1063 FTN_1064 FTN_1066 FTN_1090...”
- Genome-wide screen in Francisella novicida for genes required for pulmonary and systemic infection in mice
Kraemer, Infection and immunity 2009 - “...FTN_0857 FTN_0873 FTN_0877 FTN_0881 FTN_0918 FTN_0933 FTN_0938 FTN_1006 dcd cls FTN_1015 FTN_1016 FTN_1029 FTN_1030 FTN_1055 lipA lon FTN_1063 FTN_1098 FTN_1107...”
FTT_0676 hypothetical protein (RefSeq) from Francisella tularensis subsp. tularensis SCHU S4
Aligns to 8:196 / 419 (45.1%), covers 96.1% of PF01595, 186.4 bits
- Identification of an Attenuated Substrain of Francisella tularensis SCHU S4 by Phenotypic and Genotypic Analyses.
Lovchik, Pathogens (Basel, Switzerland) 2021 - “...694308 A G Nonsynonymous SNP causes an amino acid change (E->G) in a hypothetical protein (FTT_0676) NR-643 & FTS-635 826816 A G Nonsynonymous SNP causes an amino acid change (D->G) in CapA membrane protein (FTT_0807) NR-643 & FTS-635 1419877 C T Nonsynonymous SNP causes an amino...”
- A spontaneous mutation in kdsD, a biosynthesis gene for 3 Deoxy-D-manno-Octulosonic Acid, occurred in a ciprofloxacin resistant strain of Francisella tularensis and caused a high level of attenuation in murine models of tularemia
Chance, PloS one 2017 - “...nucleotide polymorphisms (SNPs) leading to amino acid substitutions in fabH , fabF , FTT_0807 , FTT_0676 , and FTT_1573 . The fupA gene experienced a single base pair deletion at nucleotide 105 followed by a single base pair insertion at nucleotide 111, which maintained the reading...”
SH2193 hypothetical protein (NCBI) from Staphylococcus haemolyticus JCSC1435
Aligns to 10:203 / 458 (42.4%), covers 99.4% of PF01595, 185.5 bits
CPE0437 probable hemolysin (NCBI ptt file) from Clostridium perfringens str. 13
Aligns to 12:203 / 445 (43.1%), covers 100.0% of PF01595, 182.8 bits
SE0474 conserved hypothetical protein (NCBI ptt file) from Staphylococcus epidermidis ATCC 12228
Aligns to 10:203 / 449 (43.2%), covers 99.4% of PF01595, 181.9 bits
X276_15855 hemolysin family protein from Clostridium beijerinckii NRRL B-598
Aligns to 7:202 / 429 (45.7%), covers 99.4% of PF01595, 181.2 bits
SAOUHSC_00711 hypothetical protein (NCBI) from Staphylococcus aureus subsp. aureus NCTC 8325
SA0657 hypothetical protein (NCBI) from Staphylococcus aureus subsp. aureus N315
SAUSA300_0687 putative hemolysin (NCBI) from Staphylococcus aureus subsp. aureus USA300_FPR3757
SACOL0762 hemolysin, putative (NCBI) from Staphylococcus aureus subsp. aureus COL
Aligns to 10:203 / 449 (43.2%), covers 100.0% of PF01595, 180.8 bits
- Host-inherent variability influences the transcriptional response of Staphylococcus aureus during in vivo infection
Thänert, Nature communications 2017 - “...cation/H+ antiporter subunit A SAOUHSC_02763 opp-1F Peptide ABC transporter ATP-binding protein SAOUHSC_00988 sspA Glutamyl endopeptidase SAOUHSC_00711 Hypothetical SAOUHSC_00561 vraX Hypothetical SAOUHSC_02550 FdhD Formate dehydrogenase accessory protein SAOUHSC_00875 ndh2 Hypothetical SAOUHSC_01359 mprF Hypothetical SAOUHSC_01192 vfrA Hypothetical SAOUHSC_02887 isaA Immunodominant antigen A SAOUHSC_02254 groEL chaperonin GroEL SAOUHSC_02485 rpoA...”
- Genetic screens reveal novel major and minor players in magnesium homeostasis of Staphylococcus aureus
Trachsel, PLoS genetics 2019 - “...(SA0867), and an accessory CorA (SA2137), while the export system is composed essentially of MpfA (SA0657) with a smaller role for MpfB (SA0780) ( Fig 7 ). Furthermore, import and export constitute two independent systems as evidenced by the additivity of the phenotypes of the deletion...”
- “...previously introduced mutations were verified Sanger Sequencing for SNP mutations and by PCR for deletions. SA0657 and SA2166 ORFs were replaced by an antibiotic resistance cassette (chloramphenicol and erythromycin respectively) while SA0780, SA2137 and SA0867 ORFs were deleted in frame. In particular, in the case of...”
- Structural Insights into the Intracellular Region of the Human Magnesium Transport Mediator CNNM4.
Giménez-Mascarell, International journal of molecular sciences 2019 - “...other CBS-containing proteins related with Mg 2+ extrusion such as the Mg 2+ tolerance factor SA0657 found in Staphylococcus aureus [ 43 ], or bacterial proteins CorB and CorC which have been proposed to mediate Mg 2+ extrusion through bacterial Mg 2+ channel CorA [ 44...”
- Characterization of genetic changes associated with daptomycin nonsusceptibility in Staphylococcus aureus
Ma, PloS one 2018 - “...Noncoding nagB/SA0527 Glucosamine-6-phosphate isomerase JH1/JH5 712573 Nonsynonymous A580V vraG/SA0617 ABC transporter permease JH1/JH5 751554 Noncoding SA0657 Hemolysin JH1/JH5 1005831 Nonsynonymous C147Y SA0885 Hypothetical protein JH1/JH5 1893057 Nonsynonymous E140Q prsA/SA1659 Peptidyl-prolyl cis/trans isomerase JH1/JH5 1954969 Nonsynonymous D48H SA1708 UDP-N-acetylmuramyl tripeptide synthetase JH1/JH5 2368738 Nonsynonymous H177R SA2105 Conserved...”
- An Essential Factor for High Mg2+ Tolerance of Staphylococcus aureus
Armitano, Frontiers in microbiology 2016 - “...pathogen, growing unimpaired in up to 770 mM Mg 2+ , and we here identify SA0657, a key factor in this tolerance. The predicted domain structure of SA0657 is shared with a large number of proteins in bacteria, archaea and even eukarya, for example CorB from...”
- “...2+ sensing, contains the conserved Glycine326 which we establish to be a key residue for SA0657 function. In light of our findings, we propose the name MpfA, Magnesium Protection Factor A, for SA0657. magnesium tolerance Staphylococcus aureus MpfA CNNM CorB CorC CBS Schweizerischer Nationalfonds zur Frderung...”
- The Genera Staphylococcus and Macrococcus
, The ProkaryotesVolume 4: Bacteria: Firmicutes, Cyanobacteria 2006 - “...of white blood cells - Location: SaPIn3/SaPIm3 Possible leukocidin SA1813 lukM Unknown - Possible hemolysin SA0657 None Unknown 89 Possible hemolysin SA0780 None Unknown 82 Similar to exotoxin 1 SA1009 None Unknown 55 Possible hemolysin SA1812 None Unknown - Similar to hemolysin III SA1973 None Unknown...”
- Identification of Methicillin-Resistant Staphylococcus aureus (MRSA) Genetic Factors Involved in Human Endothelial Cells Damage, an Important Phenotype Correlated with Persistent Endovascular Infection
Xiao, Antibiotics (Basel, Switzerland) 2022 - “...15.42 14.25 SAUSA300_2040 hypothetical hypothetical protein 15.42 12.63 SAUSA300_1145 xerC tyrosine recombinase xerC 15.33 4.57 SAUSA300_0687 hypothetical putative hemolysin 15.14 12.23 SAUSA300_0630 hypothetical ABC transporter ATP-binding protein 15.07 10.45 SAUSA300_1577 hypothetical TPR domain-containing protein 14.93 1.75 SAUSA300_1288 dapA dihydrodipicolinate synthase 14.75 7.53 SAUSA300_1937 hypothetical phi77 ORF045-like...”
- The second messenger c-di-AMP inhibits the osmolyte uptake system OpuC in Staphylococcus aureus
Schuster, Science signaling 2016 - “...predicted to encode the inosine-5 monophosphate dehydrogenase GuaB (SACOL0460), two membrane proteins with unknown functions (SACOL0762 and SACOL0921), the magnesium transporter MgtE (SACOL1013), the transcription factor CcpN (SACOL1621), and a multi-domain cytoplasmic protein of unknown function (SACOL1752). Sequence alignments comparing the CBS domains of OpuCA with...”
- “...separated on a polyacrylamide gel and visualized by Coomassie staining (n=4). For the membrane proteins SACOL0762, SACOL0921, and SACOL1013, His-MBP fusion proteins to the CBS domain only, but lacking the transmembrane regions, were used. ( C ) Representative DRaCALA assays showing lysates analyzed in panel (B)...”
- Development and application of the active surveillance of pathogens microarray to monitor bacterial gene flux
Stabler, BMC microbiology 2008 - “...a band for the haemolysin, which was sequenced and proven to be the haemolysin gene (SACOL0762) (table 2 ). The exotoxin 3 was also confirmed as exotoxin 3 by vectorette PCR (table 2 ), suggesting the hybridisation conditions used for the arrays were not optimal for...”
- “...S. aureus COL genes Gene Name/phenotype Gene ID BLAST/hyb Vectorette product Top Hit Size Haemolysin SACOL0762 Yes/Yes Yes SACOL0762 126/126 Exotoxin 3 SACOL0468 Yes/No Yes SACOL0468 362/362 Bleomycin resistance SAR0032 No/Yes No n/a n/a Chloramphenicol resistance CV0700 No/Yes No n/a n/a C. difficile strain 630 was...”
- Comparative genomics of Canadian epidemic lineages of methicillin-resistant Staphylococcus aureus
Christianson, Journal of clinical microbiology 2007 - “...SACOL0469 SACOL0470 SACOL0472 SACOL0473 SACOL0474 SACOL0478 SACOL0762 SACOL0886 SACOL0887 sek sei SACOL0907 seb SACOL1178 SACOL1179 SACOL1180 SACOL1880...”
O23A_p2978 CNNM domain-containing protein from Aeromonas salmonicida
Aligns to 11:185 / 426 (41.1%), covers 94.4% of PF01595, 180.8 bits
PP5322, PP_5322 metal ion transporter, putative (NCBI ptt file) from Pseudomonas putida KT2440
Aligns to 19:215 / 446 (44.2%), covers 95.6% of PF01595, 179.7 bits
- Increasing cellular fitness and product yields in Pseudomonas putida through an engineered phosphoketolase shunt
Bruinsma, 2022 - Evaluation of chromosomal insertion loci in the Pseudomonas putida KT2440 genome for predictable biosystems design
Chaves, Metabolic engineering communications 2020 - “...P.putida KT2440 wild type, and P.putida KT2440 strains with mKate inserted at PP_1642, PP_2224, and PP_5322 were selected from single colonies and grown to saturation in LB overnight at 30C, shaking at 200rpm. Saturated cultures were diluted 1/100 into fresh M9 minimal medium supplemented with 30mM...”
- “...had significant effects on both growth rate and mKate expression. At sites PP_1035, PP_4305, PP_5042, PP_5322, and PP_5388, insertion of mKate did not have a negative effect on growth, and all strains grew similarly to the wild type. The strains with mKate integration at PP_1642 or...”
- Genetic Dissection of the Regulatory Network Associated with High c-di-GMP Levels in Pseudomonas putida KT2440
Ramos-González, Frontiers in microbiology 2016 - “...PP_0114 ( metN1 ) Methionine import ATP-binding component of ABC transporter (AAA+ ATPase domain) cfcK-3 PP_5322 Putative metal ion transporter cfcK-5 PP_4366 ( fliI ) Flagellum-specific ATP synthase (AAA+ ATPase domain) cfcK-6 PP_4741 ( hsdM ) Type I restriction-modification system, M subunit cfcK-9 PP_5064 ( betA...”
- Functional genomics of stress response in Pseudomonas putida KT2440
Reva, Journal of bacteriology 2006 - “...Carlo simulation). Second, four genes (PP0063, PP0816, PP4646, and PP5322) were identified as genes that are vital for more than one stress condition (P 106 for...”
- “...PP4697 PP4731 PP4880 PP4941 PP4982 PP5044 PP5145c PP5302 PP5322 PP5326 PP5327 PP5328 PP5329 Benzoate Encoded protein P. PUTIDA KT2440 STRESS RESPONSE VOL. 188,...”
JJB81_13790 HlyC/CorC family transporter from Salmonella enterica subsp. enterica serovar Typhimurium
Aligns to 10:191 / 428 (42.5%), covers 96.1% of PF01595, 179.1 bits
YfjD / b4461 UPF0053 family inner membrane protein YfjD from Escherichia coli K-12 substr. MG1655 (see 3 papers)
P37908 UPF0053 inner membrane protein YfjD from Escherichia coli (strain K12)
b4461 predicted inner membrane protein (RefSeq) from Escherichia coli str. K-12 substr. MG1655
Aligns to 10:191 / 428 (42.5%), covers 96.1% of PF01595, 178.9 bits
- Phenotypic switching in Candida glabrata involves phase-specific regulation of the metallothionein gene MT-II and the newly discovered hemolysin gene HLP
Lachke, Infection and immunity 2000 - “...Bacillus subtilis, 007585; E.coli, Escherichia coli, P37908; T.mar, Thermotoga maritima, AE001751; M.pne, Mycoplasma pneumoniae, P75586; M.gen, Mycoplasma...”
- Combinatorial strategies for improving multiple-stress resistance in industrially relevant Escherichia coli strains
Lennen, Applied and environmental microbiology 2014 - “...b3772 b0074 b2320 b0073 b2839 b0052 b0008 b0072 b0876 b0388 b4461 b4488 b2677 leuL leuD ilvA leuA pdxB leuB lysR pdxA talB leuC ybjD aroL yfjD ilvG proV leu...”
U876_20420 CNNM domain-containing protein from Aeromonas hydrophila NJ-35
Aligns to 11:185 / 426 (41.1%), covers 94.4% of PF01595, 178.8 bits
lpg2763 Mg2+ and Co2+ transporter CorB, hemolysin (NCBI) from Legionella pneumophila subsp. pneumophila str. Philadelphia 1
Aligns to 10:187 / 421 (42.3%), covers 93.9% of PF01595, 177.9 bits
Eab7_0255 hemolysin family protein from Exiguobacterium antarcticum B7
Aligns to 10:203 / 437 (44.4%), covers 99.4% of PF01595, 176.7 bits
O05241 UPF0053 protein YugS from Bacillus subtilis (strain 168)
Aligns to 7:201 / 429 (45.5%), covers 100.0% of PF01595, 176.7 bits
VT47_24200 hemolysin family protein from Pseudomonas syringae pv. syringae
Aligns to 20:215 / 446 (43.9%), covers 95.6% of PF01595, 176.6 bits
FORC22_2576 CNNM domain-containing protein from Vibrio parahaemolyticus
VP2536 putative hemolysin (NCBI ptt file) from Vibrio parahaemolyticus RIMD 2210633
Aligns to 10:187 / 426 (41.8%), covers 93.3% of PF01595, 175.9 bits
- Potential Survival and Pathogenesis of a Novel Strain, Vibrio parahaemolyticus FORC_022, Isolated From a Soy Sauce Marinated Crab by Genome and Transcriptome Analyses
Chung, Frontiers in microbiology 2018 - “...the standard errors of the means. Several ORFs encoding various hemolysin genes (FORC22_0344, FORC22_0414, FORC22_1716, FORC22_2576, and FORC22_3059 in chromosome I; FORC22_3287, FORC22_3317, and FORC22_3346 in chromosome II) were detected; these genes may be responsible for the virulence of the FORC_022 strain. In addition, various secretion...”
- iTRAQ-based proteomic profiling of Vibrio parahaemolyticus under various culture conditions
Yang, Proteome science 2015 - “...as 11 general secretion pathway proteins. Other virulence related proteins such as three hemolysins(GN VP0730, VP2536, VPA0257) and regulator proteins Hfq and rsmA were also significantly identified. Protein quantification and differentiation analysis Proteins with iTRAQ ratios <0.50 or >2.0, p <0.05 were considered significantly different in...”
- “...significantly differentially expressed in this study. Three hemolysin proteins including putative hemolysins (GN VP0730, GN VP2536) and hemolysin (GN VPA0257) were identified, although TDH production was reported to be affected by environmental factors, such as pH, temperature, and chemicals [ 40 , 41 ], but significant...”
FORC17_0475 CNNM domain-containing protein from Vibrio vulnificus
Aligns to 10:187 / 425 (41.9%), covers 93.3% of PF01595, 175.8 bits
lmo2232 similar to unknown proteins (NCBI ptt file) from Listeria monocytogenes EGD-e
LMRG_01600 hypothetical protein (RefSeq) from Listeria monocytogenes 10403S
Aligns to 8:202 / 434 (44.9%), covers 100.0% of PF01595, 175.6 bits
LMOf2365_2265 CBS domain protein (NCBI) from Listeria monocytogenes str. 4b F2365
Aligns to 8:202 / 434 (44.9%), covers 100.0% of PF01595, 175.5 bits
CV0231 probable hemolysin (NCBI) from Chromobacterium violaceum ATCC 12472
Aligns to 4:196 / 436 (44.3%), covers 99.4% of PF01595, 175.5 bits
- The complete genome sequence of Chromobacterium violaceum reveals remarkable and exploitable bacterial adaptability
Brazilian, Proceedings of the National Academy of Sciences of the United States of America 2003 - “...lateral transfer. Twelve ORFS encoding hemolysin-like proteins (CV0231, CV0360, CV0362, CV0513, CV0516, CV0656, CV1917, CV1918, CV2873, CV3275, CV3342, and...”
- “...CV2663) with potential antitumor activity, and hemolysins (CV0231, CV0513, CV1918, CV3342, and CV4301) with potential as anticoagulants. It is established...”
AWC34_RS03405 hemolysin family protein from Staphylococcus equorum
Aligns to 7:202 / 342 (57.3%), covers 99.4% of PF01595, 175.3 bits
- Genomic insights into the virulence and salt tolerance of Staphylococcus equorum
Jeong, Scientific reports 2017 - “.... equorum genomes. Virulence factor Gene locus KM1031 C2014 KS1039 Mu2 UMC-CNS-924 G8HB1 Haemolysis-related Haemolysin AWC34_RS03405 AVJ22_RS03205 SEQMU2_RS08595 SEQU_RS25035 UF72_RS01895 Haemolysin III AWC34_RS09060 AVJ22_RS09420 SE1039_RS09485 SEQMU2_RS01345 SEQU_RS26575 UF72_RS08525 Haemolysin activation protein AWC34_RS11995 AVJ22_RS12370 SE1039_RS12450 SEQMU2_RS04245 SEQU_RS16015 UF72_RS08300 SEQU_RS16020 SEQU_RS16025 Haemolysin family calcium-binding region AVJ22_RS14095 * Antibiotic...”
UF72_RS01895 hemolysin family protein from Staphylococcus equorum subsp. equorum
Aligns to 7:202 / 342 (57.3%), covers 99.4% of PF01595, 175.3 bits
- Genomic insights into the virulence and salt tolerance of Staphylococcus equorum
Jeong, Scientific reports 2017 - “...factor Gene locus KM1031 C2014 KS1039 Mu2 UMC-CNS-924 G8HB1 Haemolysis-related Haemolysin AWC34_RS03405 AVJ22_RS03205 SEQMU2_RS08595 SEQU_RS25035 UF72_RS01895 Haemolysin III AWC34_RS09060 AVJ22_RS09420 SE1039_RS09485 SEQMU2_RS01345 SEQU_RS26575 UF72_RS08525 Haemolysin activation protein AWC34_RS11995 AVJ22_RS12370 SE1039_RS12450 SEQMU2_RS04245 SEQU_RS16015 UF72_RS08300 SEQU_RS16020 SEQU_RS16025 Haemolysin family calcium-binding region AVJ22_RS14095 * Antibiotic resistance Efflux pump Chloramphenicol...”
AVJ22_RS03205 hemolysin family protein from Staphylococcus equorum
Aligns to 7:202 / 342 (57.3%), covers 99.4% of PF01595, 175.3 bits
- Genomic insights into the virulence and salt tolerance of Staphylococcus equorum
Jeong, Scientific reports 2017 - “...equorum genomes. Virulence factor Gene locus KM1031 C2014 KS1039 Mu2 UMC-CNS-924 G8HB1 Haemolysis-related Haemolysin AWC34_RS03405 AVJ22_RS03205 SEQMU2_RS08595 SEQU_RS25035 UF72_RS01895 Haemolysin III AWC34_RS09060 AVJ22_RS09420 SE1039_RS09485 SEQMU2_RS01345 SEQU_RS26575 UF72_RS08525 Haemolysin activation protein AWC34_RS11995 AVJ22_RS12370 SE1039_RS12450 SEQMU2_RS04245 SEQU_RS16015 UF72_RS08300 SEQU_RS16020 SEQU_RS16025 Haemolysin family calcium-binding region AVJ22_RS14095 * Antibiotic resistance...”
- “...products that cannot induce haemolysis on their own. Based on the SEED subsystem, the genes AVJ22_RS03205 and AVJ22_RS09420 in strain C2014 were classified as encoding magnesium/cobalt efflux protein and the membrane protein haemolysin III, respectively. Thus, we cautiously suggest that the gene AVJ22_RS09420 might be a...”
SEQMU2_RS08595 hemolysin family protein from Staphylococcus equorum subsp. equorum Mu2
Aligns to 7:202 / 342 (57.3%), covers 99.4% of PF01595, 175.3 bits
- Genomic insights into the virulence and salt tolerance of Staphylococcus equorum
Jeong, Scientific reports 2017 - “...genomes. Virulence factor Gene locus KM1031 C2014 KS1039 Mu2 UMC-CNS-924 G8HB1 Haemolysis-related Haemolysin AWC34_RS03405 AVJ22_RS03205 SEQMU2_RS08595 SEQU_RS25035 UF72_RS01895 Haemolysin III AWC34_RS09060 AVJ22_RS09420 SE1039_RS09485 SEQMU2_RS01345 SEQU_RS26575 UF72_RS08525 Haemolysin activation protein AWC34_RS11995 AVJ22_RS12370 SE1039_RS12450 SEQMU2_RS04245 SEQU_RS16015 UF72_RS08300 SEQU_RS16020 SEQU_RS16025 Haemolysin family calcium-binding region AVJ22_RS14095 * Antibiotic resistance Efflux...”
Q8XFY3 DUF21 domain-containing protein from Salmonella typhi
Aligns to 1:176 / 413 (42.6%), covers 92.8% of PF01595, 175.2 bits
- Crystal structure of an archaeal CorB magnesium transporter
Chen, Nature communications 2021 - “...Arabidopsis thaliana ; Q84R21), MtCorB ( M. thermophilus ; A0A1G8XA46), StCorB ( Salmonella typhimurium ; Q8XFY3), TtCorB ( T. thermophilus ; A0A0K6IWT9), MpfA ( S. aureus ; A0A0H3JL60), and yhdP ( B. subtilis ; O07585). Cloning of CorB orthologs Codon-optimized cDNA of 20 CorB orthologs were...”
BA_2558 DUF21, Domain of unknown function DUF21 (NCBI) from Bacillus anthracis str. A2012
Aligns to 7:201 / 409 (47.7%), covers 99.4% of PF01595, 174.7 bits
- Bacillithiol: a key protective thiol in Staphylococcus aureus
Perera, Expert review of anti-infective therapy 2015 - “...BA_2379 BSU05630 ( dinB ) BA_2379 BSU10860 ( yisT ) BA_2937 BSU13070 ( ykkA ) BA_2558 BSU10800 ( yizA ) BA_4768 BSU26780 ( yrdA ) BSU12410 ( yjoA ) BA_2721 BA_3104 BA_2777 BA_3538 BA_2007 BA_3539 BA_2065 BA_2078 BA_2990 B. subtilis 168 ORF names are in parenthesis....”
BA2288 CBS domain protein (NCBI ptt file) from Bacillus anthracis str. Ames
Aligns to 7:201 / 451 (43.2%), covers 99.4% of PF01595, 174.6 bits
HP1490 conserved hypothetical protein (NCBI ptt file) from Helicobacter pylori 26695
Aligns to 19:214 / 449 (43.7%), covers 98.9% of PF01595, 174.5 bits
- Comparative genomics of Helicobacter pylori and the human-derived Helicobacter bizzozeronii CIII-1 strain reveal the molecular basis of the zoonotic nature of non-pylori gastric Helicobacter infections in humans
Schott, BMC genomics 2011 - “...Hypothetical protein (putative HcpA) G 10 732,027..732,038 M HBZC1_07730/HBZC1_07740 CBS domains containing protein (homologue of HP1490 - TolC efflux pump) G 15 1,677,616..1,677,630 5' HBZC1_18160 Putative ATP/GTP binding protein G 9 58,965..58,973 5' HBZC1_00570 Massive surface protein (MspC) G 9 640,616..640,624 M HBZC1_06770 Outer membrane protein...”
- A Helicobacter pylori TolC efflux pump confers resistance to metronidazole
van, Antimicrobial agents and chemotherapy 2005 - “...H. pylori, only HP1489 is found adjacent to a gene, HP1490, that might encode a substrate for type I secretion. HP1490 encodes a putative protein with a high...”
- “...membrane efflux protein encoded by HP1489 extrudes the product HP1490, presumably a toxin. Besides type I protein secretion, TolC is also involved in the efflux...”
- Gene expression profiling of Helicobacter pylori reveals a growth-phase-dependent switch in virulence gene expression
Thompson, Infection and immunity 2003 - “...HP1400 Unknown function HP0184 HP0719 HP1124 HP1173e HP0318e HP1490 Putative function Second TC Scoreb Fold changec Scoreb Fold changec prfA rpl27 fusA rps7...”
- Helicobacter pylori pore-forming cytolysin orthologue TlyA possesses in vitro hemolytic activity and has a role in colonization of the gastric mucosa
Martino, Infection and immunity 2001 - “...presence of at least two distinct hemolysins, HP1086 and HP1490, in this strain. Previous studies have shown that the in vitro hemolytic activity of H. pylori...”
- “...sequences in the H. pylori 26695 genome, HP1086 and HP1490 (34), though it is probable that H. pylori possesses a number of proteins with hemolytic activity....”
- Metabolism and genetics of Helicobacter pylori: the genome era
Marais, Microbiology and molecular biology reviews : MMBR 1999 - “...was identified, as well as the HP1086 and HP1490 genes, orthologues of tly, encoding Serpulina hyodysenteriae hemolysin (280). HP0599 is a homologue of hylB...”
EAM_RS12870 HlyC/CorC family transporter from Erwinia amylovora ATCC 49946
Aligns to 10:189 / 428 (42.1%), covers 94.4% of PF01595, 173.7 bits
ERH_0467 hemolysin family protein from Erysipelothrix rhusiopathiae str. Fujisawa
Aligns to 6:199 / 442 (43.9%), covers 94.4% of PF01595, 173.6 bits
EEY85_RS06410 hemolysin family protein from Erysipelothrix rhusiopathiae
Aligns to 6:199 / 442 (43.9%), covers 94.4% of PF01595, 173.6 bits
Q9HN02 DUF21/CBS domain protein from Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
Aligns to 28:208 / 457 (39.6%), covers 98.3% of PF01595, 173.2 bits
P74409 UPF0053 protein sll0260 from Synechocystis sp. (strain PCC 6803 / Kazusa)
Aligns to 11:203 / 448 (43.1%), covers 99.4% of PF01595, 172.9 bits
Eab7_0509 hemolysin family protein from Exiguobacterium antarcticum B7
Aligns to 31:224 / 461 (42.1%), covers 100.0% of PF01595, 172.3 bits
P54428 UPF0053 protein YrkA from Bacillus subtilis (strain 168)
Aligns to 7:201 / 434 (44.9%), covers 100.0% of PF01595, 172.2 bits
O07585 UPF0053 protein YhdP from Bacillus subtilis (strain 168)
Aligns to 7:201 / 444 (43.9%), covers 100.0% of PF01595, 171.6 bits
- Crystal structure of an archaeal CorB magnesium transporter
Chen, Nature communications 2021 - “...thermophilus ; A0A0K6IWT9), MpfA ( S. aureus ; A0A0H3JL60), and yhdP ( B. subtilis ; O07585). Cloning of CorB orthologs Codon-optimized cDNA of 20 CorB orthologs were synthesized (Bio Basic Inc., Markham, Canada) and sub-cloned into NcoI and XhoI sites of pCGFP-BC vector 57 with a...”
TTHA0734 hemolysin-related protein (NCBI) from Thermus thermophilus HB8
Aligns to 33:209 / 445 (39.8%), covers 99.4% of PF01595, 171.0 bits
- Identification of Preferred DNA-Binding Sites for the Thermus thermophilus Transcriptional Regulator SbtR by the Combinatorial Approach REPSA
Van, PloS one 2016 - “...ATACTGACCGGTCA 45 Y TTHA1606 700149 700162 8.79e-06 1 TGACTAAATAGTTG 24 Y TTHA0733 CAACTATTTAGTCA 123 ~ TTHA0734 1264565 1264578 1.13e-05 1 TGACCTCTTGGTCA +177 N TTHA1325 10108 10121 1.26e-05 1 TGACTTTAGGGTCA +868 N TTHAr01 351149 351162 1.26e-05 1 TGACCCTAAAGTCA +868 N TTHAr05 669059 669072 1.26e-05 1 TGACCAGTTGCTCA 21...”
- “...two promoters that did not demonstrate an obvious role for SbtR regulation (genes TTHA1330 and TTHA0734 ) may still be regulated in some fashion by this protein. 10.1371/journal.pone.0159408.g011 Fig 11 Bioinformatic identification of T . thermophilus HB8 promoters potentially regulated by SbtR. Shown are sequences +/-...”
XAC1709 hemolysin (NCBI ptt file) from Xanthomonas axonopodis pv. citri str. 306
Aligns to 5:207 / 446 (45.5%), covers 100.0% of PF01595, 170.2 bits
WP_016902067 hemolysin family protein from Xanthomonas arboricola
Aligns to 5:207 / 446 (45.5%), covers 100.0% of PF01595, 169.4 bits
BFF93_RS14485 hemolysin family protein from Elizabethkingia meningoseptica
Aligns to 10:205 / 452 (43.4%), covers 99.4% of PF01595, 169.4 bits
QR90_RS03530 hemolysin family protein from Deinococcus radiopugnans
Aligns to 7:202 / 446 (43.9%), covers 99.4% of PF01595, 168.9 bits
Riean_0415 hemolysin family protein from Riemerella anatipestifer ATCC 11845 = DSM 15868
Aligns to 10:205 / 450 (43.6%), covers 99.4% of PF01595, 168.6 bits
A21D_01947 hemolysin family protein from Virgibacillus dokdonensis
Aligns to 9:201 / 445 (43.4%), covers 98.9% of PF01595, 168.5 bits
LMRG_01849 hypothetical protein (RefSeq) from Listeria monocytogenes 10403S
Aligns to 7:200 / 436 (44.5%), covers 99.4% of PF01595, 168.2 bits
lmo2399 similar to conserved hypothetical proteins (NCBI ptt file) from Listeria monocytogenes EGD-e
Aligns to 7:200 / 436 (44.5%), covers 99.4% of PF01595, 168.2 bits
- Retrospective Use of Whole-Genome Sequencing Expands the Multicountry Outbreak Cluster of Listeria monocytogenes ST1247
Mäesaar, International journal of genomics 2021 - “...[ 10 ]. The two strains had three allelic differences ( lmo1630 ( trpC ), lmo2399 , and lmo2778 ) out of 1,744 loci detected in both isolates based on 1,748 cgMLST scheme [ 18 ]. The wgMLST scheme created using chewBBACA and based on VLTRLM2013...”
- “...out of five allelic differences consisted of SNPs that were detected in the lmo1630 , lmo2399 , lmo2778 , and murE genes. All the detected SNPs were nonsynonymous and did not lead to premature stop codons (PMSC). The only non-SNP allelic difference was identified in the...”
- Listeria monocytogenes {sigma}B has a small core regulon and a conserved role in virulence but makes differential contributions to stress tolerance across a diverse collection of strains
Oliver, Applied and environmental microbiology 2010 - “...lmo2196 lmo2230 lmo2231 lmo2368 lmo2386 lmo2387 lmo2389 lmo2399 lmo2437 lmo2465 lmo2511 lmo2520 lmo2522 lmo2534 lmo2536 lmo2568 lmo2611 lmo2638 lmo2670 lmo2695...”
- Comparative analysis of the sigma B-dependent stress responses in Listeria monocytogenes and Listeria innocua strains exposed to selected stress conditions
Raengpradub, Applied and environmental microbiology 2008 - “...by the present study (lmo0524, lmo1539, lmo2389, lmo2399, pdhA, and qoxA) had statistically significant differences (adjusted P 0.05) in transcript levels...”
- Identification of Listeria monocytogenes genes involved in salt and alkaline-pH tolerance
Gardan, Applied and environmental microbiology 2003 - “...in different grampositive bacteria, and lmo2232 has a paralogue (lmo2399) and five orthologues in B. subtilis yhdP, yrkA, yqhB, yugS, and yhdT and in other...”
- Listeria monocytogenes sigma B regulates stress response and virulence functions
Kazmierczak, Journal of bacteriology 2003 - “...stressed cells (0.5 M KCl). lmo0438 lmo0994 lmo2399 lmo2386 lmo2673 lmo1580 lmo0794 lmo2269 lmo0911 lmo1606 DNA translocase lmo2511 qoxA lmo2389 lmo0880...”
Q87DZ3 Hemolysin from Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Aligns to 14:206 / 448 (43.1%), covers 100.0% of PF01595, 168.2 bits
LIC13143 hemolysin (NCBI) from Leptospira interrogans serovar Copenhageni str. Fiocruz L1-130
Aligns to 7:202 / 444 (44.1%), covers 100.0% of PF01595, 167.2 bits
BMD_0560 hemolysin family protein from Priestia megaterium DSM 319
BMD_0560 hypothetical protein (RefSeq) from Bacillus megaterium DSM319
Aligns to 10:187 / 421 (42.3%), covers 98.3% of PF01595, 166.7 bits
WP_036162133 hemolysin family protein from Lysinibacillus sphaericus
Aligns to 8:202 / 446 (43.7%), covers 99.4% of PF01595, 166.1 bits
HI0107 conserved hypothetical protein (NCBI ptt file) from Haemophilus influenzae Rd KW20
Aligns to 1:172 / 403 (42.7%), covers 91.7% of PF01595, 166.0 bits
BP951000_2207 hemolysin family protein from Brachyspira pilosicoli 95/1000
Aligns to 4:195 / 423 (45.4%), covers 99.4% of PF01595, 165.8 bits
BHWA1_00962 putative hemolysin (RefSeq) from Brachyspira hyodysenteriae WA1
BHWA1_RS04705 hemolysin family protein from Brachyspira hyodysenteriae WA1
Aligns to 4:195 / 432 (44.4%), covers 98.9% of PF01595, 165.7 bits
- The complete genome sequence of the pathogenic intestinal spirochete Brachyspira pilosicoli and comparison with other Brachyspira genomes
Wanchanthuek, PloS one 2010 - “...the genome of B. hyodysenteriae WA1 [15] , an additional putative hemolysin gene was identified (BHWA1_00962). Only single copies of tlyA , tlyB , tlyC , and acpP (also known as hlyA [73] ) were identified in the partial genome of B. murdochii . On the...”
- “...lacked a gene with similarity to that encoding the new putative hemolysin of B. hyodysenteriae (BHWA1_00962). From this, it is possible that the new putative hemolysin identified in B. hyodysenteriae is responsible for its strongly hemolytic phenotype. Alternatively, it has been suggested that differences between B....”
- Differential expression of hemolysin genes in weakly and strongly hemolytic Brachyspira hyodysenteriae strains
Joerling, BMC veterinary research 2020 - “...[ 27 , 28 ]. Due to the lack of the putative hemolysin gene ( BHWA1_RS04705 ) in the weakly hemolytic strain B. pilosicoli 95/1000 compared with shBh strain WA1, Wanchanthuek et al. (2010) concluded that this factor might contribute to strong hemolysis [ 21 ]....”
- “...increased by 100% in the shBh B204. During the lag phase the hemolysin gene ( BHWA1_RS04705 ) was initially upregulated 22-fold in B204 compared with G423 ( p -value <0.001). At the second time point hemolysin gene transcription was 6-fold higher in B204 compared with G423....”
- Phylogenetic diversity, antimicrobial susceptibility and virulence gene profiles of Brachyspira hyodysenteriae isolates from pigs in Germany
Joerling, PloS one 2018 - “...for hemolysins ( tlyA , tlyB , tlyC , hlyA , BHWA1_RS02885 , BHWA1_RS09085 , BHWA1_RS04705 , and BHWA1_RS02195 ), outer membrane proteins (OMPs) ( bhlp16 , bhlp17 . 6 , bhlp29 . 7 , bhmp39f , and bhmp39h ) as well as iron acquisition factors...”
- “...all eight B . hyodysenteriae hemolysin genes tlyA , tlyB , tlyC , hlyA , BHWA1_RS04705 , BHWA1_RS09085 , BHWA1_RS02195 , and BHWA1_RS02885 [ 34 , 35 , 36 , 37 , 38 ]. One PCR reaction mix (30 l total volume) contained 1 x NH...”
AWN65_RS11020 hemolysin family protein from Flavobacterium covae
Aligns to 4:196 / 427 (45.2%), covers 98.3% of PF01595, 165.4 bits
SO1354 hemolysin protein, putative (NCBI ptt file) from Shewanella oneidensis MR-1
Aligns to 10:187 / 423 (42.1%), covers 93.9% of PF01595, 164.2 bits
LLKF_2026 magnesium and cobalt efflux protein (RefSeq) from Lactococcus lactis subsp. lactis KF147
L84992 transport protein (NCBI ptt file) from Lactococcus lactis subsp. lactis Il1403
Aligns to 6:200 / 430 (45.3%), covers 100.0% of PF01595, 163.7 bits
Cj0183 putative integral membrane protein with haemolysin domain (NCBI ptt file) from Campylobacter jejuni subsp. jejuni NCTC 11168
Aligns to 27:221 / 452 (43.1%), covers 98.3% of PF01595, 163.5 bits
- Virulence properties of Campylobacter jejuni are enhanced by displaying a mycobacterial TlyA methylation pattern in its rRNA
Sałamaszyńska-Guz, Cellular microbiology 2020 - “...Koot, van Nuenen, & van der Zeijst, 1998 ) under control of the C. jejuni cj0183 gene promoter (SaamaszyskaGuz, Grodzik, & Klimuszko, 2013 ). This created strain 81176 cj0588 :: Myco_tlyA II (Table 1 ). All strain constructions were verified by polymerase chain reaction (PCR) and...”
- “..., Grodzik , M. , & Klimuszko , D. ( 2013 ). Mutational analysis of cj0183 Campylobacter jejuni promoter . Current Microbiology , 67 ( 6 ), 696 702 . 23884593 SaamaszyskaGuz , A. , & Klimuszko , D. ( 2008 ). Functional analysis of the...”
- Mutational analysis of cj0183 Campylobacter jejuni promoter
Salamasznska-Guz, Current microbiology 2013 - “...Current Microbiology 0343-8651 1432-0991 Springer US Boston 3824568 23884593 420 10.1007/s00284-013-0420-8 Article Mutational Analysis of cj0183 Campylobacter jejuni Promoter Salamasznska-Guz Agnieszka asalam@tlen.pl 1 Grodzik Marta 2 Klimuszko Danuta 1 1 Department of Pre-Clinical Sciences, Warsaw University of Life Sciences, Warsaw, Poland 2 Department of Animal Nutrition...”
- “...and reproduction in any medium, provided the original author(s) and the source are credited. Gene-nominated cj0183 was identified in Campylobacter jejuni NCTC 11168 and in two human isolates 81116 and 81-176. It encodes a protein which shows partial homology to TlyC of Brachyspira hyodysenteriae . The...”
- Influence of mutation in cj0183 and cj0588 genes for colonization abilities of Campylobacter jejuni in Caco-2 cells using confocal laser scanning microscope
Salamaszyńska-Guz, Polish journal of veterinary sciences 2013 (PubMed)- “...Short communication Influence of mutation in cj0183 and cj0588 genes for colonization abilities of Campylobacter jejuni in Caco-2 cells using...”
- “...SGGW, Nowoursynowska 159, 02-776 Warsaw, Poland Abstract The cj0183 and cj0588 genes identified in the Campylobacter jejuni NCTC 11168 genome encode proteins...”
- Functional analysis of the Campylobacter jejuni cj0183 and cj0588 genes
Sałamaszyńska-Guz, Current microbiology 2008 (PubMed)- “...the Campylobacter jejuni cj0183 and cj0588 Genes Agnieszka Saamaszynska-Guz AE Danuta Klimuszko Received: 27 June 2007 / Accepted: 11 December 2007 / Published...”
- “...O Springer Science+Business Media, LLC 2008 Abstract The cj0183 and cj0588 genes identified in the Campylobacter jejuni NCTC 11168 genome encode proteins with...”
NCgl1392 hemolysin family protein from Corynebacterium glutamicum ATCC 13032
cg1639 CBS domain-containing protein (RefSeq) from Corynebacterium glutamicum ATCC 13032
Aligns to 8:202 / 354 (55.1%), covers 100.0% of PF01595, 163.4 bits
SERP0507 CBS domain protein (NCBI) from Staphylococcus epidermidis RP62A
Aligns to 2:179 / 341 (52.2%), covers 98.9% of PF01595, 163.2 bits
- Toxin Mediates Sepsis Caused by Methicillin-Resistant Staphylococcus epidermidis
Qin, PLoS pathogens 2017 - “...CzrA family transcriptional regulator -3.30 -2.32 -1.42 - SERP0273 alpha/beta hydrolase -3.08 -1.73 -1.78 - SERP0507 CBS domain-containing protein -3.06 -1.48 -2.07 - SERP2091 hypothetical protein -2.94 -1.32 -2.22 - SE0735 -2.91 -1.12 -2.60 - SERP1476 hypothetical protein -2.91 -9.68 3.33 - SERP1477 ABC transporter ATP-binding...”
SE_0613 CNNM domain-containing protein from Staphylococcus epidermidis ATCC 12228
Aligns to 2:179 / 341 (52.2%), covers 98.9% of PF01595, 163.2 bits
- Food-derived coagulase-negative Staphylococcus as starter cultures for fermented foods
Heo, Food science and biotechnology 2020 - “...hlb 0 0 0 0 0 0 hld 0 2.6 23.5 0 0 0 3.6 SE_0613 0 0 3.2 0 0 0 SE_1760 0 0 3.2 0 0 0 Enterotoxin genes sea 0 0 0 0 0 0 0 seb 0 0 0 0 0 0...”
- “...) Jeong et al. ( 2016a ) Blank box indicates an assay was not performed SE_0613 and SE_1760 are the hemolysin- and hemolysin III-encoding genes, respectively, from S. epidermidis ATCC 12228 hylIII, hemolysin III-encoding gene from Bacillus cereus Staphylococcus carnosus does not produce the biogenic amines...”
A21D_01697 CNNM domain-containing protein from Virgibacillus dokdonensis
Aligns to 3:179 / 416 (42.5%), covers 100.0% of PF01595, 162.5 bits
A9WCP0 HlyC/CorC family transporter from Chloroflexus aurantiacus (strain ATCC 29366 / DSM 635 / J-10-fl)
Aligns to 5:197 / 433 (44.6%), covers 100.0% of PF01595, 162.4 bits
- Deciphering the functional role of hypothetical proteins from Chloroflexus aurantiacs J-10-f1 using bioinformatics approach
Thakur, Molecular biology research communications 2020 - “...Rhamnose/fucosemutarotase A9WDH7 Photosynthetic complex assembly protein 2, putative A9WDG5 P loop containing nucleoside triphosphate hydrolase A9WCP0 FAD binding, type PCMH, subdomain 2 A9WCL1 P loop containing nucleoside triphosphate hydrolase A9WBY1 S adenosyl L methionine dependent methyltransferase A9WB90 Immunity protein 26 A9WKM2 DoxX family A9WA42 Flagellar filament...”
- “...8.63 84910 49.37 unstable 122.28 0.655 A9WDG5 192 21106.34 6.28 17990 41.23 unstable 98.07 -0.016 A9WCP0 433 48100.26 4.65 38390 38.63 stable 116.84 0.134 A9WCL1 544 63433.76 9.15 134885 46.62 unstable 89.21 -0.393 A9WBY1 825 89589 8.91 126740 35.24 stable 115.94 0.531 A9WBA3 101 11474.1 4.94...”
lmo2738 conserved hypothetical protein similar to hypothetical hemolysin (NCBI ptt file) from Listeria monocytogenes EGD-e
Aligns to 15:204 / 444 (42.8%), covers 100.0% of PF01595, 161.9 bits
LMOf2365_2725 CBS domain protein (NCBI) from Listeria monocytogenes str. 4b F2365
Aligns to 15:204 / 444 (42.8%), covers 100.0% of PF01595, 161.9 bits
EF0700 hemolysin (NCBI ptt file) from Enterococcus faecalis V583
OG1RF_10438 hemolysin family protein from Enterococcus faecalis OG1RF
Aligns to 16:202 / 459 (40.7%), covers 100.0% of PF01595, 161.1 bits
Acife_2190 hemolysin family protein from Acidithiobacillus ferrivorans SS3
Aligns to 8:204 / 441 (44.7%), covers 98.3% of PF01595, 161.0 bits
- Acidithiobacillus ferrivorans SS3 presents little RNA transcript response related to cold stress during growth at 8 °C suggesting it is a eurypsychrophile
Christel, Extremophiles : life under extreme conditions 2016 - “...acid a,c-diamide synthase CbiA 149 61 NS Acife_2081 Cobalamin biosynthesis protein CbiX 11 5 NS Acife_2190 Cobalt transporter 27 13 NS Acife_2431 Catalase 197 371 NS Acife_2993 Cobalamin biosynthesis protein CobS 14 0 NS Acife_3135 Cobyrinic acid a,c-diamide synthase CbiA 19 17 NS 3peroxiredoxin d NS...”
- “...and superoxide dismutase (Acife_1434). Its genomic production potentially includes three cobalt transporters (Acife_0490, Acife_1063, and Acife_2190), as well as the cobalamin biosynthesis proteins CobS (Acife_2993), CbiX (Acife_2081), and two copies of CbiA (Acife_1891 and Acife_3125). In addition, several other enzymes dealing with oxidative stress were found,...”
SAB0786 probable hemolysin (NCBI) from Staphylococcus aureus RF122
Aligns to 3:179 / 346 (51.2%), covers 98.9% of PF01595, 159.4 bits
G414_RS0106815 hemolysin family protein from Weissella halotolerans DSM 20190
Aligns to 11:208 / 451 (43.9%), covers 99.4% of PF01595, 159.2 bits
SAR0882 putative membrane protein (NCBI) from Staphylococcus aureus subsp. aureus MRSA252
SA0780 hypothetical protein (NCBI) from Staphylococcus aureus subsp. aureus N315
SAV0919 hemolysin (NCBI) from Staphylococcus aureus subsp. aureus Mu50
Aligns to 3:179 / 346 (51.2%), covers 98.9% of PF01595, 158.7 bits
- The Staphylococcus aureus response to unsaturated long chain free fatty acids: survival mechanisms and virulence implications
Kenny, PloS one 2009 - “...hypothetical protein 2.34 3.01E-02 SAR0879 NifU-like protein 2.06 3.39E-02 SAR0880 conserved hypothetical protein 2.14 3.47E-03 SAR0882 putative membrane protein 4.05 4.12E-03 SAR0931 putative membrane protein 7.87 4.28E-04 SAR1055 hypothetical protein 4.50 3.08E-03 SAR1077 putative membrane protein 2.54 5.69E-03 SAR1227 conserved hypothetical protein 2.11 1.71E-02 SAR1258 putative...”
- Genetic screens reveal novel major and minor players in magnesium homeostasis of Staphylococcus aureus
Trachsel, PLoS genetics 2019 - “...a novel element involved in magnesium homeostasis, mpfA (Magnesium Protection Factor ASA0657) and its paralog SA0780. We identified MpfA in a genetic screen for mutations suppressing the slow growth on defined medium of a DEAD-box helicase mutant (CshB) [ 39 ]. Indeed, in that particular mutant,...”
- “...and increasing amount of MgCl 2 . Plates were incubated for 24h at 37C. MpfB (SA0780), an auxiliary magnesium export protein The S . aureus genome encodes an MpfA paralog, SA0780 that we suggest to name MpfB. This protein shares a similar domain architecture to MpfA...”
- An Essential Factor for High Mg2+ Tolerance of Staphylococcus aureus
Armitano, Frontiers in microbiology 2016 - “...two corA -like genes (SA2137 and SA2166), and two homologs of Salmonella corB (SA0657 and SA0780), none of which have been studied. Staphylococcus aureus is a gram-positive opportunistic pathogen that is present in the nasal cavities of approximately 1/3 of the population ( Kuehnert et al.,...”
- “...cobalt resistance screen by Gibson et al. (1991) . The S. aureus genome additionally encodes SA0780, a paralog to SA0657 that is 103 residues shorter ( Figure 5 and Supplementary Figure S7 ). To get a better grasp of the evolution and the distribution of SA0657...”
- The Genera Staphylococcus and Macrococcus
, The ProkaryotesVolume 4: Bacteria: Firmicutes, Cyanobacteria 2006 - “...SaPIn3/SaPIm3 Possible leukocidin SA1813 lukM Unknown - Possible hemolysin SA0657 None Unknown 89 Possible hemolysin SA0780 None Unknown 82 Similar to exotoxin 1 SA1009 None Unknown 55 Possible hemolysin SA1812 None Unknown - Similar to hemolysin III SA1973 None Unknown 75 Possible exotoxins SA0357 None Unknown...”
- Staphylococcus aureus in vitro secretion of alpha toxin (hla) correlates with the affiliation to clonal complexes
Monecke, PloS one 2014 - “...additional genes that are assumed to encode for additional haemolysins (such as BA000017.4: locus tag SAV0919; base positions 962,930 to 963,970 or CP000046.1: locus tag SACOL2160; base positions 2,239,231 to 2,239,914). The alpha toxin (also known as haemolysin alpha) is encoded by the hla gene (BA000018.3:...”
- Staphylococcus aureus virulence expression is impaired by Lactococcus lactis in mixed cultures
Even, Applied and environmental microbiology 2009 - “...0.5 0.6 1.8 0.9 2.2 1.6 Hemolysin genes SAV2035 SAV0919 SAV2170 MW1959 MW0802 MW2096 hld/RNAIII Delta-hemolysin Hemolysin Hemolysin III 1.6 0.4 1.4 1.8 0.5 2.0...”
- Insights on evolution of virulence and resistance from the complete genome analysis of an early methicillin-resistant Staphylococcus aureus strain and a biofilm-producing methicillin-resistant Staphylococcus epidermidis strain
Gill, Journal of bacteriology 2005 - “...nuc SA0860 SA1264 lytN SA1281 SA0833 clpP SAV2170 SAV0919 SAV2202 SAV1324 SAV0815 SAV1247 SAV1262 SAV0768 hysA nuc lytN clpP SA1973 SA0780d SA2003 hysA SA1160...”
MW0802 ORFID:MW0802~hypothetical protein, similar to hemolysin (NCBI ptt file) from Staphylococcus aureus subsp. aureus MW2
Aligns to 3:179 / 346 (51.2%), covers 98.9% of PF01595, 158.7 bits
Q8EDE1 Transporter-like protein HCC family from Shewanella oneidensis (strain MR-1)
Aligns to 4:196 / 439 (44.0%), covers 99.4% of PF01595, 158.6 bits
SACOL0921 CBS domain protein (NCBI) from Staphylococcus aureus subsp. aureus COL
Aligns to 3:179 / 346 (51.2%), covers 98.9% of PF01595, 158.5 bits
- The second messenger c-di-AMP inhibits the osmolyte uptake system OpuC in Staphylococcus aureus
Schuster, Science signaling 2016 - “...encode the inosine-5 monophosphate dehydrogenase GuaB (SACOL0460), two membrane proteins with unknown functions (SACOL0762 and SACOL0921), the magnesium transporter MgtE (SACOL1013), the transcription factor CcpN (SACOL1621), and a multi-domain cytoplasmic protein of unknown function (SACOL1752). Sequence alignments comparing the CBS domains of OpuCA with the CBS...”
- “...). E. coli strains producing a His-MBP fusion to four of these proteins [SACOL0460 (GuaB), SACOL0921, SACOL1013 (MgtE), and SACOL1621 (CcpN)] were present in the S. aureus ORFeome library, however none of these fusion proteins interacted with c-di-AMP in the initial screen. To confirm the absence...”
- Prevalence of clonal complexes and virulence genes among commensal and invasive Staphylococcus aureus isolates in Sweden
Rasmussen, PloS one 2013 - “...Transferrin binding protein 46 (100) 88 (100) 1 1 Fishers exact test 2 Locus tag SACOL0921, GenBank CP000046.1: Position 927776-928816 3 Locus tag SACOL2160, GenBank CP000046.1: Position 2239231-2239914 4 Locus tag SACOL2004, GenBank CP000046.1: Position 2064956-2065972, Locus tag SACOL2006, GenBank CP000046.1: Position 2065994-2067049 5 Also known...”
- Differentiation of clonal complex 59 community-associated methicillin-resistant Staphylococcus aureus in Western Australia
Coombs, Antimicrobial agents and chemotherapy 2010 - “...the hl (GenBank accession no. CP000046.1, locus tag SACOL0921), hla, hld, and hlIII hemolysin genes. Three out of five probes for betahemolysin yielded signals,...”
- The fusidic acid stimulon of Staphylococcus aureus
Delgado, The Journal of antimicrobial chemotherapy 2008 - “...SACOL0303 SACOL1419 SACOL1005 SACOL1777 SACOL0851 SACOL0921 SACOL1034 SACOL1074 SACOL2461 SACOL0225 SACOL2579 SACOL0922 SACOL2462 SACOL2241 SACOL1115 SACOL0688...”
EFAU085_01000 hemolysin family protein from Enterococcus faecium Aus0085
Aligns to 15:201 / 458 (40.8%), covers 98.9% of PF01595, 158.2 bits
Q84R21 DUF21 domain-containing protein At1g55930, chloroplastic from Arabidopsis thaliana
AT1G55930 CBS domain-containing protein / transporter associated domain-containing protein (RefSeq) from Arabidopsis thaliana
Aligns to 158:335 / 653 (27.3%), covers 100.0% of PF01595, 158.1 bits
SP_1963 CBS domain-containing protein (RefSeq) from Streptococcus pneumoniae TIGR4
Aligns to 14:204 / 443 (43.1%), covers 97.8% of PF01595, 157.2 bits
- Identification of Pneumococcal Factors Affecting Pneumococcal Shedding Shows that the dlt Locus Promotes Inflammation and Transmission.
Zafar, mBio 2019 - “...compound-binding protein Lipoprotein component of iron ABC transport Piu system ( 88 , 89 ) SP_1963 0.036813 Putative hemolysin CBS domain-containing protein with homology to putative cytolysin proteins ( 64 ) SP_1964 0.033659 endA ; DNA entry nuclease Surface endonuclease that degrades the DNA scaffold of...”
- “...to date we have validated the effects of two other hits listed in Table1 , SP_1963 (annotated as a putative hemolysin) and SP_1964 (endonuclease; endA ). Pneumococci carrying both were confirmed to have a defect in shedding, but they did not impact colonization density. Prior studies...”
PCS8235_RS10805 hemolysin family protein from Streptococcus pneumoniae PCS8235
Aligns to 14:204 / 443 (43.1%), covers 97.8% of PF01595, 157.0 bits
- Exploration of Streptococcus core genome to reveal druggable targets and novel therapeutics against S. pneumoniae
Chowdhury, PloS one 2022 - “...= 3 SV = 1 UPF0374 protein SSU05 [ S . pneumoniae ] 28 . PCS8235_RS10805 Uncharacterized protein GO:0016021 GO:0050660 HlyC/CorC family transporter [ S . pneumoniae ] Physicochemical characterization The physicochemical properties of the 28 HPs are provided in Table 2 . The length of...”
- “...DEG10070008 9.91E-61 179 PCS8235_RS08125 DEG10210140 0.29 31.6 PCS8235_RS08375 DEG10070005 4.49E-50 151 PCS8235_RS10555 DEG10620252 1.79E-77 228 PCS8235_RS10805 DEG10390037 7.16E-50 174 Virulence factors and pathogenicity Virulence factors are the basis of bacterial infections. The virulent and pathogenic proteins help microbes invade the host and manipulate the host immune...”
WEISSC39_RS08935 hemolysin family protein from Weissella confusa LBAE C39-2
Aligns to 10:208 / 455 (43.7%), covers 98.3% of PF01595, 156.9 bits
BPSS1795 putative membrane protein (NCBI) from Burkholderia pseudomallei K96243
Aligns to 8:203 / 446 (43.9%), covers 95.0% of PF01595, 156.7 bits
7m1tA / A0A1G8XA46 Crystal structure of an archaeal cnnm, mtcorb, with c-terminal deletion in complex with mg2+-atp (see paper)
Aligns to 8:183 / 321 (54.8%), covers 99.4% of PF01595, 156.6 bits
- Ligands: magnesium ion; adenosine-5'-triphosphate (7m1tA)
SPD_1761 CBS domain membrane protein (NCBI) from Streptococcus pneumoniae D39
Aligns to 14:204 / 443 (43.1%), covers 97.8% of PF01595, 156.1 bits
SMc00697 HYPOTHETICAL TRANSMEMBRANE PROTEIN (NCBI ptt file) from Sinorhizobium meliloti 1021
Aligns to 16:198 / 434 (42.2%), covers 96.1% of PF01595, 156.0 bits
AT3G13070 CBS domain-containing protein / transporter associated domain-containing protein (RefSeq) from Arabidopsis thaliana
Q9LK65 Putative DUF21 domain-containing protein At3g13070, chloroplastic from Arabidopsis thaliana
Aligns to 163:340 / 661 (26.9%), covers 100.0% of PF01595, 156.0 bits
- Genome-Wide Investigation and Expression Profiling Under Abiotic Stresses of a Soybean Unknown Function (DUF21) and Cystathionine-β-Synthase (CBS) Domain-Containing Protein Family
Hao, Biochemical genetics 2021 - “...At02 6182193..6184648 3 cyto CBS domain-containing protein with a domain of unknown function (DUF21) AtCBSDUF5 AT3G13070 661 73.75 5.00 At03 4191351..4195112 4 plas CBS domain-containing protein/transporter associated domain-containing protein AtCBSDUF6 AT4G14230 495 53.49 6.10 At04 8200667..8203238 3 chlo CBS domain-containing protein with a domain of unknown...”
- Purification, crystallization and preliminary crystallographic analysis of the CBS-domain protein MJ1004 from Methanocaldococcus jannaschii
Oyenarte, Acta crystallographica. Section F, Structural biology and crystallization communications 2011 - “...3, CLCE; 4, CLCC; 5, CLCA; 6, Q9M1T1; 7, Q9LG18; 8, Q9LK65; 9, CLCG; 10, CLCB; 11, UMP3; 12, CLCD; 13, CLCF; 14, Q9XI37; 15, O23193; 16, Q9C5D0; 17, O49493....”
SSA_1761 Hemolysin (containing CBS domains), putative (NCBI) from Streptococcus sanguinis SK36
Aligns to 14:203 / 446 (42.6%), covers 98.3% of PF01595, 155.9 bits
SSU05_1668 Hemolysins and related proteins containing CBS domains (RefSeq) from Streptococcus suis 05ZYH33
AN924_RS07935 hemolysin family protein from Streptococcus suis
Aligns to 13:204 / 445 (43.1%), covers 97.8% of PF01595, 155.7 bits
WBM_RS00425 CNNM domain-containing protein from Wolbachia endosymbiont strain TRS of Brugia malayi
Wbm0070 Putative Mg2+ and Co2+ transporter CorB (NCBI) from Wolbachia endosymbiont strain TRS of Brugia malayi
Aligns to 10:188 / 428 (41.8%), covers 97.2% of PF01595, 155.5 bits
- Dual RNAseq analyses at soma and germline levels reveal evolutionary innovations in the elephantiasis-agent Brugia malayi, and adaptation of its Wolbachia endosymbionts
Chevignon, PLoS neglected tropical diseases 2021 - “...Protein (WSP) family S 610,3 681,0 540,5 -0,17 0,9995 0,17 0,9936 0,34 0,8203 6 WBM0070 WBM_RS00425 Mg2+/Co2+ transporter 4 609,8 676,6 588,5 -0,15 0,9995 0,05 0,9936 0,20 0,8811 39 WBM0736 WBM_RS04525 secreted FK506 binding protein-like Bm 538,4 581,6 579,7 -0,11 0,9995 -0,10 0,9936 0,01 0,9913 27...”
- Dual RNAseq analyses at soma and germline levels reveal evolutionary innovations in the elephantiasis-agent Brugia malayi, and adaptation of its Wolbachia endosymbionts
Chevignon, PLoS neglected tropical diseases 2021 - “...Surface Protein (WSP) family S 610,3 681,0 540,5 -0,17 0,9995 0,17 0,9936 0,34 0,8203 6 WBM0070 WBM_RS00425 Mg2+/Co2+ transporter 4 609,8 676,6 588,5 -0,15 0,9995 0,05 0,9936 0,20 0,8811 39 WBM0736 WBM_RS04525 secreted FK506 binding protein-like Bm 538,4 581,6 579,7 -0,11 0,9995 -0,10 0,9936 0,01 0,9913...”
- Identification of putative effectors of the Type IV secretion system from the Wolbachia endosymbiont of Brugia malayi
Carpinone, PloS one 2018 - “...hypothetical WBM0452 SAM-dependent methyltransferase E, 4 WBM0064 FAD-dependent oxidoreductase WBM0482 hypothetical, tropomyosin-like Bm , E WBM0070 Mg 2+ /Co 2+ transporter 4 WBM0484 hypothetical protein S WBM0076 WAS(p) family protein, proline-rich E WBM0491 cytochrome C oxidase assembly protein S WBM0100 Wolbachia Surface Protein (WSP) family S...”
EMQU_0948 hemolysin family protein from Enterococcus mundtii QU 25
Aligns to 15:201 / 458 (40.8%), covers 99.4% of PF01595, 155.2 bits
- Complete genome sequence of Enterococcus mundtii QU 25, an efficient L-(+)-lactic acid-producing bacterium
Shiwa, DNA research : an international journal for rapid publication of reports on genes and genomes 2014 - “...Four putative haemolysin genes (haemolysin, haemolysin III, haemolysin A, and -haemolysin) were identified (EMQU_0190 and EMQU_0948, EMQU_0449, EMQU_0841, and EMQU_1982, respectively). We tested haemolysin activity and no changes to the blood agar in the vicinity of the colonies were observed (data not shown), suggesting that these...”
SPy0378 putative hemolysin (NCBI ptt file) from Streptococcus pyogenes M1 GAS
Aligns to 14:204 / 444 (43.0%), covers 97.8% of PF01595, 154.8 bits
SDEG_0427 putative hemolysin (RefSeq) from Streptococcus dysgalactiae subsp. equisimilis GGS_124
Aligns to 14:203 / 444 (42.8%), covers 97.2% of PF01595, 154.6 bits
LCGL_0374 hemolysin family protein from Lactococcus garvieae Lg2
Aligns to 16:205 / 442 (43.0%), covers 96.1% of PF01595, 154.0 bits
SMU_1693 hemolysin family protein from Streptococcus mutans UA159
Aligns to 14:204 / 445 (42.9%), covers 97.8% of PF01595, 154.0 bits
- Protein Interactomes of Streptococcus mutans YidC1 and YidC2 Membrane Protein Insertases Suggest SRP Pathway-Independent- and -Dependent Functions, Respectively.
Lara, mSphere 2021 - “...(SMU_872) Putative PTS system, mannose-specific component IID (SMU_1879) Putative deacetylase (SMU_623c) Hypothetical protein (SMU_591c)* Hemolysin (SMU_1693) Conserved hypothetical protein, glycosyl transferase (SMU_834) Putative ABC transporter, ATP-binding protein ComA (SMU_286) Hypothetical protein APQ13_07375 (ParE_toxin) (SMU_40) Putative PTS system, glucose-specific IIABC component (SMU_2047) Conserved hypothetical protein, protease (SMU_235)...”
- “...a YidC1- and/or YidC2-only pathway, were mostly single- or double-pass membrane proteins except for hemolysin (SMU_1693) that contains four predicted TM domains. The identification of a higher proportion of membrane proteins in the lower molecular weight region suggests that the YidC1-SecY/YajC pathway is widely used for...”
P792_09655 hemolysin family protein from Asaia sp. SF2.1
Aligns to 6:198 / 430 (44.9%), covers 100.0% of PF01595, 153.7 bits
- Blood meal-induced inhibition of vector-borne disease by transgenic microbiota
Shane, Nature communications 2018 - “...63 AGLR1.HlyA HlyA Helicobacter pylori Hemolysin P792_09125 51 64 AGLR1.HlyC HlyC Vibrio cholera Hemolysin transferase P792_09655 55 65 AGLR1.Ferr TrxR Helicobacter pylori Oxidative stress protection P792_12065 43 66 AGLR1.SodB SodB Escherichia coli Oxidative stress protection P792_08220 62 67 AGLR1.Bfr Bfr Escherichia coli Iron storage P792_12870 74...”
HD0770 conserved hypothetical protein (NCBI) from Haemophilus ducreyi 35000HP
Aligns to 32:207 / 440 (40.0%), covers 93.9% of PF01595, 153.0 bits
Rmet_4765 hemolysin family protein from Cupriavidus metallidurans CH34
Aligns to 4:196 / 437 (44.2%), covers 99.4% of PF01595, 152.8 bits
Sinf_1513 hemolysin family protein from Streptococcus infantarius subsp. infantarius CJ18
Aligns to 13:203 / 443 (43.1%), covers 97.2% of PF01595, 152.5 bits
plu1254 hypothetical protein (RefSeq) from Photorhabdus luminescens subsp. laumondii TTO1
Aligns to 1:161 / 400 (40.2%), covers 85.0% of PF01595, 152.0 bits
- LuxS-dependent AI-2 production is not involved in global regulation of natural product biosynthesis in Photorhabdus and Xenorhabdus
Heinrich, PeerJ 2017 - “...Fig. 4A ). The luxS gene is located between gshA encoding a -L-glutamyl-L-cysteine synthetase and plu1254, which encodes a protein with unknown function ( Apontoweil & Berends, 1975 ). While P. luminescens luxS G is a deletion of the entire luxS gene including 13 bp of...”
- “...mutant strains. In the WT, the luxS gene (light blue) is located between gshA and plu1254 . Present between luxS and gshA is the small regulatory RNA micA (green). cat (orange): chloramphenicol resistance cassette. (B) micA sequence of P. luminescens TT01 with upstream region (marked in...”
ESE_RS0108795 hemolysin family protein from Weissella cibaria KACC 11862
Aligns to 11:208 / 454 (43.6%), covers 98.9% of PF01595, 151.9 bits
Spaf_1565 hemolysin family protein from Streptococcus parasanguinis FW213
Aligns to 14:203 / 449 (42.3%), covers 97.8% of PF01595, 151.4 bits
EMQU_0190 hemolysin family protein from Enterococcus mundtii QU 25
Aligns to 6:200 / 432 (45.1%), covers 99.4% of PF01595, 151.4 bits
- Complete genome sequence of Enterococcus mundtii QU 25, an efficient L-(+)-lactic acid-producing bacterium
Shiwa, DNA research : an international journal for rapid publication of reports on genes and genomes 2014 - “...large-scale culture. Four putative haemolysin genes (haemolysin, haemolysin III, haemolysin A, and -haemolysin) were identified (EMQU_0190 and EMQU_0948, EMQU_0449, EMQU_0841, and EMQU_1982, respectively). We tested haemolysin activity and no changes to the blood agar in the vicinity of the colonies were observed (data not shown), suggesting...”
ZMO_RS01280 hemolysin family protein from Zymomonas mobilis subsp. mobilis ZM4 = ATCC 31821
Aligns to 16:205 / 441 (43.1%), covers 100.0% of PF01595, 150.9 bits
- Phenotypic and genomic analysis of Zymomonas mobilis ZM4 mutants with enhanced ethanol tolerance
Carreón-Rodríguez, Biotechnology reports (Amsterdam, Netherlands) 2019 - “...(V313A) was located within a gene encoding a member of the HlyC/CorC family transporter protein (ZMO_RS01280). ER79ag also lost one of its plasmids (pZZM402). Table 1 Mutations found in ER79ag and ER79ap. Comparison was made with the sequence of ZM4 clone sequenced in this work (ZM4*)....”
- “...A 76942 ZMO_RS00360 WP_012817506.1 Bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase, SpoT/RelA R676M __ 299718 T C 299718 ZMO_RS01280 WP_011240232.1 HlyC/CorC family transporter V313A __ 810750 G A 810750 ZMO_RS03600 WP_011240680.1 30S ribosomal protein S12 methylthiotransferase RimO R399C __ 965913 A G 965913 ZMO_RS03600 WP_011240805.1 ATP-dependent Clp protease proteolytic...”
c3133 hypothetical protein (RefSeq) from Escherichia coli CFT073
Aligns to 1:161 / 398 (40.5%), covers 85.0% of PF01595, 150.7 bits
STM2679 hypothetical protein (RefSeq) from Salmonella typhimurium LT2
Aligns to 1:161 / 398 (40.5%), covers 85.0% of PF01595, 150.7 bits
- Genome archaeology of two laboratory Salmonella enterica enterica sv Typhimurium.
Zaworski, G3 (Bethesda, Md.) 2021 - “...B and C, the yellow and green rectangles below the alignment are landmarks, respectively gene STM2679 (JJB80-13795) and STM2780 (JJB80-13930). H1 , phase 1 flagellin region transduction patch The H1 phenotype depends on the allelic state of the gene fliC , within the H1 box of...”
- “...to STM2769. Present but divergent are locus_ID JJB81_13790 to JJB81_13790 when aligned with LT2 locus_ID STM2679 and STM3779. We infer that this divergent region represents genomic replacement of 106kb of S. sv Typhimurium LT2 by 41kb of S. sv Abony 803 during the second transduction (...”
- An Essential Factor for High Mg2+ Tolerance of Staphylococcus aureus
Armitano, Frontiers in microbiology 2016 - “...orthology database describes 2043 proteins as orthologs of SA0657, among which is Salmonella CorB (StCorB: STM2679, see Supplementary Figure S5 ) ( Altenhoff et al., 2015 ) 5 . These two proteins share the same domains architecture but their overall similarity is low (22%; Figure 5...”
VV2791 putative hemolysin (NCBI) from Vibrio vulnificus YJ016
Aligns to 1:158 / 396 (39.9%), covers 83.9% of PF01595, 150.2 bits
- Whole-genome comparison between reference sequences and oyster Vibrio vulnificus C-genotype strains
Guerrero, PloS one 2019 - “...virulence genes to cytotoxin, hemolysin, and RTX toxin (VVA0964, VVA0965, VV0508, VV0601, VV0795, VV0914, VV1495, VV2791, VV3230, VVA0118, VVA0303, VVA1339 and VVA1030), as reported by Chen et al. [ 26 ], were found in both strains. Table 2 presents a select list of genes that were...”
- “...VVA1505 + + VV2_1107 + + VV2781 + + VVA1506 + + VV2_1108 + + VV2791 + + VVA1632 + + VV2_1109 + + VV2872 + + VVA1633 + + VV2_1138 + + VV2874 + + VVA1634 + + VV2_1149 + + VV2990 + + VVA1635...”
- Comparative genome analysis of Vibrio vulnificus, a marine pathogen
Chen, Genome research 2003 - “...VVA0965), hemolysins (VV0508, VV0601, VV0795, VV0914, VV1495, VV2791, VV3230, VVA0118, VVA0303, VVA1339), and RTX toxin (VVA1030; Coote 1992) were identified in...”
alr0309 hypothetical protein (NCBI ptt file) from Nostoc sp. PCC 7120
Aligns to 5:179 / 350 (50.0%), covers 98.9% of PF01595, 149.2 bits
VVA1339 putative hemolysin (NCBI) from Vibrio vulnificus YJ016
Aligns to 21:212 / 450 (42.7%), covers 98.9% of PF01595, 148.1 bits
- Whole-genome comparison between reference sequences and oyster Vibrio vulnificus C-genotype strains
Guerrero, PloS one 2019 - “...hemolysin, and RTX toxin (VVA0964, VVA0965, VV0508, VV0601, VV0795, VV0914, VV1495, VV2791, VV3230, VVA0118, VVA0303, VVA1339 and VVA1030), as reported by Chen et al. [ 26 ], were found in both strains. Table 2 presents a select list of genes that were exclusive to V ....”
- “...VV2_0884 + + VV2043 + + VVA1310 + + VV2_0993 + + VV2191 - - VVA1339 + + VV2_0994 + + VV2778 + - VVA1413 - - VV2_1075 + + VV2779 + + VVA1504 + + VV2_1106 + + VV2780 + + VVA1505 + + VV2_1107...”
- Comparative genome analysis of Vibrio vulnificus, a marine pathogen
Chen, Genome research 2003 - “...VV0601, VV0795, VV0914, VV1495, VV2791, VV3230, VVA0118, VVA0303, VVA1339), and RTX toxin (VVA1030; Coote 1992) were identified in the genome sequence of V....”
AYI77_RS13890, AYI97_RS17645, BN1227_RS19795, HU689_20255 hemolysin family protein from Shewanella algae
Aligns to 7:199 / 443 (43.6%), covers 99.4% of PF01595, 148.0 bits
- Complete genome sequence of Shewanella algae strain 2NE11, a decolorizing bacterium isolated from industrial effluent in Peru
Lizárraga, Biotechnology reports (Amsterdam, Netherlands) 2022 - “...Metal Resistance cadA HU689_10830 P-type ATPase protein corA a & corC b HU689_12865 a &(HU689_16615; HU689_20255; HU689_07770) b Magnesium and cobalt transport protein ab zntB HU689_05170 Efflux Zn +2 ion transport protein arsA a & arsB b & arsC c HU689_08030 a &HU689_02860 b &HU689_10495 c...”
- “...to magnesium and cobalt transport such as corA ( HU689_12865 ) and corC ( HU689_16615; HU689_20255; HU689_07770 ), widely associated with the exterior and interior flux of Mg +2 and Co +2 ions in gram-negative and positive bacteria [15] . Resistance to other ions such as...”
- Comparative Genomics Reveals Pathogenicity-Related Loci in Shewanella algae
Wang, The Canadian journal of infectious diseases & medical microbiology = Journal canadien des maladies infectieuses et de la microbiologie medicale 2020 - “...locus_tag Length Strains MARS 14 YHL CHL ACCC hlyA BN1227_RS19795 443 AYI97_RS17645 443 AYI82_RS07480 443 AYI77_RS13890 443 hlyD BN1227_RS18765 352 AYI97_RS03440 352 AYI82_RS00925 352 AYI77_RS05040 352 BN1227_RS19395 349 AYI97_RS04065 349 AYI82_RS01570 349 AYI77_RS08410 349 BN1227_RS08585 314 AYI97_RS05045 314 AYI82_RS17560 314 AYI77_RS14620 314 hlyIII BN1227_RS10295 226 AYI97_RS09385...”
- “...locus_tag Length locus_tag Length locus_tag Length Strains MARS 14 YHL CHL ACCC hlyA BN1227_RS19795 443 AYI97_RS17645 443 AYI82_RS07480 443 AYI77_RS13890 443 hlyD BN1227_RS18765 352 AYI97_RS03440 352 AYI82_RS00925 352 AYI77_RS05040 352 BN1227_RS19395 349 AYI97_RS04065 349 AYI82_RS01570 349 AYI77_RS08410 349 BN1227_RS08585 314 AYI97_RS05045 314 AYI82_RS17560 314 AYI77_RS14620 314...”
- “...locus_tag Length locus_tag Length locus_tag Length locus_tag Length Strains MARS 14 YHL CHL ACCC hlyA BN1227_RS19795 443 AYI97_RS17645 443 AYI82_RS07480 443 AYI77_RS13890 443 hlyD BN1227_RS18765 352 AYI97_RS03440 352 AYI82_RS00925 352 AYI77_RS05040 352 BN1227_RS19395 349 AYI97_RS04065 349 AYI82_RS01570 349 AYI77_RS08410 349 BN1227_RS08585 314 AYI97_RS05045 314 AYI82_RS17560 314...”
BB0202 hemolysin, putative (NCBI ptt file) from Borrelia burgdorferi B31
Aligns to 4:180 / 412 (43.0%), covers 98.9% of PF01595, 147.7 bits
- Membrane directed expression in Escherichia coli of BBA57 and other virulence factors from the Lyme disease agent Borrelia burgdorferi
Robertson, Scientific reports 2019 - “...reflects technical challenges. Furthermore, it has been suggested that transmembrane domains exist in BB0017, BB0164, BB0202, BB0412, BB0473, BB0631, and ChbB 37 . Many of the important outer surface virulence proteins in Bb , including OspA, OspB, OspC, OspD, P13, P66 and Lp6.6, are common components...”
- A high-throughput genetic screen identifies previously uncharacterized Borrelia burgdorferi genes important for resistance against reactive oxygen and nitrogen species
Ramsey, PLoS pathogens 2017 - “...most sensitive to ROS, and the contribution of three such membrane proteins (BB0017, BB0164, and BB0202) to ROS sensitivity was confirmed using individual Tn mutants and complemented strains. Further analysis showed that levels of intracellular manganese are significantly reduced in the Tn:: bb0164 mutant, identifying a...”
- “...sodium/calcium exchanger-like protein 0.069 (0.085, 0.053) chr bb0473 putative MATE transporter 0.077 (0.056, 0.097) chr bb0202 putative CorC-like transporter protein, CBS domain 0.094 (0.101, 0.086) cp26 bbb06 ChbB, chitobiose transporter protein 0.100 (0.108, 0.093) chr bb0669 CheA2, chemotaxis histidine kinase 0.114 (0.033, 0.195) cp9 bbc07 hypothetical...”
AYI82_RS07480 hemolysin family protein from Shewanella algae
Aligns to 7:199 / 443 (43.6%), covers 99.4% of PF01595, 147.6 bits
- Comparative Genomics Reveals Pathogenicity-Related Loci in Shewanella algae
Wang, The Canadian journal of infectious diseases & medical microbiology = Journal canadien des maladies infectieuses et de la microbiologie medicale 2020 - “...locus_tag Length locus_tag Length Strains MARS 14 YHL CHL ACCC hlyA BN1227_RS19795 443 AYI97_RS17645 443 AYI82_RS07480 443 AYI77_RS13890 443 hlyD BN1227_RS18765 352 AYI97_RS03440 352 AYI82_RS00925 352 AYI77_RS05040 352 BN1227_RS19395 349 AYI97_RS04065 349 AYI82_RS01570 349 AYI77_RS08410 349 BN1227_RS08585 314 AYI97_RS05045 314 AYI82_RS17560 314 AYI77_RS14620 314 hlyIII BN1227_RS10295...”
MSMEG_3638 CBS domain protein (NCBI) from Mycobacterium smegmatis str. MC2 155
Aligns to 8:202 / 364 (53.6%), covers 100.0% of PF01595, 147.6 bits
TY24_RS08995 hemolysin family protein from Weissella hellenica
Aligns to 10:208 / 447 (44.5%), covers 98.9% of PF01595, 147.4 bits
sll1254 hemolysin (NCBI ptt file) from Synechocystis sp. PCC 6803
Aligns to 6:180 / 346 (50.6%), covers 99.4% of PF01595, 147.3 bits
LSA0029 Putative ion Mg(2+)/Co(2+) transport protein, hemolysinC-family (NCBI) from Lactobacillus sakei subsp. sakei 23K
Aligns to 10:209 / 447 (44.7%), covers 98.3% of PF01595, 146.6 bits
- Global transcriptome response in Lactobacillus sakei during growth on ribose
McLeod, BMC microbiology 2011 - “...ATPase (ATP synthase), C subunit 0.7 Inorganic ion transport and metabolism Transport/binding of inorganic ions LSA0029 lsa0029 Putative ion Mg(2+)/Co(2+) transport protein, hemolysinC-family -0.7 LSA0134 lsa0134 Putative Na(+)/H(+) antiporter -0.6 LSA0180 mtsC Manganese ABC transporter, ATP-binding subunit -0.8 LSA0181 mtsB Manganese ABC transporter, membrane-spanning subunit -0.8...”
HMPREF0877_RS09665 hemolysin family protein from Weissella paramesenteroides ATCC 33313
Aligns to 10:208 / 452 (44.0%), covers 98.3% of PF01595, 146.6 bits
TP0028 hemolysin, putative (NCBI ptt file) from Treponema pallidum subsp. pallidum str. Nichols
Aligns to 9:185 / 453 (39.1%), covers 98.9% of PF01595, 146.0 bits
- On the origin of the treponematoses: a phylogenetic approach
Harper, PLoS neglected tropical diseases 2008 - “...between the predicted promoter and transcriptional start site of the operon containing genes tp0027 and tp0028 ( Fig. S1 ), could attenuate transcript levels of these genes. Both of these genes are homologous to tlyC , which is believed to either code for a hemolysin or...”
- “...pallidum may be worthwhile, in order to better assess this possibility. Similarly, since tp0027 and tp0028 are both homologous to tlyC , a gene that either encodes a hemolysin or regulates a cryptic one in E. coli [48] , a difference in transcript level between subspecies...”
- Transcriptome of Treponema pallidum: gene expression profile during experimental rabbit infection
Smajs, Journal of bacteriology 2005 - “...0.27 0.26 0.26 TP0106 TP0804 TP0340 TP0288 TP0337 TP0028 TP0514 TP0689 TP0147 TP0336 TP0671 TP0566 TP0516 TP0688 TP0715 TP0714 TP0520 TP0519 TP0517 0.26 0.26...”
- “...Tpr Tpr Tpr Tpr Tpr Hemolysins TP1037 TP0936 TP0649 TP0027 TP0028 1.1 0.78 0.57 0.30 0.23 0 0 0 1 1 Hemolysin III (hlyIII) Putative hemolysin Hemolysin (tlyC)...”
TPANIC_0028 CNNM domain-containing protein from Treponema pallidum subsp. pallidum str. Nichols
Aligns to 28:204 / 472 (37.5%), covers 98.9% of PF01595, 145.9 bits
NTHI0579 hypothetical protein (RefSeq) from Haemophilus influenzae 86-028NP
Aligns to 10:201 / 432 (44.4%), covers 99.4% of PF01595, 145.2 bits
PG0272 CBS domain protein (NCBI) from Porphyromonas gingivalis W83
Aligns to 4:183 / 419 (43.0%), covers 99.4% of PF01595, 145.2 bits
LSEI_2229 hemolysin family protein from Lacticaseibacillus paracasei ATCC 334
LSEI_2229 Hemolysins related protein with CBS domains (NCBI) from Lactobacillus casei ATCC 334
Aligns to 10:210 / 463 (43.4%), covers 98.3% of PF01595, 145.1 bits
- Regulatory Mechanisms of L-Lactic Acid and Taste Substances in Chinese Acid Rice Soup (Rice-Acid) Fermented With a Lacticaseibacillus paracasei and Kluyveromyces marxianus
Liu, Frontiers in microbiology 2021 - “...transcription levels of the genes encoding putative integral membrane protein with a TlyC-like hemolysin domain (LSEI_2229) was up-regulated, whereas the transcription level of the gene encoding adenylosuccinate synthase (LSEI_0122) was down-regulated in the group of the single inoculation of L. paracasei . The genes encoding phosphoglucomutase...”
- “...rice-acid fermentation. On the third day of rice-acid fermentation, the genes of LSEI_0122, LSEI_0949, LSEI_1746, LSEI_2229, and LSEI_2287 were up-regulated and the genes of LSEI_1557, LSEI_2477, and LSEI_2515 were down-regulated. Genes Involved in Amino Sugar and Nucleotide Sugar Metabolism and Starch and Sucrose Metabolism The key...”
S100390_v1c06730 hemolysin family protein from Spiroplasma sp. NBRC 100390
Aligns to 13:195 / 443 (41.3%), covers 99.4% of PF01595, 144.9 bits
- Complete Genome Sequence of Spiroplasma sp. NBRC 100390.
Haryono, Genome announcements 2017 - “...in a nonsynonymous substitution in the predicted functional domain of the respective genes (locus tags S100390_v1c06730 and S100390_v1c09590). However, the BLASTp ( 16 ) searches against the NCBI NR database ( 17 ) showed that these polymorphisms did not affect the protein domain identification. Finally, the...”
LHK_03166 Hemolysins-like protein containing CBS domains (RefSeq) from Laribacter hongkongensis HLHK9
Aligns to 8:199 / 443 (43.3%), covers 97.8% of PF01595, 144.7 bits
lp_2671 integral membrane protein (NCBI ptt file) from Lactobacillus plantarum WCFS1
Aligns to 11:210 / 455 (44.0%), covers 98.3% of PF01595, 144.2 bits
ASA_1523 hemolysin (RefSeq) from Aeromonas salmonicida subsp. salmonicida A449
Aligns to 8:199 / 439 (43.7%), covers 99.4% of PF01595, 143.9 bits
Rmet_0698 hemolysin family protein from Cupriavidus metallidurans CH34
Aligns to 4:195 / 438 (43.8%), covers 99.4% of PF01595, 143.8 bits
APH_0957 CBS/transporter associated domain protein (NCBI) from Anaplasma phagocytophilum HZ
Aligns to 2:181 / 422 (42.7%), covers 98.3% of PF01595, 143.8 bits
- Comparative genomics of first available bovine Anaplasma phagocytophilum genome obtained with targeted sequence capture
Dugat, BMC genomics 2014 - “...of A. phagocytophilum , and do not require secretion. Seven proteins (APH_0208, APH_0232, APH_0561, APH_0687, APH_0957, APH_1084, and APH_1148) involved in various cellular processes such as cell metabolism, and two lipoproteins (APH_0985, APH_1087) with unknown localization, were also detected as potential Sec substrates. Ten hypothetical proteins...”
MB901379_02511 hemolysin family protein from Mycobacterium basiliense
Aligns to 8:202 / 349 (55.9%), covers 100.0% of PF01595, 143.0 bits
Eab7_1596 hemolysin family protein from Exiguobacterium antarcticum B7
Aligns to 7:199 / 439 (44.0%), covers 99.4% of PF01595, 142.4 bits
C9YX17 Putative transport system integral membrane component from Streptomyces scabiei (strain 87.22)
SCAB_83191 putative transporter integral membrane component (RefSeq) from Streptomyces scabiei 87.22
Aligns to 4:198 / 336 (58.0%), covers 98.9% of PF01595, 142.4 bits
Rv1841c hypothetical protein (NCBI) from Mycobacterium tuberculosis H37Rv
Aligns to 8:198 / 345 (55.4%), covers 100.0% of PF01595, 142.4 bits
- Label-Free Comparative Proteomics of Differentially Expressed Mycobacterium tuberculosis Protein in Rifampicin-Related Drug-Resistant Strains.
Ullah, Pathogens (Basel, Switzerland) 2021 - “...Rv1774 Rv1774 Function unknown; probably involved in cellular metabolism Probable oxidoreductase Intermediary metabolism and respiration Rv1841c Rv1841c Unknown Conserved hypothetical membrane protein Cell wall and cell processes Rv1976c Rv1976c Unknown Conserved hypothetical protein Conserved hypotheticals Rv2116 lppK Unknown onserved lipoprotein LppK Cell wall and cell processes...”
- A landscape of genomic alterations at the root of a near-untreatable tuberculosis epidemic
Klopper, BMC medicine 2020 - “...in glutamine synthesis ( glnE ACG278ACA and glnA2 CTG117TTG) in all AA1SA strains 20903642090443 81 Rv1841c AA1SA Non-essential conserved hypothetical membrane protein 22637792266164 2385 Rv2016 Rv2019 175a 22634482263637 AA1SA, some AA1 Rv2016 , Rv2018 and Rv2019 are non-essential, conserved hypothetical proteins. Rv2017 is a transcriptional regulator,...”
- “...large deletions observed in all AA1SA isolates (Table 1 ) include an 81-bp deletion in Rv1841c , a 1202-bp deletion from the region glnA3 - Rv1879 and a 2385-bp deletion from Rv2016 - Rv2019 . The latter two deletions encompass Region of Difference (RD) 163 and...”
- Global transcriptional profiling of longitudinal clinical isolates of Mycobacterium tuberculosis exhibiting rapid accumulation of drug resistance
Chatterjee, PloS one 2013 - “...(3), Rv3371 (2),Rv3642c (3) Rv2623 (3), MT2466 (8),MT1356 (3), Rv0049 (2),Rv0569 (5), Rv1738 (9),Rv1813c (9), Rv1841c (2),Rv2030c (4.5), Rv2596 (5),Rv2626c (10.5), Rv2694c (9),Rv3615c (2), Rv3831 (2) Rv0626 (2) MT1040.1 (5), Rv0141c (4), Rv0340 (3), Rv0875c (4), Rv0876c (2), Rv1766 (5), Rv2310 (3), Rv3088 (4), Rv3698 (2),...”
- Mature Epitope Density--a strategy for target selection based on immunoinformatics and exported prokaryotic proteins
Santos, BMC genomics 2013 - “...10.1016/j.tube.2006.01.014 Rv0436c 78 123 19,14 PSE favorable 10.1074/jbc.M004658200 Rv0116c 117 214 17,61 SEC favorable 10.1099/mic.0.024802-0 Rv1841c 167 308 17,33 PSE favorable 10.1128/jb.184.4.1112-1120.2002 Rv2339 224 437 17,25 PSE favorable 10.1093/molbev/msm111 Rv0589 195 364 17,10 PSE favorable 10.1007/s11010-011-0733-5 Rv1158c 107 189 17,07 SEC favorable 10.1016/j.tube.2004.09.005 Rv0286 129 242...”
- Chromosomal locus that affects pathogenicity of Rhodococcus fascians
Vereecke, Journal of bacteriology 2002 - “...acids) showed the highest similarity to hypothetical protein Rv1841c of M. tuberculosis (48% identity and 64% similarity) (5) and to other putative integral...”
PAEA_SALT1 / A0A0F6BAS6 Polyamine export protein from Salmonella typhimurium (strain 14028s / SGSC 2262) (see paper)
NP_463268 putative hemolysin-related protein from Salmonella enterica subsp. enterica serovar Typhimurium str. LT2
STM4407 putative hemolysin-related protein (NCBI ptt file) from Salmonella typhimurium LT2
Aligns to 6:197 / 447 (43.0%), covers 100.0% of PF01595, 141.5 bits
- function: Involved in cadaverine and putrescine tolerance in stationary phase. May facilitate the efflux of both cadaverine and putrescine from the cytoplasm, reducing potentially toxic levels under certain stress conditions.
disruption phenotype: Deletion mutant loses viability in stationary phase when grown in acidic medium with nitrite. Mutant is sensitive to cadaverine and putrescine but not to spermine or spermidine at pH 9. - PaeA (YtfL) protects from cadaverine and putrescine stress in Salmonella Typhimurium and E. coli.
Iwadate, Molecular microbiology 2021 (PubMed)- GeneRIF: PaeA (YtfL) protects from cadaverine and putrescine stress in Salmonella Typhimurium and E. coli.
- An Essential Factor for High Mg2+ Tolerance of Staphylococcus aureus
Armitano, Frontiers in microbiology 2016 - “...CorA. Among the SA0657 orthologs, we identified a paralog of CorB in S. Typhimurium genome (STM4407), whose function is unknown and which was not identified in the cobalt resistance screen by Gibson et al. (1991) . The S. aureus genome additionally encodes SA0780, a paralog to...”
- “...we performed a phylogenetic analysis of the 3743 predicted orthologs of SA0657, SA0780, StCorB, StCorC, STM4407, human CNNM2 and murin CNNM2 (see Discussion) (Supplementary Figure S4 ). This analysis reveals that SA0657 orthologs are widely distributed in the prokaryotic kingdom and that each phylum often possess...”
YtfL / b4218 UPF0053 family inner membrane protein YtfL from Escherichia coli K-12 substr. MG1655 (see 3 papers)
PAEA_ECOLI / P0AE45 Polyamine export protein from Escherichia coli (strain K12) (see 2 papers)
ECs5196 putative transport protein (NCBI ptt file) from Escherichia coli O157:H7 str. Sakai
NP_418639 putative cadaverine/putrescine exporter from Escherichia coli str. K-12 substr. MG1655
b4218 predicted inner membrane protein (NCBI) from Escherichia coli str. K-12 substr. MG1655
Aligns to 5:197 / 447 (43.2%), covers 99.4% of PF01595, 141.4 bits
- function: Involved in cadaverine and putrescine tolerance in stationary phase. May facilitate the efflux of both cadaverine and putrescine from the cytoplasm, reducing potentially toxic levels under certain stress conditions.
disruption phenotype: Deletion of the gene results in increased sensitivity to cadaverine and putrescine, but not to spermidine and spermine. - Transcriptomic analysis of Escherichia coli O157:H7 and K-12 cultures exposed to inorganic and organic acids in stationary phase reveals acidulant- and strain-specific acid tolerance responses
King, Applied and environmental microbiology 2010 - “...protein 2.3 Predicted inner membrane transport protein ytfL ECs5196 b4218 ACID TOLERANCE RESPONSE OF ESCHERICHIA COLI 6521 nrdH, trxB). Similarly, we observed a...”
- PaeA (YtfL) protects from cadaverine and putrescine stress in Salmonella Typhimurium and E. coli.
Iwadate, Molecular microbiology 2021 (PubMed)- GeneRIF: PaeA (YtfL) protects from cadaverine and putrescine stress in Salmonella Typhimurium and E. coli.
- Transcriptomic analysis of Escherichia coli O157:H7 and K-12 cultures exposed to inorganic and organic acids in stationary phase reveals acidulant- and strain-specific acid tolerance responses
King, Applied and environmental microbiology 2010 - “...2.3 Predicted inner membrane transport protein ytfL ECs5196 b4218 ACID TOLERANCE RESPONSE OF ESCHERICHIA COLI 6521 nrdH, trxB). Similarly, we observed a...”
- Identification and mapping of self-assembling protein domains encoded by the Escherichia coli K-12 genome by use of lambda repressor fusions
Mariño-Ramírez, Journal of bacteriology 2004 - “...b2434 b2549 b2875 b3071 b3193 b3199 b3830 b4212 b4218 COG0393 COG1335 COG2323 COG1335 COG3132 COG1607 COG1349 COG1396 COG3756 COG2812 COG0783 COG0583 COG1609...”
HI0452 conserved hypothetical protein (NCBI ptt file) from Haemophilus influenzae Rd KW20
P44717 Polyamine export protein from Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Aligns to 10:201 / 432 (44.4%), covers 99.4% of PF01595, 140.8 bits
- Antisera Against Certain Conserved Surface-Exposed Peptides of Nontypeable Haemophilus influenzae Are Protective
Whitby, PloS one 2015 - “.... 86-026NP locus Gene designation Rd KW20 locus Gene description Probable Type b NTHI0579 ytfL HI0452 Putative hemolysin (probable inner membrane) -helix NTHI0576 HI0449 Conserved hypothetical protein Amorphous NTHI0560 comE HI0435 Outer membrane secretin ComE Amorphous NTHI0522 ompP1 HI0401 Outer membrane protein P1 -barrel NTHI0509 yeaY...”
- Structure-based functional annotation of putative conserved proteins having lyase activity from Haemophilus influenzae
Shahbaaz, 3 Biotech 2015 - “...no Gene ID Protein product Uniprot ID Protein name 1 NC_000907.1 949660 NP_438613.1 P44717 HP HI0452 2 NC_000907.1 950684 NP_438775.1 P44782 HP HI0617 3 NC_000907.1 950339 NP_439586.2 P44197 HP HI1435 4 NC_000907.1 950454 NP_439740.1 P45267 HP HI1598 5 NC_000907.1 950030 NP_439212.1 Q57498 HP HI1053 6 NC_000907.1...”
- Functional annotation of conserved hypothetical proteins from Haemophilus influenzae Rd KW20
Shahbaaz, PloS one 2013 - “...protein 71. HP HI0449 949746 P43997 Prokaryotic membrane lipoprotein lipid attachment site profile 72. HP HI0452 949660 P44717 cystathionine-beta-synthase CBS domain protein 73. HP HI0454 949545 P44718 TatD type deoxyribonuclease 74. HP HI0457 950653 P44720 aminodeoxychorismate lyase 75. HP HI0466 949552 P44000 Aminomethyltransferase folate-binding domain family...”
- Structure-based functional annotation of putative conserved proteins having lyase activity from Haemophilus influenzae
Shahbaaz, 3 Biotech 2015 - “...no. Accession no Gene ID Protein product Uniprot ID Protein name 1 NC_000907.1 949660 NP_438613.1 P44717 HP HI0452 2 NC_000907.1 950684 NP_438775.1 P44782 HP HI0617 3 NC_000907.1 950339 NP_439586.2 P44197 HP HI1435 4 NC_000907.1 950454 NP_439740.1 P45267 HP HI1598 5 NC_000907.1 950030 NP_439212.1 Q57498 HP HI1053...”
- “...). ROBETTA server (Kim et al. 2004 ) was used for structure prediction of HP P44717, which uses ab initio or de novo methods to predict the structure of proteins whose structural analogs do not exist in the PDB or could not be successfully identified by...”
- Functional annotation of conserved hypothetical proteins from Haemophilus influenzae Rd KW20
Shahbaaz, PloS one 2013 - “...HP HI0449 949746 P43997 Prokaryotic membrane lipoprotein lipid attachment site profile 72. HP HI0452 949660 P44717 cystathionine-beta-synthase CBS domain protein 73. HP HI0454 949545 P44718 TatD type deoxyribonuclease 74. HP HI0457 950653 P44720 aminodeoxychorismate lyase 75. HP HI0466 949552 P44000 Aminomethyltransferase folate-binding domain family protein 76....”
- “...lyase enzymes. These are important for the virulence of pathogen in host [76] . The P44717 protein is a cystathionine -lyase, an enzyme which forms the cystathionine intermediate in cysteine biosynthesis, may be considered as the target for pyridiamine anti-microbial agents [86] . Similarly, isocitrate lyase...”
- Concordance analysis of microbial genomes
Bruccoleri, Nucleic acids research 1998 - “...residues of an 440 amino acid protein YTFL_HAEIN SW: P44717 unknown. N.B. f474; similar to BCHE_RHOCA SW: P26168; similar to LEXA_PSEPU SW: P37453 unknown. N.B....”
Q7VKS4 HlyC/CorC family transporter from Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Aligns to 8:199 / 429 (44.8%), covers 100.0% of PF01595, 140.6 bits
BBCT_0013 hemolysin family protein from Bifidobacterium catenulatum DSM 16992 = JCM 1194 = LMG 11043
Aligns to 8:200 / 443 (43.6%), covers 94.4% of PF01595, 140.4 bits
ABZJ_01110 hemolysin family protein from Acinetobacter baumannii MDR-ZJ06
Aligns to 8:199 / 441 (43.5%), covers 100.0% of PF01595, 140.1 bits
- Colistin Resistance in Acinetobacter baumannii MDR-ZJ06 Revealed by a Multiomics Approach
Hua, Frontiers in cellular and infection microbiology 2017 - “...protein 1.12706 10.47521 4.03E-13 9.42E-12 ABZJ_01257 Zn-dependent protease with chaperone function 1.13229 6.680195 1.30E-05 9.11E-05 ABZJ_01110 putative hemolysin-related protein 1.13995 9.22038 1.74E-11 3.54E-10 ABZJ_03720 UDP-3-O-acyl-N-acetylglucosamine deacetylase 1.14429 8.585685 1.05E-05 7.52E-05 ABZJ_01960 isochorismate hydrolase 1.14761 5.633402 0.000121 0.000638 ABZJ_00942 hypothetical protein 1.15912 8.72549 8.38E-09 1.17E-07 ABZJ_03859 putative...”
HMPREF0877_RS09670 hemolysin family protein from Weissella paramesenteroides ATCC 33313
Aligns to 12:205 / 458 (42.4%), covers 98.9% of PF01595, 139.2 bits
ESE_RS11605 hemolysin family protein from Weissella cibaria KACC 11862
Aligns to 12:205 / 456 (42.5%), covers 98.9% of PF01595, 139.2 bits
Q9WZU9 Hemolysin-related protein from Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Aligns to 16:199 / 455 (40.4%), covers 100.0% of PF01595, 138.6 bits
- Purification, crystallization and preliminary crystallographic analysis of the CBS-domain protein MJ1004 from Methanocaldococcus jannaschii
Oyenarte, Acta crystallographica. Section F, Structural biology and crystallization communications 2011 - “...codes). Thermotoga maritima: 1, UPI000016610F; 2, PPAC; 3, Q9WZU9; 4, Q9X033 (TM0935); 5, Q9X0P4; 6, Q9X0M4; 7, Q9WZH4; 8, Q9WZZ4 (TM0892); 9, Q9WZT6; 10,...”
cg1640 CBS domain-containing protein (RefSeq) from Corynebacterium glutamicum ATCC 13032
Aligns to 11:206 / 460 (42.6%), covers 98.3% of PF01595, 137.5 bits
WEISSC39_RS08940 hemolysin family protein from Weissella confusa LBAE C39-2
Aligns to 12:205 / 453 (42.8%), covers 98.9% of PF01595, 136.6 bits
SCO3764 integral membrane protein (NCBI) from Streptomyces coelicolor A3(2)
Aligns to 7:201 / 341 (57.2%), covers 95.6% of PF01595, 136.6 bits
TY24_RS08990 hemolysin family protein from Weissella hellenica
Aligns to 12:205 / 455 (42.6%), covers 98.9% of PF01595, 136.3 bits
PA3748 hypothetical protein (NCBI) from Pseudomonas aeruginosa PAO1
Aligns to 11:187 / 430 (41.2%), covers 85.6% of PF01595, 135.8 bits
GOX0169 Hypothetical membrane-spanning protein (NCBI) from Gluconobacter oxydans 621H
Aligns to 19:213 / 449 (43.4%), covers 99.4% of PF01595, 135.7 bits
- On the way toward regulatable expression systems in acetic acid bacteria: target gene expression and use cases
Fricke, Applied microbiology and biotechnology 2021 - “...2015 sldAB from G. oxydans 621H; gfp membrane-bound PQQ-dependent polyol DH; green fluorescent protein P GOX0169 , P GOX0264 , P GOX0452 , P tufB promoter strength analysis and 5-keto- d -gluconate accumulation using combinatorial metabolic engineering strategies in industrial strain G. oxydans ZJU2 Yuan et...”
- “...acid production Zhang et al. 2016 gcd from X. campestris DSM 3586 alcohol DH P GOX0169 improvement of 5-keto- d -gluconate production by G. oxydans ZJU2 mutant strain Yuan et al. 2016b zwf , gnd from G. oxydans NH-10 glucose-6-phosphate DH and 6-phospho-gluconate DH P tufB...”
- Combinatorial metabolic engineering of industrial Gluconobacter oxydans DSM2343 for boosting 5-keto-D-gluconic acid accumulation
Yuan, BMC biotechnology 2016 - “...the par-rep gene pr_SalI_R ACGC GTCGAC ggtgtttaaacagtgttacggt 0169_SacI_F ATA GAGCTC tgaaagcggctggcgcgt Amplify the 5-UTR of GOX0169 promoter 0169_XbaI_R GC TCTAGA gcggaaggcgttataccctga 0264_SacI_F ATA GAGCTC gttgcgcctgaatgagagg Amplify the 5-UTR of GOX0264 promoter 0264_XbaI_R GC TCTAGA ttcggtctccctcgccgtaa 0452_SacI_F ATA GAGCTC ggcttcgtggtgaacgcc Amplify the 5-UTR of GOX0452 promoter 0452_XbaI_R...”
JC2156_10680, JC2156_RS08435 hemolysin family protein from Weissella koreensis KCTC 3621
Aligns to 10:205 / 458 (42.8%), covers 98.9% of PF01595, 133.0 bits
- The controversial nature of the Weissella genus: technological and functional aspects versus whole genome analysis-based pathogenic potential for their application in food and health
Abriouel, Frontiers in microbiology 2015 - “...2 Hly (TY24_RS08990, TY24_RS08995) W. koreensis KACC 15510 W. koreensis KCTC 3621 2 Hly (JC2156_RS08435, JC2156_10680) W. oryzae SG25 2 AGS (WOSG25_200030, WOSG25_200040) 2 Asa1/PrgB (WOSG25_200030, WOSG25_200040) 3 hemolysins (WOSG25 150280, WOSG25_RS09625, WOSG25_RS09635) W. paramesenteroides ATCC 33313 2 Hly (HMPREF0877_RS09665, HMPREF0877_RS09670) W. thailandensis fsh4-2 2 Hly...”
- “...Wikim14 2 Hly (TY24_RS08990, TY24_RS08995) W. koreensis KACC 15510 W. koreensis KCTC 3621 2 Hly (JC2156_RS08435, JC2156_10680) W. oryzae SG25 2 AGS (WOSG25_200030, WOSG25_200040) 2 Asa1/PrgB (WOSG25_200030, WOSG25_200040) 3 hemolysins (WOSG25 150280, WOSG25_RS09625, WOSG25_RS09635) W. paramesenteroides ATCC 33313 2 Hly (HMPREF0877_RS09665, HMPREF0877_RS09670) W. thailandensis fsh4-2 2...”
MGA_0173 TlyC-like protein (RefSeq) from Mycoplasma gallisepticum str. R(low)
Aligns to 30:205 / 445 (39.6%), covers 99.4% of PF01595, 132.9 bits
- Comparative genomic analyses of attenuated strains of Mycoplasma gallisepticum
Szczepanek, Infection and immunity 2010 - “...gene with no obvious function, the conserved hypothetical gene MGA_0173. Identified in MGA_0173 was a tlyC domain which consists of a duf21 (domain of unknown...”
- “...and a CBS domain potentially involved in ligand binding. MGA_0173 was also similar to M. pneumoniae tlyC, a gene proposed to encode a hemolysin but noted by...”
MSMEG_3637 CBS domain protein (NCBI) from Mycobacterium smegmatis str. MC2 155
Aligns to 18:213 / 461 (42.5%), covers 98.3% of PF01595, 132.7 bits
G414_RS0106810 hemolysin family protein from Weissella halotolerans DSM 20190
Aligns to 11:205 / 456 (42.8%), covers 99.4% of PF01595, 131.3 bits
RT0697 conserved hypothetical protein (NCBI) from Rickettsia typhi str. wilmington
Aligns to 7:184 / 424 (42.0%), covers 99.4% of PF01595, 131.0 bits
WS105_0227 hemolysin family protein from Weissella ceti
Aligns to 12:205 / 454 (42.7%), covers 98.3% of PF01595, 130.7 bits
- The controversial nature of the Weissella genus: technological and functional aspects versus whole genome analysis-based pathogenic potential for their application in food and health
Abriouel, Frontiers in microbiology 2015 - “...CA (WS105 0070, WS105 0071, WS105_0581) 1 Hly (WS105_0554), 1 HlyA (WS105_0965), 1 Hly-like protein (WS105_0227) 4 SPA (WS105_0358, WS105_0448, WS105_1219, WS105_1255) W. ceti NC36 5 CA (WCNC 00912, WCNC 00917, WCNC 00922, WCNC 05547, WCNC 06207) 1 PA-ADHE 1 MBP (WCNC_01840) W. cibaria KACC 11862...”
- Comparative genome analysis of Weissella ceti, an emerging pathogen of farm-raised rainbow trout
Figueiredo, BMC genomics 2015 - “...hemolysins: hemolysin III ( hlyIII , WS105_0554, annotated as hypothetical protein) and a hemolysin-related protein (WS105_0227, annotated as hypothetical protein). Interestingly, the hlyIII gene of W. ceti is harboured by PAI 2, which is absent from all other Weissella species, suggesting that the hlyIII genes of...”
MAP1551c hypothetical protein (NCBI) from Mycobacterium avium subsp. paratuberculosis str. k10
Aligns to 11:205 / 454 (43.0%), covers 98.3% of PF01595, 129.4 bits
ATP_00276 probable hemolysin (RefSeq) from Candidatus Phytoplasma mali
Aligns to 1:176 / 428 (41.1%), covers 98.3% of PF01595, 129.2 bits
BHWA1_RS02885 hemolysin family protein from Brachyspira hyodysenteriae WA1
Aligns to 12:201 / 462 (41.1%), covers 98.9% of PF01595, 128.9 bits
- Differential expression of hemolysin genes in weakly and strongly hemolytic Brachyspira hyodysenteriae strains
Joerling, BMC veterinary research 2020 - “...Hemolysin activation protein, Hemolysin channel protein, and Hemolysin, which are encoded by locus tags BHWA1_RS02195, BHWA1_RS02885, BHWA1_RS0905, and BHWA1_RS0470 of the whole genome sequenced B. hyodysenteriae strain WA1 (NCBI Reference Sequence NC_012225.1) has been predicted in silico. By comparing their nucleotide sequences with that of hemolysin...”
- “...significantly downregulated in strain B204 ( p -value 0.001). The hemolysin activation protein gene ( BHWA1_RS02885 ) was upregulated ( p -value >0.05) at the first time point in both strains. During the third and fourth time point transcription increased by 100% in the shBh B204....”
- Phylogenetic diversity, antimicrobial susceptibility and virulence gene profiles of Brachyspira hyodysenteriae isolates from pigs in Germany
Joerling, PloS one 2018 - “...with virulence and encode for hemolysins ( tlyA , tlyB , tlyC , hlyA , BHWA1_RS02885 , BHWA1_RS09085 , BHWA1_RS04705 , and BHWA1_RS02195 ), outer membrane proteins (OMPs) ( bhlp16 , bhlp17 . 6 , bhlp29 . 7 , bhmp39f , and bhmp39h ) as well...”
- “...be detected. Sequence analysis of hemolysin genes of selected isolates revealed co-evolution of tlyB , BHWA1_RS02885 , BHWA1_RS09085 , and BHWA1_RS02195 with the core genome and suggested independent evolution of tlyA , tlyC , and hlyA . Our data indicate that in Germany, swine dysentery might...”
- An avirulent Brachyspira hyodysenteriae strain elicits intestinal IgA and slows down spread of swine dysentery
Mahu, Veterinary research 2017 - “...identical amino acid substitutions (positions 81, 113, 164, 227, 265) in the haemolysin activation protein BHWA1_RS02885 and eight identical amino acid substitutions in the haemolysin III protein BHWA1_RS02195 (positions 47, 49, 56, 79, 82, 111, 114, 133). For strain JR11 two additional amino acid substitutions were...”
- Variation in hemolytic activity of Brachyspira hyodysenteriae strains from pigs
Mahu, Veterinary research 2016 - “...24 ], has a conserved domain composing an integral membrane protein. The hemolysin activation protein (BHWA1_RS02885) [ 24 ], shares conserved domains with hemolysin C. We previously mentioned the existence of B. hyodysenteriae strains with an aberrant hemolytic phenotype [ 28 ]. In 1982, Lysons et...”
- “...hlyA , tlyA , tlyB , tlyC , hemolysin III (BHWA1_RS02195) , hemolysin activation protein (BHWA1_RS02885) , and hemolysin III channel protein (BHWA1_RS09085) genes were determined for all B. hyodysenteriae strains. For hlyA , the ACP1-Fo and ACP1-Re primers were used as described by Barth et...”
AT4G33700 CBS domain-containing protein (RefSeq) from Arabidopsis thaliana
Aligns to 17:191 / 424 (41.3%), covers 98.3% of PF01595, 128.6 bits
AT2G14520 CBS domain-containing protein (RefSeq) from Arabidopsis thaliana
Aligns to 17:191 / 423 (41.4%), covers 98.9% of PF01595, 128.0 bits
DCC35_RS02550 gliding motility-associated protein GldE from Mangrovivirga cuniculi
Aligns to 31:211 / 453 (40.0%), covers 98.9% of PF01595, 128.0 bits
- Mangrovivirga cuniculi gen. nov., sp. nov., a moderately halophilic bacterium isolated from bioturbated Red Sea mangrove sediment, and proposal of the novel family Mangrovivirgaceae fam. nov
Sefrji, International journal of systematic and evolutionary microbiology 2021 - “...gldF , glcG , gldJ , gldL , gldM , gldN , DCC35_RS07255, DCC35_RS14410, DCC35_RS02560, DCC35_RS02550, DCC35_RS07260, DCC35_RS07265, DCC35_RS02080, DCC35_RS02985, DCC35_RS02990, DCC35_RS02995), it was non-motile in an in vitro test in semisolid medium. However, we noted the absence of some of the genes of the cluster...”
Rv1842c hypothetical protein (NCBI) from Mycobacterium tuberculosis H37Rv
Aligns to 10:205 / 455 (43.1%), covers 98.3% of PF01595, 127.7 bits
Cp258_1017 hemolysin family protein from Corynebacterium pseudotuberculosis 258
Aligns to 11:206 / 467 (42.0%), covers 98.3% of PF01595, 127.1 bits
CNNM4_CAEEL / Q17586 Metal transporter cnnm-4; CNNM family homolog 4 from Caenorhabditis elegans (see paper)
Aligns to 116:295 / 467 (38.5%), covers 95.0% of PF01595, 127.0 bits
- function: Probable metal transporter. Probably acts redundantly with the other metal transport proteins cnnm-1, cnnm-2, cnnm-3 and cnnm-5 to regulate Mg(2+) homeostasis.
disruption phenotype: No visible phenotype. Quintuple knockout with cnnm-1, cnnm-2, cnnm-3 and cnnm-5 results in a reduced lifespan and 100% sterility.
AT1G47330 hypothetical protein (RefSeq) from Arabidopsis thaliana
Aligns to 17:191 / 527 (33.2%), covers 96.1% of PF01595, 124.6 bits
- Genome-Wide Investigation and Expression Profiling Under Abiotic Stresses of a Soybean Unknown Function (DUF21) and Cystathionine-β-Synthase (CBS) Domain-Containing Protein Family
Hao, Biochemical genetics 2021 - “...At01 799191..802436 3 chlo CBS domain-containing protein with a domain of unknown function (DUF21) AtCBSDUF2 AT1G47330 527 57.93 5.96 At01 17351050..17353875 3 plas CBS domain-containing protein with a domain of unknown function (DUF21) AtCBSDUF3 AT1G55930 653 72.93 5.46 At01 20918717..20922232 5 plas CBS domain-containing protein/transporter associated...”
- Candidate genes for first flower node identified in pepper using combined SLAF-seq and BSA
Zhang, PloS one 2018 - “...NR CA12g15090 DNA-directed RNA polymerase subunit beta COG, GO, Swissprot, NR CA12g15100 DUF21 domain-containing protein At1g47330 COG, GO, Swissprot, NR CA12g15110 Transmembrane protein 87A GO, Swissprot, NR CA12g15120 Uncharacterized protein LOC101260122 NR CA12g15130 25.3 kDa vesicle transport protein COG, GO, KEGG, Swissprot, NR CA12g15140 Uncharacterized protein...”
AT5G52790 CBS domain-containing protein-related (RefSeq) from Arabidopsis thaliana
Aligns to 18:192 / 500 (35.0%), covers 99.4% of PF01595, 124.5 bits
- Genome-Wide Investigation and Expression Profiling Under Abiotic Stresses of a Soybean Unknown Function (DUF21) and Cystathionine-β-Synthase (CBS) Domain-Containing Protein Family
Hao, Biochemical genetics 2021 - “...At04 16176276..16179481 3 E.R CBS domain-containing protein with a domain of unknown function (DUF21) AtCBSDUF9 AT5G52790 500 55.13 5.93 At05 21391717..21394359 3 cyto CBS domain-containing protein with a domain of unknown function (DUF21) PvCBSDUF1 Phvul.001G149200 472 51.81 6.12 Pv01 40258284..40264333 3 plas Predicted membrane protein, contains...”
- A willow sex chromosome reveals convergent evolution of complex palindromic repeats
Zhou, Genome biology 2020 - “...AGO4 ( ARGONAUTE 4 , siRNA mediated gene silencing) NA NA ACDP 1 Sapur.15WG074900 Chr17 AT5G52790 [d] CBS domain protein with DUF21 (transmembrane transporter) Potri.017G147900 83.33 DPRIM 2 Sapur.15WG074500 Chr17 AT5G52800 DNA primase Potri.017G148000 92.52 Sapur.15WG074800 DUF789 2 Sapur.15WG074600 Chr17 AT1G03610 DUF789 (protein of unknown function)...”
- Integrated bioinformatics analysis of As, Au, Cd, Pb and Cu heavy metal responsive marker genes through Arabidopsis thaliana GEO datasets
Niu, PeerJ 2019 - “...genes were AT3G46270, ATCSLB05, AT3G19030, COL9, BCAT4, ELF4, CYP83A1, AT1G76800, AT1G61740, CLE6, AT4G01440, AT1G72200, MOT1, AT5G52790, AT4G40070, AT4G25250, EXGE-A1, NR1, AT5G19970 and CYP735A2 ( Table 2 ). Additionally, the top 20 most significantly down-regulated genes were DIN2, WRKY75, AT4G15120, CYP81F2, AT1G73480, AT1G72900, PGPS1, AT5G06730, AT1G35910, CYP81D8,...”
- “...names Up-regulated AT3G46270 ATCSLB05 AT3G19030 COL9 BCAT4 ELF4 CYP83A1 AT1G76800 AT1G61740 CLE6 AT4G01440 AT1G72200 MOT1 AT5G52790 AT4G40070 AT4G25250 EXGT-A1 NR1 AT5G19970 CYP735A2 AT3G59370 AT3G25790 PIP2;4 AT4G16447 AT1G22500 NIR1 AT5G06610 CER4 AT1G12080 AT4G31910 LAX3 AT1G33340 LCR69 UCC1 ENODL8 GA3OX1 AT4G39070 CYP93D1 AT1G21440 AT4G01140 CKX4 AT3G12900 RVE2 AT3G20015...”
TENDBA_0027, TPANIC_0027 hemolysin family protein from Treponema pallidum subsp. pallidum str. Nichols
Aligns to 28:207 / 441 (40.8%), covers 98.3% of PF01595, 124.3 bits
- Comparison of transcriptional profiles of Treponema pallidum during experimental infection of rabbits and in vitro culture: Highly similar, yet different
De, PLoS pathogens 2021 - “...47 21 -1.18 .008 TPANIC_0130 hypothetical protein Cell envelope; Surface structures 1,408 607 -1.18 2.70E-13 TPANIC_0027 predicted CorC Co/Mg efflux protein [ 35 ] Cellular processes; Toxin production and resistance 191 84 -1.17 .0007 TPANIC_0841 htrA2 Translation; Degradation of proteins, peptides and glycopeptides 1,010 447 -1.16...”
- “...in vitro culture [ 31 34 ]. In contrast, transcripts for the magnesium/cobalt efflux proteins TPANIC_0027 and TPANIC_0028 were significantly higher in the in vitro samples compared to the rabbit (log 2 1.17 and -1.08, respectively) [ 35 ]. Four additional transport-related genes had significantly higher...”
- Functional insights from proteome-wide structural modeling of Treponema pallidum subspecies pallidum, the causative agent of syphilis
Houston, BMC structural biology 2018 - “...Genome Annotation [ 8 ] Phyre2 Model Templates: 1st rank model and potential virulence model(s) TPANIC_0027 Putative hemolysin (HlyC) 1st rank: CorC Magnesium/Cobalt efflux protein ( E. coli ) 5th rank: Hemolysin-like protein ( Oenococcus oeni ) TPANIC_0028 Putative hemolysin (HlyC) 1st rank: CorC Magnesium/Cobalt efflux...”
- Whole genome sequence of the Treponema pallidum subsp. endemicum strain Bosnia A: the genome is related to yaws treponemes but contains few loci similar to syphilis treponemes
Staudová, PLoS neglected tropical diseases 2014 - “...bp TENDBA_0067 CHP Unknown 113 bp 127 bp TENDBA_0461a HP Unknown 117 bp 83 bp TENDBA_0027 HlyC Cell processes 130 bp (altogether 60 bp of protein shortening) TENDBA_0136 d TCHP Virulence 133 bp TENDBA_0304 TCHP Unknown (altogether 111 bp) TENDBA_0314 TCHP Unknown TENDBA_0619 TCHP Unknown TENDBA_0621...”
- “...human fibronectin [28] . Except for TENDBA_0103 coding for RecQ (ATP-dependent DNA helicase; EC3.6.4.12) and TENDBA_0027 coding for HlyC (putative hemolysin), all other affected genes code for hypothetical proteins of unknown function. TENDBA_0134 has been predicted to be putative outer membrane protein. TENDBA_0462 and TENDBA_0858 have...”
Q67XQ0 DUF21 domain-containing protein At4g14240 from Arabidopsis thaliana
AT4G14240 hypothetical protein (RefSeq) from Arabidopsis thaliana
Aligns to 40:213 / 494 (35.2%), covers 98.9% of PF01595, 124.2 bits
- Crystal structure of an archaeal CorB magnesium transporter
Chen, Nature communications 2021 - “...Caenorhabditis elegans ; A3QM97), MAM3 ( Saccharomyces cerevisiae ; Q12296), CBSDUF1 ( Arabidopsis thaliana ; Q67XQ0), CBSDUFCH2 ( Arabidopsis thaliana ; Q84R21), MtCorB ( M. thermophilus ; A0A1G8XA46), StCorB ( Salmonella typhimurium ; Q8XFY3), TtCorB ( T. thermophilus ; A0A0K6IWT9), MpfA ( S. aureus ; A0A0H3JL60),...”
- Genome-Wide Investigation and Expression Profiling Under Abiotic Stresses of a Soybean Unknown Function (DUF21) and Cystathionine-β-Synthase (CBS) Domain-Containing Protein Family
Hao, Biochemical genetics 2021 - “...At04 8200667..8203238 3 chlo CBS domain-containing protein with a domain of unknown function (DUF21) AtCBSDUF7 AT4G14240 494 53.58 5.62 At04 8204347..8207408 3 plas CBS domain-containing protein with a domain of unknown function (DUF21) AtCBSDUF8 AT4G33700 424 47.11 5.73 At04 16176276..16179481 3 E.R CBS domain-containing protein with...”
- Comparative Transcriptomics Among Four White Pine Species
Baker, G3 (Bethesda, Md.) 2018 - “...bel1-like homeodomain protein 1 2517 DNA binding cbs domain-containing protein cbsx6 1311 duf21 domain-containing protein at4g14240 1623 probable wrky transcription factor 14 1431 myeloid leukemia factor 1-like isoform x2 1059 mannose-1-phosphate guanylyltransferase 1 948 phytoene synthase chloroplastic 1308 geranylgeranyl-diphosphate geranylgeranyltransferase activity; phytoene synthase activity unknown 336...”
- Characterization of the plasma membrane proteins and receptor-like kinases associated with secondary vascular differentiation in poplar
Song, Plant molecular biology 2011 - “...3 2 2 85234 At3g57880 C 2 domain-containing protein FU498 gw1.VIII.297.1 3 0 2 51259 At4g14240 CBS domain-containing protein FU50* gw1.X.4147.1 3 3 0 54367 At4g14240 CBS domain-containing protein FU215 fgenesh4_pg.C_scaffold_70000199 1 6 7 18462 No hit Duf1068 FU559 gw1.X.1601.1 1 0 2 43883 At2g40320 Duf213...”
BP951000_0473 hemolysin family protein from Brachyspira pilosicoli 95/1000
Aligns to 12:201 / 460 (41.3%), covers 97.2% of PF01595, 122.6 bits
- The complete genome sequence of the pathogenic intestinal spirochete Brachyspira pilosicoli and comparison with other Brachyspira genomes
Wanchanthuek, PloS one 2010 - “...tlyB , BP951000_1802), hemolysin C ( tlyC , BP951000_1288), hemolysin related protein ( hly , BP951000_0473), acyl carrier protein: contains beta-hemolysin ( acpP or hylA , BP951000_0533), putative hemolysin III (BP951000_0424), and putative channel protein hemolysin III family protein (BP951000_0888). The eighth was a putative hemolysin...”
SCO3765 integral membrane protein (NCBI) from Streptomyces coelicolor A3(2)
Aligns to 7:201 / 459 (42.5%), covers 99.4% of PF01595, 122.5 bits
AT1G03270 hypothetical protein (RefSeq) from Arabidopsis thaliana
Aligns to 38:211 / 499 (34.9%), covers 99.4% of PF01595, 122.1 bits
CNNM3_CAEEL / A0A131MCZ8 Metal transporter cnnm-3; CNNM family homolog 3 from Caenorhabditis elegans (see paper)
NP_001309670 Metal transporter cnnm-3 from Caenorhabditis elegans
Aligns to 202:374 / 797 (21.7%), covers 95.6% of PF01595, 122.0 bits
- function: Probable metal transporter. Probably acts redundantly with the other metal transport proteins cnnm-1, cnnm-2, cnnm-4 and cnnm-5 to regulate Mg(2+) homeostasis. Promotes postembryonic gonad development by regulating Mg(2+) levels, probably via AMPK signaling.
disruption phenotype: No visible phenotype. Double knockout with cnnm-1 results in increased levels of intestinal Mg(2+) and reduced levels in other tissues. This Mg(2+) deficiency in tissues leads to a reduced lifespan, 100% sterility, and smaller animals that exhibit a developmental delay with defective gonad development and which therefore do not produce oocytes or form vulva. In addition, the gonad development defect in the cnnm-1 and cnnm-3 double knockout is rescued when the AMPK alpha subunit aak-2 is also knocked out. Double knockout with cnnm-2 results in 22% sterility. Quintuple knockout with cnnm-1, cnnm-2, cnnm-4 and cnnm-5 results in a reduced lifespan and 100% sterility. - Mg2+ Extrusion from Intestinal Epithelia by CNNM Proteins Is Essential for Gonadogenesis via AMPK-TORC1 Signaling in Caenorhabditis elegans.
Ishii, PLoS genetics 2016 - GeneRIF: he results revealed that RNAi-mediated inactivation of several genes restores gonad elongation, including aak-2, which encodes the catalytic subunit of AMP-activated protein kinase (AMPK). We then generated triple mutant worms for cnnm-1; cnnm-3; aak-2 and confirmed that the aak-2 mutation also suppressed the defective gonadal elongation in cnnm-1; cnnm-3 mutant worms.
BHWA1_00587 hemolysin protein (RefSeq) from Brachyspira hyodysenteriae WA1
Aligns to 1:183 / 444 (41.2%), covers 94.4% of PF01595, 121.4 bits
NCgl1147 hemolysin family protein from Corynebacterium glutamicum ATCC 13032
cg1349 CBS domain-containing protein (RefSeq) from Corynebacterium glutamicum ATCC 13032
Aligns to 13:207 / 467 (41.8%), covers 96.7% of PF01595, 120.3 bits
AT4G14230 CBS domain-containing protein-related (RefSeq) from Arabidopsis thaliana
Aligns to 39:212 / 495 (35.2%), covers 98.3% of PF01595, 119.8 bits
- Genome-Wide Investigation and Expression Profiling Under Abiotic Stresses of a Soybean Unknown Function (DUF21) and Cystathionine-β-Synthase (CBS) Domain-Containing Protein Family
Hao, Biochemical genetics 2021 - “...AT3G13070 661 73.75 5.00 At03 4191351..4195112 4 plas CBS domain-containing protein/transporter associated domain-containing protein AtCBSDUF6 AT4G14230 495 53.49 6.10 At04 8200667..8203238 3 chlo CBS domain-containing protein with a domain of unknown function (DUF21) AtCBSDUF7 AT4G14240 494 53.58 5.62 At04 8204347..8207408 3 plas CBS domain-containing protein with...”
- Coordination of plastid and light signaling pathways upon development of Arabidopsis leaves under various photoperiods
Lepistö, Molecular plant 2012 - “...1 Nucleolus rRNA processing AT2G45170 2,40 AUTOPHAGY 8E Autophagy AT2G26135 2,36 Zinc finger family protein AT4G14230 2,29 Unknown protein AT1G20620 2,25 CATALASE 3 Mitochondrion, peroxisome Hydrogen peroxide catabolic processes AT5G01370 2,22 ALC-INTERACTING PROTEIN1 Nucleus AT1G20020 2,13 LEAF FNR 2 Chloroplast Photosynthesis AT3G15800 2,07 Glycosyl hydrolase family...”
PITG_03105 metal transporter, putative from Phytophthora infestans T30-4
Aligns to 55:233 / 298 (60.1%), covers 99.4% of PF01595, 119.2 bits
UEX_DROME / A0A0B7P9G0 Unextended protein; Putative metal transporter uex from Drosophila melanogaster (Fruit fly) (see paper)
Aligns to 191:361 / 834 (20.5%), covers 100.0% of PF01595, 119.2 bits
- function: Probable metal transporter (By similarity). Acts downstream of PRL-1 and protects the nervous system against olfactory carbon dioxide stimulation (PubMed:31404830).
subunit: Interacts with PRL-1, possibly at the plasma membrane.
disruption phenotype: RNAi-mediated knockdown in the nervous system results in a held-up wing phenotype after eclosion and upon carbon dioxide stimulation.
TP0027 hemolysin, putative (NCBI ptt file) from Treponema pallidum subsp. pallidum str. Nichols
Aligns to 1:173 / 407 (42.5%), covers 95.0% of PF01595, 118.7 bits
- Characterizing the Syphilis-Causing Treponema pallidum ssp. pallidum Proteome Using Complementary Mass Spectrometry
Osbak, PLoS neglected tropical diseases 2016 - “...89 ] TP0155 Fibronectin binding protein [ 75 ] TP1038 Bacterioferrin/ TpF1 [ 90 ] TP0027, TP0649 Putative hemolysins [ 91 ] Exploring the undetected T . pallidum proteins Of the predicted protein coding ORFs, 482/968 proteins were not detected in this study. Most of the...”
- Molecular differentiation of Treponema pallidum subspecies in skin ulceration clinically suspected as yaws in Vanuatu using real-time multiplex PCR and serological methods
Chi, The American journal of tropical medicine and hygiene 2015 - “...the fliG gene (tp0026) and a putative hemolysin gene (tp0027) and a 493-bp specific region within the tprI (tp0620) gene, which is present in all three...”
- Advances in the diagnosis of endemic treponematoses: yaws, bejel, and pinta
Mitjà, PLoS neglected tropical diseases 2013 - “...416 312 15 8, 10 f 2007, 2008 [94] , [95] IGR19 , intergenic spacer/hlyB (TP0027) g 2025/3407934084 9xC, 12xC CCCTCC CCCTCC CCCTCC 2011 [96] Genome positions are shown in the T. p. pertenue Samoa D genomic sequence (GenBank acc. no. CP002374.1). a For T. p....”
- “.... g IGR19 is an intergenic spacer between fliG (TP0026) and putative hemolysin gene hlyB (TP0027) in the Nichols genome (AE000520.1); this region is a part of the hlyB gene (TP0027) in the Samoa D genome (CP002374.1). Polymerase Chain Reaction Analyses of Clinical Samples During the...”
- Whole genome sequence of Treponema pallidum ssp. pallidum, strain Mexico A, suggests recombination between yaws and syphilis strains
Pětrošová, PLoS neglected tropical diseases 2012 - “...sequences of Mexico A. Two of these differences were found in homopolymeric stretches (in fliG -tp0027 and tp0347 regions) and one SNP (CT) was found in the rpiA -tp0617 region. Since both Mexico A strains came from the same laboratory (D. L. Cox, CDC Atlanta), the...”
- “...Gauthier CP002376.1, T. paraluiscuniculi strain Cuniculi A CP002103.1. Genes: TPA Mexico A: tp92 EU102088.1, fliG -tp0027 EU101896.1, tp0347 EU102160.1, rpiA -tp0617 EU101922.1; TPA South Africa: tp92 EU102098.1, fliG -tp0027 EU101902.1, tp0347 EU102170.1, rpiA -tp0617 EU101910.1; TEN Bosnia A: tp92 EU102075.1, TP0326: JX392330.1, TP0488 JX392331.1. References 1...”
- Laboratory-confirmed case of yaws in a 10-year-old boy from the Republic of the Congo
Pillay, Journal of clinical microbiology 2011 - “...(tp0026) and a putative hemolysin gene of unknown function (tp0027) and a (ii) specific region of the tprI gene (tp0620) present in all three subspecies were...”
- “...997 to 1021 and 7 to 28 in tp0026 and tp0027, respectively, in the T. pallidum subsp. pallidum Nichols genome were used to amplify a 280-bp fragment. PCR...”
- On the origin of the treponematoses: a phylogenetic approach
Harper, PLoS neglected tropical diseases 2008 - “...form a stem-loop structure in the intergenic region between the oppositely transcribed genes fliG and tp0027 . This structure, located between the predicted promoter and transcriptional start site of the operon containing genes tp0027 and tp0028 ( Fig. S1 ), could attenuate transcript levels of these...”
- “...of T. pallidum may be worthwhile, in order to better assess this possibility. Similarly, since tp0027 and tp0028 are both homologous to tlyC , a gene that either encodes a hemolysin or regulates a cryptic one in E. coli [48] , a difference in transcript level...”
- Transcriptome of Treponema pallidum: gene expression profile during experimental rabbit infection
Smajs, Journal of bacteriology 2005 - “...TP0142 TP0270 TP0009 TP0077 TP0218 TP0146 TP1005 TP0500 TP0027 TP0578 TP0687 TP0501 TP0080 TP0581 TP0105 TP0344 TP0387 TP0881 TP0448 TP0521 TP0450 TP0716 TP0670...”
- “...Tpr Tpr Tpr Tpr Tpr Tpr Hemolysins TP1037 TP0936 TP0649 TP0027 TP0028 1.1 0.78 0.57 0.30 0.23 0 0 0 1 1 Hemolysin III (hlyIII) Putative hemolysin Hemolysin...”
WP_005873396 hemolysin family protein from Porphyromonas gingivalis
Aligns to 4:185 / 417 (43.6%), covers 82.8% of PF01595, 118.1 bits
Gilli_1841 gliding motility-associated protein GldE from Gillisia limnaea DSM 15749
Aligns to 23:208 / 440 (42.3%), covers 98.3% of PF01595, 117.4 bits
- Genome sequence of the Antarctic rhodopsins-containing flavobacterium Gillisia limnaea type strain (R-8282(T))
Riedel, Standards in genomic sciences 2012 - “...( gld A (Gilli_1140), gld B (Gilli_2923), gld C (Gilli_2942), gld D (Gilli_1840), gld E (Gilli_1841), gld F (Gilli_3447), gld G (Gilli_3446), gld H (Gilli_2158), gld I (Gilli_0258), gld J (Gilli_1638), gld K (Gilli_2747), gld L (Gilli_2748), gld M (Gilli_2749), gld N (Gilli_2750), esp A (Gilli_3049),...”
MHJ_0643 putative hemolysin C (NCBI) from Mycoplasma hyopneumoniae J
mhp663 hemolysin (NCBI) from Mycoplasma hyopneumoniae 232
MHP7448_0643 hemolysin C (NCBI) from Mycoplasma hyopneumoniae 7448
Aligns to 10:180 / 410 (41.7%), covers 99.4% of PF01595, 116.9 bits
- Pathogenicity & virulence of Mycoplasma hyopneumoniae
Leal, Virulence 2020 - “...mhp540 MHP7448_0523 MHJ_0524 Immunomodulation, adhesion Su [ 75 , 156 ] Hemolysin C mhp663 MHP7448_0643 MHJ_0643 Cytotoxicity Su [ 75 , 174 ] Leucyl aminopeptidase mhp462 MHP7448_0464 MHJ_0461 Proteolytic processing, adhesion Su [ 10 , 75 ] Lipoprotein mhp164 MHP7448_0217 MHJ_0213 Cytotoxicity Se/Su [ 21 ,...”
- Pathogenicity & virulence of Mycoplasma hyopneumoniae
Leal, Virulence 2020 - “...Tu (EfTu) mhp540 MHP7448_0523 MHJ_0524 Immunomodulation, adhesion Su [ 75 , 156 ] Hemolysin C mhp663 MHP7448_0643 MHJ_0643 Cytotoxicity Su [ 75 , 174 ] Leucyl aminopeptidase mhp462 MHP7448_0464 MHJ_0461 Proteolytic processing, adhesion Su [ 10 , 75 ] Lipoprotein mhp164 MHP7448_0217 MHJ_0213 Cytotoxicity Se/Su [...”
- Pathogenicity & virulence of Mycoplasma hyopneumoniae
Leal, Virulence 2020 - “...(EfTu) mhp540 MHP7448_0523 MHJ_0524 Immunomodulation, adhesion Su [ 75 , 156 ] Hemolysin C mhp663 MHP7448_0643 MHJ_0643 Cytotoxicity Su [ 75 , 174 ] Leucyl aminopeptidase mhp462 MHP7448_0464 MHJ_0461 Proteolytic processing, adhesion Su [ 10 , 75 ] Lipoprotein mhp164 MHP7448_0217 MHJ_0213 Cytotoxicity Se/Su [ 21...”
MAM3_YEAST / Q12296 Protein MAM3 from Saccharomyces cerevisiae (strain ATCC 204508 / S288c) (Baker's yeast) (see 3 papers)
NP_014581 Mam3p from Saccharomyces cerevisiae S288C
N1NX85 Mam3p from Saccharomyces cerevisiae (strain CEN.PK113-7D)
NP_014581, YOL060C Mam3p (RefSeq) from Saccharomyces cerevisiae
Aligns to 66:238 / 706 (24.5%), covers 97.2% of PF01595, 113.4 bits
- function: Involved in metal homeostasis and more specially in manganese sensitivity.
- Manganese toxicity and Saccharomyces cerevisiae Mam3p, a member of the ACDP (ancient conserved domain protein) family.
Yang, The Biochemical journal 2005 - GeneRIF: first report of a eukaryotic ACDP family protein, MAM3, involved in metal homoeostasis
- Novel CNNM2 Mutation Responsible for Autosomal-Dominant Hypomagnesemia With Seizure.
Tseng, Frontiers in genetics 2022 - “...D. melanogaster (UEX) : A0A0B7P9G0, C. elegans (C52D10.12) : A3QM97, and S. cerevisiae (Mam3p) : N1NX85. In vitro Expression of Novel CNNM2 Mutants The total and membrane expressions of wild-type CNNM2 (amino acids 1875) and mutant CNNM2 (R480L, R480K, V548M, and T568I) proteins were examined after...”
- Crystal structure of an archaeal CorB magnesium transporter
Chen, Nature communications 2021 - “...Drosophila melanogaster ; A0A0B7P9G0), cnnm-1 ( Caenorhabditis elegans ; A3QM97), MAM3 ( Saccharomyces cerevisiae ; Q12296), CBSDUF1 ( Arabidopsis thaliana ; Q67XQ0), CBSDUFCH2 ( Arabidopsis thaliana ; Q84R21), MtCorB ( M. thermophilus ; A0A1G8XA46), StCorB ( Salmonella typhimurium ; Q8XFY3), TtCorB ( T. thermophilus ; A0A0K6IWT9),...”
- Screening and Genetic Network Analysis of Genes Involved in Freezing and Thawing Resistance in DaMDHAR-Expressing Saccharomyces cerevisiae Using Gene Expression Profiling.
Kim, Genes 2021 - “...Conserved protein of the mitochondrial matrix YMR182W-A MIN3 2.089 Mitochondrial MINi protein of 3 kDa YOL060C MAM3 2.074 Protein required for normal mitochondrial morphology YKL062W MSN4 2.061 Stress-responsive transcriptional activator YGR243W MPC3 2.050 Mitochondrial pyruvate carrier (MPC) YPR196W 2.018 Putative maltose-responsive transcription factor WT, wild-type cells...”
- Global changes in gene expression associated with phenotypic switching of wild yeast
Šťovíček, BMC genomics 2014 - “...in the left arm of chromosome XV that upregulate expression in BR-RF ( YOL110W , YOL060C and YOL038W ) with that of three genes located in the right arm of the same chromosome ( YOR194C , YOR250C , YOR288C ), indicates large duplications in the genome...”
- Changes in cell morphology are coordinated with cell growth through the TORC1 pathway
Goranov, Current biology : CB 2013 - “...Bul1 up up S252 YNL004W Hrb1 down and up up S355 YNL265C Ist1 down NA YOL060C Mam3 down down and up down S614 , T617 ; up S439 YOR322C Ldb19 up NA a Yeast cells were arrested inG1 with or without pheromone. Total protein was extracted,...”
- The role of the Parkinson's disease gene PARK9 in essential cellular pathways and the manganese homeostasis network in yeast
Chesi, PloS one 2012 - “...GGA2 YHR193C EGD2 YMR198W CIK1 YJR043C POL32 YNL021W HDA1 YDR414C ERD1 YKL190W CNB1 YHR012W VPS29 YOL060C MAM3 YLL049W LDB18 YNL027W CRZ1 YPL196W OXR1 YPL050C MNN9 YDL167C NRP1 YKR019C IRS4 YDL077C VAM6 YHR004C NEM1 YDR289C RTT103 YKL064W MNR2 YOR106W VAM3 YLR093C NYV1 YPL106C SSE1 YMR123W PKR1 YKL113C...”
- A genome-wide immunodetection screen in S. cerevisiae uncovers novel genes involved in lysosomal vacuole function and morphology
Ricarte, PloS one 2011 - “...and cellular components (Saccharomyces Genome Database). ENV Genes Biological Process Molecular Function Cellular Localization MAM3 (YOL060C) Required for normal mitochondrial organization and cell Mn 2+ homeostasis Unknown Vacuole membrane PCP1 (YGR101W) Required for normal mitochondrial organization, protein import into mitochondrion IM space, signal peptide process Peptidase...”
- Multiple Motif Scanning to identify methyltransferases from the yeast proteome
Petrossian, Molecular & cellular proteomics : MCP 2009 - “...and 6). These include YMR209C, YOL060C/Mam3, and YLR063W. YOL060C, designated Mam3, has an apparent cystathionine -synthase (CBS) domain that may bind AdoMet...”
- “...YBR141C) as methyltransferases but did not confirm YOL060C as a methyltransferase. Importantly this analysis also did not verify HMM methyltransferase profiles...”
- Molecular cloning and characterization of the mouse Acdp gene family
Wang, BMC genomics 2004 - “...the conservation of ACD domain in various species. Amip3 is a protein from Saccharomyces cerevisiae (NP_014581). CanG is a protein from Candida glabrata (AAF33142). NeuC (EAA31204) is a hypothetical protein from Neurospora crassa . DroM is a gene product from D. melanogaster . The accession number...”
- Phenotypic switching in Candida glabrata involves phase-specific regulation of the metallothionein gene MT-II and the newly discovered hemolysin gene HLP
Lachke, Infection and immunity 2000 - “...a C. glabrata homolog of the S. cerevisiae gene YOL060c (25), which encodes a putative protein with three transmembrane domains. The cloned DNA fragment was...”
- “...INFECT. IMMUN. the corresponding region of the S. cerevisiae YOL060c gene product (Fig. 6). Comparison of the deduced amino acid sequence of the fragment with...”
- More
A2ATX7 Cyclin and CBS domain divalent metal cation transport mediator 2a from Danio rerio
Aligns to 203:374 / 811 (21.2%), covers 94.4% of PF01595, 111.4 bits
- Crystal structure of an archaeal CorB magnesium transporter
Chen, Nature communications 2021 - “...UniProt accession numbers are: CNNM2 ( Homo sapiens ; Q9H8M5), cnnm2a ( Danio rerio ; A2ATX7), CNNM4 ( H. sapiens ; Q6P4Q7), CNNM4 ( Xenopus tropicalis ; A0JPA0), CNNM1 ( H. sapiens ; Q9NRU3), CNNM3 ( H. sapiens ; Q8NE01), UEX ( Drosophila melanogaster ; A0A0B7P9G0),...”
F1S849 Cyclin and CBS domain divalent metal cation transport mediator 2 from Sus scrofa
Aligns to 260:431 / 853 (20.2%), covers 94.4% of PF01595, 110.2 bits
Q5U2P1 Metal transporter CNNM2 from Rattus norvegicus
Aligns to 260:431 / 875 (19.7%), covers 94.4% of PF01595, 110.1 bits
- Novel CNNM2 Mutation Responsible for Autosomal-Dominant Hypomagnesemia With Seizure.
Tseng, Frontiers in genetics 2022 - “...sequence accession IDs are H. sapiens : Q9H8M5, M. musculus : Q3TWN3, R. norvegicus : Q5U2P1, G. gallus : K7CZV7, B. taurus : A0A3Q1LRB9, C. lupus : E2RJ19, D. melanogaster (UEX) : A0A0B7P9G0, C. elegans (C52D10.12) : A3QM97, and S. cerevisiae (Mam3p) : N1NX85. In vitro...”
- The molecular appearance of native TRPM7 channel complexes identified by high-resolution proteomics.
Kollewe, eLife 2021 - “...channel M7 Ion channel = = CNNM1 Q0GA42 Transporter CNNM1, Cyclin-M1 Potential transporter << CNNM2 Q5U2P1 Transporter CNNM1, Cyclin-M2 Potential transporter < << CNNM3 Q32NY4 Transporter CNNM1, Cyclin-M3 Potential transporter < << CNNM4 Q69ZF7 Transporter CNNM1, Cyclin-M4 Potential transporter < << ARL15 Q8BGR6 ADP-ribosylation factor-like protein...”
CNNM2_HUMAN / Q9H8M5 Metal transporter CNNM2; Ancient conserved domain-containing protein 2; Cyclin-M2 from Homo sapiens (Human) (see 2 papers)
K7CZV7 Cyclin M2 from Pan troglodytes
Aligns to 260:431 / 875 (19.7%), covers 94.4% of PF01595, 110.1 bits
- function: Divalent metal cation transporter. Mediates transport of divalent metal cations in an order of Mg(2+) > Co(2+) > Mn(2+) > Sr(2+) > Ba(2+) > Cu(2+) > Fe(2+) (By similarity).
- Novel CNNM2 Mutation Responsible for Autosomal-Dominant Hypomagnesemia With Seizure
Tseng, Frontiers in genetics 2022 - “...acid ( Stuiver et al., 2011 ). The sequence accession IDs are H. sapiens : Q9H8M5, M. musculus : Q3TWN3, R. norvegicus : Q5U2P1, G. gallus : K7CZV7, B. taurus : A0A3Q1LRB9, C. lupus : E2RJ19, D. melanogaster (UEX) : A0A0B7P9G0, C. elegans (C52D10.12) : A3QM97,...”
- Effects of DISC1 on Alzheimer's disease cell models assessed by iTRAQ proteomics analysis.
Lu, Bioscience reports 2022 - “...overexpressing DISC1 Protein ID Gene symbol Description Mean ratio O95674 CDS2 Phosphatidate cytidylyltransferase 2 0.490415498 Q9H8M5 CNNM2 Metal transporter CNNM2 0.537252179 P78369 CLDN10 Claudin-10 0.553699125 Q9UL62 TRPC5 Short transient receptor potential channel 5 0.560397651 Q92858 ATOH1 Protein atonal homolog 1 0.561748688 P48668 KRT6C Keratin, type II...”
- Crystal structure of an archaeal CorB magnesium transporter
Chen, Nature communications 2021 - “.... The CNNM/CorB orthologs and their UniProt accession numbers are: CNNM2 ( Homo sapiens ; Q9H8M5), cnnm2a ( Danio rerio ; A2ATX7), CNNM4 ( H. sapiens ; Q6P4Q7), CNNM4 ( Xenopus tropicalis ; A0JPA0), CNNM1 ( H. sapiens ; Q9NRU3), CNNM3 ( H. sapiens ; Q8NE01),...”
- Novel variant in the CNNM2 gene associated with dominant hypomagnesemia.
García-Castaño, PloS one 2020 - “...] or regulate other proteins that transport Mg2+ [ 11 ]. The CNNM2 protein (UniProtKB: Q9H8M5) structurally contains an N-terminal extracellular domain (1250 amino acids) with a large signal peptide (64 amino acids) and one glycosylation site (asparagine residue N112) [ 12 ]; a transmembrane domain...”
- CNNM2 mutations cause impaired brain development and seizures in patients with hypomagnesemia.
Arjona, PLoS genetics 2014 - “...plus (+) sign, respectively. (B) Localization of the mutations in the CNNM2 protein structure (Uniprot Q9H8M5). CNNM2 contains a long signal peptide (64 amino acids) that is cleaved at the membrane of the endoplasmic reticulum. The remaining part of the CNNM2 protein is trafficked to the...”
- “...of the most promising candidate gene CNNM2 were sequenced from both strands (Genbank: NM_017649.4, Uniprot: Q9H8M5). After discovery of a homozygous mutation in the index family F1, the mutational screening was extended to patients with hypomagnesemia without mutations in known genes involved in hereditary magnesium wasting....”
- Purification, crystallization and preliminary crystallographic analysis of the CBS-domain pair of cyclin M2 (CNNM2).
Gómez-García, Acta crystallographica. Section F, Structural biology and crystallization communications 2012 - Purification, crystallization and preliminary crystallographic analysis of the CBS-domain protein MJ1004 from Methanocaldococcus jannaschii
Oyenarte, Acta crystallographica. Section F, Structural biology and crystallization communications 2011 - “...Q57564; 11, Q59011; 12, Q58069; 13, Q58332. Homo sapiens: 1, Q9H8M5; 2, Q6P4Q7; 3, Q8NE01; 4, P51798; 5, P51790; 6, P51795; 7, P12268; 8, P51800; 9, P51793; 10,...”
- Novel CNNM2 Mutation Responsible for Autosomal-Dominant Hypomagnesemia With Seizure.
Tseng, Frontiers in genetics 2022 - “...H. sapiens : Q9H8M5, M. musculus : Q3TWN3, R. norvegicus : Q5U2P1, G. gallus : K7CZV7, B. taurus : A0A3Q1LRB9, C. lupus : E2RJ19, D. melanogaster (UEX) : A0A0B7P9G0, C. elegans (C52D10.12) : A3QM97, and S. cerevisiae (Mam3p) : N1NX85. In vitro Expression of Novel CNNM2...”
CNNM2_MOUSE / Q3TWN3 Metal transporter CNNM2; Ancient conserved domain-containing protein 2; mACDP2; Cyclin-M2 from Mus musculus (Mouse) (see 3 papers)
Q3TWN3 cystathionine beta-synthase (EC 4.2.1.22) from Mus musculus (see paper)
Aligns to 260:431 / 875 (19.7%), covers 94.4% of PF01595, 110.1 bits
- function: Divalent metal cation transporter. Mediates transport of divalent metal cations in an order of Mg(2+) > Co(2+) > Mn(2+) > Sr(2+) > Ba(2+) > Cu(2+) > Fe(2+).
subunit: Isoform 1 and isoform 2 may interact with each other - Novel CNNM2 Mutation Responsible for Autosomal-Dominant Hypomagnesemia With Seizure.
Tseng, Frontiers in genetics 2022 - “...al., 2011 ). The sequence accession IDs are H. sapiens : Q9H8M5, M. musculus : Q3TWN3, R. norvegicus : Q5U2P1, G. gallus : K7CZV7, B. taurus : A0A3Q1LRB9, C. lupus : E2RJ19, D. melanogaster (UEX) : A0A0B7P9G0, C. elegans (C52D10.12) : A3QM97, and S. cerevisiae (Mam3p)...”
- Membrane topology and intracellular processing of cyclin M2 (CNNM2).
de, The Journal of biological chemistry 2012 - Purification, crystallization and preliminary crystallographic analysis of the CBS-domain pair of cyclin M2 (CNNM2).
Gómez-García, Acta crystallographica. Section F, Structural biology and crystallization communications 2012
Rv2366c PROBABLE CONSERVED TRANSMEMBRANE PROTEIN (NCBI) from Mycobacterium tuberculosis H37Rv
Aligns to 8:185 / 435 (40.9%), covers 98.9% of PF01595, 109.3 bits
CNNM1_CAEEL / A3QM97 Metal transporter cnnm-1; CNNM family homolog 1 from Caenorhabditis elegans (see paper)
NP_503052 Metal transporter cnnm-1 from Caenorhabditis elegans
Aligns to 206:375 / 811 (21.0%), covers 93.9% of PF01595, 108.5 bits
- function: Probable metal transporter. Probably acts redundantly with the other metal transport proteins cnnm-2, cnnm-3, cnnm-4 and cnnm-5 to regulate Mg(2+) homeostasis. Promotes postembryonic gonad development by regulating Mg(2+) levels, probably via AMPK signaling.
disruption phenotype: No visible phenotype. Double knockout with cnnm-3 results in increased levels of intestinal Mg(2+) and reduced levels in other tissues. This Mg(2+) deficiency in tissues leads to a reduced lifespan, 100% sterility, and smaller animals that exhibit a developmental delay with defective gonad development and which therefore do not produce oocytes or form vulva. In addition, the gonad development defect in the cnnm-1 and cnnm-3 double knockout is rescued when the AMPK alpha subunit aak-2 is also knocked out. Quintuple knockout with cnnm-2, cnnm-3, cnnm-4 and cnnm-5 results in a reduced lifespan and 100% sterility. - Mg2+ Extrusion from Intestinal Epithelia by CNNM Proteins Is Essential for Gonadogenesis via AMPK-TORC1 Signaling in Caenorhabditis elegans.
Ishii, PLoS genetics 2016 - GeneRIF: he results revealed that RNAi-mediated inactivation of several genes restores gonad elongation, including aak-2, which encodes the catalytic subunit of AMP-activated protein kinase (AMPK). We then generated triple mutant worms for cnnm-1; cnnm-3; aak-2 and confirmed that the aak-2 mutation also suppressed the defective gonadal elongation in cnnm-1; cnnm-3 mutant worms.
- Novel CNNM2 Mutation Responsible for Autosomal-Dominant Hypomagnesemia With Seizure.
Tseng, Frontiers in genetics 2022 - “...: A0A3Q1LRB9, C. lupus : E2RJ19, D. melanogaster (UEX) : A0A0B7P9G0, C. elegans (C52D10.12) : A3QM97, and S. cerevisiae (Mam3p) : N1NX85. In vitro Expression of Novel CNNM2 Mutants The total and membrane expressions of wild-type CNNM2 (amino acids 1875) and mutant CNNM2 (R480L, R480K, V548M,...”
- Crystal structure of an archaeal CorB magnesium transporter
Chen, Nature communications 2021 - “...H. sapiens ; Q8NE01), UEX ( Drosophila melanogaster ; A0A0B7P9G0), cnnm-1 ( Caenorhabditis elegans ; A3QM97), MAM3 ( Saccharomyces cerevisiae ; Q12296), CBSDUF1 ( Arabidopsis thaliana ; Q67XQ0), CBSDUFCH2 ( Arabidopsis thaliana ; Q84R21), MtCorB ( M. thermophilus ; A0A1G8XA46), StCorB ( Salmonella typhimurium ; Q8XFY3),...”
- Short-Term Mild Temperature-Stress-Induced Alterations in the C. elegans Phosphoproteome.
Huang, International journal of molecular sciences 2020 - “...0.31 DNaJ domain (Prokaryotic heat shock protein) Q9NEN6 rps-6 SSpASpHHSpESEVK 0.327 40S ribosomal protein S6 A3QM97 cnnm-1 SMSpIVGTSELSAR 0.396 Metal transporter cnnm-1 Q21219 pept-1 GYSESRSpESpVSpSK 0.463 Peptide transporter family 1 (Di-/tri-peptide transporter CPTB) G5EFL5 alp-1 AAYHPQVNTpARPVSpVSpPAPSpAGSK 0.478 ALP/Enigma encoding H2KZZ2 hlh-30 QVVSSSpAPTSSIDIEK 0.654 Helix Loop Helix...”
- “...Q8MQ70 hpk-1 NSpGQSTDLNSR 0.322 Homeodomain-interacting protein kinase 1 O76360 egl-4 KPSpDQPNGNQVQVGTR 0.271 cGMP-dependent protein kinase A3QM97 cnnm-1 SMSpIVGTSELSAR 0.34 Metal transporter O18696 pde-1 SpYDNAPALESLEK 0.403 Probable 3,5-cyclic phosphodiesterase Q10663 icl-1 AGSpVVNRIPEAADLLEK 0.414 Bifunctional glyoxylate cycle protein Q17446 pmk-1 QTDSEMTpGYpVATR 0.537 Stress-activated protein kinase...”
Q7UQM0 Hemolysin from Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Aligns to 5:183 / 398 (45.0%), covers 98.3% of PF01595, 108.1 bits
CNNM4_MOUSE / Q69ZF7 Metal transporter CNNM4; Ancient conserved domain-containing protein 4; mACDP4; Cyclin-M4 from Mus musculus (Mouse) (see 4 papers)
NP_291048 metal transporter CNNM4 precursor from Mus musculus
Aligns to 184:355 / 771 (22.3%), covers 95.6% of PF01595, 107.6 bits
CNNM4_RAT / P0C588 Metal transporter CNNM4; Ancient conserved domain-containing protein 4; Cyclin-M4 from Rattus norvegicus (Rat) (see 2 papers)
Aligns to 185:356 / 772 (22.3%), covers 95.6% of PF01595, 107.3 bits
- function: Probable metal transporter. The interaction with the metal ion chaperone COX11 suggests that it may play a role in sensory neuron functions. May play a role in biomineralization and retinal function.
subunit: Interacts with COX11.
PITG_00746 hypothetical protein from Phytophthora infestans T30-4
Aligns to 37:208 / 503 (34.2%), covers 96.1% of PF01595, 107.0 bits
XP_002797334 DUF21 and CBS domain protein (Mam3) from Paracoccidioides lutzii Pb01
Aligns to 64:236 / 745 (23.2%), covers 96.1% of PF01595, 106.9 bits
- Hemoglobin uptake by Paracoccidioides spp. is receptor-mediated
Bailão, PLoS neglected tropical diseases 2014 - “...since hemoglobin blocked Zn-PPIX internalization. Moreover, the fungus could promote erythrocyte lysis. A hemolysin-like protein (XP_002797334) has been evidenced in a mycelium to yeast transition cDNA library [65] , which indicates that Paracoccidioides could access the intracellular heme in the host by producing a hemolytic factor...”
CNNM4_HUMAN / Q6P4Q7 Metal transporter CNNM4; Ancient conserved domain-containing protein 4; Cyclin-M4 from Homo sapiens (Human) (see 5 papers)
Q6P4Q7 P-type Mg2+ transporter (EC 7.2.2.14) from Homo sapiens (see paper)
NP_064569 metal transporter CNNM4 precursor from Homo sapiens
Aligns to 187:358 / 775 (22.2%), covers 95.0% of PF01595, 106.7 bits
- function: Probable metal transporter. The interaction with the metal ion chaperone COX11 suggests that it may play a role in sensory neuron functions (By similarity). May play a role in biomineralization and retinal function.
subunit: Interacts with COX11. - CNNM proteins selectively bind to the TRPM7 channel to stimulate divalent cation entry into cells.
Bai, PLoS biology 2021 - GeneRIF: CNNM proteins selectively bind to the TRPM7 channel to stimulate divalent cation entry into cells.
- Expanding the genotypic spectrum of Jalili syndrome: Novel CNNM4 variants and uniparental isodisomy in a north American patient cohort.
Prasov, American journal of medical genetics. Part A 2020 - GeneRIF: Expanding the genotypic spectrum of Jalili syndrome: Novel CNNM4 variants and uniparental isodisomy in a north American patient cohort.
- A novel pathogenic missense variant in CNNM4 underlying Jalili syndrome: Insights from molecular dynamics simulations.
Parveen, Molecular genetics & genomic medicine 2019 - GeneRIF: The novel identified variant in CNNM4 is the first report from the Pakistani population. Sequence analysis of CNNM4 revealed a novel missense variant (c.1220G>T, p.Arg407Leu) in exon-1 encoding cystathionine-beta-synthase (CBS) domain.
- Identification of a mutation in CNNM4 by whole exome sequencing in an Amish family and functional link between CNNM4 and IQCB1.
Li, Molecular genetics and genomics : MGG 2018 - GeneRIF: Results identified linkage at chromosome 2p14-2q14 and found a homozygous mutation in the CNNM4 gene (p.R605X) causing Jalili syndrome. The truncated CNNM4 protein starting at R605 significantly increased the rate of apoptosis, and significantly increased the interaction between CNNM4 and IQCB1. This mutation may cause Jalili syndrome by a nonsense-mediated decay mechanism, affecting the function of IQCB1 and apoptosis.
- Jalili Syndrome: Cross-sectional and Longitudinal Features of Seven Patients With Cone-Rod Dystrophy and Amelogenesis Imperfecta.
Hirji, American journal of ophthalmology 2018 - GeneRIF: Jalili Syndrome is a rare cone-rod dystrophy (CORD) and amelogenesis imperfecta (AI), We have further characterized its ocular phenotype, including describing SD-OCT, FAF, and electrophysiological features; and report several novel disease-causing sequence variants.
- Report of two unrelated families with Jalili syndrome and a novel nonsense heterozygous mutation in CNNM4 gene.
Maia, European journal of medical genetics 2018 (PubMed)- GeneRIF: Here, we report the 2 first families with Jalili Syndrome in Brazil. Molecular analysis of the first family identified a previously described homozygous mutation (p.Leu324Pro) in exon 1 of CNNM4 gene. In the second family, affected patients demonstrated a compound heterozygous mutation in CNNM4, the p.Leu324Pro and the novel nonsense mutation p.Tyr581*.
- Novel splice site mutation in CNNM4 gene in a family with Jalili syndrome.
Cherkaoui, European journal of medical genetics 2017 (PubMed)- GeneRIF: used Sanger sequencing to analyze a large consanguineous family with three siblings affected with Jalili syndrome, suspected clinically after dental and ophthalmological examination. These patients are carrying a novel homozygous mutation in the splice site acceptor of intron 3 (c.1682-1G > C) in the CNNM4 gene
- Co-occurrence of Jalili syndrome and muscular overgrowth.
Wawrocka, American journal of medical genetics. Part A 2017 (PubMed)- GeneRIF: Mutational analysis showed in all three brothers a novel likely pathogenic homozygous missense substitution in exon 1 (c.1076T>C, p.(Leu359Pro)) of CNNM4. Both parents were carriers for the variant.
- More
- Crystal structure of an archaeal CorB magnesium transporter
Chen, Nature communications 2021 - “...Homo sapiens ; Q9H8M5), cnnm2a ( Danio rerio ; A2ATX7), CNNM4 ( H. sapiens ; Q6P4Q7), CNNM4 ( Xenopus tropicalis ; A0JPA0), CNNM1 ( H. sapiens ; Q9NRU3), CNNM3 ( H. sapiens ; Q8NE01), UEX ( Drosophila melanogaster ; A0A0B7P9G0), cnnm-1 ( Caenorhabditis elegans ; A3QM97),...”
- Structural Insights into the Intracellular Region of the Human Magnesium Transport Mediator CNNM4.
Giménez-Mascarell, International journal of molecular sciences 2019 - “...transport, analyzed structure and ligand binding of the intracellular region of human CNNM4 (UniProtKB/Swiss-Prot code Q6P4Q7) both in the presence and absence of its known interaction partner, PRL-1 [ 15 ]. Thus, we significantly extend the scarce structural data available, which may help in designing new...”
- Bioinformatic analyses of integral membrane transport proteins encoded within the genome of the planctomycetes species, Rhodopirellula baltica.
Paparoditis, Biochimica et biophysica acta 2014 - “...HlyC/CorC (HCC) Family of Putative Transporters 9.A.40.2.1 P54428 4 cations Fe 2+ Q7UQW5 3 9.A.40.3.4 Q6P4Q7 5 cations metal ion Q7UQM0 3 9.A.47 Tight Adherence (Pilus) Biogenesis Apparatus (TABA) Family 9.A.47.1.1 Q9S4A8 5 proteins proteins (pili, fimbrae) Q7UXS3 4 9.A.47.1.1 Q9S4A8 5 proteins proteins (pili, fimbrae)...”
- Purification, crystallization and preliminary crystallographic analysis of the CBS-domain pair of cyclin M2 (CNNM2).
Gómez-García, Acta crystallographica. Section F, Structural biology and crystallization communications 2012 - Purification, crystallization and preliminary crystallographic analysis of the CBS pair of the human metal transporter CNNM4
Gómez, Acta crystallographica. Section F, Structural biology and crystallization communications 2011 - “...Polok et al., 2009). Structurally, CNNM4 (UniProtKB/Swiss-Prot code Q6P4Q7) is a multidomain protein formed of (i) a DUF21 domain (residues 184- 358) that...”
- Purification, crystallization and preliminary crystallographic analysis of the CBS-domain protein MJ1004 from Methanocaldococcus jannaschii
Oyenarte, Acta crystallographica. Section F, Structural biology and crystallization communications 2011 - “...Q59011; 12, Q58069; 13, Q58332. Homo sapiens: 1, Q9H8M5; 2, Q6P4Q7; 3, Q8NE01; 4, P51798; 5, P51790; 6, P51795; 7, P12268; 8, P51800; 9, P51793; 10, P51801; 11,...”
- Stable isotope labeling by amino acids in cell culture and differential plasma membrane proteome quantitation identify new substrates for the MARCH9 transmembrane E3 ligase.
Hör, Molecular & cellular proteomics : MCP 2009 - “...0.93 10 1.08 0.30 4.27 P04920 5 (5) CyclinM4 a 1.03 5 0.97 0.00 2.19 Q6P4Q7 1 (2) REEP5 a 0.93 2 1.08 0.08 6.30 Q00765 1 (2) SLC1A4 1.03 9 0.97 0.20 27.07 P43007 9 (17) SCAMP2 0.93 4 1.08 0.14 10.00 O15127 2 (2)...”
PF3D7_0932100 protein MAM3, putative from Plasmodium falciparum 3D7
Aligns to 6:184 / 1274 (14.1%), covers 96.7% of PF01595, 106.1 bits
- Impact of Sickle Cell Trait Hemoglobin on the Intraerythrocytic Transcriptional Program of Plasmodium falciparum
Saelens, mSphere 2021 - “...the six transcripts that were upregulated in severe malaria were downregulated in children with HbAS (PF3D7_0932100, PF3D7_1203500, PF3D7_0524100, PF3D7_0919800, and PF3D7_1430300). Among the transcripts with statistically significant upregulation in severe malaria but downregulation in HbAS RBCs was that of a putative acid phosphatase (PF3D7_1430300), which was...”
- Association of a Novel Mutation in the Plasmodium falciparum Chloroquine Resistance Transporter With Decreased Piperaquine Sensitivity
Agrawal, The Journal of infectious diseases 2017 - “...membrane protein, 2492S) 3.61E-07 MAL9:1279569 PF3D7_0932100 (Conserved membrane protein, intronic) 3.61E-07 MAL9:1279572 PF3D7_0932100 (Conserved membrane...”
- Analysis of the interactome of the Ser/Thr Protein Phosphatase type 1 in Plasmodium falciparum
Hollin, BMC genomics 2016 - “...conserved Plasmodium protein, unknown function QDO/A (1) PF3D7_0924100 conserved Plasmodium protein, unknown function TDO/A (1) PF3D7_0932100 protein MAM3, putative TDO/A (1) PF3D7_0933300 conserved Plasmodium protein, unknown function TDO/A (1) PF3D7_1020200 conserved Plasmodium protein, unknown function TDO/A (1) KNVFF PF3D7_1023400 HORMA domain protein, putative QDO/A (1) PF3D7_1029900...”
CT257 hypothetical protein (NCBI ptt file) from Chlamydia trachomatis D/UW-3/CX
Aligns to 11:188 / 404 (44.1%), covers 96.1% of PF01595, 105.8 bits
- Chlamydia trachomatis In Vivo to In Vitro Transition Reveals Mechanisms of Phase Variation and Down-Regulation of Virulence Factors
Borges, PloS one 2015 - “...]. Also, for the Ia/CS190/96 strain, two new adaptive mutations arose: an inactivating indel for CT257 and one non-synonymous SNP for CT205/ pfkA_1 , both reaching about 100% frequency. CT257 codes for a CBS domain-containing protein [ 96 ] that was suggested to display tropism for...”
- “...cell division (mutation in CT645); ii ) the nutrient acquisition/processing (mutations in CT205/ pfkA_1 , CT257 and CT713/ porB ); or iii ) global regulatory mechanisms, such as DNA supercoiling (mutation in CT189/ gyrA_1 ). Finally, despite most gene targets showed no parallelism across strains (at...”
A0JPA0 Metal transporter CNNM4 from Xenopus tropicalis
Aligns to 184:355 / 769 (22.4%), covers 93.9% of PF01595, 103.9 bits
- Crystal structure of an archaeal CorB magnesium transporter
Chen, Nature communications 2021 - “...Danio rerio ; A2ATX7), CNNM4 ( H. sapiens ; Q6P4Q7), CNNM4 ( Xenopus tropicalis ; A0JPA0), CNNM1 ( H. sapiens ; Q9NRU3), CNNM3 ( H. sapiens ; Q8NE01), UEX ( Drosophila melanogaster ; A0A0B7P9G0), cnnm-1 ( Caenorhabditis elegans ; A3QM97), MAM3 ( Saccharomyces cerevisiae ; Q12296),...”
CNNM2_CAEEL / Q9GYL2 Metal transporter cnnm-2; CNNM family homolog 2 from Caenorhabditis elegans (see paper)
Aligns to 154:321 / 762 (22.0%), covers 84.4% of PF01595, 103.7 bits
- function: Probable metal transporter. Probably acts redundantly with the other metal transport proteins cnnm-1, cnnm-3, cnnm-4 and cnnm-5 to regulate Mg(2+) homeostasis.
disruption phenotype: No visible phenotype. Double knockout with cnnm-3 results in 22% sterility. Quintuple knockout with cnnm-1, cnnm-3, cnnm- 4 and cnnm-5 results in a reduced lifespan and 100% sterility.
MAP2146c hypothetical protein (NCBI) from Mycobacterium avium subsp. paratuberculosis str. k10
Aligns to 8:185 / 436 (40.8%), covers 99.4% of PF01595, 103.7 bits
CC1G_14321 CBS domain-containing protein from Coprinopsis cinerea okayama7#130
Aligns to 82:265 / 428 (43.0%), covers 95.0% of PF01595, 103.3 bits
cg2511 CBS domain-containing protein (RefSeq) from Corynebacterium glutamicum ATCC 13032
NCgl2206 hemolysin family protein from Corynebacterium glutamicum ATCC 13032
Aligns to 10:188 / 440 (40.7%), covers 100.0% of PF01595, 101.4 bits
FSY75_17865 hemolysin family protein from Streptomyces sp. TR1341
Aligns to 7:185 / 428 (41.8%), covers 99.4% of PF01595, 101.1 bits
SCO2534 hypothetical protein (NCBI) from Streptomyces coelicolor A3(2)
Aligns to 7:185 / 434 (41.2%), covers 98.9% of PF01595, 98.9 bits
- A Human Lung-Associated Streptomyces sp. TR1341 Produces Various Secondary Metabolites Responsible for Virulence, Cytotoxicity and Modulation of Immune Response
Herbrík, Frontiers in microbiology 2019 - “...et al., 2010 ; Forrellad et al., 2013 ; Rahman et al., 2015 ) FSY75_17865 SCO2534 HlyC/CorC family magnesium and cobalt efflux protein TlyC family : hemolysin C of Brachyspira hyodysenteriae (ACN83901.1) and Co 2+ -resistance protein CorC of Salmonella typhimurium (TKE78380.1), TlyC hemolysin of Rickettsia...”
- SepG coordinates sporulation-specific cell division and nucleoid organization in Streptomyces coelicolor
Zhang, Open biology 2016 - “...OppB oligopeptide permease subunit 95 SCO3404 FtsH2 d metalloprotease 95 SCO1527 alcohol phosphatidyl transferase 94 SCO2534 hemolysin-like protein 93 SCO1796 stomatin-like protein 93 SCO2150 QcrC cytochrome c heme-binding subunit 93 SCO5670 putative polyamine permease subunit 93 SCO2945 sugar permease subunit 93 SCO2148 QcrB cytochrome b subunit...”
- Functional analysis of the gene SCO1782 encoding Streptomyces hemolysin (S-hemolysin) in Streptomyces coelicolor M145
Rajesh, Toxicon : official journal of the International Society on Toxinology 2013 (PubMed)- “...was searched for hemolysin-coding genes; consequently, SCO1782, SCO2534, and SCO3882 were identified, whose products were annotated as a putative, membrane, and...”
- “...This study pT2534 pET28a carrying PCR product of SCO2534 from S. coelicolor This study pT3882 pET28a carrying PCR product of SCO3882 from S. coelicolor...”
HU689_07770 hemolysin family protein from Shewanella algae
Aligns to 5:178 / 358 (48.6%), covers 99.4% of PF01595, 98.3 bits
- Complete genome sequence of Shewanella algae strain 2NE11, a decolorizing bacterium isolated from industrial effluent in Peru
Lizárraga, Biotechnology reports (Amsterdam, Netherlands) 2022 - “...Resistance cadA HU689_10830 P-type ATPase protein corA a & corC b HU689_12865 a &(HU689_16615; HU689_20255; HU689_07770) b Magnesium and cobalt transport protein ab zntB HU689_05170 Efflux Zn +2 ion transport protein arsA a & arsB b & arsC c HU689_08030 a &HU689_02860 b &HU689_10495 c ATPase...”
- “...magnesium and cobalt transport such as corA ( HU689_12865 ) and corC ( HU689_16615; HU689_20255; HU689_07770 ), widely associated with the exterior and interior flux of Mg +2 and Co +2 ions in gram-negative and positive bacteria [15] . Resistance to other ions such as zinc...”
VP2912 conserved hypothetical protein (NCBI ptt file) from Vibrio parahaemolyticus RIMD 2210633
Aligns to 6:178 / 375 (46.1%), covers 97.2% of PF01595, 97.3 bits
DIP1716 Putative membrane protein (NCBI) from Corynebacterium diphtheriae NCTC 13129
Aligns to 8:187 / 442 (40.7%), covers 100.0% of PF01595, 91.7 bits
- Transcriptome sequencing of the human pathogen Corynebacterium diphtheriae NCTC 13129 provides detailed insights into its transcriptional landscape and into DtxR-mediated transcriptional regulation
Wittchen, BMC genomics 2018 - “...wall, membrane, envelop biogenesis DIP1720 - DIP1713 8 not detected dnaJ2 , DIP1719, DIP1718, DIP1717, DIP1716, DIP1715, era , recO . Replication, recombination and repair; Cell wall, membrane, envelop biogenesis; Coenzyme metabolism; Inorganic ion transport and metabolism; Function unknown; Signal transduction mechanisms; Post-translational modification, protein turnover,...”
TC0527 conserved hypothetical protein (NCBI ptt file) from Chlamydia muridarum Nigg
Aligns to 8:182 / 412 (42.5%), covers 99.4% of PF01595, 90.0 bits
VC0271 conserved hypothetical protein (NCBI ptt file) from Vibrio cholerae O1 biovar eltor str. N16961
Aligns to 6:178 / 352 (49.1%), covers 96.7% of PF01595, 90.0 bits
- Phase variable O antigen biosynthetic genes control expression of the major protective antigen and bacteriophage receptor in Vibrio cholerae O1
Seed, PLoS pathogens 2012 - “...O139 donor DNA during natural transformation, the crossovers were often localized within or downstream of VC0271 at the right junction, and the location of the left junction was within or upstream of gmhD . These results coupled with our observation that manA participates in O1 antigen...”
- Serogroup conversion of Vibrio cholerae in aquatic reservoirs
Blokesch, PLoS pathogens 2007 - “...VchoM_01000821 (homolog to VC0267), 0820 = VchoM_01000820 (homolog to VC0268), 0819 = VchoM_01000819 (homolog to VC0271). About 15% of the Kan R transformants (approximating a transformation frequency of 2.2 10 6 ) exhibited the same opaque colony morphotype as O139 strain MO10 [ 21 ] and...”
- “...left junction ( Figure 2 D, lanes 2 and 3), and within or downstream of VC0271 at the right junction ( Figure 2 D, lane 2). However, in a few transformants, crossovers could be localized to a different right-junction site within a second region of homology...”
- Detection and transformation of genome segments that differ within a coastal population of Vibrio cholerae strains
Miller, Applied and environmental microbiology 2007 - “...gene present in Sa5Y but not in VCXB21, and VC0271. (F) Probes VC1280 to VC1286 transformed into W6G using primers in VC1279, VC1280, and VC1287. Downloaded...”
- “...replaced the intervening segment found between ORFs VC0268 and VC0271 in the Sa5Y recipient strain. Independent mapping showed that Sa5Y contains 9 kbp of DNA...”
MPN159 tlyC homolog, hemolysin activity doubtful (NCBI ptt file) from Mycoplasma pneumoniae M129
P75586 UPF0053 protein MG146 homolog from Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Aligns to 14:191 / 424 (42.0%), covers 98.9% of PF01595, 87.2 bits
- Determination of the Gene Regulatory Network of a Genome-Reduced Bacterium Highlights Alternative Regulation Independent of Transcription Factors
Yus, Cell systems 2019 - “...equilibrium between NTP and dNTPs, regulates DnaA. (2) the inactivation of the Mg 2+ transporter MPN159 (CorB), the transition metal-binding protein, MPN162, and the recombination protein MPN490 (RecA) correlate significantly (r> 0.67, p< 2.2e16) ( FigureS4 D), thus linking metal transport and binding to recombination and...”
- Phenotypic switching in Candida glabrata involves phase-specific regulation of the metallothionein gene MT-II and the newly discovered hemolysin gene HLP
Lachke, Infection and immunity 2000 - “...maritima, AE001751; M.pne, Mycoplasma pneumoniae, P75586; M.gen, Mycoplasma genitalium, 049399; C.pne, Chlamydia pneumoniae, AE001623; M.tub, Mycobacterium...”
CT256 Hypothetical protein containing CBS domains (NCBI ptt file) from Chlamydia trachomatis D/UW-3/CX
Aligns to 8:182 / 414 (42.3%), covers 100.0% of PF01595, 86.1 bits
Q7UQW5 Hemolysin protein from Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Aligns to 12:186 / 415 (42.2%), covers 95.6% of PF01595, 85.7 bits
CNNM1_HUMAN / Q9NRU3 Metal transporter CNNM1; Ancient conserved domain-containing protein 1; Cyclin-M1 from Homo sapiens (Human) (see paper)
Aligns to 227:414 / 951 (19.8%), covers 93.3% of PF01595, 80.6 bits
- function: Probable metal transporter.
- Crystal structure of an archaeal CorB magnesium transporter
Chen, Nature communications 2021 - “...H. sapiens ; Q6P4Q7), CNNM4 ( Xenopus tropicalis ; A0JPA0), CNNM1 ( H. sapiens ; Q9NRU3), CNNM3 ( H. sapiens ; Q8NE01), UEX ( Drosophila melanogaster ; A0A0B7P9G0), cnnm-1 ( Caenorhabditis elegans ; A3QM97), MAM3 ( Saccharomyces cerevisiae ; Q12296), CBSDUF1 ( Arabidopsis thaliana ; Q67XQ0),...”
- Predicting binding within disordered protein regions to structurally characterised peptide-binding domains.
Khan, PloS one 2013 - “...LLGIILLVL 0.467 0.396 Q5SVZ6 LKLIIENIL 0.434 0.329 Q96AH8 LKLIIVGAI 0.425 0.75 Q9HAU8 LTFIISSIL 0.401 0.436 Q9NRU3 LEDIIEEII 0.384 0.393 P53618 LMTIIRFVL 0.363 0.321 O75376* LEDIIRKAL 0.362 0.044 Q8IWF6 LRTHIDAII 0.350 0.197 Q8NHV5 LFFIIMGII 0.341 1 Q9UPM8 LRLHIIEII 0.338 0.3 Q9Y618* LAQHISEVI 0.335 0.055 Q96N64 LDHIIEDAL 0.333...”
- Purification, crystallization and preliminary crystallographic analysis of the CBS-domain pair of cyclin M2 (CNNM2).
Gómez-García, Acta crystallographica. Section F, Structural biology and crystallization communications 2012 - Purification, crystallization and preliminary crystallographic analysis of the CBS-domain protein MJ1004 from Methanocaldococcus jannaschii
Oyenarte, Acta crystallographica. Section F, Structural biology and crystallization communications 2011 - “...10, P51801; 11, P20839; 12, P35523; 13, P51788; 14, Q9NRU3; 15, P51797. Arabidopsis thaliana: 1, Q8GZA4; 2, Q9SSD0; 3, CLCE; 4, CLCC; 5, CLCA; 6, Q9M1T1; 7,...”
PPA0938 conserved protein, putative hemolysin (NCBI) from Propionibacterium acnes KPA171202
PPA0938 hemolysin family protein from Cutibacterium acnes KPA171202
Aligns to 10:188 / 432 (41.4%), covers 98.3% of PF01595, 80.3 bits
- Propionibacterium acnes and Acne Vulgaris: New Insights from the Integration of Population Genetic, Multi-Omic, Biochemical and Host-Microbe Studies.
McLaughlin, Microorganisms 2019 - “...Potential Effect on the Host CAMP-factors PPA0687, PPA1198, PPA1231, PPA1340, PPA2108 Haemolytic, cytotoxic Haemolysins PPA0565, PPA0938, PPA1396 Haemolytic GehA lipases PPA1796, PPA2105 Tissue damage, inflammation Sialidases PPA0684, PPA0685, PPA1560 Tissue damage Hyaluronate lyase (HYL) PPA0380 Tissue damage Endoglycoceramidases PPA0644, PPA2106 Tissue damage Endo--N-acetylglucosaminidase PPA0990 Tissue damage...”
CNNM1_MOUSE / Q0GA42 Metal transporter CNNM1; Ancient conserved domain-containing protein 1; mACDP1; Cyclin-M1; Cyclin-like protein 1; CLP-1 from Mus musculus (Mouse) (see 2 papers)
Aligns to 227:414 / 951 (19.8%), covers 93.3% of PF01595, 78.4 bits
XP_006527543 metal transporter CNNM1 isoform X1 from Mus musculus
Aligns to 227:414 / 982 (19.1%), covers 93.3% of PF01595, 78.3 bits
CNNM5_CAEEL / G5ED05 Metal transporter cnnm-5; CNNM family homolog 5 from Caenorhabditis elegans (see paper)
Aligns to 141:322 / 722 (25.2%), covers 95.0% of PF01595, 59.9 bits
- function: Probable metal transporter. Probably acts redundantly with the other metal transport proteins cnnm-1, cnnm-2, cnnm-3 and cnnm-4 to regulate Mg(2+) homeostasis.
disruption phenotype: No visible phenotype. Quintuple knockout with cnnm-1, cnnm-2, cnnm-3 and cnnm-4 results in a reduced lifespan and 100% sterility.
PITG_02263 metal transporter, putative from Phytophthora infestans T30-4
Aligns to 50:141 / 425 (21.6%), covers 41.1% of PF01595, 47.7 bits
Pput_4262 transporter-associated region (RefSeq) from Pseudomonas putida F1
Aligns to 49:166 / 401 (29.4%), covers 42.2% of PF01595, 38.7 bits
CNNM3_MOUSE / Q32NY4 Metal transporter CNNM3; Ancient conserved domain-containing protein 3; mACDP3; Cyclin-M3 from Mus musculus (Mouse) (see paper)
Aligns to 145:296 / 713 (21.3%), covers 79.4% of PF01595, 29.6 bits
D4ACK7 Cyclin and CBS domain divalent metal cation transport mediator 3 from Rattus norvegicus
Aligns to 143:294 / 711 (21.4%), covers 79.4% of PF01595, 29.5 bits
Or search for genetic data about PF01595 in the Fitness Browser
by Morgan Price,
Arkin group
Lawrence Berkeley National Laboratory