Family Search for PF01595 (DUF21)

PF01595.20 hits 192 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.

CPE0030 probable hemolysin-related protein (NCBI ptt file) from Clostridium perfringens str. 13
Aligns to 9:188 / 421 (42.8%), covers 99.4% of PF01595, 195.8 bits

• Role of RNase Y in Clostridium perfringens mRNA Decay and Processing
  Obana, Journal of bacteriology 2017
  • “...with increased expression under RNase Y-depleted condition CPE0030 CPE0452 CPE1234 CPE1279 Loci with decreased expression under RNase Y-depleted condition...”
• Complete genome sequence of Clostridium perfringens, an anaerobic flesh-eater
  Shimizu, Proceedings of the National Academy of Sciences of the United States of America 2002
  • “...importers. Other classes of Shimizu et al. Gene name CPE0030 hlyA CPE0036 plc CPE0163 pfoA CPE0173 colA CPE0191 nagH CPE0378 CPE0437 hlyB CPE0452 entC CPE0553...”

EBL75_20695, EBQ27_20700 HlyC/CorC family transporter from Clostridium butyricum
Aligns to 10:189 / 427 (42.2%), covers 99.4% of PF01595, 195.1 bits

• Epidemiological and genetic characterization of Clostridium butyricum cultured from neonatal cases of necrotizing enterocolitis in China
  Dong, Infection control and hospital epidemiology 2020
  • “...et al 9 2015 tlyB EBL75_04805 EBQ27_04805 Hemolysin B Cassir et al 9 2015 tlyC EBL75_20695 EBQ27_20700 Hemolysin C Cassir et al 9 2015 EBL75_04095 EBQ27_04095 Hemolysin III family protein Cassir et al 9 2015 hylA EBL75_16000 EBQ27_16000 -Hemolysin Cassir et al 9 2015 EBL75_11210 EBQ27_11215...”
  • “...al 9 2015 tlyB EBL75_04805 EBQ27_04805 Hemolysin B Cassir et al 9 2015 tlyC EBL75_20695 EBQ27_20700 Hemolysin C Cassir et al 9 2015 EBL75_04095 EBQ27_04095 Hemolysin III family protein Cassir et al 9 2015 hylA EBL75_16000 EBQ27_16000 -Hemolysin Cassir et al 9 2015 EBL75_11210 EBQ27_11215 Enterotoxin...”

FTL_0951 hypothetical protein (NCBI) from Francisella tularensis subsp. holarctica
Aligns to 8:196 / 419 (45.1%), covers 96.0% of PF01595, 175.6 bits

• Twin RNA polymerase-associated proteins control virulence gene expression in Francisella tularensis
  Charity, PLoS pathogens 2007
  • “...used, as a control, cells of a mutant containing a mariner transposon in the gene FTL_0951 (LVS:: FTL0951 ); this strain has a more severe growth defect than either the mglA or sspA mutant strain (with a corresponding culture doubling time of ~285 min). Cells of...”
  • “...contains a mariner transposon conferring resistance to kanamycin integrated into the LVS chromosome at the FTL_0951 locus; the presence of a single transposon in this strain was confirmed by Southern blotting, and the location of the transposon was determined by sequencing of the chromosomal DNA. Complementation...”

FTN_1006 transporter-associated protein, HlyC/CorC family (NCBI) from Francisella tularensis subsp. novicida U112
Aligns to 8:196 / 419 (45.1%), covers 96.0% of PF01595, 175.6 bits

• Genome sequence and phenotypic analysis of a first German Francisella sp. isolate (W12-1067) not belonging to the species Francisella tularensis
  Rydzewski, BMC microbiology 2014
  • “...743 Lecithinase/hemolysin FTN_0436 (75%) Lysophospholipase 167 Lysophospholipase Fphi_1625 (67%) HlyC/CorC 182 CBS domain, putative hemolysin FTN_1006 (80%) ClpB 1114 ClpB chaperone domain FTN_1743 (89%) Chitinase 1 (372 aa) 490 GH18_chitinase-like superfamily Fphi_0209 (83%) Chitinase 2 (590 aa) 816 Chitinase_glyco-hydro_19 domain, PP location, CBM Fphi_0512 (69%) Chitinase...”
• Francisella-arthropod vector interaction and its role in patho-adaptation to infect mammals
  Akimana, Frontiers in microbiology 2011
  • “...ABC transporter, ATP-binding protein FTN_0997 Proton-dependent oligopeptide transporter (POT) family protein, di- or tripeptide:H+ symporter FTN_1006 Transporter-associated protein, HlyC/CorC family FTN_1014 Nicotinamide mononucleotide transport (NMT) family protein FTN_1016 Hypothetical protein FTN_1026 Major facilitator superfamily (MFS) transport protein, pseudogene FTN_1027 Holliday junction endodeoxyribonuclease ruvC FTN_1034 Iron-sulfur cluster-binding...”
• Molecular bases of proliferation of Francisella tularensis in arthropod vectors
  Asare, Environmental microbiology 2010
  • “...FTN_0910 sugar:cation symporter family protein 2 # tnfn1_pw060419p01q175 FTN_0984 ABC transporter, ATP-binding protein 2 tnfn1_pw060419p01q170 FTN_1006 transporter-associated protein, HlyC/CorC family 4 tnfn1_pw060418p02q160 FTN_1010 major facilitator superfamily (MFS) transport protein 2 tnfn1_pw060419p01q133 FTN_1014 nicotinamide ribonucleoside (NR) uptake permease (PnuC) family protein 2 tnfn1_pw060328p02q109 FTN_1107 metlQ methionine uptake...”
  • “...protein of unknown function tnfn1_pw060420p02q181 FTN_0933 protein of unknown function tnfn1_pw060323p04q134 FTN_0938 hypothetical protein tnfn1_pw060419p01q170 FTN_1006 transporter-associated protein, HlyC/CorC family tnfn1_pw060323p08q141 FTN_1015 isochorismatase family protein tnfn1_pw060418p01q153 FTN_1055 lon DNA-binding, ATP-dependent protease La tnfn1_pw060510p01q114 FTN_1073 DNA/RNA endonuclease G tnfn1_pw060419p04q168 FTN_1091 aroA 3-phosphoshikimate 1- carboxyvinyltransferase tnfn1_pw060328p08q188 FTN_1098 conserved...”
• Molecular complexity orchestrates modulation of phagosome biogenesis and escape to the cytosol of macrophages by Francisella tularensis
  Asare, Environmental microbiology 2010
  • “...FTN_0910 sugar:cation symporter family protein 2 # tnfn1_pw060419p01q175 FTN_0984 ABC transporter, ATP-binding protein 2 tnfn1_pw060419p01q170 FTN_1006 transporter-associated protein, HlyC/CorC family 4 tnfn1_pw060418p02q160 FTN_1010 major facilitator superfamily (MFS) transport protein 2 tnfn1_pw060419p01q133 FTN_1014 nicotinamide ribonucleoside (NR) uptake permease (PnuC) family protein 2 tnfn1_pw060328p02q109 FTN_1107 metlQ methionine uptake...”
  • “...protein of unknown function tnfn1_pw060420p02q181 FTN_0933 protein of unknown function tnfn1_pw060323p04q134 FTN_0938 hypothetical protein tnfn1_pw060419p01q170 FTN_1006 transporter-associated protein, HlyC/CorC family tnfn1_pw060323p08q141 FTN_1015 isochorismatase family protein tnfn1_pw060418p01q153 FTN_1055 lon DNA-binding, ATP-dependent protease La tnfn1_pw060510p01q114 FTN_1073 DNA/RNA endonuclease G tnfn1_pw060419p04q168 FTN_1091 aroA 3-phosphoshikimate 1-carboxyvinyltransferase tnfn1_pw060328p08q188 FTN_1098 conserved hypothetical...”
• Working toward the future: insights into Francisella tularensis pathogenesis and vaccine development
  Pechous, Microbiology and molecular biology reviews : MMBR 2009
  • “...FTN_0881 ruvB FTN_0918 FTN_0925 FTN_0933 FTN_0938 FTN_0998 FTN_1006 FTN_1015 FTN_1016 FTN_1029 lipA FTN_1038 lon FTN_1063 phoH FTN_1066 FTN_1090 FTN_1098 metIQ...”
  • “...FTN_0891 FTN_0918 FTN_0925 FTN_0933 FTN_0938 FTN_0998 FTN_1006 FTN_1015 FTN_1016 FTN_1029 FTN_1030 FTN_1038 FTN_1055 FTN_1063 FTN_1064 FTN_1066 FTN_1090...”
• Genome-wide screen in Francisella novicida for genes required for pulmonary and systemic infection in mice
  Kraemer, Infection and immunity 2009
  • “...FTN_0857 FTN_0873 FTN_0877 FTN_0881 FTN_0918 FTN_0933 FTN_0938 FTN_1006 dcd cls FTN_1015 FTN_1016 FTN_1029 FTN_1030 FTN_1055 lipA lon FTN_1063 FTN_1098 FTN_1107...”

SH2193 hypothetical protein (NCBI) from Staphylococcus haemolyticus JCSC1435
Aligns to 9:203 / 458 (42.6%), covers 99.4% of PF01595, 175.1 bits

• Whole-genome sequencing of staphylococcus haemolyticus uncovers the extreme plasticity of its genome and the evolution of human-colonizing staphylococcal species
  Takeuchi, Journal of bacteriology 2005
  • “...it showed 60% identity to the Bacillus halodurans -hemolysin. SH2193 also shared a motif for "hemolysin and related molecules," and it was 39% identical to a...”
  • “...plates. At least three orfs (SH0871, SH1134, and SH2193) showed homology to known staphylococcal hemolysins. A conserved-domain search found that SH0871 shared...”

CPE0437 probable hemolysin (NCBI ptt file) from Clostridium perfringens str. 13
Aligns to 12:203 / 445 (43.1%), covers 100.0% of PF01595, 174.5 bits

• Role of RNase Y in Clostridium perfringens mRNA Decay and Processing
  Obana, Journal of bacteriology 2017
  • “...CPE1818 PCP17 PCP57 Unaffected loci CPE0191 CPE0378 CPE0437 CPE0553 CPE0606 CPE0725 CPE0737 CPE0881 CPE1354 CPE1474 CPE1501 CPE1523 CPE1847 CPE1915 Gene Product...”
• Complete genome sequence of Clostridium perfringens, an anaerobic flesh-eater
  Shimizu, Proceedings of the National Academy of Sciences of the United States of America 2002
  • “...plc CPE0163 pfoA CPE0173 colA CPE0191 nagH CPE0378 CPE0437 hlyB CPE0452 entC CPE0553 nanJ CPE0606 entD CPE0725 nanH CPE0737 CPE0846 CPE0881 nagI CPE1231 CPE1234...”

FTT_0676 hypothetical protein (RefSeq) from Francisella tularensis subsp. tularensis SCHU S4
Aligns to 8:196 / 419 (45.1%), covers 96.0% of PF01595, 174.2 bits

• A spontaneous mutation in kdsD, a biosynthesis gene for 3 Deoxy-D-manno-Octulosonic Acid, occurred in a ciprofloxacin resistant strain of Francisella tularensis and caused a high level of attenuation in murine models of tularemia
  Chance, PloS one 2017
  • “...nucleotide polymorphisms (SNPs) leading to amino acid substitutions in fabH , fabF , FTT_0807 , FTT_0676 , and FTT_1573 . The fupA gene experienced a single base pair deletion at nucleotide 105 followed by a single base pair insertion at nucleotide 111, which maintained the reading...”

O23A_p2978 DUF21 domain-containing protein from Aeromonas salmonicida
Aligns to 11:185 / 426 (41.1%), covers 94.3% of PF01595, 171.7 bits

• Analysis of the Genome and Mobilome of a Dissimilatory Arsenate Reducing Aeromonas sp. O23A Reveals Multiple Mechanisms for Heavy Metal Resistance and Metabolism
  Uhrynowski, Frontiers in microbiology 2017
  • “...cobalt, zinc and cadmium resistance systems (CzcAB), (ix) O23A_p2639-2640 encoding copper resistance system CopAB, (x) O23A_p2978 encoding magnesium and cobalt efflux protein CorB, (xi) O23A_p3017 encoding cobalt, zinc and cadmium resistance protein CzcD, (xiixiii) O23A_p3309 and O23A_p3510 encoding divalent metal cations (Fe/Co/Zn/Cd) transporters of FieF family....”

PP5322, PP_5322 metal ion transporter, putative (NCBI ptt file) from Pseudomonas putida KT2440
Aligns to 19:215 / 446 (44.2%), covers 94.9% of PF01595, 170.3 bits

• Evaluation of chromosomal insertion loci in the Pseudomonas putida KT2440 genome for predictable biosystems design
  Chaves, Metabolic engineering communications 2020
  • “...P.putida KT2440 wild type, and P.putida KT2440 strains with mKate inserted at PP_1642, PP_2224, and PP_5322 were selected from single colonies and grown to saturation in LB overnight at 30C, shaking at 200rpm. Saturated cultures were diluted 1/100 into fresh M9 minimal medium supplemented with 30mM...”
  • “...had significant effects on both growth rate and mKate expression. At sites PP_1035, PP_4305, PP_5042, PP_5322, and PP_5388, insertion of mKate did not have a negative effect on growth, and all strains grew similarly to the wild type. The strains with mKate integration at PP_1642 or...”
• Genetic Dissection of the Regulatory Network Associated with High c-di-GMP Levels in Pseudomonas putida KT2440
  Ramos-González, Frontiers in microbiology 2016
  • “...PP_0114 ( metN1 ) Methionine import ATP-binding component of ABC transporter (AAA+ ATPase domain) cfcK-3 PP_5322 Putative metal ion transporter cfcK-5 PP_4366 ( fliI ) Flagellum-specific ATP synthase (AAA+ ATPase domain) cfcK-6 PP_4741 ( hsdM ) Type I restriction-modification system, M subunit cfcK-9 PP_5064 ( betA...”
• Functional genomics of stress response in Pseudomonas putida KT2440
  Reva, Journal of bacteriology 2006
  • “...Carlo simulation). Second, four genes (PP0063, PP0816, PP4646, and PP5322) were identified as genes that are vital for more than one stress condition (P 106 for...”
  • “...PP4697 PP4731 PP4880 PP4941 PP4982 PP5044 PP5145c PP5302 PP5322 PP5326 PP5327 PP5328 PP5329 Benzoate Encoded protein P. PUTIDA KT2440 STRESS RESPONSE VOL. 188,...”

U876_20420 DUF21 domain-containing protein from Aeromonas hydrophila NJ-35
Aligns to 11:185 / 426 (41.1%), covers 94.3% of PF01595, 170.0 bits

• Identification of Aeromonas hydrophila Genes Preferentially Expressed after Phagocytosis by Tetrahymena and Involvement of Methionine Sulfoxide Reductases
  Pang, Frontiers in cellular and infection microbiology 2016
  • “...Acetolactate synthase 3 catalytic subunit Clone33 U876_19385 Diguanylate phosphodiesterase Clone34 U876_20360 thyA Thymidylate synthase Clone35 U876_20420 Transporter Clone36 U876_20490 Nitrogen regulatory protein P-II 1 Clone37 U876_20575 Metallophosphatase Clone38 U876_22695 mgtA Magnesium ABC transporter atpase Clone39 U876_22910 cysE Serine acetyltransferase (cyse) Clone40 U876_23285 norV Nitric oxide reductase...”

YfjD / b4461 UPF0053 family inner membrane protein YfjD from Escherichia coli K-12 substr. MG1655 (see 3 papers)
P37908 UPF0053 inner membrane protein YfjD from Escherichia coli (strain K12)
b4461 predicted inner membrane protein (RefSeq) from Escherichia coli str. K-12 substr. MG1655
Aligns to 10:191 / 428 (42.5%), covers 96.0% of PF01595, 169.9 bits

• Phenotypic switching in Candida glabrata involves phase-specific regulation of the metallothionein gene MT-II and the newly discovered hemolysin gene HLP
  Lachke, Infection and immunity 2000
  • “...Bacillus subtilis, 007585; E.coli, Escherichia coli, P37908; T.mar, Thermotoga maritima, AE001751; M.pne, Mycoplasma pneumoniae, P75586; M.gen, Mycoplasma...”
• Combinatorial strategies for improving multiple-stress resistance in industrially relevant Escherichia coli strains
  Lennen, Applied and environmental microbiology 2014
  • “...b3772 b0074 b2320 b0073 b2839 b0052 b0008 b0072 b0876 b0388 b4461 b4488 b2677 leuL leuD ilvA leuA pdxB leuB lysR pdxA talB leuC ybjD aroL yfjD ilvG proV leu...”

SE0474 conserved hypothetical protein (NCBI ptt file) from Staphylococcus epidermidis ATCC 12228
Aligns to 9:203 / 449 (43.4%), covers 99.4% of PF01595, 169.9 bits

• Identification of antigenic components of Staphylococcus epidermidis expressed during human infection
  Pourmand, Infection and immunity 2006
  • “...protein 12 465589-468072 SE0473 (1-390) SE0474 (1-139) N-Acetylglucosamine-6-phosphate deacetylase Conserved hypothetical protein 13 1979057-1981257 SE1945...”

SAOUHSC_00711 hypothetical protein (NCBI) from Staphylococcus aureus subsp. aureus NCTC 8325
SA0657 hypothetical protein (NCBI) from Staphylococcus aureus subsp. aureus N315
SACOL0762 hemolysin, putative (NCBI) from Staphylococcus aureus subsp. aureus COL
Aligns to 9:203 / 449 (43.4%), covers 100.0% of PF01595, 169.3 bits

• Host-inherent variability influences the transcriptional response of Staphylococcus aureus during in vivo infection
  Thänert, Nature communications 2017
  • “...cation/H+ antiporter subunit A SAOUHSC_02763 opp-1F Peptide ABC transporter ATP-binding protein SAOUHSC_00988 sspA Glutamyl endopeptidase SAOUHSC_00711 Hypothetical SAOUHSC_00561 vraX Hypothetical SAOUHSC_02550 FdhD Formate dehydrogenase accessory protein SAOUHSC_00875 ndh2 Hypothetical SAOUHSC_01359 mprF Hypothetical SAOUHSC_01192 vfrA Hypothetical SAOUHSC_02887 isaA Immunodominant antigen A SAOUHSC_02254 groEL chaperonin GroEL SAOUHSC_02485 rpoA...”
• Genetic screens reveal novel major and minor players in magnesium homeostasis of Staphylococcus aureus
  Trachsel, PLoS genetics 2019
  • “...(SA0867), and an accessory CorA (SA2137), while the export system is composed essentially of MpfA (SA0657) with a smaller role for MpfB (SA0780) ( Fig 7 ). Furthermore, import and export constitute two independent systems as evidenced by the additivity of the phenotypes of the deletion...”
  • “...previously introduced mutations were verified Sanger Sequencing for SNP mutations and by PCR for deletions. SA0657 and SA2166 ORFs were replaced by an antibiotic resistance cassette (chloramphenicol and erythromycin respectively) while SA0780, SA2137 and SA0867 ORFs were deleted in frame. In particular, in the case of...”
• Structural Insights into the Intracellular Region of the Human Magnesium Transport Mediator CNNM4
  Giménez-Mascarell, International journal of molecular sciences 2019
  • “...other CBS-containing proteins related with Mg 2+ extrusion such as the Mg 2+ tolerance factor SA0657 found in Staphylococcus aureus [ 43 ], or bacterial proteins CorB and CorC which have been proposed to mediate Mg 2+ extrusion through bacterial Mg 2+ channel CorA [ 44...”
• Characterization of genetic changes associated with daptomycin nonsusceptibility in Staphylococcus aureus
  Ma, PloS one 2018
  • “...Noncoding nagB/SA0527 Glucosamine-6-phosphate isomerase JH1/JH5 712573 Nonsynonymous A580V vraG/SA0617 ABC transporter permease JH1/JH5 751554 Noncoding SA0657 Hemolysin JH1/JH5 1005831 Nonsynonymous C147Y SA0885 Hypothetical protein JH1/JH5 1893057 Nonsynonymous E140Q prsA/SA1659 Peptidyl-prolyl cis/trans isomerase JH1/JH5 1954969 Nonsynonymous D48H SA1708 UDP-N-acetylmuramyl tripeptide synthetase JH1/JH5 2368738 Nonsynonymous H177R SA2105 Conserved...”
• An Essential Factor for High Mg2+ Tolerance of Staphylococcus aureus
  Armitano, Frontiers in microbiology 2016
  • “...pathogen, growing unimpaired in up to 770 mM Mg 2+ , and we here identify SA0657, a key factor in this tolerance. The predicted domain structure of SA0657 is shared with a large number of proteins in bacteria, archaea and even eukarya, for example CorB from...”
  • “...2+ sensing, contains the conserved Glycine326 which we establish to be a key residue for SA0657 function. In light of our findings, we propose the name MpfA, Magnesium Protection Factor A, for SA0657. magnesium tolerance Staphylococcus aureus MpfA CNNM CorB CorC CBS Schweizerischer Nationalfonds zur Frderung...”
• The Genera Staphylococcus and Macrococcus
  Dworkin, The ProkaryotesVolume 4: Bacteria: Firmicutes, Cyanobacteria 2006
  • “...of white blood cells - Location: SaPIn3/SaPIm3 Possible leukocidin SA1813 lukM Unknown - Possible hemolysin SA0657 None Unknown 89 Possible hemolysin SA0780 None Unknown 82 Similar to exotoxin 1 SA1009 None Unknown 55 Possible hemolysin SA1812 None Unknown - Similar to hemolysin III SA1973 None Unknown...”
• The second messenger c-di-AMP inhibits the osmolyte uptake system OpuC in Staphylococcus aureus
  Schuster, Science signaling 2016
  • “...predicted to encode the inosine-5 monophosphate dehydrogenase GuaB (SACOL0460), two membrane proteins with unknown functions (SACOL0762 and SACOL0921), the magnesium transporter MgtE (SACOL1013), the transcription factor CcpN (SACOL1621), and a multi-domain cytoplasmic protein of unknown function (SACOL1752). Sequence alignments comparing the CBS domains of OpuCA with...”
  • “...separated on a polyacrylamide gel and visualized by Coomassie staining (n=4). For the membrane proteins SACOL0762, SACOL0921, and SACOL1013, His-MBP fusion proteins to the CBS domain only, but lacking the transmembrane regions, were used. ( C ) Representative DRaCALA assays showing lysates analyzed in panel (B)...”
• Development and application of the active surveillance of pathogens microarray to monitor bacterial gene flux
  Stabler, BMC microbiology 2008
  • “...a band for the haemolysin, which was sequenced and proven to be the haemolysin gene (SACOL0762) (table 2 ). The exotoxin 3 was also confirmed as exotoxin 3 by vectorette PCR (table 2 ), suggesting the hybridisation conditions used for the arrays were not optimal for...”
  • “...S. aureus COL genes Gene Name/phenotype Gene ID BLAST/hyb Vectorette product Top Hit Size Haemolysin SACOL0762 Yes/Yes Yes SACOL0762 126/126 Exotoxin 3 SACOL0468 Yes/No Yes SACOL0468 362/362 Bleomycin resistance SAR0032 No/Yes No n/a n/a Chloramphenicol resistance CV0700 No/Yes No n/a n/a C. difficile strain 630 was...”
• Comparative genomics of Canadian epidemic lineages of methicillin-resistant Staphylococcus aureus
  Christianson, Journal of clinical microbiology 2007
  • “...SACOL0469 SACOL0470 SACOL0472 SACOL0473 SACOL0474 SACOL0478 SACOL0762 SACOL0886 SACOL0887 sek sei SACOL0907 seb SACOL1178 SACOL1179 SACOL1180 SACOL1880...”

X276_15855 HlyC/CorC family transporter from Clostridium beijerinckii NRRL B-598
Aligns to 7:202 / 429 (45.7%), covers 99.4% of PF01595, 169.1 bits

• Phenotypic and Genomic Analysis of Clostridium beijerinckii NRRL B-598 Mutants With Increased Butanol Tolerance
  Vasylkivska, Frontiers in bioengineering and biotechnology 2020
  • “...X276_15915 Sigma-54-dependent Fis family transcriptional regulator 2451932 2453896 + E E 7 2468045 G A X276_15855 HlyC/CorC family transporter 2467109 2468398 + A T 8 2482557 C T X276_15775 Bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase 2482286 2482915 + A V 9 3008051 C A X276_13415 S-layer family protein...”

Eab7_0255 HlyC/CorC family transporter from Exiguobacterium antarcticum B7
Aligns to 10:203 / 437 (44.4%), covers 99.4% of PF01595, 167.5 bits

• Functional annotation of hypothetical proteins from the Exiguobacterium antarcticum strain B7 reveals proteins involved in adaptation to extreme environments, including high arsenic resistance
  da, PloS one 2018
  • “...5 Eab7_0152 IPR006750 Inner membrane exporter, YdcZ 6 Eab7_0154 IPR006750 Inner membrane exporter, YdcZ 7 Eab7_0255 IPR000644 Cystathionine-beta synthase associated with the CorC_HlyC domain 8 Eab7_0278 IPR027417 P-loop containing Nucleoside Triphosphate Hydrolases 9 Eab7_0284 IPR005524 ArsP_1 Superfamily 10 Eab7_0378 IPR006750 Inner membrane exporter, YdcZ 11 Eab7_0379...”

FORC22_2576 DUF21 domain-containing protein from Vibrio parahaemolyticus
VP2536 putative hemolysin (NCBI ptt file) from Vibrio parahaemolyticus RIMD 2210633
Aligns to 10:187 / 426 (41.8%), covers 93.2% of PF01595, 167.4 bits

• Potential Survival and Pathogenesis of a Novel Strain, Vibrio parahaemolyticus FORC_022, Isolated From a Soy Sauce Marinated Crab by Genome and Transcriptome Analyses
  Chung, Frontiers in microbiology 2018
  • “...the standard errors of the means. Several ORFs encoding various hemolysin genes (FORC22_0344, FORC22_0414, FORC22_1716, FORC22_2576, and FORC22_3059 in chromosome I; FORC22_3287, FORC22_3317, and FORC22_3346 in chromosome II) were detected; these genes may be responsible for the virulence of the FORC_022 strain. In addition, various secretion...”
• iTRAQ-based proteomic profiling of Vibrio parahaemolyticus under various culture conditions
  Yang, Proteome science 2015
  • “...as 11 general secretion pathway proteins. Other virulence related proteins such as three hemolysins(GN VP0730, VP2536, VPA0257) and regulator proteins Hfq and rsmA were also significantly identified. Protein quantification and differentiation analysis Proteins with iTRAQ ratios <0.50 or >2.0, p <0.05 were considered significantly different in...”
  • “...significantly differentially expressed in this study. Three hemolysin proteins including putative hemolysins (GN VP0730, GN VP2536) and hemolysin (GN VPA0257) were identified, although TDH production was reported to be affected by environmental factors, such as pH, temperature, and chemicals [ 40 , 41 ], but significant...”

FORC17_0475 DUF21 domain-containing protein from Vibrio vulnificus
Aligns to 10:186 / 425 (41.6%), covers 93.2% of PF01595, 167.1 bits

• Complete genome sequence of Vibrio vulnificus FORC_017 isolated from a patient with a hemorrhagic rash after consuming raw dotted gizzard shad
  Chung, Gut pathogens 2016
  • “...3927), suggesting that FORC_017 is pathogenic. The FORC_017 strain has various hemolysin genes such as FORC17_0475, 1369, 2364, 2546, 2587 and 2903 in chromosome I, and FORC17_3057, 3239 and 4284 in chromosome II. Subsequent cytotoxicity test of the FORC_017 strain supported its pathogenesis activity (Additional file...”

CV0231 probable hemolysin (NCBI) from Chromobacterium violaceum ATCC 12472
Aligns to 4:196 / 436 (44.3%), covers 99.4% of PF01595, 166.6 bits

• The complete genome sequence of Chromobacterium violaceum reveals remarkable and exploitable bacterial adaptability
  Brazilian, Proceedings of the National Academy of Sciences of the United States of America 2003
  • “...lateral transfer. Twelve ORFS encoding hemolysin-like proteins (CV0231, CV0360, CV0362, CV0513, CV0516, CV0656, CV1917, CV1918, CV2873, CV3275, CV3342, and...”
  • “...CV2663) with potential antitumor activity, and hemolysins (CV0231, CV0513, CV1918, CV3342, and CV4301) with potential as anticoagulants. It is established...”

Q9HN02 DUF21/CBS domain protein from Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
Aligns to 28:208 / 457 (39.6%), covers 98.3% of PF01595, 166.2 bits

• OMICS in ecology: systems level analyses of Halobacterium salinarum reveal large-scale temperature-mediated changes and a requirement of CctA for thermotolerance
  Weng, Omics : a journal of integrative biology 2014
  • “...37C and 49C Proteomes* 69 VNG1559H Hlp Q9HPM7 Q9HN02 VNG0683C CoxA2 PdhA2 McmA1 AtpI Q9HRI2 P33518 Q9HN77 Q9HRZ1 Q9HND8 Aldolase activity Cytochrome c oxidase...”

BA_2558 DUF21, Domain of unknown function DUF21 (NCBI) from Bacillus anthracis str. A2012
Aligns to 7:201 / 409 (47.7%), covers 100.0% of PF01595, 166.0 bits

• Bacillithiol: a key protective thiol in Staphylococcus aureus
  Perera, Expert review of anti-infective therapy 2015
  • “...BA_2379 BSU05630 ( dinB ) BA_2379 BSU10860 ( yisT ) BA_2937 BSU13070 ( ykkA ) BA_2558 BSU10800 ( yizA ) BA_4768 BSU26780 ( yrdA ) BSU12410 ( yjoA ) BA_2721 BA_3104 BA_2777 BA_3538 BA_2007 BA_3539 BA_2065 BA_2078 BA_2990 B. subtilis 168 ORF names are in parenthesis....”

HP1490 conserved hypothetical protein (NCBI ptt file) from Helicobacter pylori 26695
Aligns to 19:214 / 449 (43.7%), covers 98.3% of PF01595, 165.7 bits

• Comparative genomics of Helicobacter pylori and the human-derived Helicobacter bizzozeronii CIII-1 strain reveal the molecular basis of the zoonotic nature of non-pylori gastric Helicobacter infections in humans
  Schott, BMC genomics 2011
  • “...Hypothetical protein (putative HcpA) G 10 732,027..732,038 M HBZC1_07730/HBZC1_07740 CBS domains containing protein (homologue of HP1490 - TolC efflux pump) G 15 1,677,616..1,677,630 5' HBZC1_18160 Putative ATP/GTP binding protein G 9 58,965..58,973 5' HBZC1_00570 Massive surface protein (MspC) G 9 640,616..640,624 M HBZC1_06770 Outer membrane protein...”
• A Helicobacter pylori TolC efflux pump confers resistance to metronidazole
  van, Antimicrobial agents and chemotherapy 2005
  • “...H. pylori, only HP1489 is found adjacent to a gene, HP1490, that might encode a substrate for type I secretion. HP1490 encodes a putative protein with a high...”
  • “...membrane efflux protein encoded by HP1489 extrudes the product HP1490, presumably a toxin. Besides type I protein secretion, TolC is also involved in the efflux...”
• Gene expression profiling of Helicobacter pylori reveals a growth-phase-dependent switch in virulence gene expression
  Thompson, Infection and immunity 2003
  • “...HP1400 Unknown function HP0184 HP0719 HP1124 HP1173e HP0318e HP1490 Putative function Second TC Scoreb Fold changec Scoreb Fold changec prfA rpl27 fusA rps7...”
• Helicobacter pylori pore-forming cytolysin orthologue TlyA possesses in vitro hemolytic activity and has a role in colonization of the gastric mucosa
  Martino, Infection and immunity 2001
  • “...presence of at least two distinct hemolysins, HP1086 and HP1490, in this strain. Previous studies have shown that the in vitro hemolytic activity of H. pylori...”
  • “...sequences in the H. pylori 26695 genome, HP1086 and HP1490 (34), though it is probable that H. pylori possesses a number of proteins with hemolytic activity....”
• Metabolism and genetics of Helicobacter pylori: the genome era
  Marais, Microbiology and molecular biology reviews : MMBR 1999 (secret)

lmo2232 similar to unknown proteins (NCBI ptt file) from Listeria monocytogenes EGD-e
Aligns to 8:202 / 434 (44.9%), covers 100.0% of PF01595, 165.0 bits

• Listeria monocytogenes {sigma}B has a small core regulon and a conserved role in virulence but makes differential contributions to stress tolerance across a diverse collection of strains
  Oliver, Applied and environmental microbiology 2010
  • “...lmo2102 lmo2118 lmo2167 lmo2208 lmo2216 lmo2217 lmo2223 lmo2232 lmo2240 lmo2397 lmo2415 lmo2507 lmo2547 lmo2633 lmo2660 lmo2664 lmo2665 lmo2666 lmo2667 lmo2668...”
• Identification of Listeria monocytogenes genes involved in salt and alkaline-pH tolerance
  Gardan, Applied and environmental microbiology 2003
  • “...was inserted into two genes, lmo1443 and lmo2232, respectively, which encode proteins having unknown functions in other organisms. lmo1443 has orthologues...”
  • “...lmo1413-lmo1412 intergenic regiond mdrL (397) lmo2232 (434) lmo1799-lmo1800 intergenic region lmo1432 (216) lmo1139-lmo1140 intergenic region lmo2638-lmo2639...”
• Development and application of an assay for uranyl complexation by fungal metabolites, including siderophores
  Renshaw, Applied and environmental microbiology 2003 (secret)

O05241 UPF0053 protein YugS from Bacillus subtilis (strain 168)
Aligns to 7:201 / 429 (45.5%), covers 100.0% of PF01595, 164.5 bits

• Membrane Proteomes and Ion Transporters in Bacillus anthracis and Bacillus subtilis Dormant and Germinating Spores
  Chen, Journal of bacteriology 2019
  • “...O31656 O07634 O31816 O31816 P38490 P54178 P54481 C0SP90 O05241 O32128 P39668 O34966 B. anthracis Q81ZC5 Q6I447 Q81JZ5 Q81JZ1 Q81JZ4 Q81YT8 Q81LT7 Q81ZB8 Q81VX5...”
  • “...P38490 O07543 O34966 O07634 P24139 P37814 P40868 P37580 O05241 P16450 C0SP90 O32047 P54178 Q796Q1 P54481 P24141 P34957 P36947 O34348 P54598 O05248 P40869 P37810...”

P74409 UPF0053 protein sll0260 from Synechocystis sp. (strain PCC 6803 / Kazusa)
Aligns to 11:203 / 448 (43.1%), covers 99.4% of PF01595, 163.3 bits

• Phenotypic switching in Candida glabrata involves phase-specific regulation of the metallothionein gene MT-II and the newly discovered hemolysin gene HLP
  Lachke, Infection and immunity 2000
  • “...AE001130; S.spp, Synechocystis strain PCC6803, P74409; A.aeo, Aquifex aeolicus, AE000673; H.pyl, Helicobacter pylori, AE000647; S.mut, Streptococcus...”

BA2288 CBS domain protein (NCBI ptt file) from Bacillus anthracis str. Ames
Aligns to 7:201 / 451 (43.2%), covers 99.4% of PF01595, 163.1 bits

• Genome engineering in Bacillus anthracis using Cre recombinase
  Pomerantsev, Infection and immunity 2006
  • “...the onset of sporulation (26). Two other deleted genes (BA2288 and BA2310) encode proteins predicted to be involved in regulating ion fluxes. Based on this...”

EF0700 hemolysin (NCBI ptt file) from Enterococcus faecalis V583
OG1RF_10438 HlyC/CorC family transporter from Enterococcus faecalis OG1RF
Aligns to 16:202 / 459 (40.7%), covers 100.0% of PF01595, 162.5 bits

• Survey of genomic diversity among Enterococcus faecalis strains by microarray-based comparative genomic hybridization
  Aakra, Applied and environmental microbiology 2007
  • “...the cytolysin operon EF0525 to EF0528 (in PAI), EF0700 (coding for hemolysin), EF0799 (coding for autolysin), and EF1992 (coding for endolysin in phage04)....”
• Detailed Soluble Proteome Analyses of a Dairy-Isolated Enterococcus faecalis: A Possible Approach to Assess Food Safety and Potential Probiotic Value
  Cirrincione, Frontiers in nutrition 2019
  • “...the 95 proteins present in D27 and absent in Symb1, are worth mentioning the hemolysin (OG1RF_10438) and the penicillin-binding protein 1B (OG1RF_11450) ( Table S1 ). D27 and Symb1 share 344 extracellular proteins that represent about the 90% of the identified proteins. The Voronoi treemap (...”
  • “...gelatinase enzyme does not support gelatinase activity. Two different types of hemolysins were present: hemolysin (OG1RF_10438) and hemolysin A (OG1RF_10716 ) . D27 expresses both enzymes, whereas both the probiotic and the clinical strains express only one of them. However, the clinical isolate is the only...”

AWC34_RS03405 HlyC/CorC family transporter from Staphylococcus equorum
Aligns to 7:202 / 342 (57.3%), covers 99.4% of PF01595, 162.1 bits

• Genomic insights into the virulence and salt tolerance of Staphylococcus equorum
  Jeong, Scientific reports 2017
  • “.... equorum genomes. Virulence factor Gene locus KM1031 C2014 KS1039 Mu2 UMC-CNS-924 G8HB1 Haemolysis-related Haemolysin AWC34_RS03405 AVJ22_RS03205 SEQMU2_RS08595 SEQU_RS25035 UF72_RS01895 Haemolysin III AWC34_RS09060 AVJ22_RS09420 SE1039_RS09485 SEQMU2_RS01345 SEQU_RS26575 UF72_RS08525 Haemolysin activation protein AWC34_RS11995 AVJ22_RS12370 SE1039_RS12450 SEQMU2_RS04245 SEQU_RS16015 UF72_RS08300 SEQU_RS16020 SEQU_RS16025 Haemolysin family calcium-binding region AVJ22_RS14095 * Antibiotic...”

UF72_RS01895 HlyC/CorC family transporter from Staphylococcus equorum subsp. equorum
Aligns to 7:202 / 342 (57.3%), covers 99.4% of PF01595, 162.1 bits

• Genomic insights into the virulence and salt tolerance of Staphylococcus equorum
  Jeong, Scientific reports 2017
  • “...factor Gene locus KM1031 C2014 KS1039 Mu2 UMC-CNS-924 G8HB1 Haemolysis-related Haemolysin AWC34_RS03405 AVJ22_RS03205 SEQMU2_RS08595 SEQU_RS25035 UF72_RS01895 Haemolysin III AWC34_RS09060 AVJ22_RS09420 SE1039_RS09485 SEQMU2_RS01345 SEQU_RS26575 UF72_RS08525 Haemolysin activation protein AWC34_RS11995 AVJ22_RS12370 SE1039_RS12450 SEQMU2_RS04245 SEQU_RS16015 UF72_RS08300 SEQU_RS16020 SEQU_RS16025 Haemolysin family calcium-binding region AVJ22_RS14095 * Antibiotic resistance Efflux pump Chloramphenicol...”

P54428 UPF0053 protein YrkA from Bacillus subtilis (strain 168)
Aligns to 7:201 / 434 (44.9%), covers 100.0% of PF01595, 162.1 bits

• Bioinformatic analyses of integral membrane transport proteins encoded within the genome of the planctomycetes species, Rhodopirellula baltica
  Paparoditis, Biochimica et biophysica acta 2014
  • “...6 peptides peptide (toxic) Q7UWK8 7 9.A.40 The HlyC/CorC (HCC) Family of Putative Transporters 9.A.40.2.1 P54428 4 cations Fe 2+ Q7UQW5 3 9.A.40.3.4 Q6P4Q7 5 cations metal ion Q7UQM0 3 9.A.47 Tight Adherence (Pilus) Biogenesis Apparatus (TABA) Family 9.A.47.1.1 Q9S4A8 5 proteins proteins (pili, fimbrae) Q7UXS3...”

AVJ22_RS03205 HlyC/CorC family transporter from Staphylococcus equorum
Aligns to 7:202 / 342 (57.3%), covers 99.4% of PF01595, 162.1 bits

• Genomic insights into the virulence and salt tolerance of Staphylococcus equorum
  Jeong, Scientific reports 2017
  • “...equorum genomes. Virulence factor Gene locus KM1031 C2014 KS1039 Mu2 UMC-CNS-924 G8HB1 Haemolysis-related Haemolysin AWC34_RS03405 AVJ22_RS03205 SEQMU2_RS08595 SEQU_RS25035 UF72_RS01895 Haemolysin III AWC34_RS09060 AVJ22_RS09420 SE1039_RS09485 SEQMU2_RS01345 SEQU_RS26575 UF72_RS08525 Haemolysin activation protein AWC34_RS11995 AVJ22_RS12370 SE1039_RS12450 SEQMU2_RS04245 SEQU_RS16015 UF72_RS08300 SEQU_RS16020 SEQU_RS16025 Haemolysin family calcium-binding region AVJ22_RS14095 * Antibiotic resistance...”
  • “...products that cannot induce haemolysis on their own. Based on the SEED subsystem, the genes AVJ22_RS03205 and AVJ22_RS09420 in strain C2014 were classified as encoding magnesium/cobalt efflux protein and the membrane protein haemolysin III, respectively. Thus, we cautiously suggest that the gene AVJ22_RS09420 might be a...”

SEQMU2_RS08595 HlyC/CorC family transporter from Staphylococcus equorum subsp. equorum Mu2
Aligns to 7:202 / 342 (57.3%), covers 99.4% of PF01595, 162.1 bits

• Genomic insights into the virulence and salt tolerance of Staphylococcus equorum
  Jeong, Scientific reports 2017
  • “...genomes. Virulence factor Gene locus KM1031 C2014 KS1039 Mu2 UMC-CNS-924 G8HB1 Haemolysis-related Haemolysin AWC34_RS03405 AVJ22_RS03205 SEQMU2_RS08595 SEQU_RS25035 UF72_RS01895 Haemolysin III AWC34_RS09060 AVJ22_RS09420 SE1039_RS09485 SEQMU2_RS01345 SEQU_RS26575 UF72_RS08525 Haemolysin activation protein AWC34_RS11995 AVJ22_RS12370 SE1039_RS12450 SEQMU2_RS04245 SEQU_RS16015 UF72_RS08300 SEQU_RS16020 SEQU_RS16025 Haemolysin family calcium-binding region AVJ22_RS14095 * Antibiotic resistance Efflux...”

SERP0507 CBS domain protein (NCBI) from Staphylococcus epidermidis RP62A
Aligns to 2:179 / 341 (52.2%), covers 98.9% of PF01595, 161.7 bits

• Toxin Mediates Sepsis Caused by Methicillin-Resistant Staphylococcus epidermidis
  Qin, PLoS pathogens 2017
  • “...CzrA family transcriptional regulator -3.30 -2.32 -1.42 - SERP0273 alpha/beta hydrolase -3.08 -1.73 -1.78 - SERP0507 CBS domain-containing protein -3.06 -1.48 -2.07 - SERP2091 hypothetical protein -2.94 -1.32 -2.22 - SE0735 -2.91 -1.12 -2.60 - SERP1476 hypothetical protein -2.91 -9.68 3.33 - SERP1477 ABC transporter ATP-binding...”

SE_0613 DUF21 domain-containing protein from Staphylococcus epidermidis ATCC 12228
Aligns to 2:179 / 341 (52.2%), covers 98.9% of PF01595, 161.7 bits

• Food-derived coagulase-negative Staphylococcus as starter cultures for fermented foods
  Heo, Food science and biotechnology 2020
  • “...hlb 0 0 0 0 0 0 hld 0 2.6 23.5 0 0 0 3.6 SE_0613 0 0 3.2 0 0 0 SE_1760 0 0 3.2 0 0 0 Enterotoxin genes sea 0 0 0 0 0 0 0 seb 0 0 0 0 0 0...”
  • “...) Jeong et al. ( 2016a ) Blank box indicates an assay was not performed SE_0613 and SE_1760 are the hemolysin- and hemolysin III-encoding genes, respectively, from S. epidermidis ATCC 12228 hylIII, hemolysin III-encoding gene from Bacillus cereus Staphylococcus carnosus does not produce the biogenic amines...”

Eab7_0509 HlyC/CorC family transporter from Exiguobacterium antarcticum B7
Aligns to 31:224 / 461 (42.1%), covers 100.0% of PF01595, 161.6 bits

• Functional annotation of hypothetical proteins from the Exiguobacterium antarcticum strain B7 reveals proteins involved in adaptation to extreme environments, including high arsenic resistance
  da, PloS one 2018
  • “...IPR007621 TPM_phosphatase 13 Eab7_0417 IPR025889 Heat induced stress protein YflT 14 Eab7_0504 IPR002696 Haemolytic 15 Eab7_0509 IPR000644 Cystathionine-beta synthase associated with the CorC_HlyC domain 16 Eab7_0515 IPR016047 Peptidase family M23 17 Eab7_0609 IPR000620 EamA-like transporter Family 18 Eab7_0622 IPR001509 NAD-dependent epimerase/dehydratase 19 Eab7_0636 IPR029348 Nucleotidyltransferase-like 20...”

AWN65_RS11020 HlyC/CorC family transporter from Flavobacterium columnare
Aligns to 4:196 / 427 (45.2%), covers 98.3% of PF01595, 161.4 bits

• The Emerging Fish Pathogen Flavobacterium spartansii Isolated from Chinook Salmon: Comparative Genome Analysis and Molecular Manipulation
  Chen, Frontiers in microbiology 2017
  • “...al., 2013 ). In F. columnare strain 94-081, disruption of one of the hemolysin genes (AWN65_RS11020) decreased fish mortality 15%, indicating that it contributes to virulence (Kumru et al., 2017 ). Moreover, this observation also showed that additional hemolysin(s) may be necessary to have full virulence...”
• Comparative Analysis of the Flavobacterium columnare Genomovar I and II Genomes
  Kumru, Frontiers in microbiology 2017
  • “...94-081. Mutants Transposon end Locus tag Gene ID FcMut01 F AWN65_RS03755 Chalcone isomerase FcMut02 R AWN65_RS11020 Hemolysin FcMut03 F AWN65_RS03750 Anhydro- N -acetylmuramic acid kinase (AnmK) FcMut04 R AWN65_RS11110 Glycine cleavage system protein P (GcvP) FcMut05 R AWN65_RS03940 Transcriptional regulator TetR FcMut06 R AWN65_RS04445 Peptidoglycan-binding protein...”

TTHA0734 hemolysin-related protein (NCBI) from Thermus thermophilus HB8
Aligns to 33:209 / 445 (39.8%), covers 99.4% of PF01595, 161.4 bits

• Identification of Preferred DNA-Binding Sites for the Thermus thermophilus Transcriptional Regulator SbtR by the Combinatorial Approach REPSA
  Van, PloS one 2016
  • “...ATACTGACCGGTCA 45 Y TTHA1606 700149 700162 8.79e-06 1 TGACTAAATAGTTG 24 Y TTHA0733 CAACTATTTAGTCA 123 ~ TTHA0734 1264565 1264578 1.13e-05 1 TGACCTCTTGGTCA +177 N TTHA1325 10108 10121 1.26e-05 1 TGACTTTAGGGTCA +868 N TTHAr01 351149 351162 1.26e-05 1 TGACCCTAAAGTCA +868 N TTHAr05 669059 669072 1.26e-05 1 TGACCAGTTGCTCA 21...”
  • “...two promoters that did not demonstrate an obvious role for SbtR regulation (genes TTHA1330 and TTHA0734 ) may still be regulated in some fashion by this protein. 10.1371/journal.pone.0159408.g011 Fig 11 Bioinformatic identification of T . thermophilus HB8 promoters potentially regulated by SbtR. Shown are sequences +/-...”

BFF93_RS14485 HlyC/CorC family transporter from Elizabethkingia meningoseptica
Aligns to 10:205 / 452 (43.4%), covers 99.4% of PF01595, 161.3 bits

• Insights from the draft genome into the pathogenicity of a clinical isolate of Elizabethkingia meningoseptica Em3
  Chen, Standards in genomic sciences 2017
  • “...genome, we found that there was a gene encoding the hemolysin with a CBS domain (BFF93_RS14485). Hemolysin can be possibly secreted and involved in lysis of the erythrocytes [ 35 ]. The predicted amino acid sequence was conserved in most 10.1601/nm.9258 strains (> 90%). Further examination...”

A21D_01697 DUF21 domain-containing protein from Virgibacillus dokdonensis
Aligns to 3:179 / 416 (42.5%), covers 100.0% of PF01595, 160.9 bits

• Phenomics and Genomics Reveal Adaptation of Virgibacillus dokdonensis Strain 21D to Its Origin of Isolation, the Seawater-Brine Interface of the Mediterranean Sea Deep Hypersaline Anoxic Basin Discovery
  Zeaiter, Frontiers in microbiology 2019
  • “...at high MgCl 2 concentrations, the presence of magnesium transporters was investigated and four CDS (A21D_01697, A21D_01947, A21D_02760, and A21D_02928) were unveiled from the genome annotation. The first two CDS encode for CorC protein, whereas the other CDS encode for MgtE transporters. Taking advantage of RAST...”

A21D_01947 HlyC/CorC family transporter from Virgibacillus dokdonensis
Aligns to 8:201 / 445 (43.6%), covers 98.9% of PF01595, 160.8 bits

• Phenomics and Genomics Reveal Adaptation of Virgibacillus dokdonensis Strain 21D to Its Origin of Isolation, the Seawater-Brine Interface of the Mediterranean Sea Deep Hypersaline Anoxic Basin Discovery
  Zeaiter, Frontiers in microbiology 2019
  • “...high MgCl 2 concentrations, the presence of magnesium transporters was investigated and four CDS (A21D_01697, A21D_01947, A21D_02760, and A21D_02928) were unveiled from the genome annotation. The first two CDS encode for CorC protein, whereas the other CDS encode for MgtE transporters. Taking advantage of RAST function-based...”

XAC1709 hemolysin (NCBI ptt file) from Xanthomonas axonopodis pv. citri str. 306
Aligns to 5:207 / 446 (45.5%), covers 100.0% of PF01595, 160.2 bits

• Analyses of Seven New Genomes of Xanthomonas citri pv. aurantifolii Strains, Causative Agents of Citrus Canker B and C, Show a Reduced Repertoire of Pathogenicity-Related Genes
  Fonseca, Frontiers in microbiology 2019
  • “...XAC4303 and XAC1668 (cryptic hemolysin transcriptional regulator), XAC3043 and XAC0079 (hemolysin III, hly 3), and XAC1709 (hemolysin, tlyC ). However, in XauB and XauC strains we did not find orthologs for the genes XAC1814 (outer membrane hemolysin activator protein) and XAC1918 (hemolysin-like protein). Analysis of possible...”

BP951000_2207 HlyC/CorC family transporter from Brachyspira pilosicoli 95/1000
Aligns to 3:195 / 423 (45.6%), covers 99.4% of PF01595, 160.1 bits

• The complete genome sequence of the pathogenic intestinal spirochete Brachyspira pilosicoli and comparison with other Brachyspira genomes
  Wanchanthuek, PloS one 2010
  • “...and putative channel protein hemolysin III family protein (BP951000_0888). The eighth was a putative hemolysin (BP951000_2207) that was similar to a protein of Parabacteroides distasonis ATCC 8503, with 42.9% protein identity. B. pilosicoli lacked a gene with similarity to that encoding the new putative hemolysin of...”

SP_1963 CBS domain-containing protein (RefSeq) from Streptococcus pneumoniae TIGR4
Aligns to 14:203 / 443 (42.9%), covers 97.7% of PF01595, 159.7 bits

• Identification of Pneumococcal Factors Affecting Pneumococcal Shedding Shows that the dlt Locus Promotes Inflammation and Transmission
  Zafar, mBio 2019
  • “...compound-binding protein Lipoprotein component of iron ABC transport Piu system ( 88 , 89 ) SP_1963 0.036813 Putative hemolysin CBS domain-containing protein with homology to putative cytolysin proteins ( 64 ) SP_1964 0.033659 endA ; DNA entry nuclease Surface endonuclease that degrades the DNA scaffold of...”
  • “...to date we have validated the effects of two other hits listed in Table1 , SP_1963 (annotated as a putative hemolysin) and SP_1964 (endonuclease; endA ). Pneumococci carrying both were confirmed to have a defect in shedding, but they did not impact colonization density. Prior studies...”

WP_016902067 HlyC/CorC family transporter from Xanthomonas arboricola pv. juglandis
Aligns to 5:207 / 446 (45.5%), covers 100.0% of PF01595, 159.3 bits

• Draft Genome Sequence of Xanthomonas arboricola pv. juglandis J303, Isolated from Infected Walnut Trees in Southern Chile
  Retamales, Genome announcements 2017
  • “...the cytoplasmic copper homeostasis protein (CutC) (WP_016904876), and the magnesium and cobalt efflux protein (CorC) (WP_016902067) were present in X.arboricola pv. juglandis J303, suggesting that this strain, like others previously isolated in other locations, has acquired copper resistance. This correlates with the inefficacy of copper-based agrochemicals...”

BHWA1_00962 putative hemolysin (RefSeq) from Brachyspira hyodysenteriae WA1
BHWA1_RS04705 HlyC/CorC family transporter from Brachyspira hyodysenteriae WA1
Aligns to 4:195 / 432 (44.4%), covers 98.9% of PF01595, 159.0 bits

• The complete genome sequence of the pathogenic intestinal spirochete Brachyspira pilosicoli and comparison with other Brachyspira genomes
  Wanchanthuek, PloS one 2010
  • “...the genome of B. hyodysenteriae WA1 [15] , an additional putative hemolysin gene was identified (BHWA1_00962). Only single copies of tlyA , tlyB , tlyC , and acpP (also known as hlyA [73] ) were identified in the partial genome of B. murdochii . On the...”
  • “...lacked a gene with similarity to that encoding the new putative hemolysin of B. hyodysenteriae (BHWA1_00962). From this, it is possible that the new putative hemolysin identified in B. hyodysenteriae is responsible for its strongly hemolytic phenotype. Alternatively, it has been suggested that differences between B....”
• Differential expression of hemolysin genes in weakly and strongly hemolytic Brachyspira hyodysenteriae strains
  Joerling, BMC veterinary research 2020
  • “...[ 27 , 28 ]. Due to the lack of the putative hemolysin gene ( BHWA1_RS04705 ) in the weakly hemolytic strain B. pilosicoli 95/1000 compared with shBh strain WA1, Wanchanthuek et al. (2010) concluded that this factor might contribute to strong hemolysis [ 21 ]....”
  • “...increased by 100% in the shBh B204. During the lag phase the hemolysin gene ( BHWA1_RS04705 ) was initially upregulated 22-fold in B204 compared with G423 ( p -value <0.001). At the second time point hemolysin gene transcription was 6-fold higher in B204 compared with G423....”
• Phylogenetic diversity, antimicrobial susceptibility and virulence gene profiles of Brachyspira hyodysenteriae isolates from pigs in Germany
  Joerling, PloS one 2018
  • “...for hemolysins ( tlyA , tlyB , tlyC , hlyA , BHWA1_RS02885 , BHWA1_RS09085 , BHWA1_RS04705 , and BHWA1_RS02195 ), outer membrane proteins (OMPs) ( bhlp16 , bhlp17 . 6 , bhlp29 . 7 , bhmp39f , and bhmp39h ) as well as iron acquisition factors...”
  • “...all eight B . hyodysenteriae hemolysin genes tlyA , tlyB , tlyC , hlyA , BHWA1_RS04705 , BHWA1_RS09085 , BHWA1_RS02195 , and BHWA1_RS02885 [ 34 , 35 , 36 , 37 , 38 ]. One PCR reaction mix (30 l total volume) contained 1 x NH...”

SPy0378 putative hemolysin (NCBI ptt file) from Streptococcus pyogenes M1 GAS
Aligns to 14:203 / 444 (42.8%), covers 99.4% of PF01595, 158.9 bits

• Global differential gene expression in response to growth temperature alteration in group A Streptococcus
  Smoot, Proceedings of the National Academy of Sciences of the United States of America 2001
  • “...of genes encoding inferred hemolysins (Spy0167, Spy1497, Spy0378, Spy0370, and Spy0738) was up-regulated at 40C relative to 37C. TaqMan assays showed...”
  • “...40C relative to 37C (Fig. 5). Transcription of spy0378, spy0370, and spy0738 was not influenced by growth temperature, suggesting that spy0167 and spy1497 may...”

Q87DZ3 Hemolysin from Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Aligns to 14:206 / 448 (43.1%), covers 100.0% of PF01595, 158.9 bits

• Structure-based functional annotation of putative conserved proteins having lyase activity from Haemophilus influenzae.
  Shahbaaz, 3 Biotech 2015
  • “...Q7VKS4 show three metal binding sites at residues Asp, Thr and Glu. (B). P44717 and Q87DZ3 displaying metal binding sites at Asp residues. (C). P44717 and Q8EDE1 presenting AMP binding site at Val residue (corresponding sites are shown in black boxes). Figure S3 : The corresponding...”

lmo2738 conserved hypothetical protein similar to hypothetical hemolysin (NCBI ptt file) from Listeria monocytogenes EGD-e
Aligns to 15:204 / 444 (42.8%), covers 100.0% of PF01595, 158.8 bits

• The transcriptional response of Listeria monocytogenes during adaptation to growth on lactate and diacetate includes synergistic changes that increase fermentative acetoin production
  Stasiewicz, Applied and environmental microbiology 2011
  • “...(lmo1171 adhE) Hemolysin genes (lmo0202 hly, lmo2738), pyruvate dehydrogenase repressor gene (lmo0948), transcriptional regulator genes (H7858_1021.1 and...”

EFAU085_01000 HlyC/CorC family transporter from Enterococcus faecium Aus0085
Aligns to 15:201 / 458 (40.8%), covers 99.4% of PF01595, 158.6 bits

• Comparative analysis of the complete genome of an epidemic hospital sequence type 203 clone of vancomycin-resistant Enterococcus faecium
  Lam, BMC genomics 2013
  • “...in Aus0004 were also present in Aus0085. While the sequences of the genes encoding hemolysin (EFAU085_01000) and collagen-binding adhesin ( acm ; EFAU085_02356) were nearly identical to the corresponding genes in Aus0004 (99-100% identity). The enterococcal surface protein ( esp ) encodes a 1733 aa protein...”

HI0107 conserved hypothetical protein (NCBI ptt file) from Haemophilus influenzae Rd KW20
Aligns to 1:171 / 403 (42.4%), covers 91.5% of PF01595, 158.5 bits

• Serum resistance in Haemophilus ducreyi requires outer membrane protein DsrA
  Elkins, Infection and immunity 2000
  • “...opposite orientation was an ORF with homology to hypothetical protein HI0107 of the genome sequence of H. influenzae. The GC content of the 1 kb of DNA sequence...”

SPD_1761 CBS domain membrane protein (NCBI) from Streptococcus pneumoniae D39
Aligns to 14:203 / 443 (42.9%), covers 97.7% of PF01595, 158.4 bits

• Redefining the Small Regulatory RNA Transcriptome in Streptococcus pneumoniae Serotype 2 Strain D39
  Sinha, Journal of bacteriology 2019
  • “...spd_1707 dinF, lytA spd_1756, ndk spd_1760, rpoB spd_1761, spd_1760 cbf-1, purR Spd_sr99b Spd_sr100b 1802263-1802409 () spd_1817, rrsC 1804114-1804220 () pbp2A,...”

SDEG_0427 putative hemolysin (RefSeq) from Streptococcus dysgalactiae subsp. equisimilis GGS_124
Aligns to 13:203 / 444 (43.0%), covers 98.9% of PF01595, 158.0 bits

• Complete genome sequencing and analysis of a Lancefield group G Streptococcus dysgalactiae subsp. equisimilis strain causing streptococcal toxic shock syndrome (STSS)
  Shimomura, BMC genomics 2011
  • “...are not conserved in GGS_124. (i). Pore-forming toxins GGS_124 has several putative hemolysins, including HlyX (SDEG_0427), HlyIII (SDEG_1015), and HlyA1 (SDEG_1483), which have also been detected in GAS, SESZ, SESE, S. uberis , and GBS. GGS_124 also has genes encoding streptolysin S ( sagA ) (SDEG_0705)...”

LIC13143 hemolysin (NCBI) from Leptospira interrogans serovar Copenhageni str. Fiocruz L1-130
Aligns to 7:202 / 444 (44.1%), covers 100.0% of PF01595, 157.8 bits

• Catecholamine-Modulated Novel Surface-Exposed Adhesin LIC20035 of Leptospira spp. Binds Host Extracellular Matrix Components and Is Recognized by the Host during Infection
  Ghosh, Applied and environmental microbiology 2018
  • “...r-LIC20035 for collagen was 352 near to that of LIC13143 (TlyC) (8) but higher than LIC11352 (LipL32) (27). Additionally, r- 353 LIC20035 binding to chondroitin...”
• Comparative and functional genomic analyses of iron transport and regulation in Leptospira spp
  Louvel, Journal of bacteriology 2006
  • “...pyogenes Q8K8F0 LEPBIa0082 LEPBIa0717 LA0327 LA3937 LIC10284 LIC13143 e-51 (48) e-148 (58) Hemolysin A Hemolytic protein-like protein LEPBIa2015 LA1650 LIC12134...”
• Genome features of Leptospira interrogans serovar Copenhageni
  Nascimento, Brazilian journal of medical and biological research = Revista brasileira de pesquisas medicas e biologicas 2004
  • “...tlyABC class (LIC10284, LIC10339, LIC11814, LIC12017, and LIC13143) were identified in the L. interrogans genome. NIH-PA Author Manuscript LIC12134 codes for...”

SAB0786 probable hemolysin (NCBI) from Staphylococcus aureus RF122
Aligns to 3:179 / 346 (51.2%), covers 98.9% of PF01595, 157.8 bits

• Alternative Sigma Factor B in Bovine Mastitis-Causing Staphylococcus aureus: Characterization of Its Role in Biofilm Formation, Resistance to Hydrogen Peroxide Stress, Regulon Members
  Supa-Amornkul, Frontiers in microbiology 2019
  • “...for expression of methicillin resistance + Not reported femB Methicillin resistance factor protein + N SAB0786 Hemolysin + Not reported hla -Hemolysin precursor seg Enterotoxin G + Not reported sen Enterotoxin N + Not reported sec-variant Enterotoxin type C variant + Not reported coa Coagulase N...”

SSU05_1668 Hemolysins and related proteins containing CBS domains (RefSeq) from Streptococcus suis 05ZYH33
AN924_RS07935 HlyC/CorC family transporter from Streptococcus suis
Aligns to 13:203 / 445 (42.9%), covers 99.4% of PF01595, 157.2 bits

• Genome-wide analysis of an avirulent strain that induces protective immunity against challenge with virulent Streptococcus suis serotype 2
  Wang, BMC microbiology 2017
  • “...ef ) - SSU05_0177 - SSU05_0178 Exotoxins Hemolysin III homolog PSN_CDS02424 SSU05_0994 Putative hemolysin PSN_CDS01385 SSU05_1668 PSN_CDS01413 SSU05_1653 Suilysin - SSU05_1403 Siderophores ABC-type Fe 3+ siderphore transport system Permease component PSN_CDS03427 SSU05_0646 PSN_CDS03424 SSU05_0647 ATPase domain PSN_CDS02486 SSU05_1031 ATPase component PSN_CDS03419 SSU05_0650 Miscellaneous Tetracyline resistance protein...”
• The bacteriocin from the prophylactic candidate Streptococcus suis 90-1330 is widely distributed across S. suis isolates and appears encoded in an integrative and conjugative element
  Sun, PloS one 2019
  • “...of a gene coding for a TlyC-like (CDD E -value 1e-130) hemolysin C family transporter (AN924_RS07935) potentially involved in virulence ( S9 Table ). These searches also returned a putative match with a cytolysin activator ( cylA ; E -value: 8.00E-31) but not for a cytolysin,...”

SAR0882 putative membrane protein (NCBI) from Staphylococcus aureus subsp. aureus MRSA252
SA0780 hypothetical protein (NCBI) from Staphylococcus aureus subsp. aureus N315
SAV0919 hemolysin (NCBI) from Staphylococcus aureus subsp. aureus Mu50
Aligns to 3:179 / 346 (51.2%), covers 98.9% of PF01595, 157.2 bits

• The Staphylococcus aureus response to unsaturated long chain free fatty acids: survival mechanisms and virulence implications
  Kenny, PloS one 2009
  • “...hypothetical protein 2.34 3.01E-02 SAR0879 NifU-like protein 2.06 3.39E-02 SAR0880 conserved hypothetical protein 2.14 3.47E-03 SAR0882 putative membrane protein 4.05 4.12E-03 SAR0931 putative membrane protein 7.87 4.28E-04 SAR1055 hypothetical protein 4.50 3.08E-03 SAR1077 putative membrane protein 2.54 5.69E-03 SAR1227 conserved hypothetical protein 2.11 1.71E-02 SAR1258 putative...”
• Genetic screens reveal novel major and minor players in magnesium homeostasis of Staphylococcus aureus
  Trachsel, PLoS genetics 2019
  • “...a novel element involved in magnesium homeostasis, mpfA (Magnesium Protection Factor ASA0657) and its paralog SA0780. We identified MpfA in a genetic screen for mutations suppressing the slow growth on defined medium of a DEAD-box helicase mutant (CshB) [ 39 ]. Indeed, in that particular mutant,...”
  • “...and increasing amount of MgCl 2 . Plates were incubated for 24h at 37C. MpfB (SA0780), an auxiliary magnesium export protein The S . aureus genome encodes an MpfA paralog, SA0780 that we suggest to name MpfB. This protein shares a similar domain architecture to MpfA...”
• An Essential Factor for High Mg2+ Tolerance of Staphylococcus aureus
  Armitano, Frontiers in microbiology 2016
  • “...two corA -like genes (SA2137 and SA2166), and two homologs of Salmonella corB (SA0657 and SA0780), none of which have been studied. Staphylococcus aureus is a gram-positive opportunistic pathogen that is present in the nasal cavities of approximately 1/3 of the population ( Kuehnert et al.,...”
  • “...cobalt resistance screen by Gibson et al. (1991) . The S. aureus genome additionally encodes SA0780, a paralog to SA0657 that is 103 residues shorter ( Figure 5 and Supplementary Figure S7 ). To get a better grasp of the evolution and the distribution of SA0657...”
• The Genera Staphylococcus and Macrococcus
  Dworkin, The ProkaryotesVolume 4: Bacteria: Firmicutes, Cyanobacteria 2006
  • “...SaPIn3/SaPIm3 Possible leukocidin SA1813 lukM Unknown - Possible hemolysin SA0657 None Unknown 89 Possible hemolysin SA0780 None Unknown 82 Similar to exotoxin 1 SA1009 None Unknown 55 Possible hemolysin SA1812 None Unknown - Similar to hemolysin III SA1973 None Unknown 75 Possible exotoxins SA0357 None Unknown...”
• Staphylococcus aureus in vitro secretion of alpha toxin (hla) correlates with the affiliation to clonal complexes
  Monecke, PloS one 2014
  • “...additional genes that are assumed to encode for additional haemolysins (such as BA000017.4: locus tag SAV0919; base positions 962,930 to 963,970 or CP000046.1: locus tag SACOL2160; base positions 2,239,231 to 2,239,914). The alpha toxin (also known as haemolysin alpha) is encoded by the hla gene (BA000018.3:...”
• Staphylococcus aureus virulence expression is impaired by Lactococcus lactis in mixed cultures
  Even, Applied and environmental microbiology 2009
  • “...0.5 0.6 1.8 0.9 2.2 1.6 Hemolysin genes SAV2035 SAV0919 SAV2170 MW1959 MW0802 MW2096 hld/RNAIII Delta-hemolysin Hemolysin Hemolysin III 1.6 0.4 1.4 1.8 0.5 2.0...”
• Insights on evolution of virulence and resistance from the complete genome analysis of an early methicillin-resistant Staphylococcus aureus strain and a biofilm-producing methicillin-resistant Staphylococcus epidermidis strain
  Gill, Journal of bacteriology 2005
  • “...nuc SA0860 SA1264 lytN SA1281 SA0833 clpP SAV2170 SAV0919 SAV2202 SAV1324 SAV0815 SAV1247 SAV1262 SAV0768 hysA nuc lytN clpP SA1973 SA0780d SA2003 hysA SA1160...”

MW0802 ORFID:MW0802~hypothetical protein, similar to hemolysin (NCBI ptt file) from Staphylococcus aureus subsp. aureus MW2
Aligns to 3:179 / 346 (51.2%), covers 98.9% of PF01595, 157.2 bits

• Staphylococcus aureus virulence expression is impaired by Lactococcus lactis in mixed cultures
  Even, Applied and environmental microbiology 2009
  • “...of California, Berkeley MW0051 MW0084 MW0124 MW0759 MW0760 MW0802 MW1044 MW1362 MW1889 MW1937 MW1938 MW1959 MW1963 MW2108 MW2469 Gene name(s) EVEN ET AL. 1.E+10...”
  • “...0.9 2.2 1.6 Hemolysin genes SAV2035 SAV0919 SAV2170 MW1959 MW0802 MW2096 hld/RNAIII Delta-hemolysin Hemolysin Hemolysin III 1.6 0.4 1.4 1.8 0.5 2.0 20.0 0.3 1.5...”

SACOL0921 CBS domain protein (NCBI) from Staphylococcus aureus subsp. aureus COL
Aligns to 3:179 / 346 (51.2%), covers 98.9% of PF01595, 157.1 bits

• The second messenger c-di-AMP inhibits the osmolyte uptake system OpuC in Staphylococcus aureus
  Schuster, Science signaling 2016
  • “...encode the inosine-5 monophosphate dehydrogenase GuaB (SACOL0460), two membrane proteins with unknown functions (SACOL0762 and SACOL0921), the magnesium transporter MgtE (SACOL1013), the transcription factor CcpN (SACOL1621), and a multi-domain cytoplasmic protein of unknown function (SACOL1752). Sequence alignments comparing the CBS domains of OpuCA with the CBS...”
  • “...). E. coli strains producing a His-MBP fusion to four of these proteins [SACOL0460 (GuaB), SACOL0921, SACOL1013 (MgtE), and SACOL1621 (CcpN)] were present in the S. aureus ORFeome library, however none of these fusion proteins interacted with c-di-AMP in the initial screen. To confirm the absence...”
• Prevalence of clonal complexes and virulence genes among commensal and invasive Staphylococcus aureus isolates in Sweden
  Rasmussen, PloS one 2013
  • “...Transferrin binding protein 46 (100) 88 (100) 1 1 Fishers exact test 2 Locus tag SACOL0921, GenBank CP000046.1: Position 927776-928816 3 Locus tag SACOL2160, GenBank CP000046.1: Position 2239231-2239914 4 Locus tag SACOL2004, GenBank CP000046.1: Position 2064956-2065972, Locus tag SACOL2006, GenBank CP000046.1: Position 2065994-2067049 5 Also known...”
• Differentiation of clonal complex 59 community-associated methicillin-resistant Staphylococcus aureus in Western Australia
  Coombs, Antimicrobial agents and chemotherapy 2010
  • “...the hl (GenBank accession no. CP000046.1, locus tag SACOL0921), hla, hld, and hlIII hemolysin genes. Three out of five probes for betahemolysin yielded signals,...”
• The fusidic acid stimulon of Staphylococcus aureus
  Delgado, The Journal of antimicrobial chemotherapy 2008
  • “...SACOL0303 SACOL1419 SACOL1005 SACOL1777 SACOL0851 SACOL0921 SACOL1034 SACOL1074 SACOL2461 SACOL0225 SACOL2579 SACOL0922 SACOL2462 SACOL2241 SACOL1115 SACOL0688...”

WP_036162133 HlyC/CorC family transporter from Bacillus thuringiensis
Aligns to 8:202 / 446 (43.7%), covers 99.4% of PF01595, 156.8 bits

• A genome-scale metabolic reconstruction of Lysinibacillus sphaericus unveils unexploited biotechnological potentials
  Gómez-Garzón, PloS one 2017
  • “.../ Alveolysin WP_031416422 Hemolysins Hemolysin XhlA WP_051563194 Hemolysin A (TlyA) WP_012295056 * Hemolysin C (TlyC) WP_036162133 * Chitin Metabolism Chitin binding protein WP_036162780 Chitin deacetylase WP_031419289 Chitin deacetylase WP_012292324 Beta-hexosaminidase WP_012294072 We also identified a set of hemolysin-encoding genes, which includes hemolysin A, C, D and...”

QR90_RS03530 HlyC/CorC family transporter from Deinococcus swuensis
Aligns to 7:202 / 446 (43.9%), covers 99.4% of PF01595, 156.5 bits

• Computational search for UV radiation resistance strategies in Deinococcus swuensis isolated from Paramo ecosystems
  Díaz-Riaño, PloS one 2019
  • “...103.97 49.97 0.66 0.82 1.06 GTP-binding protein QR90_RS15620 54.06 26.16 0.78 0.83 1.05 Hypothetical protein QR90_RS03530 144.65 70 0.84 0.82 1.05 Hemolysin QR90_RS09365 21 10.33 0.68 0.82 1.02 ABC ATP-binding protein QR90_RS01280 253.16 124.44 0.74 0.8 1.02 Bifunctional pyr operon 1 Only CDS with probability value...”

SSA_1761 Hemolysin (containing CBS domains), putative (NCBI) from Streptococcus sanguinis SK36
Aligns to 14:203 / 446 (42.6%), covers 98.3% of PF01595, 156.1 bits

• Association of Novel Streptococcus sanguinis Virulence Factors With Pathogenesis in a Native Valve Infective Endocarditis Model
  Martini, Frontiers in microbiology 2020
  • “...with the twin-arginine translocation (TAT) pathway; a predicted hemolysin ( hlyX ) is encoded by SSA_1761 ; and SSA_2230 encodes the anaerobic ribonucleoside triphosphate reductase, nrdD . FIGURE 2 S. sanguinis mutants with a deficiency in human platelet binding. Adherence of purified platelets to immobilized bacteria....”

LMRG_01849 hypothetical protein (RefSeq) from Listeria monocytogenes 10403S
Aligns to 7:200 / 436 (44.5%), covers 99.4% of PF01595, 155.6 bits

• PrfA-like transcription factor gene lmo0753 contributes to L-rhamnose utilization in Listeria monocytogenes strains associated with human food-borne infections
  Salazar, Applied and environmental microbiology 2013
  • “...LMRG_01236 LMRG_00278 LMRG_01602 LMRG_00472 LMRG_01574 LMRG_02611 LMRG_01103 LMRG_01849 Fold change 23.5 20.3 16.2 15.0 13.4 12.6 10.6 10.5 10.3 9.6 9.0...”

lmo2399 similar to conserved hypothetical proteins (NCBI ptt file) from Listeria monocytogenes EGD-e
Aligns to 7:200 / 436 (44.5%), covers 99.4% of PF01595, 155.6 bits

• Listeria monocytogenes {sigma}B has a small core regulon and a conserved role in virulence but makes differential contributions to stress tolerance across a diverse collection of strains
  Oliver, Applied and environmental microbiology 2010
  • “...lmo2196 lmo2230 lmo2231 lmo2368 lmo2386 lmo2387 lmo2389 lmo2399 lmo2437 lmo2465 lmo2511 lmo2520 lmo2522 lmo2534 lmo2536 lmo2568 lmo2611 lmo2638 lmo2670 lmo2695...”
• Comparative analysis of the sigma B-dependent stress responses in Listeria monocytogenes and Listeria innocua strains exposed to selected stress conditions
  Raengpradub, Applied and environmental microbiology 2008
  • “...by the present study (lmo0524, lmo1539, lmo2389, lmo2399, pdhA, and qoxA) had statistically significant differences (adjusted P 0.05) in transcript levels...”
• Listeria monocytogenes sigma B regulates stress response and virulence functions
  Kazmierczak, Journal of bacteriology 2003
  • “...stressed cells (0.5 M KCl). lmo0438 lmo0994 lmo2399 lmo2386 lmo2673 lmo1580 lmo0794 lmo2269 lmo0911 lmo1606 DNA translocase lmo2511 qoxA lmo2389 lmo0880...”
• Identification of Listeria monocytogenes genes involved in salt and alkaline-pH tolerance
  Gardan, Applied and environmental microbiology 2003
  • “...in different grampositive bacteria, and lmo2232 has a paralogue (lmo2399) and five orthologues in B. subtilis yhdP, yrkA, yqhB, yugS, and yhdT and in other...”

EMQU_0948 HlyC/CorC family transporter from Enterococcus mundtii QU 25
Aligns to 14:201 / 458 (41.0%), covers 99.4% of PF01595, 155.5 bits

• Complete genome sequence of Enterococcus mundtii QU 25, an efficient L-(+)-lactic acid-producing bacterium
  Shiwa, DNA research : an international journal for rapid publication of reports on genes and genomes 2014
  • “...Four putative haemolysin genes (haemolysin, haemolysin III, haemolysin A, and -haemolysin) were identified (EMQU_0190 and EMQU_0948, EMQU_0449, EMQU_0841, and EMQU_1982, respectively). We tested haemolysin activity and no changes to the blood agar in the vicinity of the colonies were observed (data not shown), suggesting that these...”

NCgl1392 HlyC/CorC family transporter from Corynebacterium glutamicum ATCC 13032
cg1639 CBS domain-containing protein (RefSeq) from Corynebacterium glutamicum ATCC 13032
Aligns to 8:202 / 354 (55.1%), covers 100.0% of PF01595, 154.6 bits

• High-throughput screening of a Corynebacterium glutamicum mutant library on genomic and metabolic level
  Reimer, PloS one 2014
  • “...II + 3.5.4.25 0.94 40 + + P21D2 3119587 intergenic 0.98 81 + P21E9 1525622 NCgl1392 Hypothetical protein + 0.98 99 + P21G4 2867647 NCgl2603 Cell division protein 0.98 87 + P21G11 199693 NCgl0181 Glutamate synthase large subunit + 1.4.1.13 0.98 119 + Analysis of Single...”
• The alternative sigma factor SigB of Corynebacterium glutamicum modulates global gene expression during transition from exponential growth to stationary phase
  Larisch, BMC genomics 2007
  • “...porin precursor -1.25 cg1109 porB anion-specific porin precursor -1.84 cg1349 membrane protein, CBS domain -1.79 cg1639 membrane protein, CBS domain -1.23 cg1640 membrane protein, CBS domain -1.52 cg2467 ABC-transporter ATP-binding protein -1.33 cg2468 ABC-transporter permease component -1.26 cg2511 putative membrane protein -1.80 cg3175 membrane protein -1.36...”

Sinf_1513 HlyC/CorC family transporter from Streptococcus infantarius subsp. infantarius CJ18
Aligns to 12:202 / 443 (43.1%), covers 98.9% of PF01595, 154.1 bits

• Comparative genomics of the dairy isolate Streptococcus macedonicus ACA-DC 198 against related members of the Streptococcus bovis/Streptococcus equinus complex
  Papadimitriou, BMC genomics 2014
  • “...]. Three hemolysins are conserved among the SBSEC members (Table 5 ). Sequence analysis of Sinf_1513 and Sinf_1683, also annotated as hemolysin genes, was not supportive of a hemolysin protein product (data not shown). Apart from hemolysins, a putative exfoliative toxin B (Sinf_0933) and a macrophage...”

LLKF_2026 magnesium and cobalt efflux protein (RefSeq) from Lactococcus lactis subsp. lactis KF147
L84992 transport protein (NCBI ptt file) from Lactococcus lactis subsp. lactis Il1403
Aligns to 6:200 / 430 (45.3%), covers 100.0% of PF01595, 153.9 bits

• Genome-scale diversity and niche adaptation analysis of Lactococcus lactis by comparative genome hybridization using multi-strain arrays
  Siezen, Microbial biotechnology 2011
  • “...LLKF_1861 yrfD Agmatine/putrescine antiporter LLKF_1862 pctA Putrescine carbamoyltransferase (EC 2.1.3.6) LLKF_1863 Transcriptional regulator, LuxR family LLKF_2026 corC Magnesium and cobalt efflux protein LLKF_2027 pacB Penicillin acylase (EC 3.5.1.11) LLKF_2028 ytaD Proteintyrosine phosphatase (EC 3.1.3.48) LLKF_2164 lacZ Betagalactosidase (EC 3.2.1.23) LLKF_2165 thgA Galactoside O acetyltransferase (EC 2.3.1.18)...”
• Strain-Dependent Transcriptome Signatures for Robustness in Lactococcus lactis
  Dijkstra, PloS one 2016
  • “...ybiK hypothetical protein positive 8.4 L109527 rsuA ribosomal small subunit pseudouridine synthase A negative 0.8 L84992 ytaB YtaB positive 2.9 L0165 ribA 3,4-dihydroxy-2-butanone 4-phosphate synthase positive 0.2 L4822 ptsK HPr kinase/phosphorylase positive 5.9 L196779 yfjD tRNA/rRNA methyltransferase negative 1.7 L180241 mycA myosin-cross-reactive antigen positive 5.4 L7798...”

SO1354 hemolysin protein, putative (NCBI ptt file) from Shewanella oneidensis MR-1
Aligns to 10:186 / 423 (41.8%), covers 93.8% of PF01595, 153.7 bits

• Comparative analysis of differentially expressed genes in Shewanella oneidensis MR-1 following exposure to UVC, UVB, and UVA radiation
  Qiu, Journal of bacteriology 2005
  • “...also contains a gene encoding a putative hemolysin (SO1354). Hemolysin can bind to and lyse mammalian cell membranes and, at low concentrations, perturb cell...”
  • “...secretion protein involved in secretion of toxin; and SO1354 (2.6-fold) (see Table S5 in the supplemental material). Secretion of RTX toxins requires three gene...”

Spaf_1565 HlyC/CorC family transporter from Streptococcus parasanguinis FW213
Aligns to 14:203 / 449 (42.3%), covers 98.3% of PF01595, 152.7 bits

• Complete genome and transcriptomes of Streptococcus parasanguinis FW213: phylogenic relations and potential virulence mechanisms
  Geng, PloS one 2012
  • “...Hemolysins Spaf_0610 Hemolysin A, putative 48 67 0.7 Spaf_1208 Hemolysin III-like, putative 121 60 2.0 Spaf_1565 Hemolysin 419 294 1.4 III. The Fim system Spaf_0347 FimA of FimCBA transporter 408 103 4.0 Spaf_0348 FimB of FimCBA transporter 468 134 3.5 Spaf_0349 FimC of FimCBA transporter 626...”

alr0309 hypothetical protein (NCBI ptt file) from Nostoc sp. PCC 7120
Aligns to 5:179 / 350 (50.0%), covers 98.9% of PF01595, 152.5 bits

• NsrR1, a Nitrogen Stress-Repressed sRNA, Contributes to the Regulation of nblA in Nostoc sp. PCC 7120
  Álvarez-Escribano, Frontiers in microbiology 2018
  • “...10 -04 all7229 Unknown 0.165 6.92 10 -04 all1228 Hypothetical protein 0.165 7.26 10 -04 alr0309 Hypothetical protein 0.305 1.43 10 -03 alr4953 Hypothetical protein 0.305 1.49 10 -03 alr4696 Class I peptide chain release factor CopraRNA ( Wright et al., 2013 , 2014 ) was...”

Acife_2190 HlyC/CorC family transporter from Acidithiobacillus ferrivorans SS3
Aligns to 8:204 / 441 (44.7%), covers 97.7% of PF01595, 151.6 bits

• Acidithiobacillus ferrivorans SS3 presents little RNA transcript response related to cold stress during growth at 8 °C suggesting it is a eurypsychrophile
  Christel, Extremophiles : life under extreme conditions 2016
  • “...acid a,c-diamide synthase CbiA 149 61 NS Acife_2081 Cobalamin biosynthesis protein CbiX 11 5 NS Acife_2190 Cobalt transporter 27 13 NS Acife_2431 Catalase 197 371 NS Acife_2993 Cobalamin biosynthesis protein CobS 14 0 NS Acife_3135 Cobyrinic acid a,c-diamide synthase CbiA 19 17 NS 3peroxiredoxin d NS...”
  • “...and superoxide dismutase (Acife_1434). Its genomic production potentially includes three cobalt transporters (Acife_0490, Acife_1063, and Acife_2190), as well as the cobalamin biosynthesis proteins CobS (Acife_2993), CbiX (Acife_2081), and two copies of CbiA (Acife_1891 and Acife_3125). In addition, several other enzymes dealing with oxidative stress were found,...”

Wbm0070 Putative Mg2+ and Co2+ transporter CorB (NCBI) from Wolbachia endosymbiont strain TRS of Brugia malayi
Aligns to 10:188 / 428 (41.8%), covers 97.2% of PF01595, 151.4 bits

• Identification of putative effectors of the Type IV secretion system from the Wolbachia endosymbiont of Brugia malayi
  Carpinone, PloS one 2018
  • “...hypothetical WBM0452 SAM-dependent methyltransferase E, 4 WBM0064 FAD-dependent oxidoreductase WBM0482 hypothetical, tropomyosin-like Bm , E WBM0070 Mg 2+ /Co 2+ transporter 4 WBM0484 hypothetical protein S WBM0076 WAS(p) family protein, proline-rich E WBM0491 cytochrome C oxidase assembly protein S WBM0100 Wolbachia Surface Protein (WSP) family S...”

LCGL_0374 HlyC/CorC family transporter from Lactococcus garvieae Lg2
Aligns to 16:205 / 442 (43.0%), covers 96.0% of PF01595, 150.6 bits

• Detection of virulence factors of South African Lactococcus garvieae isolated from rainbow trout, Oncorhynchus mykiss (Walbaum)
  Meyburgh, The Onderstepoort journal of veterinary research 2018
  • “...Motif (PF03006) conserved in proteins with haemolytic activity LCGL_0597 Haemolysin 72 Streptococcus suis EEF64743 - LCGL_0374 Haemolysin 59 S. pyogenes AAK33420 Cleavable N-terminal signal sequence LCGL_0664 NADH oxidase (SP1469) 51 S. pneumoniae TIGR4 - - LCGL_0285 Superoxide dismutase (SP0766) 68 S. pneumoniae TIGR4 - - LCGL_1330...”
• Comparative Genomic Analysis of Lactococcus garvieae Strains Isolated from Different Sources Reveals Candidate Virulence Genes
  Miyauchi, International journal of microbiology 2012
  • “...(1) Lg2 21881 8831 UNIUD074 Capsule gene cluster LCGL_0431-LCGL_0448 Haemolysin LCGL_0323 + + + Haemolysin LCGL_0374 + + + Haemolysin LCGL_0597 + + + NADH oxidase LCGL_0664 + + + Superoxide dismutase LCGL_0285 + + + Phosphoglucomutase LCGL_1596 + + + Adhesin Pav LCGL_1330 + +...”
• Complete genome sequence and comparative analysis of the fish pathogen Lactococcus garvieae
  Morita, PloS one 2011
  • “...shared 72% amino acid identity with haemolysin (accession number EEF64743) in Streptococcus suis . The LCGL_0374 protein showed 59% amino acid identity to haemolysin (accession number AAK33420) in Streptococcus pyogenes and contained a cleavable N-terminal signal sequence. NADH oxidase and superoxide dismutase (SOD) are also potential...”

Cj0183 putative integral membrane protein with haemolysin domain (NCBI ptt file) from Campylobacter jejuni subsp. jejuni NCTC 11168
Aligns to 27:221 / 452 (43.1%), covers 98.3% of PF01595, 150.4 bits

• Virulence properties of Campylobacter jejuni are enhanced by displaying a mycobacterial TlyA methylation pattern in its rRNA
  Sałamaszyńska-Guz, Cellular microbiology 2020
  • “...Koot, van Nuenen, & van der Zeijst, 1998 ) under control of the C. jejuni cj0183 gene promoter (SaamaszyskaGuz, Grodzik, & Klimuszko, 2013 ). This created strain 81176 cj0588 :: Myco_tlyA II (Table 1 ). All strain constructions were verified by polymerase chain reaction (PCR) and...”
  • “..., Grodzik , M. , & Klimuszko , D. ( 2013 ). Mutational analysis of cj0183 Campylobacter jejuni promoter . Current Microbiology , 67 ( 6 ), 696 702 . 23884593 SaamaszyskaGuz , A. , & Klimuszko , D. ( 2008 ). Functional analysis of the...”
• Virulence Traits of Inpatient Campylobacter jejuni Isolates, and a Transcriptomic Approach to Identify Potential Genes Maintaining Intracellular Survival
  Kovács, Microorganisms 2020
  • “...2399 2407 10.1128/IAI.01266-08 19349427 69. Saamaszyska-Guz A. Klimuszko D. Functional Analysis of the Campylobacter jejuni cj0183 and cj0588 Genes Curr. Microbiol. 2008 56 592 596 10.1007/s00284-008-9130-z 18389311 70. Pei Z.H. Ellison R.T. Blaser M.J. Identification, purification, and characterization of major antigenic proteins of Campylobacter jejuni J....”
• Biofilm Formation and Motility Are Promoted by Cj0588-Directed Methylation of rRNA in Campylobacter jejuni
  Sałamaszyńska-Guz, Frontiers in cellular and infection microbiology 2017
  • “.... 10.1128/AEM.01878-09 20139307 Salamasznska-Guz A. Grodzik M. Klimuszko D. ( 2013 ). Mutational analysis of cj0183 Campylobacter jejuni promoter . Curr. Microbiol. 67 , 696 702 . 10.1007/s00284-013-0420-8 23884593 Salamaszynska-Guz A. Klimuszko D. ( 2008 ). Functional analysis of the Campylobacter jejuni cj0183 and cj0588 genes...”
• Mutational analysis of cj0183 Campylobacter jejuni promoter
  Salamasznska-Guz, Current microbiology 2013
  • “...Microbiol Current Microbiology 0343-8651 1432-0991 Springer US Boston 23884593 420 10.1007/s00284-013-0420-8 Article Mutational Analysis of cj0183 Campylobacter jejuni Promoter Salamasznska-Guz Agnieszka [email protected] Grodzik Marta Klimuszko Danuta Department of Pre-Clinical Sciences, Warsaw University of Life Sciences, Warsaw, Poland Department of Animal Nutrition and Feed Science, Warsaw University...”
  • “...and reproduction in any medium, provided the original author(s) and the source are credited. Gene-nominated cj0183 was identified in Campylobacter jejuni NCTC 11168 and in two human isolates 81116 and 81-176. It encodes a protein which shows partial homology to TlyC of Brachyspira hyodysenteriae . The...”
• Influence of mutation in cj0183 and cj0588 genes for colonization abilities of Campylobacter jejuni in Caco-2 cells using confocal laser scanning microscope
  Salamaszyńska-Guz, Polish journal of veterinary sciences 2013 (PubMed)
  • “...Short communication Influence of mutation in cj0183 and cj0588 genes for colonization abilities of Campylobacter jejuni in Caco-2 cells using...”
  • “...SGGW, Nowoursynowska 159, 02-776 Warsaw, Poland Abstract The cj0183 and cj0588 genes identified in the Campylobacter jejuni NCTC 11168 genome encode proteins...”
• Outcome of infection of C57BL/6 IL-10(-/-) mice with Campylobacter jejuni strains is correlated with genome content of open reading frames up- and down-regulated in vivo
  Bell, Microbial pathogenesis 2013
  • “...156 1134 1143 20035004 80 Salamaszynska-Guz A Klimuszko D Functional analysis of the Campylobacter jejuni cj0183 and cj0588 genes Curr Microbiol 2008 56 592 596 18389311 81 Bras AM Chatterjee S Wren BW Newell DG Ketley JM A novel Campylobacter jejuni two-component regulatory system important for...”
• Molecular mechanisms and biological role of Campylobacter jejuni attachment to host cells
  Rubinchik, European journal of microbiology & immunology 2012
  • “...A, Klimuszko D: Functional analysis of the Campylobacter jejuni cj0183 and cj0588 genes. Curr Microbiol 56, 592-596 (2008) 39. Martino MC, Stabler RA et al.:...”
• Functional analysis of the Campylobacter jejuni cj0183 and cj0588 genes
  Sałamaszyńska-Guz, Current microbiology 2008 (PubMed)
  • “...the Campylobacter jejuni cj0183 and cj0588 Genes Agnieszka Saamaszynska-Guz AE Danuta Klimuszko Received: 27 June 2007 / Accepted: 11 December 2007 / Published...”
  • “...O Springer Science+Business Media, LLC 2008 Abstract The cj0183 and cj0588 genes identified in the Campylobacter jejuni NCTC 11168 genome encode proteins with...”

sll1254 hemolysin (NCBI ptt file) from Synechocystis sp. PCC 6803
Aligns to 6:180 / 346 (50.6%), covers 99.4% of PF01595, 150.4 bits

• Genetic engineering of Synechocystis PCC6803 for the photoautotrophic production of the sweetener erythritol
  van, Microbial cell factories 2016
  • “...]. We therefore selected this enzyme, as well as an endogenous enzyme from Synechocystis , Sll1254, that showed the highest sequence similarity to YidA. The genes encoding erythrose reductases as well as the novel phosphatase YidA were synthesized, after codon optimization for Synechocystis , behind a...”
• Systematically ranking the tightness of membrane association for peripheral membrane proteins (PMPs)
  Gao, Molecular & cellular proteomics : MCP 2015
  • “...limited number of outliers as represented by the protein Sll1254 (Fig. 3A). With this method, we were not only able to rank and experimentally validate the...”

MSH_02150 DUF21 domain-containing protein from Mycoplasma synoviae
Aligns to 20:192 / 424 (40.8%), covers 100.0% of PF01595, 150.2 bits

• Genome analysis of Mycoplasma synoviae strain MS-H, the most common M. synoviae strain with a worldwide distribution
  Zhu, BMC genomics 2018
  • “...an N-acetylneuraminate lyase ( nanA ) variant (MSH_00300), an integrase (MSH_07560, VY93_03735), a DNA methylase (MSH_02150, VY93_01015/VY93_02585), and several type I, II and III related restriction-modification proteins. The deoC fragment and the ATP-dependent DNA helicase sequences were located at two distinct chromosomal sites in the MS-H...”
  • “...MSH_01970 VY93_00915 Type II restriction enzyme MjaIII MSH_02140 VY93_01010 VY93_02580 Methyl-directed repair DNA adenine methylase MSH_02150 VY93_01015 VY93_02585 3-to-5 oligoribonuclease A MSH_02940 b MSH_02950 b MSH_02960 b MS53_0278 b MS53_0279 b VY93_01505 b VY93_01510 b Aspartate-ammonia ligase MSH_02990 MS53_0281 b VY93_01515 Hypothetical protein MSH_03480 b MSH_03490...”

Q8EDE1 Transporter-like protein HCC family from Shewanella oneidensis (strain MR-1)
Aligns to 4:196 / 439 (44.0%), covers 99.4% of PF01595, 149.8 bits

• Structure-based functional annotation of putative conserved proteins having lyase activity from Haemophilus influenzae.
  Shahbaaz, 3 Biotech 2015
  • “...Glu. (B). P44717 and Q87DZ3 displaying metal binding sites at Asp residues. (C). P44717 and Q8EDE1 presenting AMP binding site at Val residue (corresponding sites are shown in black boxes). Figure S3 : The corresponding multiple cAMP binding sites are shown in P45267 and Q7CH76 at...”

S100390_v1c06730 HlyC/CorC family transporter from Spiroplasma sp. NBRC 100390
Aligns to 13:195 / 443 (41.3%), covers 99.4% of PF01595, 149.5 bits

• Complete Genome Sequence of Spiroplasma sp. NBRC 100390
  Haryono, Genome announcements 2017
  • “...in a nonsynonymous substitution in the predicted functional domain of the respective genes (locus tags S100390_v1c06730 and S100390_v1c09590). However, the BLASTp ( 16 ) searches against the NCBI NR database ( 17 ) showed that these polymorphisms did not affect the protein domain identification. Finally, the...”

G414_RS0106815 HlyC/CorC family transporter from Weissella halotolerans DSM 20190
Aligns to 10:208 / 451 (44.1%), covers 99.4% of PF01595, 149.4 bits

• The controversial nature of the Weissella genus: technological and functional aspects versus whole genome analysis-based pathogenic potential for their application in food and health
  Abriouel, Frontiers in microbiology 2015
  • “...(WEISSC39_RS00260) 2 Hly (WEISSC39_RS08935, WEISSC39_RS08940) 1 MBP (WEISSC39_RS05980) W. halotolerans DSM 20190 2 Hly (G414_RS0106810, G414_RS0106815) W. hellenica Wikim14 2 Hly (TY24_RS08990, TY24_RS08995) W. koreensis KACC 15510 W. koreensis KCTC 3621 2 Hly (JC2156_RS08435, JC2156_10680) W. oryzae SG25 2 AGS (WOSG25_200030, WOSG25_200040) 2 Asa1/PrgB (WOSG25_200030, WOSG25_200040)...”

SMc00697 HYPOTHETICAL TRANSMEMBRANE PROTEIN (NCBI ptt file) from Sinorhizobium meliloti 1021
Aligns to 16:198 / 434 (42.2%), covers 96.6% of PF01595, 149.3 bits

• Host Factors Influencing the Retrohoming Pathway of Group II Intron RmInt1, Which Has an Intron-Encoded Protein Naturally Devoid of Endonuclease Activity
  Nisa-Martínez, PloS one 2016
  • “...transporters of Mg 2+ or other cations: SMc00399 ( corA1 ), SMc00874 ( corA2 ), SMc00697 ( corB ), SMc01261 ( mgtE ) and SMc00713 ( chaC ). As indicated above, the retrohoming efficiency in one of the corA1 mutants was 177% wild-type levels, but intracellular...”

WEISSC39_RS08935 HlyC/CorC family transporter from Weissella confusa LBAE C39-2
Aligns to 10:208 / 455 (43.7%), covers 98.9% of PF01595, 146.9 bits

• The controversial nature of the Weissella genus: technological and functional aspects versus whole genome analysis-based pathogenic potential for their application in food and health
  Abriouel, Frontiers in microbiology 2015
  • “...cibaria KACC 11862 2 Hly (ESE_RS0108795, ESE_RS11605) W. confusa LBAE C39-2 1 (WEISSC39_RS00260) 2 Hly (WEISSC39_RS08935, WEISSC39_RS08940) 1 MBP (WEISSC39_RS05980) W. halotolerans DSM 20190 2 Hly (G414_RS0106810, G414_RS0106815) W. hellenica Wikim14 2 Hly (TY24_RS08990, TY24_RS08995) W. koreensis KACC 15510 W. koreensis KCTC 3621 2 Hly (JC2156_RS08435,...”

HD0770 conserved hypothetical protein (NCBI) from Haemophilus ducreyi 35000HP
Aligns to 31:206 / 440 (40.0%), covers 93.2% of PF01595, 146.1 bits

• Haemophilus ducreyi Outer membrane determinants, including DsrA, define two clonal populations
  White, Infection and immunity 2005
  • “...box with a jagged line at the upstream end; the partial HD0770 ORF is represented by an open box with a jagged line at the downstream end. The numbered arrows...”

plu1254 hypothetical protein (RefSeq) from Photorhabdus luminescens subsp. laumondii TTO1
Aligns to 1:161 / 400 (40.2%), covers 84.7% of PF01595, 145.8 bits

• LuxS-dependent AI-2 production is not involved in global regulation of natural product biosynthesis in Photorhabdus and Xenorhabdus
  Heinrich, PeerJ 2017
  • “...Fig. 4A ). The luxS gene is located between gshA encoding a -L-glutamyl-L-cysteine synthetase and plu1254, which encodes a protein with unknown function ( Apontoweil & Berends, 1975 ). While P. luminescens luxS G is a deletion of the entire luxS gene including 13 bp of...”
  • “...mutant strains. In the WT, the luxS gene (light blue) is located between gshA and plu1254 . Present between luxS and gshA is the small regulatory RNA micA (green). cat (orange): chloramphenicol resistance cassette. (B) micA sequence of P. luminescens TT01 with upstream region (marked in...”

Q9LK65 Putative DUF21 domain-containing protein At3g13070, chloroplastic from Arabidopsis thaliana
Aligns to 163:340 / 661 (26.9%), covers 100.0% of PF01595, 145.6 bits

• Purification, crystallization and preliminary crystallographic analysis of the CBS-domain protein MJ1004 from Methanocaldococcus jannaschii
  Oyenarte, Acta crystallographica. Section F, Structural biology and crystallization communications 2011
  • “...3, CLCE; 4, CLCC; 5, CLCA; 6, Q9M1T1; 7, Q9LG18; 8, Q9LK65; 9, CLCG; 10, CLCB; 11, UMP3; 12, CLCD; 13, CLCF; 14, Q9XI37; 15, O23193; 16, Q9C5D0; 17, O49493....”

BPSS1795 putative membrane protein (NCBI) from Burkholderia pseudomallei K96243
Aligns to 8:202 / 446 (43.7%), covers 94.9% of PF01595, 145.6 bits

• Genomic characterization of Burkholderia pseudomallei isolates selected for medical countermeasures testing: comparative genomics associated with differential virulence
  Sahl, PloS one 2015
  • “...protein NC_006351.1 1917766 T C N/A N/A intergenic N/A NC_006351.1 2455301 T G S A BPSS1795 hypothetical protein NC_006351.1 2514965 G A N/A N/A intergenic N/A NC_006351.1 2695450 C T N/A N/A intergenic N/A NC_006351.1 3000485 G A N/A N/A intergenic N/A NC_006351.1 3042744 A G...”

P792_09655 HlyC/CorC family transporter from Asaia sp. SF2.1
Aligns to 6:198 / 430 (44.9%), covers 100.0% of PF01595, 145.3 bits

• Blood meal-induced inhibition of vector-borne disease by transgenic microbiota
  Shane, Nature communications 2018
  • “...63 AGLR1.HlyA HlyA Helicobacter pylori Hemolysin P792_09125 51 64 AGLR1.HlyC HlyC Vibrio cholera Hemolysin transferase P792_09655 55 65 AGLR1.Ferr TrxR Helicobacter pylori Oxidative stress protection P792_12065 43 66 AGLR1.SodB SodB Escherichia coli Oxidative stress protection P792_08220 62 67 AGLR1.Bfr Bfr Escherichia coli Iron storage P792_12870 74...”

TP0028 hemolysin, putative (NCBI ptt file) from Treponema pallidum subsp. pallidum str. Nichols
TPANIC_0028 HlyC/CorC family transporter from Treponema pallidum subsp. pertenue str. Gauthier
Aligns to 9:185 / 453 (39.1%), covers 98.9% of PF01595, 145.3 bits

• On the origin of the treponematoses: a phylogenetic approach
  Harper, PLoS neglected tropical diseases 2008
  • “...between the predicted promoter and transcriptional start site of the operon containing genes tp0027 and tp0028 ( Fig. S1 ), could attenuate transcript levels of these genes. Both of these genes are homologous to tlyC , which is believed to either code for a hemolysin or...”
  • “...pallidum may be worthwhile, in order to better assess this possibility. Similarly, since tp0027 and tp0028 are both homologous to tlyC , a gene that either encodes a hemolysin or regulates a cryptic one in E. coli [48] , a difference in transcript level between subspecies...”
• Transcriptome of Treponema pallidum: gene expression profile during experimental rabbit infection
  Smajs, Journal of bacteriology 2005
  • “...0.27 0.26 0.26 TP0106 TP0804 TP0340 TP0288 TP0337 TP0028 TP0514 TP0689 TP0147 TP0336 TP0671 TP0566 TP0516 TP0688 TP0715 TP0714 TP0520 TP0519 TP0517 0.26 0.26...”
  • “...Tpr Tpr Tpr Tpr Tpr Hemolysins TP1037 TP0936 TP0649 TP0027 TP0028 1.1 0.78 0.57 0.30 0.23 0 0 0 1 1 Hemolysin III (hlyIII) Putative hemolysin Hemolysin (tlyC)...”
• Functional insights from proteome-wide structural modeling of Treponema pallidum subspecies pallidum, the causative agent of syphilis
  Houston, BMC structural biology 2018
  • “...Magnesium/Cobalt efflux protein ( E. coli ) 5th rank: Hemolysin-like protein ( Oenococcus oeni ) TPANIC_0028 Putative hemolysin (HlyC) 1st rank: CorC Magnesium/Cobalt efflux protein ( E. coli ) 5th rank: Hemolysin-like protein ( Oenococcus oeni ) TPANIC_0399 Type 3 (virulence-related) Secretory pathway protein (FliF) 1st...”

ZMO_RS01280 HlyC/CorC family transporter from Zymomonas mobilis
Aligns to 16:205 / 441 (43.1%), covers 100.0% of PF01595, 145.1 bits

• Phenotypic and genomic analysis of Zymomonas mobilis ZM4 mutants with enhanced ethanol tolerance
  Carreón-Rodríguez, Biotechnology reports (Amsterdam, Netherlands) 2019
  • “...(V313A) was located within a gene encoding a member of the HlyC/CorC family transporter protein (ZMO_RS01280). ER79ag also lost one of its plasmids (pZZM402). Table 1 Mutations found in ER79ag and ER79ap. Comparison was made with the sequence of ZM4 clone sequenced in this work (ZM4*)....”
  • “...A 76942 ZMO_RS00360 WP_012817506.1 Bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase, SpoT/RelA R676M __ 299718 T C 299718 ZMO_RS01280 WP_011240232.1 HlyC/CorC family transporter V313A __ 810750 G A 810750 ZMO_RS03600 WP_011240680.1 30S ribosomal protein S12 methylthiotransferase RimO R399C __ 965913 A G 965913 ZMO_RS03600 WP_011240805.1 ATP-dependent Clp protease proteolytic...”

BB0202 hemolysin, putative (NCBI ptt file) from Borrelia burgdorferi B31
Aligns to 4:180 / 412 (43.0%), covers 98.9% of PF01595, 144.6 bits

• Membrane directed expression in Escherichia coli of BBA57 and other virulence factors from the Lyme disease agent Borrelia burgdorferi
  Robertson, Scientific reports 2019
  • “...reflects technical challenges. Furthermore, it has been suggested that transmembrane domains exist in BB0017, BB0164, BB0202, BB0412, BB0473, BB0631, and ChbB 37 . Many of the important outer surface virulence proteins in Bb , including OspA, OspB, OspC, OspD, P13, P66 and Lp6.6, are common components...”
• A high-throughput genetic screen identifies previously uncharacterized Borrelia burgdorferi genes important for resistance against reactive oxygen and nitrogen species
  Ramsey, PLoS pathogens 2017
  • “...most sensitive to ROS, and the contribution of three such membrane proteins (BB0017, BB0164, and BB0202) to ROS sensitivity was confirmed using individual Tn mutants and complemented strains. Further analysis showed that levels of intracellular manganese are significantly reduced in the Tn:: bb0164 mutant, identifying a...”
  • “...sodium/calcium exchanger-like protein 0.069 (0.085, 0.053) chr bb0473 putative MATE transporter 0.077 (0.056, 0.097) chr bb0202 putative CorC-like transporter protein, CBS domain 0.094 (0.101, 0.086) cp26 bbb06 ChbB, chitobiose transporter protein 0.100 (0.108, 0.093) chr bb0669 CheA2, chemotaxis histidine kinase 0.114 (0.033, 0.195) cp9 bbc07 hypothetical...”

PG0272 CBS domain protein (NCBI) from Porphyromonas gingivalis W83
Aligns to 4:183 / 419 (43.0%), covers 99.4% of PF01595, 144.5 bits

• Gene expression profile analysis of Porphyromonas gingivalis during invasion of human coronary artery endothelial cells
  Rodrigues, Infection and immunity 2005
  • “...valueb PG0120 PG0121 PG0145 PG0176 PG0178 PG0186 PG0195 PG0272 PG0288 PG0315 PG0375 PG0389 PG0390 PG0392 PG0616 PG0618 PG0687 PG0689 PG0762 PG0779 PG0780 PG0992...”

Rmet_4765 HlyC/CorC family transporter from Cupriavidus metallidurans CH34
Rmet_4765 hypothetical protein (RefSeq) from Ralstonia metallidurans CH34
Aligns to 4:196 / 437 (44.2%), covers 99.4% of PF01595, 144.5 bits

• Characterization of the Δ7 Mutant of Cupriavidus metallidurans with Deletions of Seven Secondary Metal Uptake Systems
  Große, mSystems 2016 (no snippet)

EMQU_0190 HlyC/CorC family transporter from Enterococcus mundtii QU 25
Aligns to 5:200 / 432 (45.4%), covers 99.4% of PF01595, 143.6 bits

• Complete genome sequence of Enterococcus mundtii QU 25, an efficient L-(+)-lactic acid-producing bacterium
  Shiwa, DNA research : an international journal for rapid publication of reports on genes and genomes 2014
  • “...large-scale culture. Four putative haemolysin genes (haemolysin, haemolysin III, haemolysin A, and -haemolysin) were identified (EMQU_0190 and EMQU_0948, EMQU_0449, EMQU_0841, and EMQU_1982, respectively). We tested haemolysin activity and no changes to the blood agar in the vicinity of the colonies were observed (data not shown), suggesting...”

c3133 hypothetical protein (RefSeq) from Escherichia coli CFT073
Aligns to 1:161 / 398 (40.5%), covers 84.7% of PF01595, 141.3 bits

• Nucleotide sequences of the Acinetobacter calcoaceticus benABC genes for benzoate 1,2-dioxygenase reveal evolutionary relationships among multicomponent oxygenases
  Neidle, Journal of bacteriology 1991
  • “...toluene, and naphthalene dioxygenase systems, however, two c3133 * Corresponding author. t Present address: Microbiology Department, University of Texas Medical...”

STM2679 hypothetical protein (RefSeq) from Salmonella typhimurium LT2
Aligns to 1:161 / 398 (40.5%), covers 84.7% of PF01595, 141.2 bits

• An Essential Factor for High Mg2+ Tolerance of Staphylococcus aureus
  Armitano, Frontiers in microbiology 2016
  • “...orthology database describes 2043 proteins as orthologs of SA0657, among which is Salmonella CorB (StCorB: STM2679, see Supplementary Figure S5 ) ( Altenhoff et al., 2015 ) 5 . These two proteins share the same domains architecture but their overall similarity is low (22%; Figure 5...”

VVA1339 putative hemolysin (NCBI) from Vibrio vulnificus YJ016
Aligns to 21:212 / 450 (42.7%), covers 99.4% of PF01595, 141.2 bits

• Whole-genome comparison between reference sequences and oyster Vibrio vulnificus C-genotype strains
  Guerrero, PloS one 2019
  • “...hemolysin, and RTX toxin (VVA0964, VVA0965, VV0508, VV0601, VV0795, VV0914, VV1495, VV2791, VV3230, VVA0118, VVA0303, VVA1339 and VVA1030), as reported by Chen et al. [ 26 ], were found in both strains. Table 2 presents a select list of genes that were exclusive to V ....”
  • “...VV2_0884 + + VV2043 + + VVA1310 + + VV2_0993 + + VV2191 - - VVA1339 + + VV2_0994 + + VV2778 + - VVA1413 - - VV2_1075 + + VV2779 + + VVA1504 + + VV2_1106 + + VV2780 + + VVA1505 + + VV2_1107...”
• Comparative genome analysis of Vibrio vulnificus, a marine pathogen
  Chen, Genome research 2003
  • “...VV0601, VV0795, VV0914, VV1495, VV2791, VV3230, VVA0118, VVA0303, VVA1339), and RTX toxin (VVA1030; Coote 1992) were identified in the genome sequence of V....”

VV2791 putative hemolysin (NCBI) from Vibrio vulnificus YJ016
Aligns to 1:157 / 396 (39.6%), covers 83.5% of PF01595, 140.9 bits

• Whole-genome comparison between reference sequences and oyster Vibrio vulnificus C-genotype strains
  Guerrero, PloS one 2019
  • “...virulence genes to cytotoxin, hemolysin, and RTX toxin (VVA0964, VVA0965, VV0508, VV0601, VV0795, VV0914, VV1495, VV2791, VV3230, VVA0118, VVA0303, VVA1339 and VVA1030), as reported by Chen et al. [ 26 ], were found in both strains. Table 2 presents a select list of genes that were...”
  • “...VVA1505 + + VV2_1107 + + VV2781 + + VVA1506 + + VV2_1108 + + VV2791 + + VVA1632 + + VV2_1109 + + VV2872 + + VVA1633 + + VV2_1138 + + VV2874 + + VVA1634 + + VV2_1149 + + VV2990 + + VVA1635...”
• Comparative genome analysis of Vibrio vulnificus, a marine pathogen
  Chen, Genome research 2003
  • “...VVA0965), hemolysins (VV0508, VV0601, VV0795, VV0914, VV1495, VV2791, VV3230, VVA0118, VVA0303, VVA1339), and RTX toxin (VVA1030; Coote 1992) were identified in...”

AYI77_RS13890, AYI97_RS17645, BN1227_RS19795 HlyC/CorC family transporter from Shewanella algae
Aligns to 7:199 / 443 (43.6%), covers 99.4% of PF01595, 140.3 bits

• Comparative Genomics Reveals Pathogenicity-Related Loci in Shewanella algae
  Wang, The Canadian journal of infectious diseases & medical microbiology = Journal canadien des maladies infectieuses et de la microbiologie medicale 2020
  • “...locus_tag Length Strains MARS 14 YHL CHL ACCC hlyA BN1227_RS19795 443 AYI97_RS17645 443 AYI82_RS07480 443 AYI77_RS13890 443 hlyD BN1227_RS18765 352 AYI97_RS03440 352 AYI82_RS00925 352 AYI77_RS05040 352 BN1227_RS19395 349 AYI97_RS04065 349 AYI82_RS01570 349 AYI77_RS08410 349 BN1227_RS08585 314 AYI97_RS05045 314 AYI82_RS17560 314 AYI77_RS14620 314 hlyIII BN1227_RS10295 226 AYI97_RS09385...”
  • “...locus_tag Length locus_tag Length locus_tag Length Strains MARS 14 YHL CHL ACCC hlyA BN1227_RS19795 443 AYI97_RS17645 443 AYI82_RS07480 443 AYI77_RS13890 443 hlyD BN1227_RS18765 352 AYI97_RS03440 352 AYI82_RS00925 352 AYI77_RS05040 352 BN1227_RS19395 349 AYI97_RS04065 349 AYI82_RS01570 349 AYI77_RS08410 349 BN1227_RS08585 314 AYI97_RS05045 314 AYI82_RS17560 314 AYI77_RS14620 314...”
  • “...locus_tag Length locus_tag Length locus_tag Length locus_tag Length Strains MARS 14 YHL CHL ACCC hlyA BN1227_RS19795 443 AYI97_RS17645 443 AYI82_RS07480 443 AYI77_RS13890 443 hlyD BN1227_RS18765 352 AYI97_RS03440 352 AYI82_RS00925 352 AYI77_RS05040 352 BN1227_RS19395 349 AYI97_RS04065 349 AYI82_RS01570 349 AYI77_RS08410 349 BN1227_RS08585 314 AYI97_RS05045 314 AYI82_RS17560 314...”

ESE_RS0108795 HlyC/CorC family transporter from Weissella cibaria KACC 11862
Aligns to 11:208 / 454 (43.6%), covers 98.9% of PF01595, 139.8 bits

• The controversial nature of the Weissella genus: technological and functional aspects versus whole genome analysis-based pathogenic potential for their application in food and health
  Abriouel, Frontiers in microbiology 2015
  • “...WCNC 05547, WCNC 06207) 1 PA-ADHE 1 MBP (WCNC_01840) W. cibaria KACC 11862 2 Hly (ESE_RS0108795, ESE_RS11605) W. confusa LBAE C39-2 1 (WEISSC39_RS00260) 2 Hly (WEISSC39_RS08935, WEISSC39_RS08940) 1 MBP (WEISSC39_RS05980) W. halotolerans DSM 20190 2 Hly (G414_RS0106810, G414_RS0106815) W. hellenica Wikim14 2 Hly (TY24_RS08990, TY24_RS08995) W....”

AYI82_RS07480 HlyC/CorC family transporter from Shewanella algae
Aligns to 7:199 / 443 (43.6%), covers 99.4% of PF01595, 139.8 bits

• Comparative Genomics Reveals Pathogenicity-Related Loci in Shewanella algae
  Wang, The Canadian journal of infectious diseases & medical microbiology = Journal canadien des maladies infectieuses et de la microbiologie medicale 2020
  • “...locus_tag Length locus_tag Length Strains MARS 14 YHL CHL ACCC hlyA BN1227_RS19795 443 AYI97_RS17645 443 AYI82_RS07480 443 AYI77_RS13890 443 hlyD BN1227_RS18765 352 AYI97_RS03440 352 AYI82_RS00925 352 AYI77_RS05040 352 BN1227_RS19395 349 AYI97_RS04065 349 AYI82_RS01570 349 AYI77_RS08410 349 BN1227_RS08585 314 AYI97_RS05045 314 AYI82_RS17560 314 AYI77_RS14620 314 hlyIII BN1227_RS10295...”

TY24_RS08995 HlyC/CorC family transporter from Weissella hellenica
Aligns to 10:208 / 447 (44.5%), covers 99.4% of PF01595, 138.7 bits

• The controversial nature of the Weissella genus: technological and functional aspects versus whole genome analysis-based pathogenic potential for their application in food and health
  Abriouel, Frontiers in microbiology 2015
  • “...(WEISSC39_RS05980) W. halotolerans DSM 20190 2 Hly (G414_RS0106810, G414_RS0106815) W. hellenica Wikim14 2 Hly (TY24_RS08990, TY24_RS08995) W. koreensis KACC 15510 W. koreensis KCTC 3621 2 Hly (JC2156_RS08435, JC2156_10680) W. oryzae SG25 2 AGS (WOSG25_200030, WOSG25_200040) 2 Asa1/PrgB (WOSG25_200030, WOSG25_200040) 3 hemolysins (WOSG25 150280, WOSG25_RS09625, WOSG25_RS09635) W....”

C9YX17 Putative transport system integral membrane component from Streptomyces scabiei (strain 87.22)
SCAB_83191 putative transporter integral membrane component (RefSeq) from Streptomyces scabiei 87.22
Aligns to 4:198 / 336 (58.0%), covers 98.9% of PF01595, 138.7 bits

• The Plant Pathogenic Bacterium Streptomyces scabies Degrades the Aromatic Components of Potato Periderm via the β-Ketoadipate Pathway
  Khalil, Frontiers in microbiology 2019
  • “...C9ZBK8 SCAB_15611 Amidohydrolase 0.12 Transport, secretion, and efflux C9ZC07 SCAB_46421 ABC transporter (cytochrome bd) 0.01 C9YX17 SCAB_83191 Transport system integral protein 0.05 C9ZGM4 SCAB_18691 Cation transport protein (Mg) 0.07 C9ZAS1 SCAB_61981 Metal-binding lipoprotein (Zn) 0.05 General function prediction only C9ZBK9 SCAB_15621 Dehydrogenase/reductase 0.27 C9ZCN6 SCAB_78601 Ligase...”
• The Plant Pathogenic Bacterium Streptomyces scabies Degrades the Aromatic Components of Potato Periderm via the β-Ketoadipate Pathway
  Khalil, Frontiers in microbiology 2019
  • “...SCAB_15611 Amidohydrolase 0.12 Transport, secretion, and efflux C9ZC07 SCAB_46421 ABC transporter (cytochrome bd) 0.01 C9YX17 SCAB_83191 Transport system integral protein 0.05 C9ZGM4 SCAB_18691 Cation transport protein (Mg) 0.07 C9ZAS1 SCAB_61981 Metal-binding lipoprotein (Zn) 0.05 General function prediction only C9ZBK9 SCAB_15621 Dehydrogenase/reductase 0.27 C9ZCN6 SCAB_78601 Ligase 0.03...”

MSMEG_3638 CBS domain protein (NCBI) from Mycobacterium smegmatis str. MC2 155
Aligns to 8:202 / 364 (53.6%), covers 100.0% of PF01595, 138.2 bits

• Regulatory genes coordinating antibiotic-induced changes in promoter activity and early transcriptional termination of the mycobacterial intrinsic resistance gene whiB7
  Burian, Molecular microbiology 2018 (PubMed)
  • “...A pair of hypothetical genes, MSMEG_3637 and MSMEG_3638, were identified as important contributors to whiB7 promoter induction on antibiotic challenge....”
  • “...pair of potentially overlapping genes MSMEG_3637 and MSMEG_3638. Whether these hypothetical genes or asnB promote resistance through WhiB7 rather than...”

Q9WZU9 Hemolysin-related protein from Thermotoga maritima (strain ATCC 43589 / MSB8 / DSM 3109 / JCM 10099)
Aligns to 16:199 / 455 (40.4%), covers 100.0% of PF01595, 137.8 bits

• Purification, crystallization and preliminary crystallographic analysis of the CBS-domain protein MJ1004 from Methanocaldococcus jannaschii
  Oyenarte, Acta crystallographica. Section F, Structural biology and crystallization communications 2011
  • “...codes). Thermotoga maritima: 1, UPI000016610F; 2, PPAC; 3, Q9WZU9; 4, Q9X033 (TM0935); 5, Q9X0P4; 6, Q9X0M4; 7, Q9WZH4; 8, Q9WZZ4 (TM0892); 9, Q9WZT6; 10,...”

MMB_0258, Mbov_0279 DUF21 domain-containing protein from Mycoplasma bovis Hubei-1
Aligns to 11:186 / 430 (40.9%), covers 98.9% of PF01595, 137.7 bits

• An emerging role for cyclic dinucleotide phosphodiesterase and nanoRNase activities in Mycoplasma bovis: Securing survival in cell culture
  Zhu, PLoS pathogens 2020
  • “...remains to be demonstrated, but the close proximity of Mbov_0276 to a putative hemolysin gene (Mbov_0279) is a good indication of the possible role of MbovGdpP in sensing heme signals during M . bovis infection. The DhhP-type phosphodiesterase encoded by Mbov_0328 provides M . bovis with...”
• Comparative Genomics of Mycoplasma bovis Strains Reveals That Decreased Virulence with Increasing Passages Might Correlate with Potential Virulence-Related Factors
  Rasheed, Frontiers in cellular and infection microbiology 2017
  • “...H. somnus 129PT] 89 3.00E-18 Mbov_0312 AdhD alcohol dehydrogenase [ Mycobacterium intracellulare MOTT-02] 88 7.00E-18 Mbov_0279 HlyC/CorC family [hemolysin] [ Clostridium botulinum A str. ATCC 19397] 87 3.00E-17 Mbov_0232 protein phosphatase PrpC [ L. monocytogenes ] 86 2.00E-17 Mbov_0064 beta-1,3 galactosyltransferase [ Campylobacter jejuni subsp. jejuni...”
• The complete genome sequence of Mycoplasma bovis strain Hubei-1
  Li, PloS one 2011
  • “...by tandem repeats. For example, there are two tandem repeats at the 3 end of MMB_0258 , which encodes for a hemolysin-related protein. It is noteworthy that several tandem repeats are located adjacent to restriction-modification (RM) systems, which perhaps cause RM gene degeneration or phase-specific expression....”
  • “...MMB_0127 oligoendopeptidase F (pepF) MMB_0129 spermidine/putrescine ABC transporter permease (potB) MMB_0167 major surface lipoprotein P48 MMB_0258 hemolysin-related protein MMB_0271 Vpma-like, lipoprotein MMB_0316 variable surface lipoprotein Y (vpmaY1) MMB_0345 conserved hypothetical protein MMB_0419 variable surface lipoprotein Y (vpmaY2) MMB_0422 P30, lipoprotein MMB_0431 variable surface lipoprotein A (vpmaX)...”

HMPREF0877_RS09665 HlyC/CorC family transporter from Weissella paramesenteroides ATCC 33313
Aligns to 10:208 / 452 (44.0%), covers 98.9% of PF01595, 137.4 bits

• The controversial nature of the Weissella genus: technological and functional aspects versus whole genome analysis-based pathogenic potential for their application in food and health
  Abriouel, Frontiers in microbiology 2015
  • “...Asa1/PrgB (WOSG25_200030, WOSG25_200040) 3 hemolysins (WOSG25 150280, WOSG25_RS09625, WOSG25_RS09635) W. paramesenteroides ATCC 33313 2 Hly (HMPREF0877_RS09665, HMPREF0877_RS09670) W. thailandensis fsh4-2 2 Hly (WT2_01519, WT2_01520) The role of the genes above in the virulence of Weissella is still unknown. Further studies are needed to confirm whether these...”

LHK_03166 Hemolysins-like protein containing CBS domains (RefSeq) from Laribacter hongkongensis HLHK9
Aligns to 8:199 / 443 (43.3%), covers 98.3% of PF01595, 136.8 bits

• The complete genome and proteome of Laribacter hongkongensis reveal potential mechanisms for adaptations to different temperatures and habitats
  Woo, PLoS genetics 2009
  • “...putative cytotoxins are present, including cytotoxins that act on the cell surface [hemolysins (LHK_00956 and LHK_03166) and RTX toxins (LHK_02735 and LHK_02918)] and those that act intracellularly [patatin-like proteins (LHK_00116, LHK_01938, and LHK_03113)] [32] , [33] . Furthermore, a number of CDSs that encode putative outer...”

NTHI0579 hypothetical protein (RefSeq) from Haemophilus influenzae 86-028NP
Aligns to 10:201 / 432 (44.4%), covers 100.0% of PF01595, 135.6 bits

• Antisera Against Certain Conserved Surface-Exposed Peptides of Nontypeable Haemophilus influenzae Are Protective
  Whitby, PloS one 2015
  • “...NTHi a . 86-026NP locus Gene designation Rd KW20 locus Gene description Probable Type b NTHI0579 ytfL HI0452 Putative hemolysin (probable inner membrane) -helix NTHI0576 HI0449 Conserved hypothetical protein Amorphous NTHI0560 comE HI0435 Outer membrane secretin ComE Amorphous NTHI0522 ompP1 HI0401 Outer membrane protein P1 -barrel...”

APH_0957 CBS/transporter associated domain protein (NCBI) from Anaplasma phagocytophilum HZ
Aligns to 2:181 / 422 (42.7%), covers 97.7% of PF01595, 135.2 bits

• Comparative genomics of first available bovine Anaplasma phagocytophilum genome obtained with targeted sequence capture
  Dugat, BMC genomics 2014
  • “...of A. phagocytophilum , and do not require secretion. Seven proteins (APH_0208, APH_0232, APH_0561, APH_0687, APH_0957, APH_1084, and APH_1148) involved in various cellular processes such as cell metabolism, and two lipoproteins (APH_0985, APH_1087) with unknown localization, were also detected as potential Sec substrates. Ten hypothetical proteins...”

ASA_1523 hemolysin (RefSeq) from Aeromonas salmonicida subsp. salmonicida A449
Aligns to 8:199 / 439 (43.7%), covers 99.4% of PF01595, 134.8 bits

• The Aeromonas salmonicida subsp. salmonicida exoproteome: determination of the complete repertoire of Type-Three Secretion System effectors and identification of other virulence factors
  Vanden, Proteome science 2013
  • “...once again that an intact T3SS is primordial to initiate the disease. The putative hemolysin ASA_1523 was only detected in pellets and in higher quantity in the mutant strain. In the genome of A. salmonicida A449, Zonular Occludens Toxins (Zot, ASA_2003 and ASA_2015), elastase AhpB and...”

MGA_0173 TlyC-like protein (RefSeq) from Mycoplasma gallisepticum str. R(low)
Aligns to 30:205 / 445 (39.6%), covers 99.4% of PF01595, 134.7 bits

• Comparative genomic analyses of attenuated strains of Mycoplasma gallisepticum
  Szczepanek, Infection and immunity 2010
  • “...gene with no obvious function, the conserved hypothetical gene MGA_0173. Identified in MGA_0173 was a tlyC domain which consists of a duf21 (domain of unknown...”
  • “...and a CBS domain potentially involved in ligand binding. MGA_0173 was also similar to M. pneumoniae tlyC, a gene proposed to encode a hemolysin but noted by...”

LSA0029 Putative ion Mg(2+)/Co(2+) transport protein, hemolysinC-family (NCBI) from Lactobacillus sakei subsp. sakei 23K
Aligns to 10:209 / 447 (44.7%), covers 98.3% of PF01595, 134.3 bits

• Global transcriptome response in Lactobacillus sakei during growth on ribose
  McLeod, BMC microbiology 2011
  • “...ATPase (ATP synthase), C subunit 0.7 Inorganic ion transport and metabolism Transport/binding of inorganic ions LSA0029 lsa0029 Putative ion Mg(2+)/Co(2+) transport protein, hemolysinC-family -0.7 LSA0134 lsa0134 Putative Na(+)/H(+) antiporter -0.6 LSA0180 mtsC Manganese ABC transporter, ATP-binding subunit -0.8 LSA0181 mtsB Manganese ABC transporter, membrane-spanning subunit -0.8...”

Rmet_0698 protein of unknown function DUF21 (NCBI) from Ralstonia metallidurans CH34
Rmet_0698 HlyC/CorC family transporter from Cupriavidus metallidurans CH34
Aligns to 4:195 / 438 (43.8%), covers 99.4% of PF01595, 133.9 bits

• Characterization of the Δ7 Mutant of Cupriavidus metallidurans with Deletions of Seven Secondary Metal Uptake Systems
  Große, mSystems 2016 (no snippet)

Rv1841c hypothetical protein (NCBI) from Mycobacterium tuberculosis H37Rv
Aligns to 8:198 / 345 (55.4%), covers 100.0% of PF01595, 133.6 bits

• A landscape of genomic alterations at the root of a near-untreatable tuberculosis epidemic
  Klopper, BMC medicine 2020
  • “...in glutamine synthesis ( glnE ACG278ACA and glnA2 CTG117TTG) in all AA1SA strains 20903642090443 81 Rv1841c AA1SA Non-essential conserved hypothetical membrane protein 22637792266164 2385 Rv2016 Rv2019 175a 22634482263637 AA1SA, some AA1 Rv2016 , Rv2018 and Rv2019 are non-essential, conserved hypothetical proteins. Rv2017 is a transcriptional regulator,...”
  • “...large deletions observed in all AA1SA isolates (Table 1 ) include an 81-bp deletion in Rv1841c , a 1202-bp deletion from the region glnA3 - Rv1879 and a 2385-bp deletion from Rv2016 - Rv2019 . The latter two deletions encompass Region of Difference (RD) 163 and...”
• Global transcriptional profiling of longitudinal clinical isolates of Mycobacterium tuberculosis exhibiting rapid accumulation of drug resistance
  Chatterjee, PloS one 2013
  • “...(3), Rv3371 (2),Rv3642c (3) Rv2623 (3), MT2466 (8),MT1356 (3), Rv0049 (2),Rv0569 (5), Rv1738 (9),Rv1813c (9), Rv1841c (2),Rv2030c (4.5), Rv2596 (5),Rv2626c (10.5), Rv2694c (9),Rv3615c (2), Rv3831 (2) Rv0626 (2) MT1040.1 (5), Rv0141c (4), Rv0340 (3), Rv0875c (4), Rv0876c (2), Rv1766 (5), Rv2310 (3), Rv3088 (4), Rv3698 (2),...”
• Mature Epitope Density--a strategy for target selection based on immunoinformatics and exported prokaryotic proteins
  Santos, BMC genomics 2013
  • “...10.1016/j.tube.2006.01.014 Rv0436c 78 123 19,14 PSE favorable 10.1074/jbc.M004658200 Rv0116c 117 214 17,61 SEC favorable 10.1099/mic.0.024802-0 Rv1841c 167 308 17,33 PSE favorable 10.1128/jb.184.4.1112-1120.2002 Rv2339 224 437 17,25 PSE favorable 10.1093/molbev/msm111 Rv0589 195 364 17,10 PSE favorable 10.1007/s11010-011-0733-5 Rv1158c 107 189 17,07 SEC favorable 10.1016/j.tube.2004.09.005 Rv0286 129 242...”
• Chromosomal locus that affects pathogenicity of Rhodococcus fascians
  Vereecke, Journal of bacteriology 2002
  • “...acids) showed the highest similarity to hypothetical protein Rv1841c of M. tuberculosis (48% identity and 64% similarity) (5) and to other putative integral...”

MB901379_02511 HlyC/CorC family transporter from Mycobacterium basiliense
Aligns to 8:202 / 349 (55.9%), covers 100.0% of PF01595, 133.3 bits

• Discovery and Characterization of Mycobacterium basiliense sp. nov., a Nontuberculous Mycobacterium Isolated From Human Lungs
  Seth-Smith, Frontiers in microbiology 2018
  • “...to the 29 found within M. marinum . In addition, three haemolysins have been predicted: MB901379_02511, 02512, 03838 , along with many other genes involved in antigen and immunogenic protein production. Polyketide synthesis operons and others involved in non-ribosomal peptide synthesis (NRPS) are known to be...”

Eab7_1596 HlyC/CorC family transporter from Exiguobacterium antarcticum B7
Aligns to 7:199 / 439 (44.0%), covers 98.9% of PF01595, 133.1 bits

• Functional annotation of hypothetical proteins from the Exiguobacterium antarcticum strain B7 reveals proteins involved in adaptation to extreme environments, including high arsenic resistance
  da, PloS one 2018
  • “...YebC-like 68 Eab7_1581 IPR000160 Diguanylate cyclase (GGDEF/EAL domain) 69 Eab7_1590 IPR003744 Vitamin uptake transporter 70 Eab7_1596 IPR000644 Cystathionine-beta synthase associated with the CorC_HlyC domain 71 Eab7_1603 IPR021027 Transposase DNA-binding domain 72 Eab7_1639 IPR017941 Rieske [2Fe-2S] iron-sulfur protein 73 Eab7_1666 IPR006158 Cobalamin (vitamin B12)-binding domain/Transcritional regulator MerR...”

lp_2671 integral membrane protein (NCBI ptt file) from Lactobacillus plantarum WCFS1
Aligns to 10:210 / 455 (44.2%), covers 98.3% of PF01595, 133.1 bits

• Sensitivity to the two peptide bacteriocin plantaricin EF is dependent on CorC, a membrane-bound, magnesium/cobalt efflux protein
  Heeney, MicrobiologyOpen 2019
  • “...described therein. Repeated attempts to delete the corC open reading frame (ORF) in LP8826 (WCFS1 lp_2671) using methods previously established for clean deletions in this strain (Yin et al., 2017 ) or variations of those methods (glycine concentrations, recovery times, voltage, incubation temperature) were equally unsuccessful....”
• Selection and characterization of conditionally active promoters in Lactobacillus plantarum, using alanine racemase as a promoter probe
  Bron, Applied and environmental microbiology 2004
  • “...lp_3418 (pck) lp_1144 (pcrA) lp_3688a (rpmH) lp_3312 lp_2671 lp_2231a lp_3204 (nupC) lp_1599 (folD) lp_2256 (ccpA) lp_0101 lp_3000 lp_3399 (cpd) lp_2793 lp_1512...”

YtfL / b4218 UPF0053 family inner membrane protein YtfL from Escherichia coli K-12 substr. MG1655 (see 3 papers)
ECs5196 putative transport protein (NCBI ptt file) from Escherichia coli O157:H7 str. Sakai
b4218 predicted inner membrane protein (NCBI) from Escherichia coli str. K-12 substr. MG1655
Aligns to 5:197 / 447 (43.2%), covers 99.4% of PF01595, 132.0 bits

• Transcriptomic analysis of Escherichia coli O157:H7 and K-12 cultures exposed to inorganic and organic acids in stationary phase reveals acidulant- and strain-specific acid tolerance responses
  King, Applied and environmental microbiology 2010
  • “...protein 2.3 Predicted inner membrane transport protein ytfL ECs5196 b4218 ACID TOLERANCE RESPONSE OF ESCHERICHIA COLI 6521 nrdH, trxB). Similarly, we observed a...”
• Transcriptomic analysis of Escherichia coli O157:H7 and K-12 cultures exposed to inorganic and organic acids in stationary phase reveals acidulant- and strain-specific acid tolerance responses
  King, Applied and environmental microbiology 2010
  • “...2.3 Predicted inner membrane transport protein ytfL ECs5196 b4218 ACID TOLERANCE RESPONSE OF ESCHERICHIA COLI 6521 nrdH, trxB). Similarly, we observed a...”
• Identification and mapping of self-assembling protein domains encoded by the Escherichia coli K-12 genome by use of lambda repressor fusions
  Mariño-Ramírez, Journal of bacteriology 2004
  • “...b2434 b2549 b2875 b3071 b3193 b3199 b3830 b4212 b4218 COG0393 COG1335 COG2323 COG1335 COG3132 COG1607 COG1349 COG1396 COG3756 COG2812 COG0783 COG0583 COG1609...”

STM4407 putative hemolysin-related protein (NCBI ptt file) from Salmonella typhimurium LT2
t4461 putative membrane protein (NCBI ptt file) from Salmonella enterica subsp. enterica serovar Typhi Ty2
Aligns to 5:197 / 447 (43.2%), covers 100.0% of PF01595, 132.0 bits

• An Essential Factor for High Mg2+ Tolerance of Staphylococcus aureus
  Armitano, Frontiers in microbiology 2016
  • “...CorA. Among the SA0657 orthologs, we identified a paralog of CorB in S. Typhimurium genome (STM4407), whose function is unknown and which was not identified in the cobalt resistance screen by Gibson et al. (1991) . The S. aureus genome additionally encodes SA0780, a paralog to...”
  • “...we performed a phylogenetic analysis of the 3743 predicted orthologs of SA0657, SA0780, StCorB, StCorC, STM4407, human CNNM2 and murin CNNM2 (see Discussion) (Supplementary Figure S4 ). This analysis reveals that SA0657 orthologs are widely distributed in the prokaryotic kingdom and that each phylum often possess...”
• Genome-Wide Profiling of Enterotoxigenic Staphylococcus aureus Strains Used for the Production of Naturally Contaminated Cheeses
  Macori, Genes 2019
  • “...Strain Gene(s) Spa -Type MLST S. aureus ProNaCC1 sed t2953 ST-8 S. aureus ProNaCC2 see t4461 ST-425 S. aureus ProNaCC4 sea t19075 1 ST-581 S. aureus ProNaCC5 seg / sei t164 ST-389 S. aureus ProNaCC6 seh t127 ST-1 S. aureus ProNaCC7 sea / sed / selj...”

ABZJ_01110 HlyC/CorC family transporter from Acinetobacter baumannii MDR-ZJ06
Aligns to 8:199 / 441 (43.5%), covers 100.0% of PF01595, 132.0 bits

• Colistin Resistance in Acinetobacter baumannii MDR-ZJ06 Revealed by a Multiomics Approach
  Hua, Frontiers in cellular and infection microbiology 2017
  • “...protein 1.12706 10.47521 4.03E-13 9.42E-12 ABZJ_01257 Zn-dependent protease with chaperone function 1.13229 6.680195 1.30E-05 9.11E-05 ABZJ_01110 putative hemolysin-related protein 1.13995 9.22038 1.74E-11 3.54E-10 ABZJ_03720 UDP-3-O-acyl-N-acetylglucosamine deacetylase 1.14429 8.585685 1.05E-05 7.52E-05 ABZJ_01960 isochorismate hydrolase 1.14761 5.633402 0.000121 0.000638 ABZJ_00942 hypothetical protein 1.15912 8.72549 8.38E-09 1.17E-07 ABZJ_03859 putative...”

HI0452 conserved hypothetical protein (NCBI ptt file) from Haemophilus influenzae Rd KW20
P44717 UPF0053 protein HI_0452 from Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Aligns to 10:201 / 432 (44.4%), covers 100.0% of PF01595, 130.9 bits

• Antisera Against Certain Conserved Surface-Exposed Peptides of Nontypeable Haemophilus influenzae Are Protective
  Whitby, PloS one 2015
  • “.... 86-026NP locus Gene designation Rd KW20 locus Gene description Probable Type b NTHI0579 ytfL HI0452 Putative hemolysin (probable inner membrane) -helix NTHI0576 HI0449 Conserved hypothetical protein Amorphous NTHI0560 comE HI0435 Outer membrane secretin ComE Amorphous NTHI0522 ompP1 HI0401 Outer membrane protein P1 -barrel NTHI0509 yeaY...”
• Structure-based functional annotation of putative conserved proteins having lyase activity from Haemophilus influenzae
  Shahbaaz, 3 Biotech 2015
  • “...no Gene ID Protein product Uniprot ID Protein name 1 NC_000907.1 949660 NP_438613.1 P44717 HP HI0452 2 NC_000907.1 950684 NP_438775.1 P44782 HP HI0617 3 NC_000907.1 950339 NP_439586.2 P44197 HP HI1435 4 NC_000907.1 950454 NP_439740.1 P45267 HP HI1598 5 NC_000907.1 950030 NP_439212.1 Q57498 HP HI1053 6 NC_000907.1...”
• Functional annotation of conserved hypothetical proteins from Haemophilus influenzae Rd KW20
  Shahbaaz, PloS one 2013
  • “...protein 71. HP HI0449 949746 P43997 Prokaryotic membrane lipoprotein lipid attachment site profile 72. HP HI0452 949660 P44717 cystathionine-beta-synthase CBS domain protein 73. HP HI0454 949545 P44718 TatD type deoxyribonuclease 74. HP HI0457 950653 P44720 aminodeoxychorismate lyase 75. HP HI0466 949552 P44000 Aminomethyltransferase folate-binding domain family...”
• Structure-based functional annotation of putative conserved proteins having lyase activity from Haemophilus influenzae
  Shahbaaz, 3 Biotech 2015
  • “...no. Accession no Gene ID Protein product Uniprot ID Protein name 1 NC_000907.1 949660 NP_438613.1 P44717 HP HI0452 2 NC_000907.1 950684 NP_438775.1 P44782 HP HI0617 3 NC_000907.1 950339 NP_439586.2 P44197 HP HI1435 4 NC_000907.1 950454 NP_439740.1 P45267 HP HI1598 5 NC_000907.1 950030 NP_439212.1 Q57498 HP HI1053...”
  • “...). ROBETTA server (Kim et al. 2004 ) was used for structure prediction of HP P44717, which uses ab initio or de novo methods to predict the structure of proteins whose structural analogs do not exist in the PDB or could not be successfully identified by...”
• Functional annotation of conserved hypothetical proteins from Haemophilus influenzae Rd KW20
  Shahbaaz, PloS one 2013
  • “...HP HI0449 949746 P43997 Prokaryotic membrane lipoprotein lipid attachment site profile 72. HP HI0452 949660 P44717 cystathionine-beta-synthase CBS domain protein 73. HP HI0454 949545 P44718 TatD type deoxyribonuclease 74. HP HI0457 950653 P44720 aminodeoxychorismate lyase 75. HP HI0466 949552 P44000 Aminomethyltransferase folate-binding domain family protein 76....”
  • “...lyase enzymes. These are important for the virulence of pathogen in host [76] . The P44717 protein is a cystathionine -lyase, an enzyme which forms the cystathionine intermediate in cysteine biosynthesis, may be considered as the target for pyridiamine anti-microbial agents [86] . Similarly, isocitrate lyase...”
• Concordance analysis of microbial genomes
  Bruccoleri, Nucleic acids research 1998
  • “...residues of an 440 amino acid protein YTFL_HAEIN SW: P44717 unknown. N.B. f474; similar to BCHE_RHOCA SW: P26168; similar to LEXA_PSEPU SW: P37453 unknown. N.B....”

GOX0169 Hypothetical membrane-spanning protein (NCBI) from Gluconobacter oxydans 621H
Aligns to 19:213 / 449 (43.4%), covers 99.4% of PF01595, 130.7 bits

• Combinatorial metabolic engineering of industrial Gluconobacter oxydans DSM2343 for boosting 5-keto-D-gluconic acid accumulation
  Yuan, BMC biotechnology 2016
  • “...the par-rep gene pr_SalI_R ACGC GTCGAC ggtgtttaaacagtgttacggt 0169_SacI_F ATA GAGCTC tgaaagcggctggcgcgt Amplify the 5-UTR of GOX0169 promoter 0169_XbaI_R GC TCTAGA gcggaaggcgttataccctga 0264_SacI_F ATA GAGCTC gttgcgcctgaatgagagg Amplify the 5-UTR of GOX0264 promoter 0264_XbaI_R GC TCTAGA ttcggtctccctcgccgtaa 0452_SacI_F ATA GAGCTC ggcttcgtggtgaacgcc Amplify the 5-UTR of GOX0452 promoter 0452_XbaI_R...”

BBCT_0013 HlyC/CorC family transporter from Bifidobacterium catenulatum DSM 16992 = JCM 1194 = LMG 11043
Aligns to 8:200 / 443 (43.6%), covers 93.8% of PF01595, 130.4 bits

• Analysis of Temporal Changes in Growth and Gene Expression for Commensal Gut Microbes in Response to the Polyphenol Naringenin
  Firrman, Microbiology insights 2018
  • “...Dipeptide ABC transporter permease component 1.5 Molecular transport BBCT_1680 Galactoside transport protein 1.5 Molecular transport BBCT_0013 Conserved hypothetical protein 1.5 Unknown BBCT_1574 N -acetylglucosamine-6-phosphate deacetylase 1.5 Metabolism BBCT_0175 6-phosphogluconate dehydrogenase-like protein 1.5 Metabolism BBCT_0364 Conserved hypothetical protein 1.5 Unknown BBCT_0688 Conserved hypothetical protein 1.5 Unknown BBCT_0180...”

HMPREF0877_RS09670 HlyC/CorC family transporter from Weissella paramesenteroides ATCC 33313
Aligns to 11:205 / 458 (42.6%), covers 98.9% of PF01595, 130.4 bits

• The controversial nature of the Weissella genus: technological and functional aspects versus whole genome analysis-based pathogenic potential for their application in food and health
  Abriouel, Frontiers in microbiology 2015
  • “...(WOSG25_200030, WOSG25_200040) 3 hemolysins (WOSG25 150280, WOSG25_RS09625, WOSG25_RS09635) W. paramesenteroides ATCC 33313 2 Hly (HMPREF0877_RS09665, HMPREF0877_RS09670) W. thailandensis fsh4-2 2 Hly (WT2_01519, WT2_01520) The role of the genes above in the virulence of Weissella is still unknown. Further studies are needed to confirm whether these virulence...”

cg1640 CBS domain-containing protein (RefSeq) from Corynebacterium glutamicum ATCC 13032
Aligns to 11:206 / 460 (42.6%), covers 98.3% of PF01595, 130.2 bits

• The alternative sigma factor SigB of Corynebacterium glutamicum modulates global gene expression during transition from exponential growth to stationary phase
  Larisch, BMC genomics 2007
  • “...porin precursor -1.84 cg1349 membrane protein, CBS domain -1.79 cg1639 membrane protein, CBS domain -1.23 cg1640 membrane protein, CBS domain -1.52 cg2467 ABC-transporter ATP-binding protein -1.33 cg2468 ABC-transporter permease component -1.26 cg2511 putative membrane protein -1.80 cg3175 membrane protein -1.36 cg3195 flavin-containing monooxygenase involved in K...”

AT2G14520 CBS domain-containing protein (RefSeq) from Arabidopsis thaliana
Aligns to 17:191 / 423 (41.4%), covers 98.3% of PF01595, 130.0 bits

• Genome-wide identification of pistil-specific genes expressed during fruit set initiation in tomato (Solanum lycopersicum)
  Ezura, PloS one 2017
  • “...protein expressed (Fragment) (AHRD V1 *A6N095_ORYSI); contains Interpro domain(s) IPR002550 Protein of unknown function DUF21 AT2G14520 423 283/423 67 CBS domain-containing protein with a domain of unknown function (DUF21) 29 Solyc02g093540 Cytochrome P450 AT3G50660 513 193/470 41 DWF4, CYP90B1, CLM, SNP2, SAV1, PSC1 30 Solyc03g020000 Pentatricopeptide...”

AT4G33700 CBS domain-containing protein (RefSeq) from Arabidopsis thaliana
Aligns to 17:191 / 424 (41.3%), covers 97.7% of PF01595, 129.8 bits

• Quantitative phosphoproteomic analysis reveals common regulatory mechanisms between effector- and PAMP-triggered immunity in plants
  Kadota, The New phytologist 2019
  • “...nd 0.32 nd Not quantified *3 S169 3.02 0.20 Not quantified *3 CBS domain-containing protein (AT4G33700) S331 5.65 1.11 1.07 0.66 1.8 *1 T336 5.96 0.70 2.9 *1 S/T-P *8 PEARLI 4 (AT2G16900) S63 9.95 nd 1.33 nd 4.2 *1 S/T-P *8 AHA1 (AT2G18960) T948 0.10...”

SCO3764 integral membrane protein (NCBI) from Streptomyces coelicolor A3(2)
Aligns to 7:201 / 341 (57.2%), covers 95.5% of PF01595, 129.6 bits

• Conservation of thiol-oxidative stress responses regulated by SigR orthologues in actinomycetes
  Kim, Molecular microbiology 2012
  • “...6 SCO3451 * rsrA2-1 Putative ZAS (zinc-containing anti-sigma) factor 14 SCO3509 * Hypothetical protein 7 SCO3764 Integral membrane protein (A) 7 SCO3765 * Possible integral membrane protein with CBS domain 14 SCO3766 * Hypothetical protein 14 SCO3767 * Hypothetical protein, similar to tellurite resistance protein TerB...”

ESE_RS11605 HlyC/CorC family transporter from Weissella cibaria KACC 11862
Aligns to 11:205 / 456 (42.8%), covers 98.9% of PF01595, 129.6 bits

• The controversial nature of the Weissella genus: technological and functional aspects versus whole genome analysis-based pathogenic potential for their application in food and health
  Abriouel, Frontiers in microbiology 2015
  • “...05547, WCNC 06207) 1 PA-ADHE 1 MBP (WCNC_01840) W. cibaria KACC 11862 2 Hly (ESE_RS0108795, ESE_RS11605) W. confusa LBAE C39-2 1 (WEISSC39_RS00260) 2 Hly (WEISSC39_RS08935, WEISSC39_RS08940) 1 MBP (WEISSC39_RS05980) W. halotolerans DSM 20190 2 Hly (G414_RS0106810, G414_RS0106815) W. hellenica Wikim14 2 Hly (TY24_RS08990, TY24_RS08995) W. koreensis...”

Q7VKS4 Uncharacterized protein from Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Aligns to 8:199 / 429 (44.8%), covers 100.0% of PF01595, 129.4 bits

• Structure-based functional annotation of putative conserved proteins having lyase activity from Haemophilus influenzae
  Shahbaaz, 3 Biotech 2015
  • “...influenzae using the STRING database. Figure S2 : Multiple sequence alignment of (A). P44717 and Q7VKS4 show three metal binding sites at residues Asp, Thr and Glu. (B). P44717 and Q87DZ3 displaying metal binding sites at Asp residues. (C). P44717 and Q8EDE1 presenting AMP binding site...”

BHWA1_RS02885 HlyC/CorC family transporter from Brachyspira hyodysenteriae WA1
Aligns to 12:201 / 462 (41.1%), covers 98.9% of PF01595, 128.7 bits

• Differential expression of hemolysin genes in weakly and strongly hemolytic Brachyspira hyodysenteriae strains
  Joerling, BMC veterinary research 2020
  • “...Hemolysin activation protein, Hemolysin channel protein, and Hemolysin, which are encoded by locus tags BHWA1_RS02195, BHWA1_RS02885, BHWA1_RS0905, and BHWA1_RS0470 of the whole genome sequenced B. hyodysenteriae strain WA1 (NCBI Reference Sequence NC_012225.1) has been predicted in silico. By comparing their nucleotide sequences with that of hemolysin...”
  • “...significantly downregulated in strain B204 ( p -value 0.001). The hemolysin activation protein gene ( BHWA1_RS02885 ) was upregulated ( p -value >0.05) at the first time point in both strains. During the third and fourth time point transcription increased by 100% in the shBh B204....”
• Phylogenetic diversity, antimicrobial susceptibility and virulence gene profiles of Brachyspira hyodysenteriae isolates from pigs in Germany
  Joerling, PloS one 2018
  • “...with virulence and encode for hemolysins ( tlyA , tlyB , tlyC , hlyA , BHWA1_RS02885 , BHWA1_RS09085 , BHWA1_RS04705 , and BHWA1_RS02195 ), outer membrane proteins (OMPs) ( bhlp16 , bhlp17 . 6 , bhlp29 . 7 , bhmp39f , and bhmp39h ) as well...”
  • “...be detected. Sequence analysis of hemolysin genes of selected isolates revealed co-evolution of tlyB , BHWA1_RS02885 , BHWA1_RS09085 , and BHWA1_RS02195 with the core genome and suggested independent evolution of tlyA , tlyC , and hlyA . Our data indicate that in Germany, swine dysentery might...”
• An avirulent Brachyspira hyodysenteriae strain elicits intestinal IgA and slows down spread of swine dysentery
  Mahu, Veterinary research 2017
  • “...identical amino acid substitutions (positions 81, 113, 164, 227, 265) in the haemolysin activation protein BHWA1_RS02885 and eight identical amino acid substitutions in the haemolysin III protein BHWA1_RS02195 (positions 47, 49, 56, 79, 82, 111, 114, 133). For strain JR11 two additional amino acid substitutions were...”
• Variation in hemolytic activity of Brachyspira hyodysenteriae strains from pigs
  Mahu, Veterinary research 2016
  • “...24 ], has a conserved domain composing an integral membrane protein. The hemolysin activation protein (BHWA1_RS02885) [ 24 ], shares conserved domains with hemolysin C. We previously mentioned the existence of B. hyodysenteriae strains with an aberrant hemolytic phenotype [ 28 ]. In 1982, Lysons et...”
  • “...hlyA , tlyA , tlyB , tlyC , hemolysin III (BHWA1_RS02195) , hemolysin activation protein (BHWA1_RS02885) , and hemolysin III channel protein (BHWA1_RS09085) genes were determined for all B. hyodysenteriae strains. For hlyA , the ACP1-Fo and ACP1-Re primers were used as described by Barth et...”

CNNM3_CAEEL / A0A131MCZ8 Metal transporter cnnm-3; CNNM family homolog 3 from Caenorhabditis elegans (see paper)
NP_001309670 Metal transporter cnnm-3 from Caenorhabditis elegans
Aligns to 202:374 / 797 (21.7%), covers 95.5% of PF01595, 128.6 bits

• function: Probable metal transporter. Probably acts redundantly with the other metal transport proteins cnnm-1, cnnm-2, cnnm-4 and cnnm-5 to regulate Mg(2+) homeostasis. Promotes postembryonic gonad development by regulating Mg(2+) levels, probably via AMPK signaling.
  disruption phenotype: No visible phenotype. Double knockout with cnnm-1 results in increased levels of intestinal Mg(2+) and reduced levels in other tissues. This Mg(2+) deficiency in tissues leads to a reduced lifespan, 100% sterility, and smaller animals that exhibit a developmental delay with defective gonad development and which therefore do not produce oocytes or form vulva. In addition, the gonad development defect in the cnnm-1 and cnnm-3 double knockout is rescued when the AMPK alpha subunit aak-2 is also knocked out. Double knockout with cnnm-2 results in 22% sterility. Quintuple knockout with cnnm-1, cnnm-2, cnnm-4 and cnnm-5 results in a reduced lifespan and 100% sterility.
• Mg2+ Extrusion from Intestinal Epithelia by CNNM Proteins Is Essential for Gonadogenesis via AMPK-TORC1 Signaling in Caenorhabditis elegans.
  Ishii, PLoS genetics 2016
  • GeneRIF: he results revealed that RNAi-mediated inactivation of several genes restores gonad elongation, including aak-2, which encodes the catalytic subunit of AMP-activated protein kinase (AMPK). We then generated triple mutant worms for cnnm-1; cnnm-3; aak-2 and confirmed that the aak-2 mutation also suppressed the defective gonadal elongation in cnnm-1; cnnm-3 mutant worms.

PA3748 hypothetical protein (NCBI) from Pseudomonas aeruginosa PAO1
Aligns to 11:189 / 430 (41.6%), covers 84.1% of PF01595, 128.2 bits

• Fitness of isogenic colony morphology variants of Pseudomonas aeruginosa in murine airway infection
  Rakhimova, PloS one 2008
  • “...PA2122 A - Hypothetical protein PA3462 A - Probable sensor/response regulator hybrid, transcriptional regulatory protein PA3748 A - Conserved hypothetical protein; putative magnesium and cobalt transporter (CorB) PA4190 A + pqsL Probable FAD-dependent monooxygenase PA4489 A - Conserved hypothetical protein PA5524 A - Probable short-chain dehydrogenase...”
  • “...+ A not A; wild type PAO1 PA3462 ++ A not A; wild type PAO1 PA3748 ++ A not A; wild type PAO1 PA4190 ++ A A PA4489 ++ A not A; wild type PAO1 PA0999 ++ B B PA1003 ++ B B PA2361 ++ B...”
• Reverse engineering antibiotic sensitivity in a multidrug-resistant Pseudomonas aeruginosa isolate
  Struble, Antimicrobial agents and chemotherapy 2006
  • “...PA3153 PA3157 PA3158 PA3159 PA3160 PA3176 PA3337 PA3514 PA3748 PA3753 PA4020 PA4501 PA4503 PA4514 PA4996 PA5265 Pae AF035937cds10 a Pae AF035937cds11 a Pae...”

TY24_RS08990 HlyC/CorC family transporter from Weissella hellenica
Aligns to 11:205 / 455 (42.9%), covers 98.9% of PF01595, 128.1 bits

• The controversial nature of the Weissella genus: technological and functional aspects versus whole genome analysis-based pathogenic potential for their application in food and health
  Abriouel, Frontiers in microbiology 2015
  • “...MBP (WEISSC39_RS05980) W. halotolerans DSM 20190 2 Hly (G414_RS0106810, G414_RS0106815) W. hellenica Wikim14 2 Hly (TY24_RS08990, TY24_RS08995) W. koreensis KACC 15510 W. koreensis KCTC 3621 2 Hly (JC2156_RS08435, JC2156_10680) W. oryzae SG25 2 AGS (WOSG25_200030, WOSG25_200040) 2 Asa1/PrgB (WOSG25_200030, WOSG25_200040) 3 hemolysins (WOSG25 150280, WOSG25_RS09625, WOSG25_RS09635)...”

WEISSC39_RS08940 HlyC/CorC family transporter from Weissella confusa LBAE C39-2
Aligns to 12:205 / 453 (42.8%), covers 98.9% of PF01595, 127.8 bits

• The controversial nature of the Weissella genus: technological and functional aspects versus whole genome analysis-based pathogenic potential for their application in food and health
  Abriouel, Frontiers in microbiology 2015
  • “...KACC 11862 2 Hly (ESE_RS0108795, ESE_RS11605) W. confusa LBAE C39-2 1 (WEISSC39_RS00260) 2 Hly (WEISSC39_RS08935, WEISSC39_RS08940) 1 MBP (WEISSC39_RS05980) W. halotolerans DSM 20190 2 Hly (G414_RS0106810, G414_RS0106815) W. hellenica Wikim14 2 Hly (TY24_RS08990, TY24_RS08995) W. koreensis KACC 15510 W. koreensis KCTC 3621 2 Hly (JC2156_RS08435, JC2156_10680)...”

MSMEG_3637 CBS domain protein (NCBI) from Mycobacterium smegmatis str. MC2 155
Aligns to 18:213 / 461 (42.5%), covers 98.3% of PF01595, 127.4 bits

• Regulatory genes coordinating antibiotic-induced changes in promoter activity and early transcriptional termination of the mycobacterial intrinsic resistance gene whiB7
  Burian, Molecular microbiology 2018 (PubMed)
  • “...gene, MSMEG_4060. A pair of hypothetical genes, MSMEG_3637 and MSMEG_3638, were identified as important contributors to whiB7 promoter induction on antibiotic...”
  • “...and the pair of potentially overlapping genes MSMEG_3637 and MSMEG_3638. Whether these hypothetical genes or asnB promote resistance through WhiB7 rather...”

XP_005269990 metal transporter CNNM2 isoform X1 from Homo sapiens
Aligns to 260:431 / 564 (30.5%), covers 99.4% of PF01595, 126.7 bits

• Associations between polymorphisms of the CXCL12 and CNNM2 gene and hypertension risk: A case-control study.
  Liu, Gene 2018 (PubMed)
  • GeneRIF: CNNM2 single nucleotide polymorphisms association with the risk of hypertension in Chinese Han population.
• The cyclic nucleotide-binding homology domain of the integral membrane protein CNNM mediates dimerization and is required for Mg2+ efflux activity.
  Chen, The Journal of biological chemistry 2018
  • GeneRIF: This study determined the first crystal structures of the cyclic nucleotide-binding homology (CNBH) domain domains of CNNM2 and CNNM3 at 2.6 and 1.9 A resolutions.
• Genome-wide significant schizophrenia risk variation on chromosome 10q24 is associated with altered cis-regulation of BORCS7, AS3MT, and NT5C2 in the human brain.
  Duarte, American journal of medical genetics. Part B, Neuropsychiatric genetics : the official publication of the International Society of Psychiatric Genetics 2016
  • GeneRIF: this study implicates altered neural expression of BORCS7, AS3MT, and NT5C2 in susceptibility to schizophrenia arising from genetic variation at the chromosome 10q24 locus
• Human CNNM2 is not a Mg(2+) transporter per se.
  Sponder, Pflugers Archiv : European journal of physiology 2016 (PubMed)
  • GeneRIF: Sensitivity of CNNM2 expression to extracellular Mg(2+) depletion depends on cell type.
• Two-stage replication of previous genome-wide association studies of AS3MT-CNNM2-NT5C2 gene cluster region in a large schizophrenia case-control sample from Han Chinese population.
  Guan, Schizophrenia research 2016 (PubMed)
  • GeneRIF: In this large-scale, Han Chinese population-based genetic association study for genetic susceptibility to schizophrenia of a three-gene cluster region, AS3MT-CNNM2-NT5C2, two SNPs with independent effects, rs11191419 and rs11191514, were identified. Rs11191419 is located on the 5' (potential promoter) region of AS3MT, while rs11191514 is located in one of the introns of CNNM2.
• Evaluation of genetic risk loci for intracranial aneurysms in sporadic arteriovenous malformations of the brain.
  Kremer, Journal of neurology, neurosurgery, and psychiatry 2015
  • GeneRIF: meta-analysis of two Caucasian cohorts did not show an association between five aneurysm associated loci and sporadic brain Arteriovenous malformations.
• Effects of a novel schizophrenia risk variant rs7914558 at CNNM2 on brain structure and attributional style.
  Rose, The British journal of psychiatry : the journal of mental science 2014 (PubMed)
  • GeneRIF: This CNNM2 risk variant rs7914558 may have an impact on neural systems relevant to social cognition.
• CNNM2 mutations cause impaired brain development and seizures in patients with hypomagnesemia.
  Arjona, PLoS genetics 2014
  • GeneRIF: Cells expressing mutated CNNM2 proteins did not show increased Mg(2+) uptake.
• More

CNNM4_CAEEL / Q17586 Metal transporter cnnm-4; CNNM family homolog 4 from Caenorhabditis elegans (see paper)
Aligns to 116:294 / 467 (38.3%), covers 90.3% of PF01595, 126.4 bits

• function: Probable metal transporter. Probably acts redundantly with the other metal transport proteins cnnm-1, cnnm-2, cnnm-3 and cnnm-5 to regulate Mg(2+) homeostasis.
  disruption phenotype: No visible phenotype. Quintuple knockout with cnnm-1, cnnm-2, cnnm-3 and cnnm-5 results in a reduced lifespan and 100% sterility.

AT4G14240 hypothetical protein (RefSeq) from Arabidopsis thaliana
Aligns to 40:213 / 494 (35.2%), covers 98.9% of PF01595, 126.3 bits

• Comparative Transcriptomics Among Four White Pine Species
  Baker, G3 (Bethesda, Md.) 2018
  • “...bel1-like homeodomain protein 1 2517 DNA binding cbs domain-containing protein cbsx6 1311 duf21 domain-containing protein at4g14240 1623 probable wrky transcription factor 14 1431 myeloid leukemia factor 1-like isoform x2 1059 mannose-1-phosphate guanylyltransferase 1 948 phytoene synthase chloroplastic 1308 geranylgeranyl-diphosphate geranylgeranyltransferase activity; phytoene synthase activity unknown 336...”
• Characterization of the plasma membrane proteins and receptor-like kinases associated with secondary vascular differentiation in poplar
  Song, Plant molecular biology 2011
  • “...3 2 2 85234 At3g57880 C 2 domain-containing protein FU498 gw1.VIII.297.1 3 0 2 51259 At4g14240 CBS domain-containing protein FU50* gw1.X.4147.1 3 3 0 54367 At4g14240 CBS domain-containing protein FU215 fgenesh4_pg.C_scaffold_70000199 1 6 7 18462 No hit Duf1068 FU559 gw1.X.1601.1 1 0 2 43883 At2g40320 Duf213...”

RT0697 conserved hypothetical protein (NCBI) from Rickettsia typhi str. wilmington
Aligns to 7:184 / 424 (42.0%), covers 98.9% of PF01595, 126.2 bits

• Characterization of Sec-translocon-dependent extracytoplasmic proteins of Rickettsia typhi
  Ammerman, Journal of bacteriology 2008
  • “...RT0551 RT0561 RT0565 RT0601 RT0667 RT0692 RT0694 RT0697 RT0699 RT0279 RT0281 RT0711 RT0733 RT0758 RT0761 RT0767 Peptidoglycan-associated lipoprotein Pal...”
  • “...RT0103 RT0711 RT0057 RT0825 RT0399 RT0355 RT0080 RT0406 RT0697 RT0224 RT0291 RT0438 RT0052 RT0263 RT0029 RT0056 RT0312 RT0733 RT0810 RT0218 RT0390 RT0301 RT0393...”

AT1G47330 hypothetical protein (RefSeq) from Arabidopsis thaliana
Aligns to 17:191 / 527 (33.2%), covers 96.0% of PF01595, 125.9 bits

• Candidate genes for first flower node identified in pepper using combined SLAF-seq and BSA
  Zhang, PloS one 2018
  • “...NR CA12g15090 DNA-directed RNA polymerase subunit beta COG, GO, Swissprot, NR CA12g15100 DUF21 domain-containing protein At1g47330 COG, GO, Swissprot, NR CA12g15110 Transmembrane protein 87A GO, Swissprot, NR CA12g15120 Uncharacterized protein LOC101260122 NR CA12g15130 25.3 kDa vesicle transport protein COG, GO, KEGG, Swissprot, NR CA12g15140 Uncharacterized protein...”

F1S849 Cyclin and CBS domain divalent metal cation transport mediator 2 from Sus scrofa
Aligns to 260:431 / 853 (20.2%), covers 99.4% of PF01595, 125.9 bits

• Quantitative Proteomic Analysis of Porcine Intestinal Epithelial Cells Infected with Porcine Deltacoronavirus Using iTRAQ-Coupled LC-MS/MS
  Zhou, Journal of proteome research 2020
  • “...17.1 0.0282 Cysteine-type endopeptidase inhibitor activity Cyclin and CBS domain divalent metal cation transport mediator2 F1S849 0.33 1 1.1 0.0173 Adenylnucleotide binding Protein-serine/threonine kinase F1S069 0.34 4 8.2 0.0247 Protein serine/threonine kinase activity Aamy domain-containing protein F1S5K2 0.34 1 2.5 0.0390 Catalytic activity; amino acid transport...”

CNNM2_HUMAN / Q9H8M5 Metal transporter CNNM2; Ancient conserved domain-containing protein 2; Cyclin-M2 from Homo sapiens (Human) (see 2 papers)
Aligns to 260:431 / 875 (19.7%), covers 99.4% of PF01595, 125.8 bits

• function: Divalent metal cation transporter. Mediates transport of divalent metal cations in an order of Mg(2+) > Co(2+) > Mn(2+) > Sr(2+) > Ba(2+) > Cu(2+) > Fe(2+) (By similarity).
• Novel variant in the CNNM2 gene associated with dominant hypomagnesemia.
  García-Castaño, PloS one 2020
  • “...] or regulate other proteins that transport Mg2+ [ 11 ]. The CNNM2 protein (UniProtKB: Q9H8M5) structurally contains an N-terminal extracellular domain (1250 amino acids) with a large signal peptide (64 amino acids) and one glycosylation site (asparagine residue N112) [ 12 ]; a transmembrane domain...”
• CNNM2 mutations cause impaired brain development and seizures in patients with hypomagnesemia.
  Arjona, PLoS genetics 2014
  • “...plus (+) sign, respectively. (B) Localization of the mutations in the CNNM2 protein structure (Uniprot Q9H8M5). CNNM2 contains a long signal peptide (64 amino acids) that is cleaved at the membrane of the endoplasmic reticulum. The remaining part of the CNNM2 protein is trafficked to the...”
  • “...of the most promising candidate gene CNNM2 were sequenced from both strands (Genbank: NM_017649.4, Uniprot: Q9H8M5). After discovery of a homozygous mutation in the index family F1, the mutational screening was extended to patients with hypomagnesemia without mutations in known genes involved in hereditary magnesium wasting....”
• Purification, crystallization and preliminary crystallographic analysis of the CBS-domain pair of cyclin M2 (CNNM2).
  Gómez-García, Acta crystallographica. Section F, Structural biology and crystallization communications 2012
• Purification, crystallization and preliminary crystallographic analysis of the CBS-domain protein MJ1004 from Methanocaldococcus jannaschii
  Oyenarte, Acta crystallographica. Section F, Structural biology and crystallization communications 2011
  • “...Q57564; 11, Q59011; 12, Q58069; 13, Q58332. Homo sapiens: 1, Q9H8M5; 2, Q6P4Q7; 3, Q8NE01; 4, P51798; 5, P51790; 6, P51795; 7, P12268; 8, P51800; 9, P51793; 10,...”

CNNM2_MOUSE / Q3TWN3 Metal transporter CNNM2; Ancient conserved domain-containing protein 2; mACDP2; Cyclin-M2 from Mus musculus (Mouse) (see 3 papers)
Q3TWN3 cystathionine beta-synthase (EC 4.2.1.22) from Mus musculus (see paper)
Aligns to 260:431 / 875 (19.7%), covers 99.4% of PF01595, 125.8 bits

• function: Divalent metal cation transporter. Mediates transport of divalent metal cations in an order of Mg(2+) > Co(2+) > Mn(2+) > Sr(2+) > Ba(2+) > Cu(2+) > Fe(2+).
  subunit: Isoform 1 and isoform 2 may interact with each other
• Membrane topology and intracellular processing of cyclin M2 (CNNM2).
  de, The Journal of biological chemistry 2012
• Purification, crystallization and preliminary crystallographic analysis of the CBS-domain pair of cyclin M2 (CNNM2).
  Gómez-García, Acta crystallographica. Section F, Structural biology and crystallization communications 2012

AT5G52790 CBS domain-containing protein-related (RefSeq) from Arabidopsis thaliana
Aligns to 18:192 / 500 (35.0%), covers 98.9% of PF01595, 125.7 bits

• A willow sex chromosome reveals convergent evolution of complex palindromic repeats
  Zhou, Genome biology 2020
  • “...AGO4 ( ARGONAUTE 4 , siRNA mediated gene silencing) NA NA ACDP 1 Sapur.15WG074900 Chr17 AT5G52790 [d] CBS domain protein with DUF21 (transmembrane transporter) Potri.017G147900 83.33 DPRIM 2 Sapur.15WG074500 Chr17 AT5G52800 DNA primase Potri.017G148000 92.52 Sapur.15WG074800 DUF789 2 Sapur.15WG074600 Chr17 AT1G03610 DUF789 (protein of unknown function)...”
• Integrated bioinformatics analysis of As, Au, Cd, Pb and Cu heavy metal responsive marker genes through Arabidopsis thaliana GEO datasets
  Niu, PeerJ 2019
  • “...genes were AT3G46270, ATCSLB05, AT3G19030, COL9, BCAT4, ELF4, CYP83A1, AT1G76800, AT1G61740, CLE6, AT4G01440, AT1G72200, MOT1, AT5G52790, AT4G40070, AT4G25250, EXGE-A1, NR1, AT5G19970 and CYP735A2 ( Table 2 ). Additionally, the top 20 most significantly down-regulated genes were DIN2, WRKY75, AT4G15120, CYP81F2, AT1G73480, AT1G72900, PGPS1, AT5G06730, AT1G35910, CYP81D8,...”
  • “...names Up-regulated AT3G46270 ATCSLB05 AT3G19030 COL9 BCAT4 ELF4 CYP83A1 AT1G76800 AT1G61740 CLE6 AT4G01440 AT1G72200 MOT1 AT5G52790 AT4G40070 AT4G25250 EXGT-A1 NR1 AT5G19970 CYP735A2 AT3G59370 AT3G25790 PIP2;4 AT4G16447 AT1G22500 NIR1 AT5G06610 CER4 AT1G12080 AT4G31910 LAX3 AT1G33340 LCR69 UCC1 ENODL8 GA3OX1 AT4G39070 CYP93D1 AT1G21440 AT4G01140 CKX4 AT3G12900 RVE2 AT3G20015...”

ATP_00276 probable hemolysin (RefSeq) from Candidatus Phytoplasma mali
Aligns to 1:176 / 428 (41.1%), covers 98.3% of PF01595, 125.1 bits

• Analysis of expressed genes of the bacterium 'Candidatus phytoplasma Mali' highlights key features of virulence and metabolism
  Siewert, PloS one 2014
  • “...of the methionine transport system (ATP_00192), type IVB secretion system IcmE protein (ATP_00087), hemolysin-like protein (ATP_00276) and the Zn-dependent protease TldD (ATP_00323). In addition, six expressed proteins identified by the proteomic approach are predicted to be secreted via the Sec -dependent secretion system. Five of them...”

PITG_03105 metal transporter, putative from Phytophthora infestans T30-4
Aligns to 55:233 / 298 (60.1%), covers 99.4% of PF01595, 123.6 bits

• Lifestyle, gene gain and loss, and transcriptional remodeling cause divergence in the transcriptomes of Phytophthora infestans and Pythium ultimum during potato tuber colonization
  Ah-Fong, BMC genomics 2017
  • “...expression while zero expression was seen for PYU1_G014841. In a second ortholog pair, PYU1_G000638 and PITG_03105 show moderate and zero expression, respectively. The ortholog assignments in this family are supported by synteny. The transcriptional network that regulates the family thus appears to have become rewired during...”

JC2156_10680, JC2156_RS08435 HlyC/CorC family transporter from Weissella koreensis KCTC 3621
Aligns to 10:205 / 458 (42.8%), covers 99.4% of PF01595, 123.4 bits

• The controversial nature of the Weissella genus: technological and functional aspects versus whole genome analysis-based pathogenic potential for their application in food and health
  Abriouel, Frontiers in microbiology 2015
  • “...2 Hly (TY24_RS08990, TY24_RS08995) W. koreensis KACC 15510 W. koreensis KCTC 3621 2 Hly (JC2156_RS08435, JC2156_10680) W. oryzae SG25 2 AGS (WOSG25_200030, WOSG25_200040) 2 Asa1/PrgB (WOSG25_200030, WOSG25_200040) 3 hemolysins (WOSG25 150280, WOSG25_RS09625, WOSG25_RS09635) W. paramesenteroides ATCC 33313 2 Hly (HMPREF0877_RS09665, HMPREF0877_RS09670) W. thailandensis fsh4-2 2 Hly...”
  • “...Wikim14 2 Hly (TY24_RS08990, TY24_RS08995) W. koreensis KACC 15510 W. koreensis KCTC 3621 2 Hly (JC2156_RS08435, JC2156_10680) W. oryzae SG25 2 AGS (WOSG25_200030, WOSG25_200040) 2 Asa1/PrgB (WOSG25_200030, WOSG25_200040) 3 hemolysins (WOSG25 150280, WOSG25_RS09625, WOSG25_RS09635) W. paramesenteroides ATCC 33313 2 Hly (HMPREF0877_RS09665, HMPREF0877_RS09670) W. thailandensis fsh4-2 2...”

BP951000_0473 HlyC/CorC family transporter from Brachyspira pilosicoli 95/1000
Aligns to 12:200 / 460 (41.1%), covers 96.6% of PF01595, 123.1 bits

• The complete genome sequence of the pathogenic intestinal spirochete Brachyspira pilosicoli and comparison with other Brachyspira genomes
  Wanchanthuek, PloS one 2010
  • “...tlyB , BP951000_1802), hemolysin C ( tlyC , BP951000_1288), hemolysin related protein ( hly , BP951000_0473), acyl carrier protein: contains beta-hemolysin ( acpP or hylA , BP951000_0533), putative hemolysin III (BP951000_0424), and putative channel protein hemolysin III family protein (BP951000_0888). The eighth was a putative hemolysin...”

Gilli_1841 gliding motility-associated protein GldE from Gillisia limnaea DSM 15749
Aligns to 23:208 / 440 (42.3%), covers 98.9% of PF01595, 122.2 bits

• Genome sequence of the Antarctic rhodopsins-containing flavobacterium Gillisia limnaea type strain (R-8282(T))
  Riedel, Standards in genomic sciences 2012
  • “...( gld A (Gilli_1140), gld B (Gilli_2923), gld C (Gilli_2942), gld D (Gilli_1840), gld E (Gilli_1841), gld F (Gilli_3447), gld G (Gilli_3446), gld H (Gilli_2158), gld I (Gilli_0258), gld J (Gilli_1638), gld K (Gilli_2747), gld L (Gilli_2748), gld M (Gilli_2749), gld N (Gilli_2750), esp A (Gilli_3049),...”

AT4G14230 CBS domain-containing protein-related (RefSeq) from Arabidopsis thaliana
Aligns to 39:212 / 495 (35.2%), covers 97.7% of PF01595, 122.1 bits

• Coordination of plastid and light signaling pathways upon development of Arabidopsis leaves under various photoperiods
  Lepistö, Molecular plant 2012
  • “...1 Nucleolus rRNA processing AT2G45170 2,40 AUTOPHAGY 8E Autophagy AT2G26135 2,36 Zinc finger family protein AT4G14230 2,29 Unknown protein AT1G20620 2,25 CATALASE 3 Mitochondrion, peroxisome Hydrogen peroxide catabolic processes AT5G01370 2,22 ALC-INTERACTING PROTEIN1 Nucleus AT1G20020 2,13 LEAF FNR 2 Chloroplast Photosynthesis AT3G15800 2,07 Glycosyl hydrolase family...”

MAP1551c hypothetical protein (NCBI) from Mycobacterium avium subsp. paratuberculosis str. k10
Aligns to 11:205 / 454 (43.0%), covers 98.3% of PF01595, 121.8 bits

• Gene expression profiling of Mycobacterium avium subsp. paratuberculosis in simulated multi-stress conditions and within THP-1 cells reveals a new kind of interactive intramacrophage behaviour
  Cossu, BMC microbiology 2012
  • “...several virulence factors required for cell invasion or escape are up-regulated such as hemolysin ( MAP1551c ) and mce ( MAP1857 MAP0767c MAP3609 ) together with a couple of cutinase ( MAP4237c MAP3495c ) perhaps involved in the destruction of the host cell membrane lipids [...”

G414_RS0106810 HlyC/CorC family transporter from Weissella halotolerans DSM 20190
Aligns to 11:205 / 456 (42.8%), covers 99.4% of PF01595, 121.7 bits

• The controversial nature of the Weissella genus: technological and functional aspects versus whole genome analysis-based pathogenic potential for their application in food and health
  Abriouel, Frontiers in microbiology 2015
  • “...1 (WEISSC39_RS00260) 2 Hly (WEISSC39_RS08935, WEISSC39_RS08940) 1 MBP (WEISSC39_RS05980) W. halotolerans DSM 20190 2 Hly (G414_RS0106810, G414_RS0106815) W. hellenica Wikim14 2 Hly (TY24_RS08990, TY24_RS08995) W. koreensis KACC 15510 W. koreensis KCTC 3621 2 Hly (JC2156_RS08435, JC2156_10680) W. oryzae SG25 2 AGS (WOSG25_200030, WOSG25_200040) 2 Asa1/PrgB (WOSG25_200030,...”

Cp258_1017 HlyC/CorC family transporter from Corynebacterium pseudotuberculosis 258
Aligns to 11:206 / 467 (42.0%), covers 98.3% of PF01595, 121.4 bits

• Quantitative Proteomic Analysis Reveals Changes in the Benchmark Corynebacterium pseudotuberculosis Biovar Equi Exoproteome after Passage in a Murine Host
  Silva, Frontiers in cellular and infection microbiology 2017
  • “...I3QXX7_CORPS Lipoprotein 36815.57 Cp258_1221 3.62 I3QXE1_CORPS Hemolysin related protein 893.83 tlyC 1.75 I3QXC3_CORPS Esterase 496.62 Cp258_1017 1.30 I3QZ50_CORPS Peptidase S8A Subtilisin family 40174.72 Cp258_1653 1.23 I3QW71_CORPS Periplasmic binding protein 11884.29 fecB 1.21 I3QW24_CORPS Hydrolase domain containing protein 17234.12 Cp258_0564 1.26 I3QYP5_CORPS MutT NUDIX family protein 5870.55...”

BHWA1_00587 hemolysin protein (RefSeq) from Brachyspira hyodysenteriae WA1
Aligns to 1:183 / 444 (41.2%), covers 94.3% of PF01595, 121.3 bits

• Genome sequence of the pathogenic intestinal spirochete brachyspira hyodysenteriae reveals adaptations to its lifestyle in the porcine large intestine
  Bellgard, PloS one 2009
  • “...genes encoded putative hemolysin III (BHWA1_00446 and BHWA1_01870) and a putative hemolysin CBS domain-containing protein (BHWA1_00587). Interestingly, the hlyA -encoded hemolysin contained a phosphopantetheine binding motif [35] that binds lipids in a similar way to ACPs. ACPs carry fatty acids as thioester intermediates that are attached...”

WS105_0227 HlyC/CorC family transporter from Weissella ceti
Aligns to 12:205 / 454 (42.7%), covers 98.3% of PF01595, 121.0 bits

• The controversial nature of the Weissella genus: technological and functional aspects versus whole genome analysis-based pathogenic potential for their application in food and health
  Abriouel, Frontiers in microbiology 2015
  • “...CA (WS105 0070, WS105 0071, WS105_0581) 1 Hly (WS105_0554), 1 HlyA (WS105_0965), 1 Hly-like protein (WS105_0227) 4 SPA (WS105_0358, WS105_0448, WS105_1219, WS105_1255) W. ceti NC36 5 CA (WCNC 00912, WCNC 00917, WCNC 00922, WCNC 05547, WCNC 06207) 1 PA-ADHE 1 MBP (WCNC_01840) W. cibaria KACC 11862...”
• Comparative genome analysis of Weissella ceti, an emerging pathogen of farm-raised rainbow trout
  Figueiredo, BMC genomics 2015
  • “...hemolysins: hemolysin III ( hlyIII , WS105_0554, annotated as hypothetical protein) and a hemolysin-related protein (WS105_0227, annotated as hypothetical protein). Interestingly, the hlyIII gene of W. ceti is harboured by PAI 2, which is absent from all other Weissella species, suggesting that the hlyIII genes of...”

CNNM4_MOUSE / Q69ZF7 Metal transporter CNNM4; Ancient conserved domain-containing protein 4; mACDP4; Cyclin-M4 from Mus musculus (Mouse) (see 4 papers)
NP_291048 metal transporter CNNM4 precursor from Mus musculus
Aligns to 184:355 / 771 (22.3%), covers 100.0% of PF01595, 120.7 bits

• function: Probable metal transporter. The interaction with the metal ion chaperone COX11 suggests that it may play a role in sensory neuron functions (By similarity). May play a role in biomineralization and retinal function.
  subunit: Interacts with COX11.
• Cnnm4 deficiency suppresses Ca2+ signaling and promotes cell proliferation in the colon epithelia.
  Yamazaki, Oncogene 2019 (PubMed)
  • GeneRIF: The importance of CNNM4 in maintaining the normal balance between cell proliferation and differentiation in the colon epithelia.
• The Mg2+ transporter CNNM4 regulates sperm Ca2+ homeostasis and is essential for reproduction.
  Yamazaki, Journal of cell science 2016 (PubMed)
  • GeneRIF: These results suggest a new role of CNNM4 in sperm Ca(2+) homeostasis.
• Membrane protein CNNM4-dependent Mg2+ efflux suppresses tumor progression.
  Funato, The Journal of clinical investigation 2014
  • GeneRIF: these results indicate that CNNM4-dependent Mg(2+) efflux suppresses tumor progression by regulating energy metabolism.

Rv1842c hypothetical protein (NCBI) from Mycobacterium tuberculosis H37Rv
Aligns to 10:205 / 455 (43.1%), covers 98.3% of PF01595, 120.2 bits

• Chromosomal locus that affects pathogenicity of Rhodococcus fascians
  Vereecke, Journal of bacteriology 2002
  • “...homology to the carboxyl-terminal part of hypothetical protein Rv1842c of M. tuberculosis (58% identity and 72% similarity) (5), to a putative integral membrane...”

CNNM4_RAT / P0C588 Metal transporter CNNM4; Ancient conserved domain-containing protein 4; Cyclin-M4 from Rattus norvegicus (Rat) (see 2 papers)
Aligns to 185:356 / 772 (22.3%), covers 100.0% of PF01595, 120.1 bits

• function: Probable metal transporter. The interaction with the metal ion chaperone COX11 suggests that it may play a role in sensory neuron functions. May play a role in biomineralization and retinal function.
  subunit: Interacts with COX11.

CNNM4_HUMAN / Q6P4Q7 Metal transporter CNNM4; Ancient conserved domain-containing protein 4; Cyclin-M4 from Homo sapiens (Human) (see 5 papers)
Q6P4Q7 P-type Mg2+ transporter (EC 7.2.2.14) from Homo sapiens (see paper)
NP_064569 metal transporter CNNM4 precursor from Homo sapiens
Aligns to 187:358 / 775 (22.2%), covers 100.0% of PF01595, 119.9 bits

• function: Probable metal transporter. The interaction with the metal ion chaperone COX11 suggests that it may play a role in sensory neuron functions (By similarity). May play a role in biomineralization and retinal function.
  subunit: Interacts with COX11.
• A novel pathogenic missense variant in CNNM4 underlying Jalili syndrome: Insights from molecular dynamics simulations.
  Parveen, Molecular genetics & genomic medicine 2019
  • GeneRIF: The novel identified variant in CNNM4 is the first report from the Pakistani population. Sequence analysis of CNNM4 revealed a novel missense variant (c.1220G>T, p.Arg407Leu) in exon-1 encoding cystathionine-beta-synthase (CBS) domain.
• Identification of a mutation in CNNM4 by whole exome sequencing in an Amish family and functional link between CNNM4 and IQCB1.
  Li, Molecular genetics and genomics : MGG 2018
  • GeneRIF: Results identified linkage at chromosome 2p14-2q14 and found a homozygous mutation in the CNNM4 gene (p.R605X) causing Jalili syndrome. The truncated CNNM4 protein starting at R605 significantly increased the rate of apoptosis, and significantly increased the interaction between CNNM4 and IQCB1. This mutation may cause Jalili syndrome by a nonsense-mediated decay mechanism, affecting the function of IQCB1 and apoptosis.
• Jalili Syndrome: Cross-sectional and Longitudinal Features of Seven Patients With Cone-Rod Dystrophy and Amelogenesis Imperfecta.
  Hirji, American journal of ophthalmology 2018
  • GeneRIF: Jalili Syndrome is a rare cone-rod dystrophy (CORD) and amelogenesis imperfecta (AI), We have further characterized its ocular phenotype, including describing SD-OCT, FAF, and electrophysiological features; and report several novel disease-causing sequence variants.
• Report of two unrelated families with Jalili syndrome and a novel nonsense heterozygous mutation in CNNM4 gene.
  Maia, European journal of medical genetics 2018 (PubMed)
  • GeneRIF: Here, we report the 2 first families with Jalili Syndrome in Brazil. Molecular analysis of the first family identified a previously described homozygous mutation (p.Leu324Pro) in exon 1 of CNNM4 gene. In the second family, affected patients demonstrated a compound heterozygous mutation in CNNM4, the p.Leu324Pro and the novel nonsense mutation p.Tyr581*.
• Novel splice site mutation in CNNM4 gene in a family with Jalili syndrome.
  Cherkaoui, European journal of medical genetics 2017 (PubMed)
  • GeneRIF: used Sanger sequencing to analyze a large consanguineous family with three siblings affected with Jalili syndrome, suspected clinically after dental and ophthalmological examination. These patients are carrying a novel homozygous mutation in the splice site acceptor of intron 3 (c.1682-1G > C) in the CNNM4 gene
• Co-occurrence of Jalili syndrome and muscular overgrowth.
  Wawrocka, American journal of medical genetics. Part A 2017 (PubMed)
  • GeneRIF: Mutational analysis showed in all three brothers a novel likely pathogenic homozygous missense substitution in exon 1 (c.1076T>C, p.(Leu359Pro)) of CNNM4. Both parents were carriers for the variant.
• The Mg2+ transporter CNNM4 regulates sperm Ca2+ homeostasis and is essential for reproduction.
  Yamazaki, Journal of cell science 2016 (PubMed)
  • GeneRIF: These results suggest a new role of CNNM4 in sperm Ca(2+) homeostasis.
• A novel mutation and variable phenotypic expression in a large consanguineous pedigree with Jalili syndrome.
  Rahimi-Aliabadi, Eye (London, England) 2016
  • GeneRIF: We identified a novel homozygous deleterious mutation in CNNM4 gene which causes Jalili syndrome.
• More
• Structural Insights into the Intracellular Region of the Human Magnesium Transport Mediator CNNM4.
  Giménez-Mascarell, International journal of molecular sciences 2019
  • “...transport, analyzed structure and ligand binding of the intracellular region of human CNNM4 (UniProtKB/Swiss-Prot code Q6P4Q7) both in the presence and absence of its known interaction partner, PRL-1 [ 15 ]. Thus, we significantly extend the scarce structural data available, which may help in designing new...”
• Bioinformatic analyses of integral membrane transport proteins encoded within the genome of the planctomycetes species, Rhodopirellula baltica.
  Paparoditis, Biochimica et biophysica acta 2014
  • “...HlyC/CorC (HCC) Family of Putative Transporters 9.A.40.2.1 P54428 4 cations Fe 2+ Q7UQW5 3 9.A.40.3.4 Q6P4Q7 5 cations metal ion Q7UQM0 3 9.A.47 Tight Adherence (Pilus) Biogenesis Apparatus (TABA) Family 9.A.47.1.1 Q9S4A8 5 proteins proteins (pili, fimbrae) Q7UXS3 4 9.A.47.1.1 Q9S4A8 5 proteins proteins (pili, fimbrae)...”
• Purification, crystallization and preliminary crystallographic analysis of the CBS-domain pair of cyclin M2 (CNNM2).
  Gómez-García, Acta crystallographica. Section F, Structural biology and crystallization communications 2012
• Purification, crystallization and preliminary crystallographic analysis of the CBS pair of the human metal transporter CNNM4
  Gómez, Acta crystallographica. Section F, Structural biology and crystallization communications 2011
  • “...Polok et al., 2009). Structurally, CNNM4 (UniProtKB/Swiss-Prot code Q6P4Q7) is a multidomain protein formed of (i) a DUF21 domain (residues 184- 358) that...”
• Purification, crystallization and preliminary crystallographic analysis of the CBS-domain protein MJ1004 from Methanocaldococcus jannaschii
  Oyenarte, Acta crystallographica. Section F, Structural biology and crystallization communications 2011
  • “...Q59011; 12, Q58069; 13, Q58332. Homo sapiens: 1, Q9H8M5; 2, Q6P4Q7; 3, Q8NE01; 4, P51798; 5, P51790; 6, P51795; 7, P12268; 8, P51800; 9, P51793; 10, P51801; 11,...”
• Stable isotope labeling by amino acids in cell culture and differential plasma membrane proteome quantitation identify new substrates for the MARCH9 transmembrane E3 ligase.
  Hör, Molecular & cellular proteomics : MCP 2009
  • “...0.93 10 1.08 0.30 4.27 P04920 5 (5) CyclinM4 a 1.03 5 0.97 0.00 2.19 Q6P4Q7 1 (2) REEP5 a 0.93 2 1.08 0.08 6.30 Q00765 1 (2) SLC1A4 1.03 9 0.97 0.20 27.07 P43007 9 (17) SCAMP2 0.93 4 1.08 0.14 10.00 O15127 2 (2)...”

Q7UQM0 Uncharacterized protein from Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Aligns to 5:183 / 398 (45.0%), covers 98.3% of PF01595, 119.0 bits

• Bioinformatic analyses of integral membrane transport proteins encoded within the genome of the planctomycetes species, Rhodopirellula baltica
  Paparoditis, Biochimica et biophysica acta 2014
  • “...Transporters 9.A.40.2.1 P54428 4 cations Fe 2+ Q7UQW5 3 9.A.40.3.4 Q6P4Q7 5 cations metal ion Q7UQM0 3 9.A.47 Tight Adherence (Pilus) Biogenesis Apparatus (TABA) Family 9.A.47.1.1 Q9S4A8 5 proteins proteins (pili, fimbrae) Q7UXS3 4 9.A.47.1.1 Q9S4A8 5 proteins proteins (pili, fimbrae) Q7UR19 4 9.B putative Uncharacterized...”

cg1349 CBS domain-containing protein (RefSeq) from Corynebacterium glutamicum ATCC 13032
Aligns to 12:207 / 467 (42.0%), covers 96.6% of PF01595, 118.8 bits

• Citrate utilization by Corynebacterium glutamicum is controlled by the CitAB two-component system through positive regulation of the citrate transport genes citH and tctCBA
  Brocker, Journal of bacteriology 2009
  • “...cg0576 cg2894 cg1364 cg2157 cg1151 cg1386 cg0653 cg1147 cg1349 cg0825 cg0882 cg3420 cg2069 cg3351 cg2630 cg2966 cg1255 cg0638 cg3216 cg2504 cg2181 cg2182 cg2183...”
• The alternative sigma factor SigB of Corynebacterium glutamicum modulates global gene expression during transition from exponential growth to stationary phase
  Larisch, BMC genomics 2007
  • “...membrane protein 1.04 cg1108 porC putative porin precursor -1.25 cg1109 porB anion-specific porin precursor -1.84 cg1349 membrane protein, CBS domain -1.79 cg1639 membrane protein, CBS domain -1.23 cg1640 membrane protein, CBS domain -1.52 cg2467 ABC-transporter ATP-binding protein -1.33 cg2468 ABC-transporter permease component -1.26 cg2511 putative membrane...”

TENDBA_0027 HlyC/CorC family transporter from Treponema pallidum subsp. endemicum str. Bosnia A
Aligns to 44:223 / 457 (39.4%), covers 98.3% of PF01595, 118.7 bits

• Whole genome sequence of the Treponema pallidum subsp. endemicum strain Bosnia A: the genome is related to yaws treponemes but contains few loci similar to syphilis treponemes
  Staudová, PLoS neglected tropical diseases 2014
  • “...bp TENDBA_0067 CHP Unknown 113 bp 127 bp TENDBA_0461a HP Unknown 117 bp 83 bp TENDBA_0027 HlyC Cell processes 130 bp (altogether 60 bp of protein shortening) TENDBA_0136 d TCHP Virulence 133 bp TENDBA_0304 TCHP Unknown (altogether 111 bp) TENDBA_0314 TCHP Unknown TENDBA_0619 TCHP Unknown TENDBA_0621...”
  • “...human fibronectin [28] . Except for TENDBA_0103 coding for RecQ (ATP-dependent DNA helicase; EC3.6.4.12) and TENDBA_0027 coding for HlyC (putative hemolysin), all other affected genes code for hypothetical proteins of unknown function. TENDBA_0134 has been predicted to be putative outer membrane protein. TENDBA_0462 and TENDBA_0858 have...”

TPANIC_0027 HlyC/CorC family transporter from Treponema pallidum subsp. pallidum str. Nichols
Aligns to 45:224 / 458 (39.3%), covers 98.3% of PF01595, 118.7 bits

• Functional insights from proteome-wide structural modeling of Treponema pallidum subspecies pallidum, the causative agent of syphilis
  Houston, BMC structural biology 2018
  • “...Genome Annotation [ 8 ] Phyre2 Model Templates: 1st rank model and potential virulence model(s) TPANIC_0027 Putative hemolysin (HlyC) 1st rank: CorC Magnesium/Cobalt efflux protein ( E. coli ) 5th rank: Hemolysin-like protein ( Oenococcus oeni ) TPANIC_0028 Putative hemolysin (HlyC) 1st rank: CorC Magnesium/Cobalt efflux...”

MAM3_YEAST / Q12296 Protein MAM3 from Saccharomyces cerevisiae (strain ATCC 204508 / S288c) (Baker's yeast) (see 3 papers)
NP_014581 Mam3p from Saccharomyces cerevisiae S288C
NP_014581, YOL060C Mam3p (RefSeq) from Saccharomyces cerevisiae
Aligns to 66:238 / 706 (24.5%), covers 97.2% of PF01595, 117.1 bits

• function: Involved in metal homeostasis and more specially in manganese sensitivity.
• Manganese toxicity and Saccharomyces cerevisiae Mam3p, a member of the ACDP (ancient conserved domain protein) family.
  Yang, The Biochemical journal 2005
  • GeneRIF: first report of a eukaryotic ACDP family protein, MAM3, involved in metal homoeostasis
• Global changes in gene expression associated with phenotypic switching of wild yeast
  Šťovíček, BMC genomics 2014
  • “...in the left arm of chromosome XV that upregulate expression in BR-RF ( YOL110W , YOL060C and YOL038W ) with that of three genes located in the right arm of the same chromosome ( YOR194C , YOR250C , YOR288C ), indicates large duplications in the genome...”
• Changes in cell morphology are coordinated with cell growth through the TORC1 pathway
  Goranov, Current biology : CB 2013
  • “...Bul1 up up S252 YNL004W Hrb1 down and up up S355 YNL265C Ist1 down NA YOL060C Mam3 down down and up down S614 , T617 ; up S439 YOR322C Ldb19 up NA a Yeast cells were arrested inG1 with or without pheromone. Total protein was extracted,...”
• The role of the Parkinson's disease gene PARK9 in essential cellular pathways and the manganese homeostasis network in yeast
  Chesi, PloS one 2012
  • “...GGA2 YHR193C EGD2 YMR198W CIK1 YJR043C POL32 YNL021W HDA1 YDR414C ERD1 YKL190W CNB1 YHR012W VPS29 YOL060C MAM3 YLL049W LDB18 YNL027W CRZ1 YPL196W OXR1 YPL050C MNN9 YDL167C NRP1 YKR019C IRS4 YDL077C VAM6 YHR004C NEM1 YDR289C RTT103 YKL064W MNR2 YOR106W VAM3 YLR093C NYV1 YPL106C SSE1 YMR123W PKR1 YKL113C...”
• A genome-wide immunodetection screen in S. cerevisiae uncovers novel genes involved in lysosomal vacuole function and morphology
  Ricarte, PloS one 2011
  • “...and cellular components (Saccharomyces Genome Database). ENV Genes Biological Process Molecular Function Cellular Localization MAM3 (YOL060C) Required for normal mitochondrial organization and cell Mn 2+ homeostasis Unknown Vacuole membrane PCP1 (YGR101W) Required for normal mitochondrial organization, protein import into mitochondrion IM space, signal peptide process Peptidase...”
• Assessment of inactivating stop codon mutations in forty Saccharomyces cerevisiae strains: implications for [PSI] prion- mediated phenotypes
  Fitzpatrick, PloS one 2011
  • “...Q649TAG23 amino acid truncation YNL065W AQR1 Plasma membrane multidrug transporter 505,411 Q563TAG23 amino acid truncation YOL060C b MAM3 Protein required for normal mitochondrial morphology 214,535 K535TAA171 amino acid truncation YOR183W FYV12 Protein of unknown function 678,996 E42TAA87 amino acid truncation YPL222W b FMP40 Proposed to be...”
• Multiple Motif Scanning to identify methyltransferases from the yeast proteome
  Petrossian, Molecular & cellular proteomics : MCP 2009
  • “...and 6). These include YMR209C, YOL060C/Mam3, and YLR063W. YOL060C, designated Mam3, has an apparent cystathionine -synthase (CBS) domain that may bind AdoMet...”
  • “...YBR141C) as methyltransferases but did not confirm YOL060C as a methyltransferase. Importantly this analysis also did not verify HMM methyltransferase profiles...”
• Molecular cloning and characterization of the mouse Acdp gene family
  Wang, BMC genomics 2004
  • “...the conservation of ACD domain in various species. Amip3 is a protein from Saccharomyces cerevisiae (NP_014581). CanG is a protein from Candida glabrata (AAF33142). NeuC (EAA31204) is a hypothetical protein from Neurospora crassa . DroM is a gene product from D. melanogaster . The accession number...”
• Phenotypic switching in Candida glabrata involves phase-specific regulation of the metallothionein gene MT-II and the newly discovered hemolysin gene HLP
  Lachke, Infection and immunity 2000
  • “...a C. glabrata homolog of the S. cerevisiae gene YOL060c (25), which encodes a putative protein with three transmembrane domains. The cloned DNA fragment was...”
  • “...INFECT. IMMUN. the corresponding region of the S. cerevisiae YOL060c gene product (Fig. 6). Comparison of the deduced amino acid sequence of the fragment with...”
• More

SCO3765 integral membrane protein (NCBI) from Streptomyces coelicolor A3(2)
Aligns to 7:201 / 459 (42.5%), covers 99.4% of PF01595, 116.4 bits

• Conservation of thiol-oxidative stress responses regulated by SigR orthologues in actinomycetes
  Kim, Molecular microbiology 2012
  • “...(zinc-containing anti-sigma) factor 14 SCO3509 * Hypothetical protein 7 SCO3764 Integral membrane protein (A) 7 SCO3765 * Possible integral membrane protein with CBS domain 14 SCO3766 * Hypothetical protein 14 SCO3767 * Hypothetical protein, similar to tellurite resistance protein TerB 1 SCO3889 trxA Thioredoxin (A) 1...”

Rv2366c PROBABLE CONSERVED TRANSMEMBRANE PROTEIN (NCBI) from Mycobacterium tuberculosis H37Rv
Aligns to 8:185 / 435 (40.9%), covers 98.9% of PF01595, 114.5 bits

• The Rv2633c protein of Mycobacterium tuberculosis is a non-heme di-iron catalase with a possible role in defenses against oxidative stress
  Ma, The Journal of biological chemistry 2018
  • “...Figure 6. Kinetic analysis of the inhibition of catalase activity of Rv2366c by cyanide (A) and azide (B). The line is the fit of the data by eq 3. Each data...”
• Both Corynebacterium diphtheriae DtxR(E175K) and Mycobacterium tuberculosis IdeR(D177K) are dominant positive repressors of IdeR-regulated genes in M. tuberculosis
  Manabe, Infection and immunity 2005
  • “...Rv2123 Rv3402c Rv1519 hisE Rv2417C Rv2366c Rv2869c Rv0127 fadE30 Rv1396c pheA tox GATATCCGGTGGCGAGTAATCGGTC GGATCCAGTGCGTCGTTGGATTCGTG...”
  • “...our FACS assay. The other three promoters (Rv1396c, Rv2366c, and Rv2417c) were only minimally induced under iron-poor conditions. pheA was minimally induced in...”

WP_005873396 HlyC/CorC family transporter from Porphyromonas gingivalis
Aligns to 4:192 / 417 (45.3%), covers 82.4% of PF01595, 114.4 bits

• Comparative Genomics of the Genus Porphyromonas Identifies Adaptations for Heme Synthesis within the Prevalent Canine Oral Species Porphyromonas cangingivalis
  O'Flynn, Genome biology and evolution 2015
  • “...AAB49691 HagE gbk: AAQ66991 Hemagglutinin gbk: WP_012458040 Hemagglutinin gbk: WP_005873402 Hemolysin ref: WP_023847110 Hemolysin ref: WP_005873396 Cell Envelope Biogenesis Protein TonB ref: WP_013815139 TonB-Dependent Receptor ref: WP_013816293 Ferritin ref: WP_004585574 Ferrochelatase ref:WP_013815385 Iron Transport FeoB ref:WP_013816689 Iron ABC Transporter ref:WP_013816382 Iron ABC Transporter Substrate-Binding Protein ref:WP_013816383...”

CNNM1_CAEEL / A3QM97 Metal transporter cnnm-1; CNNM family homolog 1 from Caenorhabditis elegans (see paper)
NP_503052 Metal transporter cnnm-1 from Caenorhabditis elegans
Aligns to 206:375 / 811 (21.0%), covers 93.2% of PF01595, 113.5 bits

• function: Probable metal transporter. Probably acts redundantly with the other metal transport proteins cnnm-2, cnnm-3, cnnm-4 and cnnm-5 to regulate Mg(2+) homeostasis. Promotes postembryonic gonad development by regulating Mg(2+) levels, probably via AMPK signaling.
  disruption phenotype: No visible phenotype. Double knockout with cnnm-3 results in increased levels of intestinal Mg(2+) and reduced levels in other tissues. This Mg(2+) deficiency in tissues leads to a reduced lifespan, 100% sterility, and smaller animals that exhibit a developmental delay with defective gonad development and which therefore do not produce oocytes or form vulva. In addition, the gonad development defect in the cnnm-1 and cnnm-3 double knockout is rescued when the AMPK alpha subunit aak-2 is also knocked out. Quintuple knockout with cnnm-2, cnnm-3, cnnm-4 and cnnm-5 results in a reduced lifespan and 100% sterility.
• Mg2+ Extrusion from Intestinal Epithelia by CNNM Proteins Is Essential for Gonadogenesis via AMPK-TORC1 Signaling in Caenorhabditis elegans.
  Ishii, PLoS genetics 2016
  • GeneRIF: he results revealed that RNAi-mediated inactivation of several genes restores gonad elongation, including aak-2, which encodes the catalytic subunit of AMP-activated protein kinase (AMPK). We then generated triple mutant worms for cnnm-1; cnnm-3; aak-2 and confirmed that the aak-2 mutation also suppressed the defective gonadal elongation in cnnm-1; cnnm-3 mutant worms.
• Short-Term Mild Temperature-Stress-Induced Alterations in the C. elegans Phosphoproteome
  Huang, International journal of molecular sciences 2020
  • “...0.31 DNaJ domain (Prokaryotic heat shock protein) Q9NEN6 rps-6 SSpASpHHSpESEVK 0.327 40S ribosomal protein S6 A3QM97 cnnm-1 SMSpIVGTSELSAR 0.396 Metal transporter cnnm-1 Q21219 pept-1 GYSESRSpESpVSpSK 0.463 Peptide transporter family 1 (Di-/tri-peptide transporter CPTB) G5EFL5 alp-1 AAYHPQVNTpARPVSpVSpPAPSpAGSK 0.478 ALP/Enigma encoding H2KZZ2 hlh-30 QVVSSSpAPTSSIDIEK 0.654 Helix Loop Helix...”
  • “...Q8MQ70 hpk-1 NSpGQSTDLNSR 0.322 Homeodomain-interacting protein kinase 1 O76360 egl-4 KPSpDQPNGNQVQVGTR 0.271 cGMP-dependent protein kinase A3QM97 cnnm-1 SMSpIVGTSELSAR 0.34 Metal transporter O18696 pde-1 SpYDNAPALESLEK 0.403 Probable 3,5-cyclic phosphodiesterase Q10663 icl-1 AGSpVVNRIPEAADLLEK 0.414 Bifunctional glyoxylate cycle protein Q17446 pmk-1 QTDSEMTpGYpVATR 0.537 Stress-activated protein kinase...”

TP0027 hemolysin, putative (NCBI ptt file) from Treponema pallidum subsp. pallidum str. Nichols
Aligns to 1:173 / 407 (42.5%), covers 94.9% of PF01595, 113.0 bits

• Characterizing the Syphilis-Causing Treponema pallidum ssp. pallidum Proteome Using Complementary Mass Spectrometry
  Osbak, PLoS neglected tropical diseases 2016
  • “...89 ] TP0155 Fibronectin binding protein [ 75 ] TP1038 Bacterioferrin/ TpF1 [ 90 ] TP0027, TP0649 Putative hemolysins [ 91 ] Exploring the undetected T . pallidum proteins Of the predicted protein coding ORFs, 482/968 proteins were not detected in this study. Most of the...”
• Molecular differentiation of Treponema pallidum subspecies in skin ulceration clinically suspected as yaws in Vanuatu using real-time multiplex PCR and serological methods
  Chi, The American journal of tropical medicine and hygiene 2015
  • “...the fliG gene (tp0026) and a putative hemolysin gene (tp0027) and a 493-bp specific region within the tprI (tp0620) gene, which is present in all three...”
• Advances in the diagnosis of endemic treponematoses: yaws, bejel, and pinta
  Mitjà, PLoS neglected tropical diseases 2013
  • “...416 312 15 8, 10 f 2007, 2008 [94] , [95] IGR19 , intergenic spacer/hlyB (TP0027) g 2025/3407934084 9xC, 12xC CCCTCC CCCTCC CCCTCC 2011 [96] Genome positions are shown in the T. p. pertenue Samoa D genomic sequence (GenBank acc. no. CP002374.1). a For T. p....”
  • “.... g IGR19 is an intergenic spacer between fliG (TP0026) and putative hemolysin gene hlyB (TP0027) in the Nichols genome (AE000520.1); this region is a part of the hlyB gene (TP0027) in the Samoa D genome (CP002374.1). Polymerase Chain Reaction Analyses of Clinical Samples During the...”
• Whole genome sequence of Treponema pallidum ssp. pallidum, strain Mexico A, suggests recombination between yaws and syphilis strains
  Pětrošová, PLoS neglected tropical diseases 2012
  • “...sequences of Mexico A. Two of these differences were found in homopolymeric stretches (in fliG -tp0027 and tp0347 regions) and one SNP (CT) was found in the rpiA -tp0617 region. Since both Mexico A strains came from the same laboratory (D. L. Cox, CDC Atlanta), the...”
  • “...Gauthier CP002376.1, T. paraluiscuniculi strain Cuniculi A CP002103.1. Genes: TPA Mexico A: tp92 EU102088.1, fliG -tp0027 EU101896.1, tp0347 EU102160.1, rpiA -tp0617 EU101922.1; TPA South Africa: tp92 EU102098.1, fliG -tp0027 EU101902.1, tp0347 EU102170.1, rpiA -tp0617 EU101910.1; TEN Bosnia A: tp92 EU102075.1, TP0326: JX392330.1, TP0488 JX392331.1. References 1...”
• Laboratory-confirmed case of yaws in a 10-year-old boy from the Republic of the Congo
  Pillay, Journal of clinical microbiology 2011
  • “...(tp0026) and a putative hemolysin gene of unknown function (tp0027) and a (ii) specific region of the tprI gene (tp0620) present in all three subspecies were...”
  • “...997 to 1021 and 7 to 28 in tp0026 and tp0027, respectively, in the T. pallidum subsp. pallidum Nichols genome were used to amplify a 280-bp fragment. PCR...”
• On the origin of the treponematoses: a phylogenetic approach
  Harper, PLoS neglected tropical diseases 2008
  • “...form a stem-loop structure in the intergenic region between the oppositely transcribed genes fliG and tp0027 . This structure, located between the predicted promoter and transcriptional start site of the operon containing genes tp0027 and tp0028 ( Fig. S1 ), could attenuate transcript levels of these...”
  • “...of T. pallidum may be worthwhile, in order to better assess this possibility. Similarly, since tp0027 and tp0028 are both homologous to tlyC , a gene that either encodes a hemolysin or regulates a cryptic one in E. coli [48] , a difference in transcript level...”
• Transcriptome of Treponema pallidum: gene expression profile during experimental rabbit infection
  Smajs, Journal of bacteriology 2005
  • “...TP0142 TP0270 TP0009 TP0077 TP0218 TP0146 TP1005 TP0500 TP0027 TP0578 TP0687 TP0501 TP0080 TP0581 TP0105 TP0344 TP0387 TP0881 TP0448 TP0521 TP0450 TP0716 TP0670...”
  • “...Tpr Tpr Tpr Tpr Tpr Tpr Hemolysins TP1037 TP0936 TP0649 TP0027 TP0028 1.1 0.78 0.57 0.30 0.23 0 0 0 1 1 Hemolysin III (hlyIII) Putative hemolysin Hemolysin...”

CNNM2_CAEEL / Q9GYL2 Metal transporter cnnm-2; CNNM family homolog 2 from Caenorhabditis elegans (see paper)
Aligns to 154:322 / 762 (22.2%), covers 93.2% of PF01595, 110.3 bits

• function: Probable metal transporter. Probably acts redundantly with the other metal transport proteins cnnm-1, cnnm-3, cnnm-4 and cnnm-5 to regulate Mg(2+) homeostasis.
  disruption phenotype: No visible phenotype. Double knockout with cnnm-3 results in 22% sterility. Quintuple knockout with cnnm-1, cnnm-3, cnnm- 4 and cnnm-5 results in a reduced lifespan and 100% sterility.

FSY75_17865 HlyC/CorC family transporter from Streptomyces sp. TR1341
Aligns to 7:185 / 428 (41.8%), covers 99.4% of PF01595, 109.9 bits

• A Human Lung-Associated Streptomyces sp. TR1341 Produces Various Secondary Metabolites Responsible for Virulence, Cytotoxicity and Modulation of Immune Response
  Herbrík, Frontiers in microbiology 2019
  • “...Rahman et al., 2010 ; Forrellad et al., 2013 ; Rahman et al., 2015 ) FSY75_17865 SCO2534 HlyC/CorC family magnesium and cobalt efflux protein TlyC family : hemolysin C of Brachyspira hyodysenteriae (ACN83901.1) and Co 2+ -resistance protein CorC of Salmonella typhimurium (TKE78380.1), TlyC hemolysin of...”

XP_002797334 DUF21 and CBS domain protein (Mam3) from Paracoccidioides lutzii Pb01
Aligns to 64:236 / 745 (23.2%), covers 96.0% of PF01595, 109.5 bits

• Hemoglobin uptake by Paracoccidioides spp. is receptor-mediated
  Bailão, PLoS neglected tropical diseases 2014
  • “...since hemoglobin blocked Zn-PPIX internalization. Moreover, the fungus could promote erythrocyte lysis. A hemolysin-like protein (XP_002797334) has been evidenced in a mycelium to yeast transition cDNA library [65] , which indicates that Paracoccidioides could access the intracellular heme in the host by producing a hemolytic factor...”

PPA0938 conserved protein, putative hemolysin (NCBI) from Propionibacterium acnes KPA171202
PPA0938 HlyC/CorC family transporter from Cutibacterium acnes KPA171202
Aligns to 9:188 / 432 (41.7%), covers 98.9% of PF01595, 109.2 bits

• Propionibacterium acnes and Acne Vulgaris: New Insights from the Integration of Population Genetic, Multi-Omic, Biochemical and Host-Microbe Studies
  McLaughlin, Microorganisms 2019
  • “...Potential Effect on the Host CAMP-factors PPA0687, PPA1198, PPA1231, PPA1340, PPA2108 Haemolytic, cytotoxic Haemolysins PPA0565, PPA0938, PPA1396 Haemolytic GehA lipases PPA1796, PPA2105 Tissue damage, inflammation Sialidases PPA0684, PPA0685, PPA1560 Tissue damage Hyaluronate lyase (HYL) PPA0380 Tissue damage Endoglycoceramidases PPA0644, PPA2106 Tissue damage Endo--N-acetylglucosaminidase PPA0990 Tissue damage...”

PF3D7_0932100 protein MAM3, putative from Plasmodium falciparum 3D7
Aligns to 6:184 / 1274 (14.1%), covers 97.7% of PF01595, 108.3 bits

• Association of a Novel Mutation in the Plasmodium falciparum Chloroquine Resistance Transporter With Decreased Piperaquine Sensitivity
  Agrawal, The Journal of infectious diseases 2017
  • “...membrane protein, 2492S) 3.61E-07 MAL9:1279569 PF3D7_0932100 (Conserved membrane protein, intronic) 3.61E-07 MAL9:1279572 PF3D7_0932100 (Conserved membrane...”
• Analysis of the interactome of the Ser/Thr Protein Phosphatase type 1 in Plasmodium falciparum
  Hollin, BMC genomics 2016
  • “...conserved Plasmodium protein, unknown function QDO/A (1) PF3D7_0924100 conserved Plasmodium protein, unknown function TDO/A (1) PF3D7_0932100 protein MAM3, putative TDO/A (1) PF3D7_0933300 conserved Plasmodium protein, unknown function TDO/A (1) PF3D7_1020200 conserved Plasmodium protein, unknown function TDO/A (1) KNVFF PF3D7_1023400 HORMA domain protein, putative QDO/A (1) PF3D7_1029900...”

PITG_00746 hypothetical protein from Phytophthora infestans T30-4
Aligns to 37:208 / 503 (34.2%), covers 96.0% of PF01595, 108.0 bits

• Lifestyle, gene gain and loss, and transcriptional remodeling cause divergence in the transcriptomes of Phytophthora infestans and Pythium ultimum during potato tuber colonization
  Ah-Fong, BMC genomics 2017
  • “...Fig. 12c , which shows a family of metal ion transporters. While one ortholog pair (PITG_00746, PYU1_G0144338) shows high expression in each tissue, expression of the other orthologs has been shuffled. In one ortholog pair, PITG_02263 shows moderate expression while zero expression was seen for PYU1_G014841....”

MAP2146c hypothetical protein (NCBI) from Mycobacterium avium subsp. paratuberculosis str. k10
Aligns to 8:185 / 436 (40.8%), covers 99.4% of PF01595, 107.6 bits

• Comparative genomic hybridizations reveal genetic regions within the Mycobacterium avium complex that are divergent from Mycobacterium avium subsp. paratuberculosis isolates
  Paustian, Journal of bacteriology 2005
  • “...MAP0096c MAP0106c MAP0107 MAP0845 MAP0850c MAP0866 MAP0867c MAP2146c MAP2158 MAP2164 MAP2189 MAP2198 MAP2749c MAP2756c MAP2765c MAP2770 MAP3715 MAP3726 MAP3751...”

SCO2534 hypothetical protein (NCBI) from Streptomyces coelicolor A3(2)
Aligns to 7:185 / 434 (41.2%), covers 98.9% of PF01595, 107.0 bits

• A Human Lung-Associated Streptomyces sp. TR1341 Produces Various Secondary Metabolites Responsible for Virulence, Cytotoxicity and Modulation of Immune Response
  Herbrík, Frontiers in microbiology 2019
  • “...et al., 2010 ; Forrellad et al., 2013 ; Rahman et al., 2015 ) FSY75_17865 SCO2534 HlyC/CorC family magnesium and cobalt efflux protein TlyC family : hemolysin C of Brachyspira hyodysenteriae (ACN83901.1) and Co 2+ -resistance protein CorC of Salmonella typhimurium (TKE78380.1), TlyC hemolysin of Rickettsia...”
• SepG coordinates sporulation-specific cell division and nucleoid organization in Streptomyces coelicolor
  Zhang, Open biology 2016
  • “...OppB oligopeptide permease subunit 95 SCO3404 FtsH2 d metalloprotease 95 SCO1527 alcohol phosphatidyl transferase 94 SCO2534 hemolysin-like protein 93 SCO1796 stomatin-like protein 93 SCO2150 QcrC cytochrome c heme-binding subunit 93 SCO5670 putative polyamine permease subunit 93 SCO2945 sugar permease subunit 93 SCO2148 QcrB cytochrome b subunit...”
• Functional analysis of the gene SCO1782 encoding Streptomyces hemolysin (S-hemolysin) in Streptomyces coelicolor M145
  Rajesh, Toxicon : official journal of the International Society on Toxinology 2013 (PubMed)
  • “...was searched for hemolysin-coding genes; consequently, SCO1782, SCO2534, and SCO3882 were identified, whose products were annotated as a putative, membrane, and...”
  • “...This study pT2534 pET28a carrying PCR product of SCO2534 from S. coelicolor This study pT3882 pET28a carrying PCR product of SCO3882 from S. coelicolor...”

cg2511 CBS domain-containing protein (RefSeq) from Corynebacterium glutamicum ATCC 13032
NCgl2206 HlyC/CorC family transporter from Corynebacterium glutamicum ATCC 13032
Aligns to 10:188 / 440 (40.7%), covers 100.0% of PF01595, 106.4 bits

• Understanding the high L-valine production in Corynebacterium glutamicum VWB-1 using transcriptomics and proteomics
  Zhang, Scientific reports 2018
  • “...6521.77 2.1 83 NCgl2219 cg2527 dcp Peptidyl-dipeptidase A protein 4.70/73880.16 1408.44 0.00 NC 84 NCgl2206 cg2511 Membrane protein containing CBS domain 4.66/47768.97 0.00 1818.35 3.4 85 NCgl2217 cg2523 malQ 4-alpha-glucanotransferase 4.75/78524.38 3756.57 815.02 1.9 88 NCgl0884 cg1051 Hypothetical protein 4.96/43075.70 0.00 1413.45 2.3 91 NCgl0884 cg0870...”
• The alternative sigma factor SigB of Corynebacterium glutamicum modulates global gene expression during transition from exponential growth to stationary phase
  Larisch, BMC genomics 2007
  • “...membrane protein, CBS domain -1.52 cg2467 ABC-transporter ATP-binding protein -1.33 cg2468 ABC-transporter permease component -1.26 cg2511 putative membrane protein -1.80 cg3175 membrane protein -1.36 cg3195 flavin-containing monooxygenase involved in K + transport -1.16 PHOSPHORUS METABOLISM AND REGULATION cg0866 phosphoribosyl transferase 1.02 cg1718 phospholipid-binding protein 1.02 cg2842...”
• Understanding the high L-valine production in Corynebacterium glutamicum VWB-1 using transcriptomics and proteomics
  Zhang, Scientific reports 2018
  • “...1793.80 6521.77 2.1 83 NCgl2219 cg2527 dcp Peptidyl-dipeptidase A protein 4.70/73880.16 1408.44 0.00 NC 84 NCgl2206 cg2511 Membrane protein containing CBS domain 4.66/47768.97 0.00 1818.35 3.4 85 NCgl2217 cg2523 malQ 4-alpha-glucanotransferase 4.75/78524.38 3756.57 815.02 1.9 88 NCgl0884 cg1051 Hypothetical protein 4.96/43075.70 0.00 1413.45 2.3 91 NCgl0884...”

VP2912 conserved hypothetical protein (NCBI ptt file) from Vibrio parahaemolyticus RIMD 2210633
Aligns to 6:178 / 375 (46.1%), covers 97.7% of PF01595, 105.6 bits

• Four genomic islands that mark post-1995 pandemic Vibrio parahaemolyticus isolates
  Hurley, BMC genomics 2006
  • “...primer pair designed from the 5' and 3' core chromosomal VPaI-5 flanking genes VP2898 and VP2912 respectively, indicating that these genes are adjacent to one another and no novel DNA is present in these isolates (Table 6 ). By PCR assay we show that in each...”

CC1G_14321 CBS domain-containing protein from Coprinopsis cinerea okayama7#130
Aligns to 82:265 / 428 (43.0%), covers 94.9% of PF01595, 104.7 bits

• Comparative transcriptomics of the model mushroom Coprinopsis cinerea reveals tissue-specific armories and a conserved circuitry for sexual development
  Plaza, BMC genomics 2014
  • “...68 Pore-forming protein 8.08E-91 N N CC1G_07956 66 Peptidoglycan-binding domain 1 protein 1.70E-48 Y 1 CC1G_14321 35 Hemolysin 9.81E-77 N 3 CC1G_08484 34 Cercosporin toxin biosynthesis protein 4.71E-115 N N CC1G_06959 31 Thaumatin-like protein 3.50E-79 Y N CC1G_13099 15 Peptidoglycan-binding domain 1 protein 4.40E-17 N N...”

CT257 hypothetical protein (NCBI ptt file) from Chlamydia trachomatis D/UW-3/CX
Aligns to 11:188 / 404 (44.1%), covers 96.0% of PF01595, 102.5 bits

• Chlamydia trachomatis In Vivo to In Vitro Transition Reveals Mechanisms of Phase Variation and Down-Regulation of Virulence Factors
  Borges, PloS one 2015
  • “...]. Also, for the Ia/CS190/96 strain, two new adaptive mutations arose: an inactivating indel for CT257 and one non-synonymous SNP for CT205/ pfkA_1 , both reaching about 100% frequency. CT257 codes for a CBS domain-containing protein [ 96 ] that was suggested to display tropism for...”
  • “...cell division (mutation in CT645); ii ) the nutrient acquisition/processing (mutations in CT205/ pfkA_1 , CT257 and CT713/ porB ); or iii ) global regulatory mechanisms, such as DNA supercoiling (mutation in CT189/ gyrA_1 ). Finally, despite most gene targets showed no parallelism across strains (at...”

VC0271 conserved hypothetical protein (NCBI ptt file) from Vibrio cholerae O1 biovar eltor str. N16961
Aligns to 6:178 / 352 (49.1%), covers 97.7% of PF01595, 99.3 bits

• Phase variable O antigen biosynthetic genes control expression of the major protective antigen and bacteriophage receptor in Vibrio cholerae O1
  Seed, PLoS pathogens 2012
  • “...O139 donor DNA during natural transformation, the crossovers were often localized within or downstream of VC0271 at the right junction, and the location of the left junction was within or upstream of gmhD . These results coupled with our observation that manA participates in O1 antigen...”
• Serogroup conversion of Vibrio cholerae in aquatic reservoirs
  Blokesch, PLoS pathogens 2007
  • “...VchoM_01000821 (homolog to VC0267), 0820 = VchoM_01000820 (homolog to VC0268), 0819 = VchoM_01000819 (homolog to VC0271). About 15% of the Kan R transformants (approximating a transformation frequency of 2.2 10 6 ) exhibited the same opaque colony morphotype as O139 strain MO10 [ 21 ] and...”
  • “...left junction ( Figure 2 D, lanes 2 and 3), and within or downstream of VC0271 at the right junction ( Figure 2 D, lane 2). However, in a few transformants, crossovers could be localized to a different right-junction site within a second region of homology...”
• Detection and transformation of genome segments that differ within a coastal population of Vibrio cholerae strains
  Miller, Applied and environmental microbiology 2007
  • “...gene present in Sa5Y but not in VCXB21, and VC0271. (F) Probes VC1280 to VC1286 transformed into W6G using primers in VC1279, VC1280, and VC1287. Downloaded...”
  • “...replaced the intervening segment found between ORFs VC0268 and VC0271 in the Sa5Y recipient strain. Independent mapping showed that Sa5Y contains 9 kbp of DNA...”

DIP1716 Putative membrane protein (NCBI) from Corynebacterium diphtheriae NCTC 13129
Aligns to 8:187 / 442 (40.7%), covers 100.0% of PF01595, 97.8 bits

• Transcriptome sequencing of the human pathogen Corynebacterium diphtheriae NCTC 13129 provides detailed insights into its transcriptional landscape and into DtxR-mediated transcriptional regulation
  Wittchen, BMC genomics 2018
  • “...wall, membrane, envelop biogenesis DIP1720 - DIP1713 8 not detected dnaJ2 , DIP1719, DIP1718, DIP1717, DIP1716, DIP1715, era , recO . Replication, recombination and repair; Cell wall, membrane, envelop biogenesis; Coenzyme metabolism; Inorganic ion transport and metabolism; Function unknown; Signal transduction mechanisms; Post-translational modification, protein turnover,...”

MPN159 tlyC homolog, hemolysin activity doubtful (NCBI ptt file) from Mycoplasma pneumoniae M129
P75586 UPF0053 protein MG146 homolog from Mycoplasma pneumoniae (strain ATCC 29342 / M129)
Aligns to 14:191 / 424 (42.0%), covers 98.9% of PF01595, 90.8 bits

• Determination of the Gene Regulatory Network of a Genome-Reduced Bacterium Highlights Alternative Regulation Independent of Transcription Factors
  Yus, Cell systems 2019
  • “...equilibrium between NTP and dNTPs, regulates DnaA. (2) the inactivation of the Mg 2+ transporter MPN159 (CorB), the transition metal-binding protein, MPN162, and the recombination protein MPN490 (RecA) correlate significantly (r> 0.67, p< 2.2e16) ( FigureS4 D), thus linking metal transport and binding to recombination and...”
• Phenotypic switching in Candida glabrata involves phase-specific regulation of the metallothionein gene MT-II and the newly discovered hemolysin gene HLP
  Lachke, Infection and immunity 2000
  • “...maritima, AE001751; M.pne, Mycoplasma pneumoniae, P75586; M.gen, Mycoplasma genitalium, 049399; C.pne, Chlamydia pneumoniae, AE001623; M.tub, Mycobacterium...”

TC0527 conserved hypothetical protein (NCBI ptt file) from Chlamydia muridarum Nigg
Aligns to 7:182 / 412 (42.7%), covers 99.4% of PF01595, 88.5 bits

• Identification of immunodominant antigens by probing a whole Chlamydia trachomatis open reading frame proteome microarray using sera from immunized mice
  Cruz-Fisher, Infection and immunity 2011
  • “...TC0491 TC0500 TC0503 TC0504 TC0512 TC0519 TC0521 TC0522 TC0527 TC0536 TC0539 TC0551 TC0557 TC0561 TC0574 TC0582 TC0588 TC0589 TC0590 TC0596 TC0619 TC0623 TC0629...”

CNNM1_HUMAN / Q9NRU3 Metal transporter CNNM1; Ancient conserved domain-containing protein 1; Cyclin-M1 from Homo sapiens (Human) (see paper)
Aligns to 227:414 / 951 (19.8%), covers 94.9% of PF01595, 87.0 bits

• function: Probable metal transporter.
• Predicting binding within disordered protein regions to structurally characterised peptide-binding domains.
  Khan, PloS one 2013
  • “...LLGIILLVL 0.467 0.396 Q5SVZ6 LKLIIENIL 0.434 0.329 Q96AH8 LKLIIVGAI 0.425 0.75 Q9HAU8 LTFIISSIL 0.401 0.436 Q9NRU3 LEDIIEEII 0.384 0.393 P53618 LMTIIRFVL 0.363 0.321 O75376* LEDIIRKAL 0.362 0.044 Q8IWF6 LRTHIDAII 0.350 0.197 Q8NHV5 LFFIIMGII 0.341 1 Q9UPM8 LRLHIIEII 0.338 0.3 Q9Y618* LAQHISEVI 0.335 0.055 Q96N64 LDHIIEDAL 0.333...”
• Purification, crystallization and preliminary crystallographic analysis of the CBS-domain pair of cyclin M2 (CNNM2).
  Gómez-García, Acta crystallographica. Section F, Structural biology and crystallization communications 2012
• Purification, crystallization and preliminary crystallographic analysis of the CBS-domain protein MJ1004 from Methanocaldococcus jannaschii
  Oyenarte, Acta crystallographica. Section F, Structural biology and crystallization communications 2011
  • “...10, P51801; 11, P20839; 12, P35523; 13, P51788; 14, Q9NRU3; 15, P51797. Arabidopsis thaliana: 1, Q8GZA4; 2, Q9SSD0; 3, CLCE; 4, CLCC; 5, CLCA; 6, Q9M1T1; 7,...”

CT256 Hypothetical protein containing CBS domains (NCBI ptt file) from Chlamydia trachomatis D/UW-3/CX
Aligns to 8:182 / 414 (42.3%), covers 100.0% of PF01595, 84.8 bits

• In silico prediction and functional validation of sigma28-regulated genes in Chlamydia and Escherichia coli
  Yu, Journal of bacteriology 2006
  • “...by University of California, Berkeley CT047 CT099 CT181 CT249 CT256 CT359 CT396 CT415 CT418 CT425 CT441 CT553 CT631 CT693 CT789 CT798 Gene name VOL. 188, 2006...”

CNNM1_MOUSE / Q0GA42 Metal transporter CNNM1; Ancient conserved domain-containing protein 1; mACDP1; Cyclin-M1; Cyclin-like protein 1; CLP-1 from Mus musculus (Mouse) (see 2 papers)
Aligns to 227:414 / 951 (19.8%), covers 94.9% of PF01595, 83.9 bits

• function: Probable metal transporter.

XP_006527543 metal transporter CNNM1 isoform X1 from Mus musculus
Aligns to 227:414 / 982 (19.1%), covers 94.9% of PF01595, 83.8 bits

• Expression of Cnnm1 and Its Association with Stemness, Cell Cycle, and Differentiation in Spermatogenic Cells in Mouse Testis.
  Chandran, Biology of reproduction 2016 (PubMed)
  • GeneRIF: CNNM1 expression was restricted to c-KIT- and OCT3/4-positive cells in the testis, indicating that they are early spermatogonial cells. Spermatogonial stem cells in primary culture expressed Cnnm1, and their differentiation into embryoid body-like clusters in vitro resulted in the loss of Cnnm1 expression. Silencing of Cnnm1 in GC1-spg cells reduced number of cells in G1 phase with increased cells in S and G2/M phases.
• Ancient conserved domain protein-1 binds copper and modifies its retention in cells.
  Alderton, Journal of neurochemistry 2007 (PubMed)
  • GeneRIF: We determined that ACDP-1 is a high affinity copper binding protein able to bind copper at nanomolar concentrations. In addition the promoter of ACDP-1 contains metal response elements and cellular expression of ACDP-1 alters cellular retention of copper.

Q7UQW5 Hemolysin protein from Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Aligns to 12:186 / 415 (42.2%), covers 95.5% of PF01595, 81.5 bits

• Bioinformatic analyses of integral membrane transport proteins encoded within the genome of the planctomycetes species, Rhodopirellula baltica
  Paparoditis, Biochimica et biophysica acta 2014
  • “...7 9.A.40 The HlyC/CorC (HCC) Family of Putative Transporters 9.A.40.2.1 P54428 4 cations Fe 2+ Q7UQW5 3 9.A.40.3.4 Q6P4Q7 5 cations metal ion Q7UQM0 3 9.A.47 Tight Adherence (Pilus) Biogenesis Apparatus (TABA) Family 9.A.47.1.1 Q9S4A8 5 proteins proteins (pili, fimbrae) Q7UXS3 4 9.A.47.1.1 Q9S4A8 5 proteins...”

CNNM5_CAEEL / G5ED05 Metal transporter cnnm-5; CNNM family homolog 5 from Caenorhabditis elegans (see paper)
Aligns to 141:322 / 722 (25.2%), covers 96.6% of PF01595, 63.7 bits

• function: Probable metal transporter. Probably acts redundantly with the other metal transport proteins cnnm-1, cnnm-2, cnnm-3 and cnnm-4 to regulate Mg(2+) homeostasis.
  disruption phenotype: No visible phenotype. Quintuple knockout with cnnm-1, cnnm-2, cnnm-3 and cnnm-4 results in a reduced lifespan and 100% sterility.

PITG_02263 metal transporter, putative from Phytophthora infestans T30-4
Aligns to 50:156 / 425 (25.2%), covers 51.7% of PF01595, 49.1 bits

• Lifestyle, gene gain and loss, and transcriptional remodeling cause divergence in the transcriptomes of Phytophthora infestans and Pythium ultimum during potato tuber colonization
  Ah-Fong, BMC genomics 2017
  • “...in each tissue, expression of the other orthologs has been shuffled. In one ortholog pair, PITG_02263 shows moderate expression while zero expression was seen for PYU1_G014841. In a second ortholog pair, PYU1_G000638 and PITG_03105 show moderate and zero expression, respectively. The ortholog assignments in this family...”

Pput_4262 transporter-associated region (RefSeq) from Pseudomonas putida F1
Aligns to 11:167 / 401 (39.2%), covers 38.1% of PF01595, 37.9 bits

• iTRAQ-based quantitative proteomic analysis of the global response to 17β-estradiol in estrogen-degradation strain Pseudomonas putida SJTE-1
  Xu, Scientific reports 2017
  • “...transport system Pput_3978 1.73 0.042 gi|148546300 Porin, OprB family Pput_1057 0.48 0.039 gi|148549468 Transporter-associated region Pput_4262 2.26 0.007 gi|148545498 L-cystine-binding protein/Diaminopimelate-binding protein Pput_0242 0.65 0.001 gi|148550288 Putrescine-binding periplasmic protein Pput_5088 3.80 0.000 Carbohydrate metabolism gi|148545619 Pyruvate dehydrogenase E1 component Pput_0364 0.64 0.002 gi|148546901 Succinate dehydrogenase subunit...”

Or search for genetic data about PF01595 in the Fitness Browser