Family Search for PF01894 (UPF0047)

PF01894 hits 23 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.

TTE2189 conserved hypothetical protein (NCBI ptt file) from Thermoanaerobacter tengcongensis MB4
Aligns to 16:127 / 130 (86.2%), covers 100.0% of PF01894, 155.5 bits

• A cross-genomic approach for systematic mapping of phenotypic traits to genes
  Jim, Genome research 2004
  • “...TTE1354 TTE1210 TTE1341 TTE1276 TTE1779 TTE0960 TTE1571 TTE2189 TTE2193 TTE1537 TTE2532 TTE0444 TTE1518 TTE0818 TTE1866 TTE0714 TTE2659 TTE0820 TTE1891 TTE1892...”

Q9X2I5 thiamine phosphate synthase (EC 2.5.1.3) from Thermotoga maritima (see paper)
Aligns to 17:129 / 132 (85.6%), covers 100.0% of PF01894, 153.9 bits

Q8U3C6 thiamine phosphate synthase (EC 2.5.1.3) from Pyrococcus furiosus (see paper)
Aligns to 17:130 / 133 (85.7%), covers 100.0% of PF01894, 146.1 bits

BCAM0378 hypothetical upf0047 protein sll1880 (RefSeq) from Burkholderia cenocepacia J2315
Aligns to 19:136 / 139 (84.9%), covers 99.1% of PF01894, 140.2 bits

• Characterization of the AtsR hybrid sensor kinase phosphorelay pathway and identification of its response regulator in Burkholderia cenocepacia
  Khodai-Kalaki, The Journal of biological chemistry 2013
  • “...with fragments flanking atsT pGPI-SceI with fragments flanking bcam0378 pET28a () encoding B. cenocepacia bcam0378, His6: kanR pET28a () encoding B. cenocepacia...”
  • “...conserved Asp at the C terminus. The other is BCAM0378, which locates immediately upstream of atsR and encodes a hypothetical protein containing His and Asp...”

MA3192 conserved hypothetical protein (NCBI ptt file) from Methanosarcina acetivorans C2A
Aligns to 15:128 / 132 (86.4%), covers 100.0% of PF01894, 139.4 bits

• A DNA element recognised by the molybdenum-responsive transcription factor ModE is conserved in Proteobacteria, green sulphur bacteria and Archaea
  Studholme, BMC microbiology 2003
  • “...protein Methanosarcina acetivorans ATTTTTTAGATAAATTTATATATATCGTA 76 441 MA1756 cell surface protein Methanosarcina acetivorans ATCCATTAGATACAAATATTTATATAGAA 76 1467 MA3192 conserved hypothetical protein Methanosarcina acetivorans TATATTTATATAAAAATCAACATATCTAT 76 555 cpa MA3604 carboxypeptidase A Methanosarcina acetivorans GTACAGTATATATTTTAAAATATAGTTAT 76 507 atpH MA4152 H(+) transporting ATP synthase, subunit H Table 3 Frequencies of matches...”

DVU0499 conserved hypothetical protein TIGR00149 (TIGR) from Desulfovibrio vulgaris Hildenborough
Aligns to 16:128 / 131 (86.3%), covers 99.1% of PF01894, 133.4 bits

• Transcriptome Analysis of the Acid Stress Response of Desulfovibrio vulgaris ATCC 7757
  Yu, Current microbiology 2020 (PubMed)
  • “...in the reduction process decreased, including the genes DVU0499 and sat, which encode proteins that affect the sulfate reduction process. Both gene activities...”
  • “...to the ATCC 7757 reduction process, such as the DVU0499 and sat genes. These genes were downregulated under acid stress, indicating that the reduction ability...”

1ve0A / Q96YV5 Crystal structure of uncharacterized protein st2072 from sulfolobus tokodaii
ST2072 134aa long conserved hypothetical protein (NCBI ptt file) from Sulfolobus tokodaii str. 7
WP_010980147 secondary thiamine-phosphate synthase enzyme YjbQ from Sulfurisphaera ohwakuensis
Aligns to 20:131 / 134 (83.6%), covers 99.1% of PF01894, 130.7 bits

• Ligand: zinc ion (1ve0A)
• "Hot cores" in proteins: comparative analysis of the apolar contact area in structures from hyper/thermophilic and mesophilic organisms
  Paiardini, BMC structural biology 2008
  • “...tokodaii 2.00 1VMH A a/b C. acetobutylicum 1.31 0.69 42 Metal Binding Protein Hypothetical Protein St2072 22 1VPE 0 a/b Thermotoga maritima 2.00 1HDI A a/b Sus scrofa 1.80 0.20 47 Transferase Phosphoglycerate Kinase 23 1XGS A mainly a Pyrococcus furiosus 1.75 1B6A 0 mainly a...”
  • “...tokodaii 2.00 1VMH A a/b Clostridium acetobutylicum 1.31 0.69 42 Metal Binding Protein Hypothetical Protein St2072 33 1VFF A a/b Pyrococcus horikoshii 2.55 1E4I A a/b Bacillus polymyxa 2.00 0.55 32 Hydrolase B-Glucosidase 34 1VPE 0 a/b Thermotoga maritima 2.00 1HDI A a/b Sus scrofa 1.80...”
• Crystal structure of the hypothetical protein ST2072 from Sulfolobus tokodaii
  Tanaka, Proteins 2005 (PubMed)
  • “...of the Hypothetical Protein ST2072 From Sulfolobus tokodaii Yoshikazu Tanaka,1,2 Kouhei Tsumoto,1,3* Eiki Tanabe,1 Yoshiaki Yasutake,2 Naoki Sakai,2 Min Yao,2,4...”
  • “...RIKEN Harima Institute/SPring-8, Hyogo, Japan Introduction. ST2072 is a hypothetical function unknown protein from the thermophilic archaeon Sulfolobus...”
• Crystal structure of the hypothetical protein ST2072 from Sulfolobus tokodaii.
  Tanaka, Proteins 2005 (PubMed)
  • GeneRIF: xray diffraction of the recombinant protein.

EHI_169840 hypothetical protein, conserved from Entamoeba histolytica HM-1:IMSS
Aligns to 25:144 / 148 (81.1%), covers 98.3% of PF01894, 130.6 bits

• Use of bacterially expressed dsRNA to downregulate Entamoeba histolytica gene expression
  Solis, PloS one 2009
  • “...647 5 0 1009 ehcs0011A12.b EHI_054480 100 209 0 0 8 216 1E-91 332 ehcs0011A16.b EHI_169840 100 391 0 0 17 407 3E-178 621 ehcs0011A22.b EHI_105770 100 218 0 0 12 229 6E-96 347 ehcs0011B11.b EHI_050960 100 416 0 0 21 436 8E-165 576 ehcs0011D07.b EHI_087410...”

BH3498 hypothetical protein (NCBI) from Bacillus halodurans C-125
Aligns to 16:130 / 133 (86.5%), covers 99.1% of PF01894, 130.2 bits

• Comprehensive characterization of the contribution of individual SigB-dependent general stress genes to stress resistance of Bacillus subtilis
  Höper, Journal of bacteriology 2005
  • “...BH3178, Bacillus halodurans (3.3e-90) Hypothetical protein BH3498, Bacillus halodurans (1.4e-45) Oxidoreductase (EC 1.1.1.-) BC3595, Bacillus cereus (4.0e-78)...”
• Global analysis of the general stress response of Bacillus subtilis
  Petersohn, Journal of bacteriology 2001
  • “...protein, A. rubrum (6e-07) Unknown conserved protein BH3498, B. halodurans (2e-48) Hypothetical conserved protein BH3345, B. halodurans (7e-22) Senescence...”

SPAC4A8.02c conserved protein (broad species distribution) (RefSeq) from Schizosaccharomyces pombe
Aligns to 19:136 / 142 (83.1%), covers 98.3% of PF01894, 127.7 bits

• Rif1 Regulates the Fate of DNA Entanglements during Mitosis
  Zaaijer, Cell reports 2016
  • “...telomere length was assessed by Southern blot analysis. A probe to a PCR-amplified fragment of SPAC4A8.02c was used as an internal loading control. Asterisks above blots indicate parental diploids, with the following lanes taken from progressive restreaks. (B) Sub-telomeric recombination is monitored via stability of the...”
• Non-coding telomeric and subtelomeric transcripts are differentially regulated by telomeric and heterochromatin assembly factors in fission yeast
  Greenwood, Nucleic acids research 2012
  • “...isolated. Loading control probe was generated by PCR for an internal genomic sequence in gene SPAC4A8.02c using primers 5-CTCGTGACAACAACTTAGTC and 5-ACTTTTGGGCGTTCAGAAGC. RNA isolation and northern blotting Cells of the indicated strains were grown in 1050ml rich media to OD 600 of 0.60.8, and RNA was isolated...”
• Cross-species Functionome analysis identifies proteins associated with DNA repair, translation and aerobic respiration as conserved modulators of UV-toxicity
  Rooney, Genomics 2011
  • “...elongation factor Spt6 High Elf1 AAA family ATPase ELf1 High Sty1 MAP kinase Sty1 High Spac4a8.02c conserved protein (broad species distribution) High Spbc6b1.03c Pal1 family protein High Cds1 replication checkpoint kinase Cds1 High Swi3 replication fork protection complex subunit Swi3 High Tom7 mitochondrial TOM complex subunit...”

TTE1571 conserved hypothetical protein (NCBI ptt file) from Thermoanaerobacter tengcongensis MB4
Aligns to 20:135 / 138 (84.1%), covers 100.0% of PF01894, 125.6 bits

• A cross-genomic approach for systematic mapping of phenotypic traits to genes
  Jim, Genome research 2004
  • “...TTE0961 TTE1354 TTE1210 TTE1341 TTE1276 TTE1779 TTE0960 TTE1571 TTE2189 TTE2193 TTE1537 TTE2532 TTE0444 TTE1518 TTE0818 TTE1866 TTE0714 TTE2659 TTE0820 TTE1891...”

A4XHT6 Secondary thiamine-phosphate synthase enzyme from Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
Aligns to 20:135 / 138 (84.1%), covers 100.0% of PF01894, 124.9 bits

• Part II: defining and quantifying individual and co-cultured intracellular proteomes of two thermophilic microorganisms by GeLC-MS2 and spectral counting
  Andrews, Analytical and bioanalytical chemistry 2010
  • “...4 SpC A4XJ94 Ferredoxin-dependent glutamate synthase 58.8 16 0.08850 A4XI39 NUDIX hydrolase 16.0 6 0.12612 A4XHT6 Putative, probable YjbQ-like protein 15.9 5 0.10662 A4XG53 Monosaccharide-transporting ATPase 34.1 5 0.04486 A4XLT3 Putative, probable beta-lactamase-like protein 5.9 4 0.22209 A4XHL3 Lipolytic enzyme, G-D-S-L family 26.9 4 0.05052 A4XFT4...”

Q9WZI2 thiamine phosphate synthase (EC 2.5.1.3) from Thermotoga maritima (see paper)
Aligns to 20:136 / 139 (84.2%), covers 100.0% of PF01894, 120.3 bits

PA5286 hypothetical protein (NCBI) from Pseudomonas aeruginosa PAO1
Aligns to 18:136 / 141 (84.4%), covers 97.4% of PF01894, 119.8 bits

• Full Transcriptomic Response of Pseudomonas aeruginosa to an Inulin-Derived Fructooligosaccharide
  Rubio-Gómez, Frontiers in microbiology 2020
  • “...glpT Glycerol-3-phosphate transporter 1.0 0.000 0.9 0.000 PA5285 sutA Uncharacterized protein 0.6 0.003 0.6 0.002 PA5286 yjbQ Uncharacterized protein 0.7 0.002 0.7 0.003 PA5301 pauR Polyamine catabolic process 0.7 0.002 0.6 0.002 PA5315 rpmG 50S ribosomal protein L33 0.6 0.002 0.6 0.001 PA5332 crc Catabolite repression...”
  • “...1.2 0.000 PA5255 algQ Alginate regulatory protein 0.6 0.007 PA5285 sutA Uncharacterized protein 0.5 0.006 PA5286 yjbQ Uncharacterized protein 0.7 0.000 PA5288 glnK Nitrogen regulatory protein 0.6 0.003 PA5301 pauR Polyamine catabolic process 0.9 0.000 PA5315 rpmG 50S ribosomal protein L33 0.7 0.000 PA5332 crc Catabolite...”
• Protein-to-mRNA ratios are conserved between Pseudomonas aeruginosa strains
  Kwon, Journal of proteome research 2014
  • “...17.7 367.0 406.0 peptide methionine sulfoxide reductase PA5201 28.5 7.3 1453.0 1523.5 conserved hypothetical protein PA5286 9.4 3.6 818.0 1366.5 conserved hypothetical protein PA5343 8.3 3.0 193.5 246.5 hypothetical protein PA5535 0.0 17.1 42.0 42.5 conserved hypothetical protein a The protein abundance value represents the average...”

Q97VS8 thiamine phosphate synthase (EC 2.5.1.3) from Saccharolobus solfataricus (see paper)
Aligns to 20:134 / 137 (83.9%), covers 99.1% of PF01894, 119.3 bits

YjbQ / b4056 UPF0047 protein YjbQ from Escherichia coli K-12 substr. MG1655 (see 4 papers)
b4056 hypothetical protein (NCBI) from Escherichia coli str. K-12 substr. MG1655
ECs5038 hypothetical protein (NCBI ptt file) from Escherichia coli O157:H7 str. Sakai
Aligns to 18:135 / 138 (85.5%), covers 97.4% of PF01894, 118.0 bits

• Identification and mapping of self-assembling protein domains encoded by the Escherichia coli K-12 genome by use of lambda repressor fusions
  Mariño-Ramírez, Journal of bacteriology 2004
  • “...b2861 b3044 b4272 b3585 b3589 b3644 b3638 b3695 b3884 b4056 b4167 b4191 b4192 b4249 b4295 b0515 b1145 b1330 b1524 b1595 b1760 b2434 b2549 b2875 b3071 b3193...”
• Global transcriptional response of Escherichia coli O157:H7 to growth transitions in glucose minimal medium
  Bergholz, BMC microbiology 2007
  • “...O157 2.12 2 ECs5207 ytfT 3.32 2 ECs5007 lysC -3.43 1 ECs5208 yjfF 2.59 2 ECs5038 pfkA 2.14 2 ECs5211 yjgA 2.20 2 ECs5039 yjbR 2.21 2 ECs5213 cybC 2.20 2 ECs5049 actP 4.17 2 ECs5222 pyrB -2.95 1 ECs5050 yjcH 3.78 2 ECs5253 O157 2.70...”

SG2130 hypothetical protein (NCBI) from Sodalis glossinidius str. 'morsitans'
Aligns to 17:134 / 137 (86.1%), covers 96.5% of PF01894, 117.3 bits

• Mobile genetic element proliferation and gene inactivation impact over the genome structure and metabolic capabilities of Sodalis glossinidius, the secondary endosymbiont of tsetse flies
  Belda, BMC genomics 2010
  • “...evidences of complementation. This was revealed through the identification of yjbQ gene in S. glossinidius (SG2130). The YjbQ protein has been recently demonstrated to contain a thiamine phosphate synthase activity able to rescue thiamine auxotrophy in a mutant thiE strain [ 83 ]. This leads to...”

STM4250 putative cytoplasmic protein (NCBI ptt file) from Salmonella typhimurium LT2
Aligns to 18:135 / 138 (85.5%), covers 97.4% of PF01894, 114.6 bits

• Novel DNA Binding and Regulatory Activities for σ54 (RpoN) in Salmonella enterica Serovar Typhimurium 14028s.
  Bono, Journal of bacteriology 2017
  • “...STM3521f STM3568f STM3772f STM_R0167f STM4007f STM4172f STM4173f STM4244f STM4250 STM4285f STM4367f STM4535f prpB clpP glnK glmY norV hydN hycA hypA rsr rpoH...”

TTC1351 No description from Thermus thermophilus HB27
Aligns to 18:128 / 129 (86.0%), covers 99.1% of PF01894, 111.4 bits

• Phosphoproteomic analysis reveals the effects of PilF phosphorylation on type IV pilus and biofilm formation in Thermus thermophilus HB27
  Wu, Molecular & cellular proteomics : MCP 2013
  • “...elongation factor tu Hypothetical protein TTC1351 Orotidine 5-phosphate decarboxylase Fructose-bisphosphate aldolase Metal dependent phosphohydrolase ABC...”
  • “...protein Acetylglutamate kinase Inorganic pyrophosphatase TTC1330/tuf TTC1351 TTC1381/pyrF TTC1414 TTC1420 TTC1488 TTC1541 TTC1600 Locus name/gene name TABLE...”

YP_001997537 protein of unknown function UPF0047 (RefSeq) from Chloroherpeton thalassium ATCC 35110
Aligns to 19:135 / 138 (84.8%), covers 99.1% of PF01894, 95.7 bits

• Biosynthesis of rhizocticins, antifungal phosphonate oligopeptides produced by Bacillus subtilis ATCC6633
  Borisova, Chemistry & biology 2010
  • “...HPr kinase/phosphatase (1KNX_A) (312 aa) 14 rhiN 132 Chloroherpeton thalassium protein of unknown function UPF0047 (YP_001997537) (138 aa) 35 E. coli conserved hypothetical protein YjbQ (ZP_03048862) (138 aa) 22 rhiJ 393 Thermotoga lettingae aminotransferase class V (YP_001471385) (381 aa) 42 Methanocaldococcus jannaschii broad-specificity class V aspartate...”

MAP_1076 secondary thiamine-phosphate synthase enzyme YjbQ from Mycobacterium avium subsp. paratuberculosis K-10
Aligns to 13:126 / 129 (88.4%), covers 98.3% of PF01894, 88.2 bits

• Acanthamoeba castellanii as a Screening Tool for Mycobacterium avium Subspecies paratuberculosis Virulence Factors with Relevance in Macrophage Infection.
  Phillips, Microorganisms 2020
  • “...Yes Hypothetical protein with EAL domain/Diguanylate cyclase domain 7E1 MAP_1024/cysM2 High No Cystathionine beta-synthase 14C8 MAP_1076 Low N/A Hypothetical protein 2G12 MAP_1133 High Yes Methionyl-tRNA formyltransferase 7B10 MAP_1221 High N/A DNA-binding response regulator, OmpR family, contains REC and winged-helix (wHTH) domain 4H8 MAP_1301/chaA Low No Ca...”

Rv2556c hypothetical protein (NCBI) from Mycobacterium tuberculosis H37Rv
Aligns to 13:126 / 129 (88.4%), covers 98.3% of PF01894, 87.3 bits

• The unfoldase ClpC1 of Mycobacterium tuberculosis regulates the expression of a distinct subset of proteins having intrinsically disordered termini
  Lunge, The Journal of biological chemistry 2020 (secret)
• Whole genome sequencing, analyses of drug resistance-conferring mutations, and correlation with transmission of Mycobacterium tuberculosis carrying katG-S315T in Hanoi, Vietnam
  Hang, Scientific reports 2019
  • “...Rv2143, Rv2164c, Rv2177c, Rv2190c, Rv2219A, Rv2228c, Rv2254c, Rv2256a, Rv2286c, Rv2314c, Rv2319c, Rv2327, Rv2424c, Rv2456c, Rv2532c, Rv2556c, Rv2567, Rv2621c, Rv2630, Rv2638, Rv2656c, Rv2668, Rv2669, Rv2729c, Rv2733c, Rv2792c, Rv2798c, Rv2851c, Rv2864c, Rv2893, Rv2897c, Rv2951c, Rv2974c, Rv2994, Rv3027c, Rv3060c, Rv3064c, Rv3074, Rv3104c, Rv3169, Rv3193c, Rv3201c, Rv3208, Rv3216, Rv3218, Rv3230c,...”
• Application of Distributive Conjugal DNA Transfer in Mycobacterium smegmatis To Establish a Genome-Wide Synthetic Genetic Array.
  Judd, Journal of bacteriology 2017
  • “...Synthetic lethal H2O2 Synthetic lethal -- Rv0043c Rv2556c Rv2256c Synthetic Synthetic Synthetic Synthetic Synthetic sick Synthetic sick None Synthetic lethal...”
• Proteomic definition of the cell wall of Mycobacterium tuberculosis
  Wolfe, Journal of proteome research 2010
  • “...CONSERVED HYPOTHETICAL PROTEIN 10 V D Rv2518c lppS PROBABLE CONSERVED LIPOPROTEIN LPPS 3 II.C.1 D Rv2556c Rv2556c CONSERVED HYPOTHETICAL PROTEIN 10 V D Rv2712c Rv2712c HYPOTHETICAL PROTEIN 16 VI A Rv2720 leXA REPRESSOR LEXA 9 I.J.1 D Rv2789c fadE21 PROBABLE ACYL-CoA DEHYDROGENASE FADE21 1 I.A.3 A...”

P9WFP9 UPF0047 protein Rv2556c from Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Aligns to 17:130 / 133 (85.7%), covers 98.3% of PF01894, 87.2 bits

• The unfoldase ClpC1 of Mycobacterium tuberculosis regulates the expression of a distinct subset of proteins having intrinsically disordered termini
  Lunge, The Journal of biological chemistry 2020 (secret)

Or search for genetic data about PF01894 in the Fitness Browser