Family Search for PF02656 (DUF202)

PF02656 hits 38 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.

Rv2272 PROBABLE CONSERVED TRANSMEMBRANE PROTEIN from Mycobacterium tuberculosis H37Rv
Aligns to 17:84 / 122 (55.7%), covers 98.5% of PF02656, 72.2 bits

• Large genomic deletions delineate Mycobacterium tuberculosis L4 sublineages in South American countries
  Baena, PloS one 2023
  • “...a larger deletion that spans 6,479 nucleotides and affects the genes ippN , rv2271 , rv2272 , rv2273 , mazF8 , mazE8 , rv2275 , cyp121 , rv2277c , and rv2280 ( Fig 7 , panel A). Additionally, several strains of the sister clades 4.1.2.1Col1, 4.1.2.1Peru1,...”
  • “...and is present in 249 genomes. This deletion affects the genes ippN , rv2271 , rv2272 , rv2273 , mazF8 , mazE8 , rv2275 , cyp121 , rv2277c , and rv2280 . Panel B . Genomic deletion of 4,752 bp. that is common in the Latin...”
• Label-Free Comparative Proteomics of Differentially Expressed Mycobacterium tuberculosis Protein in Rifampicin-Related Drug-Resistant Strains
  Ullah, Pathogens (Basel, Switzerland) 2021
  • “...mainly involved in the cell wall and cell processes. When compared to the RR strain, Rv2272, smtB, lpqB, icd1, and folK were up-regulated, while esxK, PPE19, Rv1534, rpmI, ureA, tpx, mpt64, frr, Rv3678c, esxB, esxA, and espL were down-regulated in both MDR and XDR strains. Additionally,...”
  • “...Figure 3 B). Importantly, both MDR and XDR strains showed high expression of 5 proteins: Rv2272, smtB, lpqB, icd1, and folK ( Figure 3 C, Table 5 ) and low expression of 12 proteins: esxK, PPE19, Rv1534, rpmI, ureA, tpx, mpt64, frr, Rv3678c, esxB, esxA, and...”
• Structure-Aware Mycobacterium tuberculosis Functional Annotation Uncloaks Resistance, Metabolic, and Virulence Genes
  Modlin, mSystems 2021
  • “...Rv1205 Hypothetical protein Riboside monophosphate phosphoribohydrolase 25728768 Rv2018 Hypothetical protein Probable antitoxin VapB/antigen 28066388, 23140854 Rv2272 Transmembrane protein Probable gamma delta T-cell activator 23389928 Rv2525c Tat pathway signal sequence Probable peptidoglycan hydrolase 16952959, 25869294, 25260828 Rv2923c Hypothetical protein Probable osmotically induced bacterial protein C (OsmC, a...”
• Phosphoantigen Presentation to TCR γδ Cells, a Conundrum Getting Less Gray Zones
  De, Frontiers in immunology 2014
  • “...IPP, HMBPP ( 43 45 ) Tetanus toxoid ( 30 , 31 ) DXS2 or Rv2272 peptides ( 40 ) V1 clones HLA-A24, HLA-A2 ( 9 , 10 ) V4V1 HLA-B27 ( 32 ) V3V2 Histidyl-tRNA synthetase ( 39 ) MOUSE Hybridoma G8 T10, T22, T27...”
  • “...isopentenyl pyrophosphate; MICA or MICB, MHC class I chain-related protein A or B; NP, 4-hydroxy-3-nitrophenylacetyl; Rv2272, mycobacterium transmembrane protein; T10, T22, or T27, MHC class Ib proteins; PE, algae protein phycoerythrin . CD1 molecules have been found to interact with the human TCR. The first isolated...”
• Nonclassical T cells and their antigens in tuberculosis
  De, Cold Spring Harbor perspectives in medicine 2014
  • “...proteins, namely of 1-deoxy-D-xylulose 5-phosphate synthase 2 and Rv2272 protein, which activated gd T cells from pulmonary TB patients (Xi et al. 2013)....”
• Molecules and Mechanisms Implicated in the Peculiar Antigenic Activation Process of Human Vγ9Vδ2 T Cells
  Harly, Frontiers in immunology 2014
  • “...characterized which led to the identification of new protein/peptides of mycobacterial origin (e.g., OXYS, DXS2, Rv2272) ( 94 , 95 ) that can interact with V9V2 TCRs and activate a large fraction of V9V2 T cells isolated from peripheral blood of tuberculosis infected patients but not...”
• Identification of a new tuberculosis antigen recognized by γδ T cell receptor
  Xi, Clinical and vaccine immunology : CVI 2013
  • “...The extracellular region (extracellular peptide [EP]) of Rv2272, a TP2-matched mycobacterial transmembrane protein, was also shown to activate T cells from...”
  • “...transmembrane region of the unknown transmembrane protein (Rv2272). Statistical analysis. Statistical comparisons were performed using the Student t test....”
• Genetic heterogeneity revealed by sequence analysis of Mycobacterium tuberculosis isolates from extra-pulmonary tuberculosis patients
  Das, BMC genomics 2013
  • “...tuberculosis [ 19 ]. In case of F99 several trans-membrane protein coding genes, such as Rv2272 and Rv2273 were missing. Although we have considered repeat regions by realigning short reads with multiple matches, a number of prophage proteins (phiRV2) were not mapped. Prophage proteins are quite...”
• More

YidH / b3676 DUF202 domain-containing inner membrane protein YidH from Escherichia coli K-12 substr. MG1655 (see 3 papers)
Aligns to 13:80 / 115 (59.1%), covers 100.0% of PF02656, 69.8 bits

FOIG_07033 vacuolar transporter chaperone 1 from Fusarium odoratissimum NRRL 54006
Aligns to 24:86 / 129 (48.8%), covers 98.5% of PF02656, 64.0 bits

• RNA Sequencing Reveals that Endoplasmic Reticulum Stress and Disruption of Membrane Integrity Underlie Dimethyl Trisulfide Toxicity against Fusarium oxysporum f. sp. cubense Tropical Race 4
  Zuo, Frontiers in microbiology 2017
  • “...OST4 (FOIG_01070), signal peptidase complex (FOIG_03977 and FOIG_05064), phosphotransferase (FOIG_05811), and vacuolar transporter chaperone 1 (FOIG_07033) ( Figure 5 ). FIGURE 5 Expression profiles of ER-related genes. Repression of DEGs Involved in Steroid Biosynthesis Following DT Exposure The expression of the genes involved in steroid biosynthesis...”

VTC1_YEAST / P40046 Vacuolar transporter chaperone complex subunit 1; Negative regulator of CDC42 protein 1; Phosphate metabolism protein 4; SPX-dependent polyphosphate polymerase VTC subunit 1; Vacuolar membrane polyphosphate polymerase accessory subunit 1; PolyP polymerase from Saccharomyces cerevisiae (strain ATCC 204508 / S288c) (Baker's yeast) (see 9 papers)
TC 9.B.51.1.6 / P40046 VTC1 or PHM4 protein of 129 aas and 3 TMSs from Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
YER072W Vacuolar transporter chaperon (VTC) involved in distributing V-ATPase and other membrane proteins; together with other VTC proteins, forms a heterotetrameric complex that associates with the SNARE Nyv1p and the V0 sector of the V-ATPase from Saccharomyces cerevisiae
NP_010995 Vtc1p from Saccharomyces cerevisiae S288C
Aligns to 24:86 / 129 (48.8%), covers 98.5% of PF02656, 63.9 bits

• function: Accessory subunit of the vacuolar transporter chaperone (VTC) complex. The VTC complex acts as a vacuolar polyphosphate polymerase that catalyzes the synthesis of inorganic polyphosphate (polyP) via transfer of phosphate from ATP to a growing polyP chain, releasing ADP. VTC exposes its catalytic domain VTC4 to the cytosol, where the growing polyP chain winds through a tunnel-shaped pocket, integrating cytoplasmic polymer synthesis with polyP membrane translocation (PubMed:19390046). The VTC complex carries 9 vacuolar transmembrane domains, which are likely to constitute the translocation channel into the organelle lumen (PubMed:19390046, PubMed:25315834). PolyP synthesis is tightly coupled to its transport into the vacuole lumen, in order to avoid otherwise toxic intermediates in the cytosol, and it depends on the proton gradient across the membrane, formed by V-ATPase (PubMed:25315834). VTC1 contributes only 3 transmembrane domains to the complex (Probable). The VTC complex also plays a role in vacuolar membrane fusion (PubMed:10480897, PubMed:11102525, PubMed:11823419, PubMed:12584253). Required for SEC18/NSF activity in SNARE priming, membrane binding of LMA1 and V(0) trans-complex formation (PubMed:11823419).
  subunit: The VTC core complex is an integral membrane heterooligomer composed of the catalytic subunit VTC4 and the accessory subunits VTC1, VTC2 and VTC3. The complex exists in 2 different sub-complexes: VTC1- VTC2-VCT4 and VCT1-VTC3-VTC4. The VCT1-VTC3-VTC4 subcomplex is mostly found on the vacuolar membrane. The VTC1-VTC2-VCT4 subcomplex is observed in the cell periphery, probably ER and nuclear envelope, but localizes to the vacuole under phosphate starvation. Each subunit contains 3 transmembrane helices. VTC1 is a small membrane protein without hydrophilic domain. VTC2, VTC3 and VTC4 are related and have 2 hydrophilic domains that face the cytosol, an N-terminal SPX domain and the central core domain. The central core in VTC4 is the catalytic domain, with the essential catalytic lysine replaced by isoleucine and leucine in VTC2 and VTC3, respectively (PubMed:19390046). The core complex associates with the accessory subunit VTC5 (PubMed:27587415). The complex interacts with the v-SNARE NYV1 and with the V(0) subunit of V-ATPase VPH1 (PubMed:11823419).
• substrates: H+
  tcdb comment: This protein corresponds to the C-terminal domain of polyphosphate polymerase (TC# 4..E.1) (Gerasimaitė et al. 2014). VTC proteins influence the vacuolar H+-ATPase (V-ATPase) as well as vacuolar H+ uptake. Like the V-ATPase V0 sectors, VTCs are important factors in vacuolar membrane fusion (Müller et al. 2003)
• Antifungal Activity of Disalt of Epipyrone A from Epicoccum nigrum Likely via Disrupted Fatty Acid Elongation and Sphingolipid Biosynthesis
  Lee, Journal of fungi (Basel, Switzerland) 2024
  • “...6500HS (General Electric). For reference, nuclei were distinguished with RFP. These proteins include Sit1(YEL065W); Vtc1 (YER072W); Sna3 (YJL151C); Ade17 (YMR120C); Aga1 (YNR044W); Cmk2 (YOL016C); and Sur1 (YPL057C). Figure 8 Quantitative comparison of GFP-tagged protein intensity in presence and absence (control) of disalt of epipyrone A (DEA)....”
  • “...proteins include Ade17 (YMR120C); Aga1 (YNR044W); Cmk2 (YOL016C); Sit1(YEL065W); Sna3 (YJL151C); Sur1 (YPL057C); and Vtc1 (YER072W). **** represents p < 0.0001. Figure 9 Thin-layer chromatography (TLC) reveals accumulation of free fatty acids (FFA) and triacyl glycerides (TAG) in disalt of epipyrone A (DEA)-treated cells. Cells were...”
• Spt4 facilitates the movement of RNA polymerase II through the +2 nucleosomal barrier
  Uzun, Cell reports 2021
  • “...(RNAPII) and TEF-seq (Spt4 and Spt5) reads of example genes transcribed fromthe positive strand, namely, YER072W , YER073W , and YDR381W , in two biological replicates. The dark-blue boxes indicate the transcribed region of the genes (from TSS to PAS), and the blue line indicates the...”
• The Reduced Level of Inorganic Polyphosphate Mobilizes Antioxidant and Manganese-Resistance Systems in Saccharomyces cerevisiae
  Trilisenko, Cells 2019
  • “...and diphosphoinositol endopolyphosphatase 1.00 0.96 0.46 Subunits of the VTC Complex Involved in Polyphosphate Biosynthesis YER072W VTC1 Regulatory subunit involved in membrane trafficking and vacuolar polyphosphate accumulation 5.48 5.05 2.94 YFL004W VTC2 1.59 1.52 0.98 YPL019C VTC3 1.18 2.51 2.33 YDR089W VTC5 0.78 0.96 0.07 YJL012C...”
• Widespread Cumulative Influence of Small Effect Size Mutations on Yeast Quantitative Traits
  Hua, Cell systems 2018
  • “...YDR245W, YBR036C, YDR221W, YPL192C, YLL014W, YDR508C, YEL001C, YER005W, YDR137W, YDL099W, YGL231C, YHR108W, YMR238W, YAL053W, YIL027C, YER072W, YML038C, YER120W, YEL027W, YIL030C, YDR492W, YJR131W, YMR010W, YHR181W, YPR063C, YIL124W, YLR350W, YJR088C, YBL011W, YML048W, YNL044W, YDR358W, YOR311C, YDR411C, YMR272C, YNL049C, YMR015C, YDL052C, YJR134C, YKL096W, YNL280C, YLR194C, YER113C, YDR077W, YDR055W, YNR021W,...”
• Yeast metabolic and signaling genes are required for heat-shock survival and have little overlap with the heat-induced genes
  Gibney, Proceedings of the National Academy of Sciences of the United States of America 2013
  • “...YDR340W RPL4A BMH1 YIR027C YML107C DAL1 PML39 YER072W YOL153C YFR010W YBL081W YOR170W YLR392C VTC1 YOL153C UBP6 YBL081W YOR170W ART10 Inositol hexakisphosphate...”
• A Whole Genome Screen for Minisatellite Stability Genes in Stationary-Phase Yeast Cells
  Alver, G3 (Bethesda, Md.) 2013
  • “...YMR258C YMR258c EDC3 YEL015w PRM4 YPL156c VPS61 YDR136c YMR304C-A YMR304c-a EFT2 YDR385w PSD2 YGR170w VTC1 YER072w YOL024W YOL024w ELC1 YPL046c PXL1 YKR090w YAP1801 YHR161c YOL079W YOL079w FDC1 YDR539w QCR10 YHR001w-a YAT2 YER024w YOL153C YOL153c FIN1 YDR130c RDS1 YCR106w YBL096C YBL096c YOR170W YOR170w FOB1 YDR110w REC104 YHR157w...”
• The role of the Parkinson's disease gene PARK9 in essential cellular pathways and the manganese homeostasis network in yeast
  Chesi, PloS one 2012
  • “...PPM1 YHR180W YHR180W YJR033C RAV1 YJL053W PEP8 YKR028W SAP190 YIL054W YIL054W YBR231C SWC5 YIL040W APQ12 YER072W VTC1 YLL044W YLL044W YJL004C SYS1 YJR074W MOG1 YJL012C VTC4 YOR199W YOR199W YKL081W TEF4 YMR031W-A YMR031W-A YHR135C YCK1 YIL145C PAN6 YOL018C TLG2 YDR089W YDR089W YDL095W PMT1 YKR001C VPS1 YDR295C HDA2 YLL030C...”
• High-resolution genome-wide scan of genes, gene-networks and cellular systems impacting the yeast ionome
  Yu, BMC genomics 2012
  • “...- - - - - - 8.45 - - - - 6.10 - - P YER072W VTC1 B - - - - - - 8.94 - - - - 8.59 - - S YOL049W GSH2 C - 5.42 - - - - - - 6.15 -...”
• More
• Ddi1 is a ubiquitin-dependent protease.
  Yip, Proceedings of the National Academy of Sciences of the United States of America 2020
  • GeneRIF: unlike other shuttling factors, Ddi1 and its homologs contain a conserved helical domain (helical domain of Ddi1, HDD) and a retroviral-like protease (RVP) domain. The RVP domain is probably responsible for cleavage of the precursor of the transcription factor Nrf1 in higher eukaryotes, which results in the up-regulation of proteasomal subunit genes.
• The cytoplasmic synthesis and coupled membrane translocation of eukaryotic polyphosphate by signal-activated VTC complex
  Guan, Nature communications 2023
  • “...14 , 35 . Protein expression and purification The codon-optimized DNAs of yeast Vtc1 (Uniprot: P40046), Vtc3 (Uniprot: Q02725) and Vtc4 (Uniprot: P47075) were subcloned separately into the pMlink vector 55 . Vtc1 was tagged with a C-terminal HA tag, Vtc3 was tagged with an N-terminal...”
• Knockout of the Hmt1p Arginine Methyltransferase in Saccharomyces cerevisiae Leads to the Dysregulation of Phosphate-associated Genes and Processes
  Chia, Molecular & cellular proteomics : MCP 2018
  • “...Pho8p YLR413W Pho3p Fpr4p Pdr5p Q02725 P25297 P40046 P47075 P32802 P11491 Q06689 P24031 Q06205 P33302 Vacuolar transporter chaperone Inorganic phosphate...”
• Ablation of a small transmembrane protein of Trypanosoma brucei (TbVTC1) involved in the synthesis of polyphosphate alters acidocalcisome biogenesis and function, and leads to a cytokinesis defect
  Fang, The Biochemical journal 2007
  • “...of TbVTC1 (Tb, AAX70699) with S. cerevisiae Phm4/Vtc1 (Sc, P40046) and two orthologues from T. cruzi (Tc, AY304574) and L. major (Lm, CAB 86965). Lines above...”
• Isolation and characterization of Nrf1p, a novel negative regulator of the Cdc42p GTPase in Schizosaccharomyces pombe
  Murray, Genetics 2000
  • “...S. cerevisiae encodes a protein (YER072w; accession no. P40046) that is 78% identical (91% similar) in predicted amino-acid sequence to S. pombe Nrf1p (Figure...”

cg0135 putative inner membrane protein from Corynebacterium glutamicum ATCC 13032
Aligns to 21:88 / 122 (55.7%), covers 100.0% of PF02656, 63.9 bits

• Target genes, consensus binding site, and role of phosphorylation for the response regulator MtrA of Corynebacterium glutamicum
  Brocker, Journal of bacteriology 2011
  • “...2017 by University of California, Berkeley cg0133 cg0134 cg0135 cg0136 cg0282 cg0689 cg0715 cg0859 cg0862 cg0896 cg0909 cg1016 cg1037 cg1085 cg1210 cg1213...”

sll0847 unknown protein from Synechocystis sp. PCC 6803
Aligns to 88:163 / 201 (37.8%), covers 98.5% of PF02656, 62.5 bits

• Roles of Close Homologues SigB and SigD in Heat and High Light Acclimation of the Cyanobacterium Synechocystis sp. PCC 6803
  Turunen, Life (Basel, Switzerland) 2022
  • “...of an up-regulated glm gene (glucose-1-phosphate adenylyltransferase) and down-regulated ndhD2 , ssl2501 , slr1236 , sll0847, and slr0284 genes ( Figure 5 ). For these, only ssl2501 belongs to the SigB high-temperature regulon. The SigD high light regulon included 51 down-regulated and 11 up-regulated genes (...”

AFUA_8G05950 conserved hypothetical protein from Aspergillus fumigatus Af293
Aligns to 116:192 / 222 (34.7%), covers 98.5% of PF02656, 61.5 bits

• RNAseq analysis of Aspergillus fumigatus in blood reveals a just wait and see resting stage behavior
  Irmer, BMC genomics 2015
  • “...AFUA_5G02300 peroxidase 2.16 AFUA_8G01630 pyridine nucleotide-disulphide oxidoreductase 2.38 AFUA_4G00750 hypothetical protein 2.46 AFUA_5G13830 alpha-galactosidase 2.50 AFUA_8G05950 hypothetical protein 2.91 AFUA_7G06330 hypothetical protein 3.03 Genes with highest levels of differential expression are shown with a cutoff at>2 or<2. The number represents the log2-ratio or fold change for...”

VTC1_SCHPO / Q9UR17 Vacuolar transporter chaperone complex subunit 1; Negative regulator of cdc42; SPX-dependent polyphosphate polymerase VTC subunit 1; Vacuolar membrane polyphosphate polymerase accessory subunit 1; PolyP polymerase from Schizosaccharomyces pombe (strain 972 / ATCC 24843) (Fission yeast) (see 2 papers)
nrf1 GTPase regulator Nrf1 from Schizosaccharomyces pombe (see 3 papers)
SPBC21B10.04c GTPase regulator Nrf1 (predicted) from Schizosaccharomyces pombe
Aligns to 24:86 / 122 (51.6%), covers 98.5% of PF02656, 61.5 bits

• function: Accessory subunit of the vacuolar transporter chaperone (VTC) complex. The VTC complex acts as a vacuolar polyphosphate polymerase that catalyzes the synthesis of inorganic polyphosphate (polyP) via transfer of phosphate from ATP to a growing polyP chain, releasing ADP. VTC exposes its catalytic domain vtc4 to the cytosol, where the growing polyP chain winds through a tunnel-shaped pocket, integrating cytoplasmic polymer synthesis with polyP membrane translocation. The VTC complex carries 9 vacuolar transmembrane domains, which are likely to constitute the translocation channel into the organelle lumen. PolyP synthesis is tightly coupled to its transport into the vacuole lumen, in order to avoid otherwise toxic intermediates in the cytosol, and it depends on the proton gradient across the membrane, formed by V-ATPase. Vtc1 contributes only 3 transmembrane domains to the complex. The VTC complex also plays a role in vacuolar membrane fusion (By similarity). Involved in the control of cell polarity (PubMed:10628977).
  subunit: The VTC core complex is an integral membrane heterooligomer composed of at least the catalytic subunit vtc4 and the accessory subunits vtc1 and vtc2. vtc1 is a small membrane protein without hydrophilic domain. Vtc2 and vtc4 are related and have 2 hydrophilic domains that face the cytosol, an N-terminal SPX domain and the central core domain. The central core in vtc4 is the catalytic domain (By similarity). Vtc1 interacts with GTP-bound Ras-like cdc42, which is subsequently inactivated (PubMed:10628977).
  disruption phenotype: Defects in endocytosis.
• CharProtDB Source (per GeneDB): GeneDB_Spombe
• Dataset describing the genome wide effects on transcription resulting from alterations in the relative levels of the bZIP transcription factors Atf1 and Pcr1 in Schizosaccharomyces pombe
  Basu, Data in brief 2022
  • “...vesicle-mediated transport SPAC15A10.05c mug182 NADHX epimerase SPAC4G9.12 idn1 gluconokinase SPBC23G7.16 ctr6 vacuolar copper exporter Ctr6 SPBC21B10.04c nrf1 vacuolar transporter chaperone (VTC) complex, GTPase regulator subunit Nrf1 SPCC965.06 osr2 potassium channel, beta subunit, aldo-keto reductase SPNCRNA.906 snR30 non-coding RNA SPAC823.17 tom6 mitochondrial TOM complex subunit Tom6 SPAC688.16...”
  • “...SPAC1F8.03c str3 plasma membrane heme transmembrane transporter Str3 SPAC1F8.05 isp3 spore wall structural constituent Isp3 SPBC21B10.04c nrf1 vacuolar transporter chaperone (VTC) complex, GTPase regulator subunit Nrf1 SPBC215.11c SPBC215.11c aldo/keto reductase, unknown biological role SPBC11B10.10c pht1 histone H2A variant H2A.Z Pht1 SPAC4F8.10c stg1 SM22/transgelin-like actin modulating protein...”
• Proteasome regulation of petite-negativity in fission yeast.
  Amberg, bioRxiv : the preprint server for biology 2024
  • “...involved in cell-cell communication in N. crassa O13791 slt1 0.57 0.036 Schizosaccharomyces specific protein Slt1 Q9UR17 nrf1 0.57 0.028 vacuolar transporter chaperone (VTC) complex, GTPase regulator subunit Nrf1 P27584 gpa1 0.58 0.009 G-protein alpha subunit O14363 rpl102 0.58 0.003 60S ribosomal protein L10a P79081 SPAC1002.07c 0.58...”

CNAG_00582 vacuolar transporter chaperone 1 from Cryptococcus neoformans var. grubii H99
Aligns to 24:86 / 123 (51.2%), covers 100.0% of PF02656, 60.7 bits

• The F-Box Protein Fbp1 Regulates Virulence of Cryptococcus neoformans Through the Putative Zinc-Binding Protein Zbp1
  Han, Frontiers in cellular and infection microbiology 2021
  • “...2 CNAG_05216 CAMK protein kinase 1.378940229 1 CNAG_04669 Mitochondrial matrix protein import protein 1.370162857 0 CNAG_00582 Vacuolar transporter chaperone 1 1.369598183 0 CNAG_05817 GDP-mannose transporter 1 1.358720216 0 CNAG_06837 PH domain-containing protein 1.355891304 2 CNAG_05173 DNA-3-methyladenine glycosylase II 1.343807756 0 CNAG_02823 Bloom syndrome protein 1.307827849 2...”

BC1G_14169 hypothetical protein from Botrytis cinerea B05.10
Aligns to 644:708 / 773 (8.4%), covers 98.5% of PF02656, 60.2 bits

• Genome-wide transcriptional profiling of Botrytis cinerea genes targeting plant cell walls during infections of different hosts
  Blanco-Ulate, Frontiers in plant science 2014
  • “...CE12 RG acetylesterases 1 BC1G_14009 XyG backbone GH3 -Glucosidases 6 BC1G_03179, BC1G_07110, BC1G_07622, BC1G_10231, BC1G_11439, BC1G_14169 GH12 XyG-specific -glucanases 1 BC1G_00594 GH16, GH16|CBM18 Glucanases and XyG transglucosylase/hydrolases 11 BC1G_00409, BC1G_02932, BC1G_04948, BC1G_07945, BC1G_08924, BC1G_09991 Xylan backbone GH10, GH11, GH10|CBM1, GH11|CBM1 -Xylanases 5 BcXyn11A, BC1G_00576, BC1G_01778, BC1G_03590...”

VTC1_TRYB2 / Q57UM0 Vacuolar transporter chaperone complex subunit 1; SPX-dependent polyphosphate polymerase VTC subunit 1; Vacuolar membrane polyphosphate polymerase accessory subunit 1; PolyP polymerase from Trypanosoma brucei brucei (strain 927/4 GUTat10.1) (see paper)
XP_846013 vacuolar transporter chaperone, putative from Trypanosoma brucei brucei TREU927
Aligns to 62:127 / 180 (36.7%), covers 97.1% of PF02656, 60.0 bits

• function: Accessory subunit of the vacuolar transporter chaperone (VTC) complex. The VTC complex acts as a vacuolar polyphosphate polymerase that catalyzes the synthesis of inorganic polyphosphate (polyP) via transfer of phosphate from ATP to a growing polyP chain, releasing ADP. VTC exposes its catalytic domain vtc4 to the cytosol, where the growing polyP chain winds through a tunnel-shaped pocket, integrating cytoplasmic polymer synthesis with polyP membrane translocation. The VTC complex carries 9 vacuolar transmembrane domains, which are likely to constitute the translocation channel into the organelle lumen. PolyP synthesis is tightly coupled to its transport into the vacuole lumen, in order to avoid otherwise toxic intermediates in the cytosol, and it depends on the proton gradient across the membrane, formed by V-ATPase. VTC1 contributes only 3 transmembrane domains to the complex. The VTC complex also plays a role in vacuolar membrane fusion.
  subunit: The VTC core complex is an integral membrane heterooligomer composed of at least the catalytic subunit vtc4 and the accessory subunits vtc1 and vtc2. vtc1 is a small membrane protein without hydrophilic domain. Vtc2 and vtc4 are related and have 2 hydrophilic domains that face the cytosol, an N-terminal SPX domain and the central core domain. The central core in vtc4 is the catalytic domain.
  disruption phenotype: Causes an abnormal morphology of acidocalcisomes, a significant decrease in the amount of polyP and a deficient response to hyposmotic stress.
• Ablation of a small transmembrane protein of Trypanosoma brucei (TbVTC1) involved in the synthesis of polyphosphate alters acidocalcisome biogenesis and function, and leads to a cytokinesis defect.
  Fang, The Biochemical journal 2007
  • GeneRIF: PP(i)-driven H+ pumping deficiency induced by ablation of TbVTC1 induces changes in the protonmotive force of acidocalcisomes, resulting in deficient fusion or budding of the organelles, decreased H+ and Ca2+ content, and decreased synthesis of poly P.

CLUG_04164 uncharacterized protein from Clavispora lusitaniae
Aligns to 58:146 / 182 (48.9%), covers 98.5% of PF02656, 60.0 bits

• Comparative Genomics for the Elucidation of Multidrug Resistance in Candida lusitaniae
  Kannan, mBio 2019
  • “...MSH2 VG Substitution 186 EJF15_30782 P3 CLUG_02496 60S ribosomal protein EK Substitution 206 EJF15_50669 P3 CLUG_04164 CLUG_04164 Clavispora lusitaniae ATCC 42720 PS Substitution 25 EJF18_60098 P5 CBP1_CANAL Corticosteroid-binding protein AK Substitution 531 EJF18_60098 P5 CBP1_CANAL Corticosteroid-binding protein KA Substitution 536 EJF18_20361 P5 STP4_CANAL Transcriptional regulator STP4...”
  • “...repair gene), EJF15_30782 (similar to a 60S ribosomal protein), EJF15_50669 (similar to the hypothetical protein CLUG_04164 from C. lusitaniae ATCC 42720), and EJF18_60098 (similar to CBP1 , a corticosteroid-binding protein gene). Out of these, the change V186G in EJF15_30569 (similar to MSH2 ) from isolate P3...”

Q6CDJ7 YALI0B23408p from Yarrowia lipolytica (strain CLIB 122 / E 150)
Aligns to 24:86 / 122 (51.6%), covers 98.5% of PF02656, 59.1 bits

• Validated Growth Rate-Dependent Regulation of Lipid Metabolism in Yarrowia lipolytica
  Poorinmohammad, International journal of molecular sciences 2022
  • “...extracting the interaction term of the linear model. Contrastingly, the proteins Q6CAQ5 (E3 ubiquitin-protein ligase), Q6CDJ7 (YALI0B23408p), and Q6CHE0 (glycine cleavage system P protein) ( Figure 2 b) exemplify expression changes with similar patterns in both strains, and thus such profiles were not considered in the...”

M7WMK7 Vacuolar transporter chaperone 2 from Rhodotorula toruloides (strain NP11)
Aligns to 69:134 / 203 (32.5%), covers 97.1% of PF02656, 58.0 bits

• Adaptation of Proteome and Metabolism in Different Haplotypes of Rhodosporidium toruloides during Cu(I) and Cu(II) Stress
  Cavelius, Microorganisms 2023
  • “...n.d. down n.d. Copper P-type ATPase A0A2T0A6Z7 2.81 3.19 n.d. 2.17 Vacuolar transporter chaperone 2 M7WMK7 64.00 17.05 n.d. n.d. Vacuolar transporter chaperone 4 M7XMX5 n.d. 2.26 n.d. n.d. Mitochondrial inner membrane metallopeptidase Oma1 M7X2Q6 down n.d. down down A0A0K3C9S0 down 0.46 n.d. n.d. Mitochondrial outer...”

cg0136 hypothetical protein from Corynebacterium glutamicum ATCC 13032
Aligns to 6:71 / 105 (62.9%), covers 97.1% of PF02656, 57.2 bits

• Target genes, consensus binding site, and role of phosphorylation for the response regulator MtrA of Corynebacterium glutamicum
  Brocker, Journal of bacteriology 2011
  • “...by University of California, Berkeley cg0133 cg0134 cg0135 cg0136 cg0282 cg0689 cg0715 cg0859 cg0862 cg0896 cg0909 cg1016 cg1037 cg1085 cg1210 cg1213 cg1227...”

FGR18 putative uncharacterized protein from Candida albicans (see paper)
Aligns to 1:80 / 120 (66.7%), covers 92.6% of PF02656, 57.0 bits

• CharProtDB CGD description: Protein lacking an ortholog in S. cerevisiae; transposon mutation affects filamentous growth; possibly spurious ORF (Annotation Working Group prediction)

VTC2_TOXGM / A0A125YS36 Vacuolar transporter chaperone complex subunit 2; SPX-dependent polyphosphate polymerase VTC subunit 2; Vacuolar membrane polyphosphate polymerase accessory subunit 2; PolyP polymerase from Toxoplasma gondii (strain ATCC 50611 / Me49) (see paper)
Aligns to 1075:1137 / 1308 (4.8%), covers 100.0% of PF02656, 56.8 bits

• function: Accessory subunit of the vacuolar transporter chaperone (VTC) complex. The VTC complex acts as a vacuolar polyphosphate polymerase that catalyzes the synthesis of inorganic polyphosphate (polyP) via transfer of phosphate from ATP to a growing polyP chain, releasing ADP. VTC exposes its catalytic domain vtc4 to the cytosol, where the growing polyP chain winds through a tunnel-shaped pocket, integrating cytoplasmic polymer synthesis with polyP membrane translocation. The VTC complex carries 9 vacuolar transmembrane domains, which are likely to constitute the translocation channel into the organelle lumen. PolyP synthesis is tightly coupled to its transport into the vacuole lumen, in order to avoid otherwise toxic intermediates in the cytosol, and it depends on the proton gradient across the membrane, formed by V-ATPase. The VTC complex also plays a role in vacuolar membrane fusion.
  subunit: The VTC core complex is an integral membrane heterooligomer composed of at least the catalytic subunit vtc4 and the accessory subunits vtc1 and vtc2. vtc1 is a small membrane protein without hydrophilic domain. Vtc2 and vtc4 are related and have 2 hydrophilic domains that face the cytosol, an N-terminal SPX domain and the central core domain. The central core in vtc4 is the catalytic domain.
  disruption phenotype: The VTC2 locus is refractory to knockout, and may be essential. Partial disruption of the gene results in reduced polyP accumulation.

AO090012000979 No description from Aspergillus oryzae RIB40
Aligns to 646:711 / 756 (8.7%), covers 98.5% of PF02656, 55.2 bits

• Transcriptome analysis of genes and metabolic pathways associated with nicotine degradation in Aspergillus oryzae 112822
  He, BMC genomics 2019
  • “...(AO090011000649, AO090005000455), ribosome assembly protein (AO090701000541), ATP-dependent RNA helicase (AO090023000510), DNA replication licensing factors MCM4 (AO090012000979, AO090011000793), choline dehydrogenases (AO090026000028, AO090003001420, AO090023000847), RNA-dependent RNA polymerase (AO090020000563), and DNA-directed RNA polymerase (AO090012000486) were approved to have much lower transcriptional level in response to nicotine exposure through qRT-PCR....”

AFUA_2G09040, Afu2g09040 vacuolar transporter chaperone (Vtc4), putative from Aspergillus fumigatus Af293
Aligns to 677:740 / 801 (8.0%), covers 98.5% of PF02656, 54.5 bits

• Lipid Biosynthesis as an Antifungal Target
  Pan, Journal of fungi (Basel, Switzerland) 2018
  • “...A. nidulans A. fumigatus [ 51 ] AFUA_3G12320 Lipase/Serine esterase S. cerevisiae [ 57 ] AFUA_2G09040 Vacuolar transporter chaperone (Vtc4) Ustilago maydis Candida [ 53 , 54 ] * Fungi tested means that fungi listed here are already well described in literature and the researchers have...”
• Systematic Identification of Anti-Fungal Drug Targets by a Metabolic Network Approach
  Kaltdorf, Frontiers in molecular biosciences 2016
  • “...protein AFUA_2G17650 0.523 2.921 2.795 DUF907 domain protein AFUA_2G17300 n.s. 4.050 1.057 GSH Glutathione S-transferase AFUA_2G09040 n.s. 1.360 1.053 Vacuolar transporter chaperone (Vtc4) AFUA_2G04010 n.s. 1.125 1.182 SUC Alpha,alpha-trehalose-phosphate synthase subunit ESSENTIAL GENES AFUA_3G14440 0.916 1.174 n.s. Cytochrome c oxidase family protein AFUA_4G10480 n.s. 2.375 1.812...”
  • “...protein AFUA_2G17300 261 220 481 14 Glutathione S-transferase AFUA_1G17010 261 220 481 14 Glutathione S-transferase AFUA_2G09040 307 195 502 15 Vacuolar transporter chaperone (Vtc4) AFUA_2G04010 220 302 522 16 Alpha, alpha-trehalose-phosphate synthase subunit AFUA_6G12950 220 302 522 16 Trehalose-phosphate synthase/phosphatase complex subunit Tps1, putative B I...”
• Functional characterization of the Aspergillus fumigatusPHO80 homologue
  de, Fungal genetics and biology : FG & B 2008 (PubMed)
  • “...(phoDPHO84), Afu7g06350 (phoEPHO89), Afu4g06020 (phoCPHO81), and Afu2g09040 (vacuolar transporter Vtc4) as more expressed both in the phoBPHO80 mutant...”
  • “...Afu4g03610 Phosphate:H + symporter ( phoD PHO84 ) Afu2g09040 Vacuolar transporter chaperone Vtc4 Afu4g06020 Cyclin dependent kinase inhibitor, Nuc2 ( phoC PHO81...”

M7XMX5 Vacuolar transporter chaperone 4 from Rhodotorula toruloides (strain NP11)
Aligns to 708:773 / 811 (8.1%), covers 100.0% of PF02656, 53.8 bits

• Adaptation of Proteome and Metabolism in Different Haplotypes of Rhodosporidium toruloides during Cu(I) and Cu(II) Stress
  Cavelius, Microorganisms 2023
  • “...n.d. 2.17 Vacuolar transporter chaperone 2 M7WMK7 64.00 17.05 n.d. n.d. Vacuolar transporter chaperone 4 M7XMX5 n.d. 2.26 n.d. n.d. Mitochondrial inner membrane metallopeptidase Oma1 M7X2Q6 down n.d. down down A0A0K3C9S0 down 0.46 n.d. n.d. Mitochondrial outer membrane protein IML2 M7X0Q4 n.d. up down down A0A2T0A031...”

O13718 Vacuolar transporter chaperone complex subunit 2 from Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Aligns to 617:680 / 734 (8.7%), covers 98.5% of PF02656, 53.7 bits

• Proteasome regulation of petite-negativity in fission yeast.
  Amberg, bioRxiv : the preprint server for biology 2024
  • “...1 Q9UUB1 rib4 0.32 0.025 6,7-dimethyl-8-ribityllumazine synthase O94435 mug35 0.34 0.034 Schizosaccharomyces specific protein Mug35 O13718 vtc2 0.35 0.006 vacuolar transporter chaperone (VTC) complex polyphosphate synthetase subunit Vtc2/3 O14463 trx1 0.35 0.040 cytosolic thioredoxin Trx1 Q9UTK3 SPAC1486.06 0.35 0.021 nicotinate phosphoribosyltransferase Npt1 Q9P544 SPAC1635.01 0.35 0.008...”

7ytjE / Q02725 Cryo-em structure of vtc complex (see paper)
Aligns to 533:600 / 650 (10.5%), covers 97.1% of PF02656, 52.0 bits

• Ligand: inositol hexakisphosphate (7ytjE)

XP_001690865 uncharacterized protein from Chlamydomonas reinhardtii
Aligns to 45:119 / 158 (47.5%), covers 98.5% of PF02656, 51.7 bits

• Critical function of a Chlamydomonas reinhardtii putative polyphosphate polymerase subunit during nutrient deprivation.
  Aksoy, The Plant cell 2014
  • GeneRIF: Data show that introduction of the VACUOLAR TRANSPORTER CHAPERONE1 (VTC1) gene, which encodes a component of a polyphosphate polymerase complex, specifically complements the ars76 mutant phenotypes.

An12g04710 uncharacterized protein from Aspergillus niger
Aligns to 688:751 / 808 (7.9%), covers 98.5% of PF02656, 51.5 bits

• The transcriptomic signature of RacA activation and inactivation provides new insights into the morphogenetic network of Aspergillus niger
  Kwon, PloS one 2013
  • “...uptake An17g01925 Sat4 transcription factor for RNA polymerase II An16g07220 Tfg2 negative regulator of Cdc42 An12g04710 Vtc1 putative C 2 H 2 zinc-finger transcription factor An04g01500 SUN family protein involved in replication An08g07090 Sim1 similar to A. nidulans transcription factor RosA An16g07890 Ume6 Others hypothetical aspergillosis...”
• Reconstruction of signaling networks regulating fungal morphogenesis by transcriptomics
  Meyer, Eukaryotic cell 2009
  • “...Other signaling processes An15g01560 An04g01500 An08g07090 An16g07890 An12g04710 (3.21) 2.98 0.06 0.04 0.29 0.029 0.044 0.054 0.037 0.031 GTPase-activating...”
  • “...reference 83). Interestingly, we found a downregulation of An12g04710, which displays similarity to the yeast Vtc1p and Nrf1p proteins, which are negative...”

VTC2_YEAST / P43585 Vacuolar transporter chaperone complex subunit 2; Phosphate metabolism protein 1; SPX-dependent polyphosphate polymerase VTC subunit 2; Vacuolar membrane polyphosphate polymerase accessory subunit 2; PolyP polymerase from Saccharomyces cerevisiae (strain ATCC 204508 / S288c) (Baker's yeast) (see 9 papers)
YFL004W Vacuolar membrane protein involved in vacuolar polyphosphate accumulation; functions as a regulator of vacuolar H+-ATPase activity and vacuolar transporter chaperones; involved in protein localization and non-autophagic vacuolar fusion from Saccharomyces cerevisiae
Aligns to 686:752 / 828 (8.1%), covers 97.1% of PF02656, 51.5 bits

• function: Accessory subunit of the vacuolar transporter chaperone (VTC) complex. The VTC complex acts as a vacuolar polyphosphate polymerase that catalyzes the synthesis of inorganic polyphosphate (polyP) via transfer of phosphate from ATP to a growing polyP chain, releasing ADP. VTC exposes its catalytic domain VTC4 to the cytosol, where the growing polyP chain winds through a tunnel-shaped pocket, integrating cytoplasmic polymer synthesis with polyP membrane translocation (PubMed:19390046). The VTC complex carries 9 vacuolar transmembrane domains, which are likely to constitute the translocation channel into the organelle lumen (PubMed:19390046, PubMed:25315834). PolyP synthesis is tightly coupled to its transport into the vacuole lumen, in order to avoid otherwise toxic intermediates in the cytosol, and it depends on the proton gradient across the membrane, formed by V-ATPase (PubMed:25315834). Binds inositol hexakisphosphate (Ins6P) and similar inositol polyphosphates, such as 5-diphospho-inositol pentakisphosphate (5-InsP7); these are important intracellular signaling molecules (PubMed:27080106). Inositol polyphosphate binding promotes vacuolar polyphosphate synthesis (PubMed:27080106). The VTC complex also plays a role in vacuolar membrane fusion (PubMed:11102525, PubMed:11823419). Required for SEC18/NSF activity in SNARE priming, membrane binding of LMA1 and V(0) trans-complex formation (PubMed:11823419).
  subunit: The VTC core complex is an integral membrane heterooligomer composed of the catalytic subunit VTC4 and the accessory subunits VTC1, VTC2 and VTC3. The complex exists in 2 different sub-complexes: VTC1- VTC2-VCT4 and VCT1-VTC3-VTC4. The VCT1-VTC3-VTC4 subcomplex is mostly found on the vacuolar membrane. The VTC1-VTC2-VCT4 subcomplex is observed in the cell periphery, probably ER and nuclear envelope, but localizes to the vacuole under phosphate starvation. Each subunit contains 3 transmembrane helices. VTC1 is a small membrane protein without hydrophilic domain. VTC2, VTC3 and VTC4 are related and have 2 hydrophilic domains that face the cytosol, an N-terminal SPX domain and the central core domain. The central core in VTC4 is the catalytic domain, with the essential catalytic lysine replaced by isoleucine and leucine in VTC2 and VTC3, respectively (PubMed:19390046). The core complex associates with the accessory subunit VTC5 (PubMed:27587415). The complex interacts with the v-SNARE NYV1 and with the V(0) subunit of V-ATPase VPH1 (PubMed:11823419).
• Identification of the Genetic Requirements for Zinc Tolerance and Toxicity in Saccharomyces cerevisiae
  Zhao, G3 (Bethesda, Md.) 2020
  • “...MRP10 YHR076W PTC7 YMR264W CUE1 Cellular transport, transport facilities and transport routes (32) YBR127C VMA2 YFL004W VTC2 YJL012C VTC4 YLR261C VPS63 YCL038C ATG22 YGL212W VAM7 YJL024C APS3 YLR262C YPT6 YCR037C PHO87 YGL095C VPS45 YJL154C VPS35 YLR268W SEC22 YDL100C GET3 YGR105W VMA21 YJL198W PHO90 YLR396C VPS33 YDR089W...”
• The Reduced Level of Inorganic Polyphosphate Mobilizes Antioxidant and Manganese-Resistance Systems in Saccharomyces cerevisiae
  Trilisenko, Cells 2019
  • “...YER072W VTC1 Regulatory subunit involved in membrane trafficking and vacuolar polyphosphate accumulation 5.48 5.05 2.94 YFL004W VTC2 1.59 1.52 0.98 YPL019C VTC3 1.18 2.51 2.33 YDR089W VTC5 0.78 0.96 0.07 YJL012C VTC4 Vacuolar membrane polyphosphate polymerase 0.97 1.48 1.90 Phosphate Transport YFR034C PHO4 Activates transcription in...”
• Widespread Cumulative Influence of Small Effect Size Mutations on Yeast Quantitative Traits
  Hua, Cell systems 2018
  • “...YPR071W, YKL065C, YKL046C, YPL274W, YEL048C, YOR317W, YDR100W, YNL146W, YMR253C, YJR031C, YER011W, YJL078C, YIL016W, YML037C, YGR247W, YFL004W, YBR023C, YIL044C, YMR052W, YDL204W, YBR067C, YDR153C, YIL043C, YNL095C, YDR476C, YOR307C, YOR321W, YCR011C, YMR237W, YMR071C, YER004W, YPR028W, YGL255W, YPL170W, YKL063C, YJL044C, YLR023C, YMR215W, YMR251W-A, YGR261C, YPR091C, YDR056C, YLL028W, YLR330W, YBL010C, YNR019W,...”
• Mutation rates across budding yeast chromosome VI are correlated with replication timing
  Lang, Genome biology and evolution 2011
  • “...WWM1 115102 GL47 YFR054C Hypothetical 258842 GL23 YFL007W BLM3 123474 GL48 YFR055W Hypothetical 264191 GL24 YFL004W VTC2 131805 GL49 YFR057W Hypothetical 269048 a Position is the location at which the gene is first encountered moving across Chromosome VI starting at the left telomere. b Strains omitted...”
• Non-coding RNA prediction and verification in Saccharomyces cerevisiae
  Kavanaugh, PLoS genetics 2009
  • “...file. Figure S7 Regions producing Z-scores 3.5 for intergenic sequence between SEC4 (YFL005W) and VTC1 (YFL004W). Positions along the 828 bp sequence are shown on the scale at the top of the figure. All windows producing a Z-score 3.5 are plotted below the scale as a...”
  • “...The first column provides the sequence name. This region lies between SEC4 (YFL005W) and VTC2 (YFL004W) and is 828 bp long. The sequence name ends with the boundary values for the window being evaluated. The second column (Pos) specifies the beginning position of the window. The...”
• Identification of direct target genes using joint sequence and expression likelihood with application to DAF-16
  Yu, PloS one 2008
  • “...YDR281C PPN1 YDR452W PHO8 * YDR481C PHM8 YER037W HIS1 YER055C HOR2 YER062C VTC1 YER072W VTC2 YFL004W SPL2 * YHR136C PHO12 * YHR215W VTC4 YJL012C PHO86 * YJL117W PHO84 * YML123C PHM7 YOL084W CTF19 YPL018W VTC3 YPL019C KRE29 YER038C SWC3 YAL011W YAR069C YAR069C YAR070C YAR070C KRE2 YDR483W...”
• Selective inhibition of yeast regulons by daunorubicin: a transcriptome-wide analysis
  Rojas, BMC genomics 2008
  • “...COS7 LSC2 SUN4 YLR414C YDR214W KRI1 SES1 YFL002W-A COX20 MCR1 TAT2 YLR454W YDR476C KRR1 SIT1 YFL004W CPA1 MDH1 TDH1 YML128C YER134C LOS1 SKP1 YGR038C-B CTS1 MDH2 TDH2 YMR090W YER182W LYS7 SMD3 YGR081C CYC3 MEP1 TDH3 YMR173W-A YGL047W MGM101 SNF8 YGR161W-B CYT1 MEP3 THO1 YMR181C YGR201C NAT3...”
• Expression evolution in yeast genes of single-input modules is mainly due to changes in trans-acting factors
  Wang, Genome research 2007
  • “...the promoter regions of YCR075C, YDL137W, YEL052W, YEL053C, YFL004W, YGR157W, YLR438W, YML075C, YOR306C, and YPL157W between BY and RM. After the replacement of...”
  • “...Ratio Swap/BY (95% CI) Effect YCR075C YDL137W YEL052W YEL053C YFL004W YGR157W YLR438W YML075C YOR306C YPL157W 0.74 1.27 0.83 0.84 0.68 0.66 1.31 1.97 0.58 0.93...”
• More
• Altered proteome in translation initiation fidelity defective eIF5^G31R mutant causes oxidative stress and DNA damage
  Ram, Scientific reports 2022
  • “...P40159 YNL208W 1.8591 0.0191 19 Q04432 HSP31 1.8778 0.0026 20 P22943 HSP12 1.8912 0.0252 21 P43585 VTC2 1.9087 0.0453 22 P12962 CAF20 1.9685 0.0059 23 Q12123 DCS2 2.2230 0.0340 24 P38736 GOS1 2.3314 0.0344 25 P06115 CTT1 2.4573 0.0475 26 P54785 MOT3 3.3204 0.0459 Upstream UUG...”
• The macro domain as fusion tag for carrier-driven crystallization
  Wild, Protein science : a publication of the Protein Society 2017
  • “...VTC subunits ScVtc2 (S. cerevisiae Vtc2; UniProt Acc. P43585), ScVtc3 (S. cerevisiae Vtc3; Q02725) and ScVtc4 (S. cerevisiae Vtc4; P47075) and including a...”

VTC3_YEAST / Q02725 Vacuolar transporter chaperone 3 complex subunit 3; Phosphate metabolism protein 2; SPX-dependent polyphosphate polymerase VTC subunit 3; Vacuolar membrane polyphosphate polymerase accessory subunit 3; PolyP polymerase from Saccharomyces cerevisiae (strain ATCC 204508 / S288c) (Baker's yeast) (see 9 papers)
YPL019C Vacuolar membrane protein involved in vacuolar polyphosphate accumulation; functions as a regulator of vacuolar H+-ATPase activity and vacuolar transporter chaperones; involved in non-autophagic vacuolar fusion from Saccharomyces cerevisiae
Aligns to 698:765 / 835 (8.1%), covers 97.1% of PF02656, 51.4 bits

• function: Accessory subunit of the vacuolar transporter chaperone (VTC) complex. The VTC complex acts as a vacuolar polyphosphate polymerase that catalyzes the synthesis of inorganic polyphosphate (polyP) via transfer of phosphate from ATP to a growing polyP chain, releasing ADP. VTC exposes its catalytic domain VTC4 to the cytosol, where the growing polyP chain winds through a tunnel-shaped pocket, integrating cytoplasmic polymer synthesis with polyP membrane translocation (PubMed:19390046). The VTC complex carries 9 vacuolar transmembrane domains, which are likely to constitute the translocation channel into the organelle lumen (PubMed:19390046, PubMed:25315834). PolyP synthesis is tightly coupled to its transport into the vacuole lumen, in order to avoid otherwise toxic intermediates in the cytosol, and it depends on the proton gradient across the membrane, formed by V-ATPase (PubMed:25315834). The VTC complex also plays a role in vacuolar membrane fusion (PubMed:11102525, PubMed:11823419). Required for SEC18/NSF activity in SNARE priming, membrane binding of LMA1 and V(0) trans-complex formation (PubMed:11823419). Binds inositol hexakisphosphate (Ins6P) and similar inositol polyphosphates, such as 5-diphospho-inositol pentakisphosphate (5-InsP7); these are important intracellular signaling molecules. Inositol polyphosphate binding promotes vacuolar polyphosphate synthesis (PubMed:27080106).
  subunit: The VTC core complex is an integral membrane heterooligomer composed of the catalytic subunit VTC4 and the accessory subunits VTC1, VTC2 and VTC3. The complex exists in 2 different sub-complexes: VTC1- VTC2-VCT4 and VCT1-VTC3-VTC4. The VCT1-VTC3-VTC4 subcomplex is mostly found on the vacuolar membrane. The VTC1-VTC2-VCT4 subcomplex is observed in the cell periphery, probably ER and nuclear envelope, but localizes to the vacuole under phosphate starvation. Each subunit contains 3 transmembrane helices. VTC1 is a small membrane protein without hydrophilic domain. VTC2, VTC3 and VTC4 are related and have 2 hydrophilic domains that face the cytosol, an N-terminal SPX domain and the central core domain. The central core in VTC4 is the catalytic domain, with the essential catalytic lysine replaced by isoleucine and leucine in VTC2 and VTC3, respectively (PubMed:19390046). The core complex associates with the accessory subunit VTC5 (PubMed:27587415). The complex interacts with the v-SNARE NYV1 and with the V(0) subunit of V-ATPase VPH1 (PubMed:11823419).
• Isolation and characterization of Saccharomyces cerevisiae mutants with increased cell wall chitin using fluorescence-activated cell sorting
  Chuene, FEMS yeast research 2024
  • “...the EUROSCARF library identified after sorting for high chitin levels. ORF Gene Molecular function Description YPL019C * 4 (4G) VTC3/PHM2 Unknown Subunit of the vacuolar transporter chaperone (VTC) complex involved in membrane trafficking (Cohen et al. 1999 ). YLR131C * 1 (1G) ACE2 Sequence-specific DNA binding...”
• The Reduced Level of Inorganic Polyphosphate Mobilizes Antioxidant and Manganese-Resistance Systems in Saccharomyces cerevisiae
  Trilisenko, Cells 2019
  • “...in membrane trafficking and vacuolar polyphosphate accumulation 5.48 5.05 2.94 YFL004W VTC2 1.59 1.52 0.98 YPL019C VTC3 1.18 2.51 2.33 YDR089W VTC5 0.78 0.96 0.07 YJL012C VTC4 Vacuolar membrane polyphosphate polymerase 0.97 1.48 1.90 Phosphate Transport YFR034C PHO4 Activates transcription in response to phosphate limitation; function...”
• Effects of the yeast RNA-binding protein Whi3 on the half-life and abundance of CLN3 mRNA and other targets
  Cai, PloS one 2013
  • “...PDR15 YDR406W 1.4 0.0 0.0 0.7 0.0 ICT1 YLR099C 1.1 0.0 0.0 0.2 0.0 VTC3 YPL019C 1.2 0.1 0.2 0.2 0.5 CMK2 YOL016C 1.1 0.1 0.0 0.2 0.1 YIL100W YIL100W 1.0 0.7 0.8 0.7 Down-regulated SAM3 YPL274W 1.4 0.5 0.1 0.8 0.4 GDH1 YOR375C 1.4 0.2...”
• Rif2 promotes a telomere fold-back structure through Rpd3L recruitment in budding yeast
  Poschke, PLoS genetics 2012
  • “...+++ C Unknown YJR119C +++ MRPL9 YGR220C + BUD31 YCR063W +++ NPC2 YDL046W +++ VTC3 YPL019C + CTK1 YKL139W +++ C RTG3 YBL103C +++ MSR1 YHR091C + SIN3 YOL004W +++ B,C TPM2 YIL138C +++ EDE1 YBL047C + E EAF3 YPR023C +++ SUR4 YLR372W +++ C KRE28...”
• The role of the Parkinson's disease gene PARK9 in essential cellular pathways and the manganese homeostasis network in yeast
  Chesi, PloS one 2012
  • “...YDR089W YDL095W PMT1 YKR001C VPS1 YDR295C HDA2 YLL030C RRT7 YJL029C VPS53 YPR179C HDA3 YIL047C SYG1 YPL019C VTC3 YEL057C YEL057C YLR087C CSF1 YNL148C ALF1 YBR014C GRX7 YDR174W HMO1 YDR297W SUR2 YOR123C LEO1 YLR372W SUR4 YHL023C NPR3 YDL122W UBP1 YBR103W SIF2 YML097C VPS9 YML020W YML020W YLR138W NHA1 YIL153W...”
• Identification of direct target genes using joint sequence and expression likelihood with application to DAF-16
  Yu, PloS one 2008
  • “...* YHR215W VTC4 YJL012C PHO86 * YJL117W PHO84 * YML123C PHM7 YOL084W CTF19 YPL018W VTC3 YPL019C KRE29 YER038C SWC3 YAL011W YAR069C YAR069C YAR070C YAR070C KRE2 YDR483W MNN1 YER001W ARO9 YHR137W REC107 YJR021C YJR039W YJR039W NUP85 YJR042W PTK2 YJR059W CDA1 YLR307W YLR402W YLR402W YML089C YML089C YMR291W YMR291W...”
• The 2 microm plasmid causes cell death in Saccharomyces cerevisiae with a mutation in Ulp1 protease
  Dobson, Molecular and cellular biology 2005
  • “...BamHI restriction fragment containing the YPL020C/ULP1 gene and YPL019C (an uncharacterized open reading frame [ORF] flanking ULP1) was amplified by PCR from...”
  • “...clones, containing the YPL026C/STS1, YPL022W/RAD1, YPL018W/CTF19, YPL019C and YPL020C/ULP1 genes, respectively, were tested for their ability to complement...”
• Mutations in the histone fold domain of the TAF12 gene show synthetic lethality with the TAF1 gene lacking the TAF N-terminal domain (TAND) by different mechanisms from those in the SPT15 gene encoding the TATA box-binding protein (TBP)
  Kobayashi, Nucleic acids research 2003
  • “...for CAM1, TK2117/TK2118 for PMT4, TK2119/TK2431 for YPL019C, TK2121/TK2432 for PHO5, TK2125/TK2126 for YDL124W, TK2294/ TK2295 for TRX1, TK2296/TK2297 for WTM2...”
  • “...the expression levels of SAGA-dependent genes, that is, PHO84, YPL019C, PHO5, YHB1 and YDL124W (35), in these three taf12 mutants (Fig. 3A, right panel). The...”
• More
• The cytoplasmic synthesis and coupled membrane translocation of eukaryotic polyphosphate by signal-activated VTC complex
  Guan, Nature communications 2023
  • “.... Protein expression and purification The codon-optimized DNAs of yeast Vtc1 (Uniprot: P40046), Vtc3 (Uniprot: Q02725) and Vtc4 (Uniprot: P47075) were subcloned separately into the pMlink vector 55 . Vtc1 was tagged with a C-terminal HA tag, Vtc3 was tagged with an N-terminal 3Flag, and Vtc4...”
• Altered proteome in translation initiation fidelity defective eIF5^G31R mutant causes oxidative stress and DNA damage
  Ram, Scientific reports 2022
  • “...Q01454 CTF4 1.7217 0.0309 14 P46992 TOH1 1.7233 0.0489 15 P32528 DUR1,2 1.7275 0.0011 16 Q02725 VTC3 1.7513 0.0068 17 P47075 VTC4 1.8045 0.0040 18 P40159 YNL208W 1.8591 0.0191 19 Q04432 HSP31 1.8778 0.0026 20 P22943 HSP12 1.8912 0.0252 21 P43585 VTC2 1.9087 0.0453 22 P12962...”
• Knockout of the Hmt1p Arginine Methyltransferase in Saccharomyces cerevisiae Leads to the Dysregulation of Phosphate-associated Genes and Processes
  Chia, Molecular & cellular proteomics : MCP 2018
  • “...Vtc4p Emp70p Pho8p YLR413W Pho3p Fpr4p Pdr5p Q02725 P25297 P40046 P47075 P32802 P11491 Q06689 P24031 Q06205 P33302 Vacuolar transporter chaperone Inorganic...”
• The macro domain as fusion tag for carrier-driven crystallization
  Wild, Protein science : a publication of the Protein Society 2017
  • “...UniProt Acc. P43585), ScVtc3 (S. cerevisiae Vtc3; Q02725) and ScVtc4 (S. cerevisiae Vtc4; P47075) and including a secondary structure assignment calculated...”

MT2334 hypothetical protein from Mycobacterium tuberculosis CDC1551
Rv2273 PROBABLE CONSERVED TRANSMEMBRANE PROTEIN from Mycobacterium tuberculosis H37Rv
Aligns to 10:73 / 109 (58.7%), covers 100.0% of PF02656, 50.9 bits

• Transcriptional Profiling of Mycobacterium tuberculosis Exposed to In Vitro Lysosomal Stress
  Lin, Infection and immunity 2016
  • “...MT1973 MT1997 MT2016 MT2031 MT2040 MT2097 MT2100 MT2101 MT2334 MT2339 MT2469 MT2471 MT2598 MT2901 Rv1607 Rv1877 Rv1922 Rv1946c Rv1964 Rv1979c Rv1986 Rv2037c...”
• Large genomic deletions delineate Mycobacterium tuberculosis L4 sublineages in South American countries
  Baena, PloS one 2023
  • “...deletion that spans 6,479 nucleotides and affects the genes ippN , rv2271 , rv2272 , rv2273 , mazF8 , mazE8 , rv2275 , cyp121 , rv2277c , and rv2280 ( Fig 7 , panel A). Additionally, several strains of the sister clades 4.1.2.1Col1, 4.1.2.1Peru1, and 4.1.2.1cpb...”
  • “...present in 249 genomes. This deletion affects the genes ippN , rv2271 , rv2272 , rv2273 , mazF8 , mazE8 , rv2275 , cyp121 , rv2277c , and rv2280 . Panel B . Genomic deletion of 4,752 bp. that is common in the Latin American lineages...”
• The EXIT Strategy: an Approach for Identifying Bacterial Proteins Exported during Host Infection
  Perkowski, mBio 2017
  • “...in vitro ( 81 ) 0.006 Rv2144c Unknown TM In mice ( 85 ) 0.001 Rv2273 Unknown TM In macrophages ( 89 ) 0.000 Rv2284 lipM Probable esterase TM In mice ( 90 ) 0.024 Rv2330c lppP Probable lipoprotein SP, Lipo, TM In macrophages ( 91...”
• Transcriptional Profiling of Mycobacterium tuberculosis Exposed to In Vitro Lysosomal Stress
  Lin, Infection and immunity 2016
  • “...Rv1946c Rv1964 Rv1979c Rv1986 Rv2037c Rv2040c Rv2041c Rv2273 Rv2281 Rv2398c Rv2400c Rv2522c Rv2835c MT3080 MT3951 Rv3000 Rv3843c MT0691 MT0699 MT1338 MT1463...”
• Genetic heterogeneity revealed by sequence analysis of Mycobacterium tuberculosis isolates from extra-pulmonary tuberculosis patients
  Das, BMC genomics 2013
  • “...19 ]. In case of F99 several trans-membrane protein coding genes, such as Rv2272 and Rv2273 were missing. Although we have considered repeat regions by realigning short reads with multiple matches, a number of prophage proteins (phiRV2) were not mapped. Prophage proteins are quite often present...”
• Genomic signatures of the haarlem lineage of Mycobacterium tuberculosis: implications of strain genetic variation in drug and vaccine development
  Cubillos-Ruiz, Journal of clinical microbiology 2010
  • “...by deletion of the transmembrane proteins Rv2272 and Rv2273 as part of HSD2. Consequently, vaccine candidates should be effective against challenge not only...”
• Analysis of the genetic variation in Mycobacterium tuberculosis strains by multiple genome alignments
  Cubillos-Ruiz, BMC research notes 2008
  • “...(Helicase) Rv2102 (Conserved hypothetical protein) 2546849 6480 Rv2271 (Hypothetical protein) Rv2272 (Probable conserved transmembrane protein) Rv2273 (Probable conserved transmembrane protein) Rv2274c (Hypothetical protein) Rv2275 (Hypothetical protein) cyp121 (Cytochrome P450) Rv2277c (Probable glycerolphosphodiesterase) 2792261 170 PE-PGRS42 3117314 439 Repeat region (DR) Intergenic between Rv2813 and Rv2814 3192481...”
• Cloning and expression of multiple integral membrane proteins from Mycobacterium tuberculosis in Escherichia coli
  Korepanova, Protein science : a publication of the Protein Society 2005
  • “...Rv1924c Rv1974 Rv2076c Rv2144c Rv2146c Rv2169c Rv2198c Rv2199c Rv2272 Rv2273 Rv2287 10.4 26.9 50.8 11.8 13.9 38.0 45.3 35.3 25.6 12.6 15.3 15.1 15.4 8.1 10.1...”
• Mycobacterium tuberculosis genes induced during infection of human macrophages
  Dubnau, Infection and immunity 2002
  • “...infC nirA dut Unknown Rv0036c, Rv0406c, Rv0811c, Rv1778c, Rv2273, Rv2468c, Rv2632c, Rv2717c, Rv3427c, Rv3493c, Rv3717 a The Rv number is the number assigned to...”

J9VQL2 Vacuolar transporter chaperone 4 from Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
CNAG_01263, XP_012049426 vacuolar transporter chaperone 4 from Cryptococcus neoformans var. grubii H99
Aligns to 762:827 / 864 (7.6%), covers 98.5% of PF02656, 49.5 bits

• Identification, Culture Characteristics and Whole-Genome Analysis of Pestalotiopsis neglecta Causing Black Spot Blight of Pinus sylvestris var. mongolica
  Yang, Journal of fungi (Basel, Switzerland) 2023
  • “...quality control protease 31.9 gene03868 Scaffold2 PHI:2393 I1R980 Fusarium graminearum - 25.8 gene03896 Scaffold2 PHI:3529 J9VQL2 Cryptococcus neoformans Phosphate Acquisition and Storage 46.9 gene04733 Scaffold3 PHI:2393 I1R980 Fusarium graminearum - 26.8 gene05524 Scaffold3 PHI:7121 B0YCA2 Aspergillus fumigatus Trehalosephosphate synthase subunit 51.9 gene05651 Scaffold3 PHI:2393 I1R980 Fusarium...”
• Dysregulating PHO Signaling via the CDK Machinery Differentially Impacts Energy Metabolism, Calcineurin Signaling, and Virulence in Cryptococcus neoformans
  Bowring, mBio 2023
  • “...(CNAG_00483) ATGGTATTGCCGACCGTATG CTCTTCGCGATCCACATCTG PHO89 sodium-dependent phosphate transporter (CNAG_05075) GTGCTCGGTAACAGACTGAC ACGCTCGCCAGTTAATCG VTC4 vacuolar chaperone complex 4 (CNAG_01263) GATGCCGTCGGTATGGTTTC TAACAACGCCGCGCAAAG BTA1 betaine lipid synthase (CNAG_02353) CCCATTCCAACGCTTTCTACTCTCA AGCGACTCATCAGGAAGACCCC PHO84 phosphate:H symporter (CNAG_02777) CCTACTCGTTACCGATCAACTG AGTCTCGGGAAGAAGCAATG APH1 phosphate-repressible vacuolar acid phosphatase (CNAG_02944) CCTTCAACTTGAGTGCGCTT ACATCCCGTCCTTGTTCCAT PHO81 cyclin-dependent protein kinase inhibitor (CNAG_02541) AAGAAGGTAGGAAGGGAGAGCGG...”
• IP₇-SPX Domain Interaction Controls Fungal Virulence by Stabilizing Phosphate Signaling Machinery
  Desmarini, mBio 2020
  • “...XP_012049680 ), CnSyg1 ( XP_012051471 ), CnPho91 ( XP_012049822 ) phosphate transporter, and CnVtc4 ( XP_012049426 ) vacuolar transporter chaperone 4; Saccharomyces cerevisiae ScPho81 (SGDID:S000003465), ScVtc4 (SGDID:S000003549), ScVtc2 (SGDID:S000001890), and ScVtc3 (SGDID:S000005940); Histoplasma capsulatum HcPho81 ( EEH08674 ); Pneumocystis jirovecii PjPho81 ( XP_018228495 ); Candida albicans...”
• Pho4 Is Essential for Dissemination of Cryptococcus neoformans to the Host Brain by Promoting Phosphate Uptake and Growth at Alkaline pH
  Lev, mSphere 2017
  • “...) CNAG_06967 APH2 Phytase CNAG_02681 APH3 Phytase CNAG_06115 APH4 Acid phosphatase VTC4 Vacuolar transporter chaperone CNAG_01263 VTC4 Vacuolar transporter chaperone 4 ( 8 ) NA CNAG_02353 BTA1 Betaine lipid (DGTS) synthase PHO81 Cyclin-dependent kinase inhibitor CNAG_02541 PHO81 Cyclin-dependent protein kinase inhibitor ( 7 ) GDE1 Glycerophosphocholine...”
• Defects in phosphate acquisition and storage influence virulence of Cryptococcus neoformans
  Kretschmer, Infection and immunity 2014
  • “...membrane Polyphosphate storage and processing Vtc4 Ppx1 Ppn1 CNAG_01263 CNAG_04354 CNAG_07629 VTC4 XPP1 EPP1 e155 2e24 1e76 64 26 43 80 44 61 Vacuolar...”
  • “...to the yeast vacuolar transport chaperone Vtc4 (CNAG_01263) for polyphosphate synthesis, as well as candidate orthologs for endopolyphosphatases (EPP1) and...”

UTI89_C4231 hypothetical protein from Escherichia coli UTI89
Aligns to 12:74 / 120 (52.5%), covers 83.8% of PF02656, 46.3 bits

• Genetic requirements for uropathogenic <i>E. coli</i> proliferation in the bladder cell infection cycle
  Mediati, mSystems 2024 (no snippet)

YidG / b3675 inner membrane protein YidG from Escherichia coli K-12 substr. MG1655 (see 2 papers)
b3675 predicted inner membrane protein from Escherichia coli str. K-12 substr. MG1655
Aligns to 12:74 / 120 (52.5%), covers 83.8% of PF02656, 46.0 bits

• Physical interventions to interrupt or reduce the spread of respiratory viruses
  Jefferson, The Cochrane database of systematic reviews 2020 (secret)
• Infektionen
  Heininger, Pädiatrische Pneumologie 2013
  • “...interventions to interrupt or reduce the spread of respiratory viruses: systematic review. BMJ 2009; 339: b3675 Lessler J Reich NG Brookmeyer R Perl TM Nelson KE Cummings DA Incubation periods of acute respiratory viral infections: a systematic review Lancet Infect Dis 2009 9 291300 10.1016/S1473-3099(09)70069-6 19393959...”

8i6vE / P47075 Cryo-em structure of the polyphosphate polymerase vtc complex(vtc4/vtc3/vtc1) (see paper)
Aligns to 513:575 / 611 (10.3%), covers 97.1% of PF02656, 45.3 bits

• Ligand: triphosphate (8i6vE)

B7GCM8 SPX domain-containing protein from Phaeodactylum tricornutum (strain CCAP 1055/1)
Aligns to 613:679 / 722 (9.3%), covers 97.1% of PF02656, 45.1 bits

• Comparative Proteomic Analysis of the Diatom Phaeodactylum tricornutum Reveals New Insights Into Intra- and Extra-Cellular Protein Contents of Its Oval, Fusiform, and Triradiate Morphotypes
  Chuberre, Frontiers in plant science 2022
  • “...Predicted protein NA Phatr3_J49296 B7GA48 Predicted protein NA Phatr3_J41518 B7GEF5 Predicted protein Methyltransferase activity Phatr3_J50019 B7GCM8 Predicted protein NA Phatr3_J47667 B7G4H1 Predicted protein Sodium-dependent phosphate transmembrane transporter activity Phatr3_J47412 B7G3A5 Predicted protein Nucleic acid binding Phatr3_J48827 B7G8I4 Predicted protein NA Phatr3_J46547 B7G1L3 Predicted protein Serine-type endopeptidase...”

VTC4_YEAST / P47075 Vacuolar transporter chaperone complex subunit 4; Phosphate metabolism protein 3; Polyphosphate kinase; SPX-dependent polyphosphate polymerase VTC subunit 4; Vacuolar membrane polyphosphate polymerase catalytic subunit; PolyP polymerase; EC 2.7.4.1 from Saccharomyces cerevisiae (strain ATCC 204508 / S288c) (Baker's yeast) (see 12 papers)
NP_012522 Vtc4p from Saccharomyces cerevisiae S288C
NP_012522, YJL012C Vacuolar membrane protein involved in vacuolar polyphosphate accumulation; functions as a regulator of vacuolar H+-ATPase activity and vacuolar transporter chaperones; involved in non-autophagic vacuolar fusion from Saccharomyces cerevisiae
Aligns to 622:684 / 721 (8.7%), covers 97.1% of PF02656, 45.0 bits

• function: Catalytic subunit of the vacuolar transporter chaperone (VTC) complex. The VTC complex acts as a vacuolar polyphosphate polymerase that catalyzes the synthesis of inorganic polyphosphate (polyP) via transfer of phosphate from ATP to a growing polyP chain, releasing ADP. VTC exposes its catalytic domain VTC4 to the cytosol, where the growing polyP chain winds through a tunnel-shaped pocket, integrating cytoplasmic polymer synthesis with polyP membrane translocation (PubMed:19390046). The VTC complex carries 9 vacuolar transmembrane domains, which are likely to constitute the translocation channel into the organelle lumen (PubMed:19390046, PubMed:25315834). PolyP synthesis is tightly coupled to its transport into the vacuole lumen, in order to avoid otherwise toxic intermediates in the cytosol, and it depends on the proton gradient across the membrane, formed by V-ATPase (PubMed:25315834). The VTC complex also plays a role in vacuolar membrane fusion (PubMed:11102525, PubMed:11823419, PubMed:12584253). Required for SEC18/NSF activity in SNARE priming, membrane binding of LMA1 and V(0) trans-complex formation (PubMed:11823419). Binds inositol hexakisphosphate (Ins6P) and similar inositol polyphosphates, such as 5-diphospho-inositol pentakisphosphate (5-InsP7); these are important intracellular signaling molecules. Inositol polyphosphate binding promotes vacuolar polyphosphate synthesis (PubMed:27080106). The VTC complex is required for microautophagy. It is a constituent of autophagic tubes and is required for scission of microautophagic vesicles from these tubes (PubMed:17079729).
  catalytic activity: [phosphate](n) + ATP = [phosphate](n+1) + ADP (RHEA:19573)
  cofactor: Mn(2+)
  subunit: The VTC core complex is an integral membrane heterooligomer composed of the catalytic subunit VTC4 and the accessory subunits VTC1, VTC2 and VTC3. The complex exists in 2 different sub-complexes: VTC1- VTC2-VCT4 and VCT1-VTC3-VTC4. The VCT1-VTC3-VTC4 subcomplex is mostly found on the vacuolar membrane. The VTC1-VTC2-VCT4 subcomplex is observed in the cell periphery, probably ER and nuclear envelope, but localizes to the vacuole under phosphate starvation. Each subunit contains 3 transmembrane helices. VTC1 is a small membrane protein without hydrophilic domain. VTC2, VTC3 and VTC4 are related and have 2 hydrophilic domains that face the cytosol, an N-terminal SPX domain and the central core domain. The central core in VTC4 is the catalytic domain, with the essential catalytic lysine replaced by isoleucine and leucine in VTC2 and VTC3, respectively (PubMed:19390046). The core complex associates with the accessory subunit VTC5 (PubMed:27587415). The complex interacts with the v-SNARE NYV1 and with the V(0) subunit of V-ATPase VPH1 (PubMed:11823419).
  disruption phenotype: Leads to a decrease in intracellular arginine, consistent with a role for polyP in vacuolar arginine storage.
• The cytoplasmic synthesis and coupled membrane translocation of eukaryotic polyphosphate by signal-activated VTC complex
  Guan, Nature communications 2023
  • “...purification The codon-optimized DNAs of yeast Vtc1 (Uniprot: P40046), Vtc3 (Uniprot: Q02725) and Vtc4 (Uniprot: P47075) were subcloned separately into the pMlink vector 55 . Vtc1 was tagged with a C-terminal HA tag, Vtc3 was tagged with an N-terminal 3Flag, and Vtc4 was tagged with a...”
• Altered proteome in translation initiation fidelity defective eIF5^G31R mutant causes oxidative stress and DNA damage
  Ram, Scientific reports 2022
  • “...P46992 TOH1 1.7233 0.0489 15 P32528 DUR1,2 1.7275 0.0011 16 Q02725 VTC3 1.7513 0.0068 17 P47075 VTC4 1.8045 0.0040 18 P40159 YNL208W 1.8591 0.0191 19 Q04432 HSP31 1.8778 0.0026 20 P22943 HSP12 1.8912 0.0252 21 P43585 VTC2 1.9087 0.0453 22 P12962 CAF20 1.9685 0.0059 23 Q12123...”
• Knockout of the Hmt1p Arginine Methyltransferase in Saccharomyces cerevisiae Leads to the Dysregulation of Phosphate-associated Genes and Processes
  Chia, Molecular & cellular proteomics : MCP 2018
  • “...YLR413W Pho3p Fpr4p Pdr5p Q02725 P25297 P40046 P47075 P32802 P11491 Q06689 P24031 Q06205 P33302 Vacuolar transporter chaperone Inorganic phosphate transporter...”
• The macro domain as fusion tag for carrier-driven crystallization
  Wild, Protein science : a publication of the Protein Society 2017
  • “...cerevisiae Vtc3; Q02725) and ScVtc4 (S. cerevisiae Vtc4; P47075) and including a secondary structure assignment calculated with the program DSSP48 and based on...”
• Positively-charged semi-tunnel is a structural and surface characteristic of polyphosphate-binding proteins: an in-silico study
  Wei, PloS one 2015
  • “...three-subunit components with actin-like structure. not reported PPK4 (vacuolar transporter chaperone, VTC4) Saccharomyces cerevisiae (NP_012522.2, P47075) membrane transport and vesicular traffic. one SPX domain (IPR004331) at the N terminus, DUF202 (IPR003807) and VTC domain (IPR018966). polyP-winding tunnel-shaped pocket with nucleotide-and phosphate-binding structures, formed mainly by antiparallel...”
• Catalytic core of a membrane-associated eukaryotic polyphosphate polymerase.
  Hothorn, Science (New York, N.Y.) 2009 (PubMed)
  • GeneRIF: results define Vtc4p* as a polyP-synthesizing enzyme
• Identification of the Genetic Requirements for Zinc Tolerance and Toxicity in Saccharomyces cerevisiae
  Zhao, G3 (Bethesda, Md.) 2020
  • “...PTC7 YMR264W CUE1 Cellular transport, transport facilities and transport routes (32) YBR127C VMA2 YFL004W VTC2 YJL012C VTC4 YLR261C VPS63 YCL038C ATG22 YGL212W VAM7 YJL024C APS3 YLR262C YPT6 YCR037C PHO87 YGL095C VPS45 YJL154C VPS35 YLR268W SEC22 YDL100C GET3 YGR105W VMA21 YJL198W PHO90 YLR396C VPS33 YDR089W VTC5 YHL031C...”
• The Reduced Level of Inorganic Polyphosphate Mobilizes Antioxidant and Manganese-Resistance Systems in Saccharomyces cerevisiae
  Trilisenko, Cells 2019
  • “...YFL004W VTC2 1.59 1.52 0.98 YPL019C VTC3 1.18 2.51 2.33 YDR089W VTC5 0.78 0.96 0.07 YJL012C VTC4 Vacuolar membrane polyphosphate polymerase 0.97 1.48 1.90 Phosphate Transport YFR034C PHO4 Activates transcription in response to phosphate limitation; function is regulated by phosphate availability 0.82 0.81 0.52 YML123C PHO84...”
• The role of PCNA as a scaffold protein in cellular signaling is functionally conserved between yeast and humans
  Olaisen, FEBS open bio 2018
  • “...Cox23 Cytochrome c oxidaseassembly factor Cox23 2 YHR137W Aro9 Aromatic amino acid aminotransferase 2 1 YJL012C Vtc4 Vacuolar transporter chaperone 4 42 YJL090C Dpb11 DNA replication regulator Dpb11 10 YKL028W Tfa1 Transcription initiation factor IIE subunit alpha 11 YKL103C Ape1 Vacuolar aminopeptidase 1 14 YKR026C Gcn3...”
• Analysis of COPII Vesicles Indicates a Role for the Emp47-Ssp120 Complex in Transport of Cell Surface Glycoproteins
  Margulis, Traffic (Copenhagen, Denmark) 2016
  • “...21 30 Plasma membrane H+-ATPase YOR270C Vph1 7 22 Subunit a of vacuolar-ATPase V0 domain YJL012C Vtc4 5 20 Vacuolar membrane polyphosphate polymerase YDR135C Ycf1 0 11 Vacuolar glutathione S-conjugate transporter...”
• The role of the Parkinson's disease gene PARK9 in essential cellular pathways and the manganese homeostasis network in yeast
  Chesi, PloS one 2012
  • “...SAP190 YIL054W YIL054W YBR231C SWC5 YIL040W APQ12 YER072W VTC1 YLL044W YLL044W YJL004C SYS1 YJR074W MOG1 YJL012C VTC4 YOR199W YOR199W YKL081W TEF4 YMR031W-A YMR031W-A YHR135C YCK1 YIL145C PAN6 YOL018C TLG2 YDR089W YDR089W YDL095W PMT1 YKR001C VPS1 YDR295C HDA2 YLL030C RRT7 YJL029C VPS53 YPR179C HDA3 YIL047C SYG1 YPL019C...”
• High-resolution genome-wide scan of genes, gene-networks and cellular systems impacting the yeast ionome
  Yu, BMC genomics 2012
  • “...- 3.98 - - - - - 3.63 - - - - - - P YJL012C VTC4 B - - - - - - 8.45 - - - - 6.10 - - P YER072W VTC1 B - - - - - - 8.94 - - -...”
• Identification of an evolutionarily conserved family of inorganic polyphosphate endopolyphosphatases
  Lonetti, The Journal of biological chemistry 2011
  • “...2). It has recently been found that Vtc4 (YJL012C; also known as Phm3), corresponding to subunit four of the vacuolar transporter chaperone complex, functions...”
• Identification of direct target genes using joint sequence and expression likelihood with application to DAF-16
  Yu, PloS one 2008
  • “...HIS1 YER055C HOR2 YER062C VTC1 YER072W VTC2 YFL004W SPL2 * YHR136C PHO12 * YHR215W VTC4 YJL012C PHO86 * YJL117W PHO84 * YML123C PHM7 YOL084W CTF19 YPL018W VTC3 YPL019C KRE29 YER038C SWC3 YAL011W YAR069C YAR069C YAR070C YAR070C KRE2 YDR483W MNN1 YER001W ARO9 YHR137W REC107 YJR021C YJR039W YJR039W...”
• More

XP_002295322 predicted protein from Thalassiosira pseudonana CCMP1335
Aligns to 475:541 / 589 (11.4%), covers 94.1% of PF02656, 44.9 bits

• Quantitative Proteomics Reveals Common and Specific Responses of a Marine Diatom Thalassiosira pseudonana to Different Macronutrient Deficiencies
  Chen, Frontiers in microbiology 2018
  • “...XP_002292372 2 1.57 Phosphatidylserine decarboxylase XP_002295759 8 2.94 Polyphosphate allocation Vacuolar transporter chaperone 4 (VTC4) XP_002295322 27 3.63 N containing lipids synthesis Betaine aldehyde dehydrogenase XP_002295797 8 1.58 Si deficiency (-Si vs. Control) Transport Silicic acid transporter (SIT1) XP_002290700 3 8.62 Silicic acid transporter (SIT2) XP_002295920...”

S8GSS4 VTC domain-containing protein from Toxoplasma gondii (strain ATCC 50611 / Me49)
Aligns to 1116:1180 / 1231 (5.3%), covers 94.1% of PF02656, 44.8 bits

• Epitope vaccine design for Toxoplasma gondii based on a genome-wide database of membrane proteins
  Li, Parasites & vectors 2022
  • “...20 S8FBJ7 Membrane protein, putative GGRQIENGGEDAAVND 936951 16 Q6GV23 Rhomboid-like protease 5 EQPPTGDYKRRALASP 5166 16 S8GSS4 Vacuolar transporter chaperone (VTC) domain-containing protein VGSQESGQARERDDREATE 136154 19 S8GRC2 Uncharacterized protein [Basic Local Alignment Search Tool (BLAST): organic solute transporter ostalpha protein] DGRREASEDPSVSANPHPTDSARTTSPSADDQ 5889 32 SAPGQEPQSPRGNADPRPSG 10151034 20 S7WII9...”

P78810 Vacuolar transporter chaperone complex subunit 4 from Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Aligns to 622:685 / 721 (8.9%), covers 97.1% of PF02656, 43.0 bits

• Proteasome regulation of petite-negativity in fission yeast.
  Amberg, bioRxiv : the preprint server for biology 2024
  • “...mrpl4 0.41 0.036 mitochondrial ribosomal protein subunit L29 O74512 wtf14 0.42 0.031 wtf element Wtf14 P78810 vtc4 0.43 0.010 vacuolar transporter chaperone (VTC) complex subunit Vtc4 P00046 cyc1 0.43 0.006 cyc1 cytochrome c O14249 SPAC6G10.03c 0.43 0.030 mitochondrial cardiolipin-specific phospholipase Cld1 Q9HDU3 gal10 0.44 0.047 UDP-glucose...”

A4HTX5 Uncharacterized protein from Leishmania infantum
Aligns to 686:765 / 813 (9.8%), covers 97.1% of PF02656, 26.6 bits

• Proteomic examination of Leishmania chagasi plasma membrane proteins: Contrast between avirulent and virulent (metacyclic) parasite forms
  Yao, Proteomics. Clinical applications 2010
  • “...Putative A4HQC5 84125.60 5.57 2 2.92 2 Putative A4HTP3 42020.60 7.28 1 6.30 2 Putative A4HTX5 93405.40 8.82 4 2.83 2 Putative A4HWV0 36798.80 7.02 0 7.93 2 Putative A4HXA8 36292.30 5.64 1 17.03 5 Putative A4HZ55 11111.80 4.81 1 11.46 2 Putative A4I0T3 13296.80 6.52...”

VTC4_TRYCC / Q4E409 Vacuolar transporter chaperone complex subunit 4; Polyphosphate kinase; SPX-dependent polyphosphate polymerase VTC subunit 4; Vacuolar membrane polyphosphate polymerase catalytic subunit; PolyP polymerase; EC 2.7.4.1 from Trypanosoma cruzi (strain CL Brener) (see paper)
Aligns to 674:753 / 801 (10.0%), covers 97.1% of PF02656, 24.2 bits

• function: Component of a polyphosphate synthase complex that utilizes ATP to synthesize and translocate polyphosphate to acidocalcisomes in epimastigotes, insect-stages of Trypanosoma brucei (PubMed:24386955). Catalytic subunit of the vacuolar transporter chaperone (VTC) complex. The VTC complex acts as a vacuolar polyphosphate polymerase that catalyzes the synthesis of inorganic polyphosphate (polyP) via transfer of phosphate from ATP to a growing polyP chain, releasing ADP. VTC exposes its catalytic domain vtc4 to the cytosol, where the growing polyP chain winds through a tunnel-shaped pocket, integrating cytoplasmic polymer synthesis with polyP membrane translocation. The VTC complex carries 9 vacuolar transmembrane domains, which are likely to constitute the translocation channel into the organelle lumen. PolyP synthesis is tightly coupled to its transport into the vacuole lumen, in order to avoid otherwise toxic intermediates in the cytosol, and it depends on the proton gradient across the membrane, formed by V-ATPase. The VTC complex also plays a role in vacuolar membrane fusion (By similarity). Essential for infection and parasite survival in the mammalian host (By similarity).
  catalytic activity: [phosphate](n) + ATP = [phosphate](n+1) + ADP (RHEA:19573)
  cofactor: Mn(2+)
  subunit: The VTC core complex is an integral membrane heterooligomer composed of at least the catalytic subunit vtc4 and the accessory subunits vtc1 and vtc2. vtc1 is a small membrane protein without hydrophilic domain. Vtc2 and vtc4 are related and have 2 hydrophilic domains that face the cytosol, an N-terminal SPX domain and the central core domain. The central core in vtc4 is the catalytic domain.
  disruption phenotype: Results in growth defects in procyclic forms (PCF) and changes in acidocalcisome morphology and number. The mean number of acidocalcisomes drops by approximately 2-fold, but individual acidocalcisomes are considerably larger and less circular. Also affects cellular polyP and PPi content. Short chain polyP drops almost 2-fold, while PPi nearly doubles.

Or search for genetic data about PF02656 in the Fitness Browser