Family Search for PF03235 (DUF262)

Running HMMer for PF03235

PF03235 hits 58 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.

CjjRM3420_1536 DUF262 domain-containing protein from Campylobacter jejuni subsp. jejuni str. RM3420
Aligns to 13:241 / 555 (41.3%), covers 100.0% of PF03235, 143.4 bits

• Biomolecule sulphation and novel methylations related to Guillain-Barré syndrome-associated Campylobacter jejuni serotype HS:19
  Heikema, Microbial genomics 2021
  • “...97 33 CjjRM3420_1453 capsular polysaccharide biosynthesis protein 100 34 CjjRM3420_1454 Sam-dependent methyltransferase 97 6 ST-21/HS:8 CjjRM3420_1536, rloF cluster IIX restriction modification linked orf restriction modification 97 16 ST-257/HS:11, ST-574/HS:mix, ST:48/HS:4, ST-677/HS:4 CjjRM3420_1537, hsdS type I restriction-modification system, specificity subunit S 100 12 ST-257/HS:11, ST-574/HS:mix, ST:48/HS:4 CjjRM3420_1677...”

c5426 Conserved hypothetical protein from Escherichia coli CFT073
Aligns to 15:226 / 557 (38.1%), covers 100.0% of PF03235, 142.1 bits

• The inner membrane protein YhiM links copper and CpxAR envelope stress responses in uropathogenic E. coli
  Saenkham-Huntsinger, mBio 2024
  • “...protein Cytosol ycjG c1797 Hypothetical protein Cytosol c5382 Hypothetical protein Cytosol c2508 Hypothetical protein Cytosol c5426 Conserved hypothetical protein Cytosol c5304 Putative conserved protein Cytosol c3171 Putative capsid protein of prophage Unknown ykfF c0279 Hypothetical protein Unknown c2748 Hypothetical protein Unknown c0293 Hypothetical protein Unknown c4303...”
• Pedigrees of some mutant strains of Escherichia coli K-12
  Bachmann, Bacteriological reviews 1972

HP1397 hypothetical protein from Helicobacter pylori 26695
Aligns to 11:227 / 271 (80.1%), covers 98.5% of PF03235, 135.8 bits

• The Helicobacter pylori J99 jhp0106 Gene, under the Control of the CsrA/RpoN Regulatory System, Modulates Flagella Formation and Motility
  Kao, Frontiers in microbiology 2017
  • “...ns /2.70 jhp1332 HP1439 Putative 1.85 ns /1.23 jhp1333 HP1440 Putative 7.22 *** /11.63 jhp1430 HP1397 Putative 3.23 *** /2.97 jhp1431 HP1396 Putative 3.74 *** /4.12 jhp1436 HP1391 Putative 2.16 ** /2.13 jhp1437 b HcpA family protein 1.63 ** /1.69 jhp1474 HP1566 Membrane protein 1.77 ***...”
• Alteration of the Helicobacter pylori membrane proteome in response to changes in environmental salt concentration
  Voss, Proteomics. Clinical applications 2015
  • “...D7FFD6 NA 2.53 Outer membrane protein HopA HP0229 HPB8_1699 D7FGE9 NA 2.53 Putative uncharacterized protein HP1397 HPB8_957 * & D7FEA7 NA 2.48 Putative uncharacterized protein HP0750 HPB8_1043 D7FEJ3 NA 2.43 Putative uncharacterized protein HP0833 HPB8_385 * D7FCN5 NA 2.4 cysteine-rich protein X HcpX HP1117 HPB8_513 *...”
• Differences in genome content among Helicobacter pylori isolates from patients with gastritis, duodenal ulcer, or gastric cancer reveal novel disease-associated genes
  Romo-González, Infection and immunity 2009
  • “...JHP0899 N/A, HP0965, JHP0899 N/A, HP1396, JHP1431 N/A, HP1397, JHP1430 N/A, N/A, JHP0616 N/A, N/A, JHP0961 N/A, N/A, JHP0959 N/A, N/A, JHP0960 N/A, N/A,...”
• Using macro-arrays to study routes of infection of Helicobacter pylori in three families
  Raymond, PloS one 2008
  • “...HP1383 restriction modification system S subunit HP1388 hypothetical protein HP1390 hypothetical protein HP1396 hypothetical protein HP1397 hypothetical protein HP1400+ iron(III) dicitrate transport protein (fecA) HP1402 type I restriction enzyme R protein (hsdR) HP1410 hypothetical protein HP1411 hypothetical protein HP1412 hypothetical protein HP1415 tRNA delta(2)-isopentenylpyrophosphate transferase (miaA)...”
• Acid-adaptive genes of Helicobacter pylori
  Wen, Infection and immunity 2003
  • “...HP1207 HP1236 HP1288 HP1289 HP1326 HP1327 HP1391 HP1397 HP1412 HP1440 HP1457 HP1499 HP1520 HP0433 Downloaded from http://iai.asm.org/ on February 11, 2017...”
• Comparison of genetic divergence and fitness between two subclones of Helicobacter pylori
  Björkholm, Infection and immunity 2001
  • “...JHP0950, HP0999, HP1074, JHP0332, HP1250, HP1324, HP1396, HP1397, HP1405, HP1412, HP1439, JHP1408, HP1586 NA hsdS Ribosomal protein L28 Acyl carrier protein...”

HPB8_729 DUF262 and DUF1524 domain-containing protein from Helicobacter pylori B8
D7FDN0 DUF262 domain-containing protein from Helicobacter pylori (strain B8)
Aligns to 8:220 / 687 (31.0%), covers 98.5% of PF03235, 135.4 bits

• Alteration of the Helicobacter pylori membrane proteome in response to changes in environmental salt concentration
  Voss, Proteomics. Clinical applications 2015
  • “...Putative uncharacterized protein comL HP1378 HPB8_319 * D7FCG9 NA 1.78 Outer membrane protein HopQ HP1177 HPB8_729 D7FDN0 NA 1.78 Putative uncharacterized protein HP0513 HPB8_1047 * D7FEJ7 NA 1.78 Putative uncharacterized protein HP0836|HP0837 HPB8_972 * D7FEC2 NA 1.77 Putative uncharacterized protein HP0764 HPB8_24 D7FBM4 oxidation-reduction process 1.75...”
• Alteration of the Helicobacter pylori membrane proteome in response to changes in environmental salt concentration
  Voss, Proteomics. Clinical applications 2015
  • “...uncharacterized protein comL HP1378 HPB8_319 * D7FCG9 NA 1.78 Outer membrane protein HopQ HP1177 HPB8_729 D7FDN0 NA 1.78 Putative uncharacterized protein HP0513 HPB8_1047 * D7FEJ7 NA 1.78 Putative uncharacterized protein HP0836|HP0837 HPB8_972 * D7FEC2 NA 1.77 Putative uncharacterized protein HP0764 HPB8_24 D7FBM4 oxidation-reduction process 1.75 Riboflavin...”

jhp0462 putative from Helicobacter pylori J99
Aligns to 8:217 / 706 (29.7%), covers 98.0% of PF03235, 135.3 bits

• Inter-species horizontal transfer resulting in core-genome and niche-adaptive variation within Helicobacter pylori
  Saunders, BMC genomics 2005
  • “...159 176 49 121 hypothetical protein HP0058 JHP0051 394 16 53 122 hypothetical protein HP0513 JHP0462 104 28 15 125 type I restriction enzyme M protein (hsdM) HP1403 JHP1423 299 340 44 132 hypothetical protein HP0731 JHP0668 110 80 32 139 hypothetical protein HP0508 JHP0458 84...”
  • “...protein JHP0336 HP1089 27 54 53 hypothetical protein JHP0940 NAH 39 393 54 hypothetical protein JHP0462 HP0513 104 11 55 type II restriction enzyme (methyltransferase) JHP1409 NAH 37 15 58 hypothetical protein JHP1285 HP1371 55 25 59 hypothetical protein JHP0693 HP0756 19 1490 62 cag pathogenicity...”

K747_06625 DUF262 and DUF1524 domain-containing protein from Helicobacter pylori UM032
Aligns to 7:218 / 689 (30.8%), covers 97.5% of PF03235, 135.1 bits

• Immunometabolism in biofilm infection: lessons from cancer
  Mirzaei, Molecular medicine (Cambridge, Mass.) 2022
  • “...that seem to be correlated with biofilm production. Indeed, three hypothetical genes (K74_10375, K747_09130, and K747_06625) were remarkably associated with biofilm production (Wong et al. 2016 ). K747_06625 is prognosticated to hold a homing endonuclease and a ParB-like domain, the latter of which is correlated with...”
• Biophysical characterization of the homodimers of HomA and HomB, outer membrane proteins of Helicobacter pylori
  Tamrakar, Scientific reports 2021
  • “...globular domain likely contributes to dimer formation. Some of the hypothetical proteins (K74_10375, K747_09130, and K747_06625) and outer membrane protein is associated with biofilm formation, HomD, a member of Hom OMP family is associated with moderate biofilm former (58.3%) to hyper biofilm former (66.7%) H. pylori...”
• Helicobacter pylori Biofilm Formation and Its Potential Role in Pathogenesis
  Hathroubi, Microbiology and molecular biology reviews : MMBR 2018
  • “...Indeed, three hypothetical genes (K74_10375, K747_09130, and K747_06625) were significantly correlated with biofilm formation (34). K747_06625 is predicted to...”
  • “...formation by H. pylori Gene K74_10375 K747_09130 K747_06625 fucT homD cagA Gene product Hypothetical gene Hypothetical gene Hypothetical gene...”
• Comparative Genomics Revealed Multiple Helicobacter pylori Genes Associated with Biofilm Formation In Vitro
  Wong, PloS one 2016
  • “...95C, 5min; 35x (95C, 30s; 57C, 30s; 72C, 1min); 72C, 7min Reverse: AGCTCCAAAAGAGGGGTAGC hypothetical protein K747_06625 Forward: GGCTCACCACTATACCGCTT 1089 95C, 5min; 35x (95C, 30s; 57C, 30s; 72C, 1min); 72C, 7min Reverse: TGACCGGCTCTTTTGTGTCA outer membrane protein ( homD ) Forward: GACGCTCAAGGCAAGGTAGT 1409 95C, 5min; 35x (95C, 30s;...”
  • “...forming strains, with 3 hypothetical genes (Hypothetical protein K747_10375, Hypothetical protein K747_09130 and Hypothetical protein K747_06625) and 4 functional genes (flagellar protein, cag pathogenicity island protein, outer membrane protein ( homD ) and alpha-(1,3)- fucosyltransferase) were identified to be significantly correlating with capability of forming biofilm...”

NMA2230 hypothetical protein from Neisseria meningitidis Z2491
Aligns to 11:243 / 571 (40.8%), covers 98.0% of PF03235, 133.0 bits

• Microarray genomotyping of key experimental strains of Neisseria gonorrhoeae reveals gene complement diversity and five new neisserial genes associated with Minimal Mobile Elements
  Snyder, BMC genomics 2004
  • “...probe for XNG1618 or to the alternate N. meningitidis strain Z2491 probes for NMA0001 and NMA2230 . Figure 2 The MME flanked by nuoL and nuoM . This MME contains a hypothetical gene in N. gonorrhoeae strain FA1090 [ 16 ], short intergenic sequences in N....”

NP_463839 similar to unknown protein from Listeria monocytogenes EGD-e
Aligns to 8:239 / 553 (42.0%), covers 95.0% of PF03235, 129.0 bits

• Actinomycete integrative and conjugative elements
  te, Antonie van Leeuwenhoek 2008
  • “...of AICE Sco 5349 (65% G + C) is 28% identical to a hypothetical protein (NP_463839) of the food-borne pathogen Listeria monocytogenes EGD-e. This indicates that AICEs may also mediate genetic exchange outside of the actinomycetes. However, database searches fail to identify clear AICE homologues in...”

HPYLSS1_01469 DUF262 domain-containing protein from Helicobacter pylori SS1
Aligns to 7:242 / 584 (40.4%), covers 97.5% of PF03235, 127.6 bits

• Helicobacter pylori Biofilm Involves a Multigene Stress-Biased Response, Including a Structural Role for Flagella
  Hathroubi, mBio 2018
  • “...protein homD 3.26 HPYLSS1_01113 Putative outer membrane protein 2.91 HPYLSS1_01021 Outer membrane protein homC 2.69 HPYLSS1_01469 Putative outer membrane protein 2.52 Cellular processes cagE (HPYLSS1_00705) Type IV secretion system protein VirB4/DNA transfer 2.46 cagW (HPYLSS1_00718) cag pathogenicity island protein CagW ( cag10 ) 2.31 cagL (HPYLSS1_00710)...”

cg0841 hypothetical protein from Corynebacterium glutamicum ATCC 13032
Aligns to 8:222 / 811 (26.5%), covers 99.0% of PF03235, 127.0 bits

• Ciprofloxacin triggered glutamate production by Corynebacterium glutamicum
  Lubitz, BMC microbiology 2016
  • “...protein 1.88 0.000 cg1978 - Hypothetical protein 1.72 0.000 cg1917 - Hypothetical protein 1.50 0.002 cg0841 - Conserved hypothetical protein 1.39 0.016 cg1743 - Conserved hypothetical protein 1.38 0.006 cg1937 - Putative secreted protein 1.22 0.015 cg3018 - Hypothetical protein 1.22 0.002 cg0451 - Putative membrane...”
  • “..., radA , lexA (autoregulation) and divS and several genes of unknown function (cg2381, cg2026, cg0841, cg1977) of the 48 genes of the LexA regulon were upregulated. As known for C. glutamicum and other bacteria, autoproteolytic cleavage of the transcriptional regulator LexA is induced by RecA...”
• The Zur regulon of Corynebacterium glutamicum ATCC 13032
  Schröder, BMC genomics 2010
  • “...sequence representing a regulatory gene region with a LexA binding site located in front of cg0841 [ 40 ] served as additional negative control. Likewise, Zur did not interact in vitro with the 21-bp motif located upstream of the adhA promoter region (Fig. 8A ). Furthermore,...”
  • “...The negative control assay was performed with a 40-mer deduced from the upstream region of cg0841. (B) , DNA band shift assays with mutated versions of the 40-mers. Mutated versions were generated by introducing transitions into the candidate Zur-binding sites or into the genomic flanking regions....”

jhp1301 putative from Helicobacter pylori J99
Aligns to 10:235 / 314 (72.0%), covers 97.5% of PF03235, 126.1 bits

• Differences in genome content among Helicobacter pylori isolates from patients with gastritis, duodenal ulcer, or gastric cancer reveal novel disease-associated genes
  Romo-González, Infection and immunity 2009
  • “...N/A, N/A, N/A, N/A, JHP0925 HP0992, N/A HP1409, JHP1301, JHP1302 HP1410, JHP1303 HP0425, N/A HP0674, N/A (absent in all cancer isolates) N/A, JHP0940 (absent...”
• Identification of a genetic marker of Helicobacter pylori strains involved in gastric extranodal marginal zone B cell lymphoma of the MALT-type
  Lehours, Gut 2004
  • “...L M N JHP305 JHP428 JHP1031 JHP1044 JHP1285 JHP1301 JHP1424 JHP820 JHP921* JHP922* JHP946* JHP949* JHP950* JHP960* JHP961* JHP1297 JHP1409 JHP1462 HP322 HP476...”
• Identification of target genes regulated by the two-component system HP166-HP165 of Helicobacter pylori
  Dietz, Journal of bacteriology 2002
  • “...HP1411, and HP1412 are split into two separate ORFs (JHP1301 and JHP1302, JHP1304 and JHP1305, and JHP1306 and JHP1307, respectively). The ORFs adjacent to the...”

HP0426 hypothetical protein from Helicobacter pylori 26695
HP1409 hypothetical protein from Helicobacter pylori 26695
Aligns to 12:236 / 578 (38.9%), covers 98.5% of PF03235, 125.9 bits

• High-Salt Conditions Alter Transcription of Helicobacter pylori Genes Encoding Outer Membrane Proteins
  Loh, Infection and immunity 2018
  • “...HP0219 HP0213 HP0157 HP0135 HP0113 HP0112 HP0054 HP0427 HP0426 HP0426 HP0036 HP0025 HP0016 HP0015 HP1564 HP1541 HP1399 Gene name or function Membrane protein...”
• Screening Helicobacter pylori genes induced during infection of mouse stomachs
  Singh, World journal of gastroenterology 2012
  • “...Ycf5 F Ycf5 R HP0423 F HP0423 R HP0424 F HP0424 R HP0426 F HP0426 R HP0427 F HP0427 R Table 2 Primers used in this study Genes Primer sequences 5'-3' HP1 HP2A...”
  • “...Type IV secretion system Predicted coding region HP0426 Predicted coding region HP0427 Predicted coding region HP0423 Predicted coding region HP0424 Motility...”
• Using macro-arrays to study routes of infection of Helicobacter pylori in three families
  Raymond, PloS one 2008
  • “...HP0414 IS200 insertion sequence from SARA17 HP0423 hypothetical protein HP0424 hypothetical protein HP0425 hypothetical protein HP0426 hypothetical protein HP0428 phage/colicin/tellurite resistance cluster terY protein HP0431 protein phosphatase 2C homolog (ptc1) HP0432 protein kinase C-like protein HP0433 hypothetical protein HP0434 hypothetical protein HP0436 hypothetical protein HP0437 IS605...”
• Characterization of the ArsRS regulon of Helicobacter pylori, involved in acid adaptation
  Pflock, Journal of bacteriology 2006
  • “...HP0081 HP0118 HP0120 HP0242* HP0305 HP0307* HP0423 HP0425 HP0426 HP0641 HP0731 HP0733 HP0963 HP0964 HP1154 HP1187 HP1188 HP1223 HP1408 HP1412 JHP0110 JHP0227...”
• The Helicobacter pylori J99 jhp0106 Gene, under the Control of the CsrA/RpoN Regulatory System, Modulates Flagella Formation and Motility
  Kao, Frontiers in microbiology 2017
  • “...*** /3.24 jhp1049 b Putative 3.53 *** /2.94 jhp1242 HP1322 Putative 2.60 ** /2.48 jhp1302 HP1409 Putative 2.83 ns /2.70 jhp1332 HP1439 Putative 1.85 ns /1.23 jhp1333 HP1440 Putative 7.22 *** /11.63 jhp1430 HP1397 Putative 3.23 *** /2.97 jhp1431 HP1396 Putative 3.74 *** /4.12 jhp1436 HP1391...”
• Association between Helicobacter pylori cagA-related genes and clinical outcomes in Colombia and Japan
  Watada, BMC gastroenterology 2011
  • “...file 1 . Among the 37 genes, the status of 9 genes (hp0186, hp0713, hp0967, hp1409, hp1410, jhp0045, jhp0046, jhp0950 , and jhp0951 ) were significantly correlated with the cagA status in our microarray data [ 18 ] (P = 0.026, 0.026, 0.014, 0.048, 0.030, 0.033,...”
• New implications on genomic adaptation derived from the Helicobacter pylori genome comparison
  Lara-Ramírez, PloS one 2011
  • “...of beta bands. The interactions with three proteins HP0887 (vacuolating cytotoxin precursor), HP0588 (ferrodoxin-like protein), HP1409 (hypothetical protein) was demonstrated by two-hybrid test [60] . HP1580, an uncharacterized protein and its H. pylori homologs in other H. pylori strains have been annotated in two sizes in...”
• Differences in genome content among Helicobacter pylori isolates from patients with gastritis, duodenal ulcer, or gastric cancer reveal novel disease-associated genes
  Romo-González, Infection and immunity 2009
  • “...N/A, N/A, N/A, N/A, N/A, N/A, JHP0925 HP0992, N/A HP1409, JHP1301, JHP1302 HP1410, JHP1303 HP0425, N/A HP0674, N/A (absent in all cancer isolates) N/A, JHP0940...”
  • “...two-component system confers urease-independent acid adaptation. The HP1409 and HP1410 genes, of unknown function, were also less frequent in cancer isolates...”
• Identification of a genetic marker of Helicobacter pylori strains involved in gastric extranodal marginal zone B cell lymphoma of the MALT-type
  Lehours, Gut 2004
  • “...JHP961* JHP1297 JHP1409 JHP1462 HP322 HP476 HP1105 HP1116 HP1371 HP1409 HP1402 None None None None None None None None None None None Putative poly E-rich...”
• Identification of target genes regulated by the two-component system HP166-HP165 of Helicobacter pylori
  Dietz, Journal of bacteriology 2002
  • “...(PCR amplified with primer pair 1187-5-1187-3) and HP1409 (PCR amplified with primer pair 1409-5-1409-3), respectively. RNA isolation. RNA was prepared as...”
  • “...(9) and a 504-bp PstI-SacI fragment derived from ORF HP1409 which was obtained by PCR performed with primer pair HP1409-5-HP1409-3 on chromosomal DNA of H....”

BCAL1172 hypothetical protein from Burkholderia cenocepacia J2315
Aligns to 10:234 / 590 (38.1%), covers 95.0% of PF03235, 125.5 bits

• Various Evolutionary Trajectories Lead to Loss of the Tobramycin-Potentiating Activity of the Quorum-Sensing Inhibitor Baicalin Hydrate in Burkholderia cenocepacia Biofilms
  Sass, Antimicrobial agents and chemotherapy 2019
  • “...CDS (10 bp 1012042 to 1012051) 100 repressor, GlpR BCAL1172 Conserved hypothetical protein, in BcenGI5 Deletion of first 148 bp of gene 100 92 BCAL1315...”
• The Mla Pathway Plays an Essential Role in the Intrinsic Resistance of Burkholderia cepacia Complex Species to Antimicrobials and Host Innate Components
  Bernier, Journal of bacteriology 2018
  • “...regulator 14C3 BCAL1048 Putative alpha/beta hydrolase 37B7 BCAL1172 Hypothetical protein 28H12 BCAL1246 Putative malonyl coenzyme A-acyl carrier protein 37H7...”
• Use of suppression-subtractive hybridization to identify genes in the Burkholderia cepacia complex that are unique to Burkholderia cenocepacia
  Bernier, Journal of bacteriology 2005
  • “...YP_109966g ZP_00213820 ZP_00222251 ZP_00222248 BCAL1291 BCAL1292 BCAL1172 BCAL1122 pBCA044 pBCA032 pBCA033 BCAM0327 BCAM0340 BCAM0514 BCAM0524 BCAS0034 BCAM2275...”

SCO5329 hypothetical protein from Streptomyces coelicolor A3(2)
Aligns to 12:239 / 565 (40.4%), covers 99.0% of PF03235, 125.3 bits

• Expression of genes of the Pho regulon is altered in Streptomyces coelicolor
  Millan-Oropeza, Scientific reports 2020
  • “...all time points on both carbon sources (Fig. S3 ). Interestingly the genes sco6638 , sco5329 and sco0324 encoding putative endonuclease or nucleosidase are present and expressed in SC but absent or truncated in the SL . The abundance of these proteins in SC suggests the...”
• Actinomycete integrative and conjugative elements
  te, Antonie van Leeuwenhoek 2008
  • “...proteins (ZP_01980106; ZP_01705385) of the -proteobacteria Vibrio cholerae MZO-2 and Shewanella putrefaciens 200. The gene SCO5329 (52% G + C) of AICE Sco 5349 (65% G + C) is 28% identical to a hypothetical protein (NP_463839) of the food-borne pathogen Listeria monocytogenes EGD-e. This indicates that...”

jhp1430 putative from Helicobacter pylori J99
Aligns to 12:233 / 282 (78.7%), covers 98.5% of PF03235, 124.1 bits

• The Helicobacter pylori J99 jhp0106 Gene, under the Control of the CsrA/RpoN Regulatory System, Modulates Flagella Formation and Motility
  Kao, Frontiers in microbiology 2017
  • “...2.83 ns /2.70 jhp1332 HP1439 Putative 1.85 ns /1.23 jhp1333 HP1440 Putative 7.22 *** /11.63 jhp1430 HP1397 Putative 3.23 *** /2.97 jhp1431 HP1396 Putative 3.74 *** /4.12 jhp1436 HP1391 Putative 2.16 ** /2.13 jhp1437 b HcpA family protein 1.63 ** /1.69 jhp1474 HP1566 Membrane protein 1.77...”
• Differences in genome content among Helicobacter pylori isolates from patients with gastritis, duodenal ulcer, or gastric cancer reveal novel disease-associated genes
  Romo-González, Infection and immunity 2009
  • “...JHP0899 N/A, HP0965, JHP0899 N/A, HP1396, JHP1431 N/A, HP1397, JHP1430 N/A, N/A, JHP0616 N/A, N/A, JHP0961 N/A, N/A, JHP0959 N/A, N/A, JHP0960 N/A, N/A, JHP0830...”

TM0991 hypothetical protein from Thermotoga maritima MSB8
Aligns to 13:230 / 584 (37.3%), covers 97.5% of PF03235, 121.9 bits

• A pipeline for completing bacterial genomes using in silico and wet lab approaches
  Puranik, BMC genomics 2015
  • “...Disrupted hypothetical protein TM0989 TRQ2_1806 CTN_1588 Present hypothetical protein TM0990 TRQ2_1805 CTN_1587 Disrupted hypothetical protein TM0991 TRQ2_1804 CTN_1586 Disrupted hypothetical protein TM0992 Absent CTN_1585 Disrupted hypothetical protein TM0993 Absent CTN_1584 Present hypothetical protein TM0994 Absent CTN_1583 Present hypothetical protein TM0995 Absent CTN_1582 Present hypothetical protein TM0996...”

CTN_1586 hypothetical protein from Thermotoga neapolitana DSM 4359
Aligns to 13:230 / 584 (37.3%), covers 97.5% of PF03235, 121.4 bits

• A pipeline for completing bacterial genomes using in silico and wet lab approaches
  Puranik, BMC genomics 2015
  • “...protein TM0989 TRQ2_1806 CTN_1588 Present hypothetical protein TM0990 TRQ2_1805 CTN_1587 Disrupted hypothetical protein TM0991 TRQ2_1804 CTN_1586 Disrupted hypothetical protein TM0992 Absent CTN_1585 Disrupted hypothetical protein TM0993 Absent CTN_1584 Present hypothetical protein TM0994 Absent CTN_1583 Present hypothetical protein TM0995 Absent CTN_1582 Present hypothetical protein TM0996 TRQ2_1803 CTN_1581...”

jhp0174 putative from Helicobacter pylori J99
Aligns to 5:214 / 567 (37.0%), covers 99.5% of PF03235, 121.3 bits

• Inter-species horizontal transfer resulting in core-genome and niche-adaptive variation within Helicobacter pylori
  Saunders, BMC genomics 2005
  • “...12 51 54 28 JHP1426 iron(III) dicitrate transport protein (fecA) HP1400 32 78 111 29 JHP0174 hypothetical protein HP0187 / 8 / 6 47&1127&596 88 90 30 JHP1297 type III restriction enzyme (res) NAH - 63 28 31 JHP0953 hypothetical protein NAH - 26 1463 32...”
  • “...46 histidine and glutamine-rich metal-binding protein HP1432 JHP1321 15 9 1432 47 hypothetical protein HP0186 JHP0174 29 130 276 48 fucosyltransferase HP0651 JHP0596 105 43 75 49 translation elongation factor EF-Tu (tufB) HP1205 JHP1128 81 64 166 50 virulence associated protein homolog (vacB) HP1248 JHP1169 79...”
• Genomic diversity in Campylobacter jejuni: identification of C. jejuni 81-176-specific genes
  Poly, Journal of clinical microbiology 2005
  • “...enterica serovar Typhi CT18 (NP_457434) Hypothetical protein jhp0174, H. pylori strain J99 (NP_222895) Hypothetical protein, Bacillus cereus ATCC 14579...”
• Identification of genes with fast-evolving regions in microbial genomes
  Zheng, Nucleic acids research 2004
  • “...jhp0786 jhp1070 jhp1293 jhp1392 jhp0320 jhp0372 jhp1365 jhp0174 jhp0596 jhp0346 jhp0649 jhp0613 jhp0989 jhp0530 jhp0684 jhp1281 jhp1410 jhp0189 jhp0967 jhp0655...”

PmCQ2_004580 DUF262 domain-containing protein from Pasteurella multocida
Aligns to 39:225 / 412 (45.4%), covers 98.5% of PF03235, 121.1 bits

• Attenuated vaccine PmCQ2Δ4555-4580 effectively protects mice against Pasteurella multocida infection
  He, BMC veterinary research 2024
  • “...PCR analysis showed that PmCQ245554580 missed six genes, including PmCQ2_004555, PmCQ2_004560, PmCQ2_004565, PmCQ2_004570, PmCQ2_004575, and PmCQ2_004580. Importantly, the virulence of PmCQ245554580 was reduced by approximately 2.810 9 times in mice. Notably, live PmCQ245554580 could provide 100%, 100% and 40% protection against PmA, PmB and PmF, respectively;...”
  • “...dihydrouridine synthase DusB), PmCQ2_004565 (Fis family transcriptional regulator), PmCQ2_004570 (phosphorribosylformyl-glycinamidine synthase), PmCQ2_004575 (hypothetical protein), and PmCQ2_004580 (DUF 26-containing protein) (Fig. 2 B). Then, the 6 missing genes were identified by PCR and RT-qPCR, which is consistent with our whole-genome resequencing data (Fig. 2 C, D). As...”

DDV75_00040 DUF262 domain-containing protein from Campylobacter jejuni
Aligns to 11:247 / 563 (42.1%), covers 99.0% of PF03235, 120.7 bits

• Identification of Novel Phage Resistance Mechanisms in Campylobacter jejuni by Comparative Genomics
  Sørensen, Frontiers in microbiology 2021
  • “...Position Product Gene Position Product Query cover Similarity E -value DDR89_00040 12.64214.393 DUF262 domain-containing protein DDV75_00040 12.65314.344 DUF262 domain-containing protein No significant similarity DDR89_00180 46.40450.144 Eco 57I restriction-modification methylase domain-containing protein DDV75_00180 46.52150.294 Eco 57I restriction-modification methylase domain-containing protein 88% 94.5% 0.0 DDR89_00185 50.147-52.291 AAA family...”
  • “...sensitive CAMSA2002 and phage resistant CAMSA2038 both encode a DUF262-containing protein ( DDR89_00040 in CAMSA2002, DDV75_00040 in CAMSA2038) in the same location of the genomes, but the protein sequences show no similarity ( Table 2 ). We therefore conducted a detailed in silico analysis to predict...”

TRQ2_1804 hypothetical protein from Thermotoga sp. RQ2
Aligns to 13:230 / 584 (37.3%), covers 97.5% of PF03235, 120.7 bits

• A pipeline for completing bacterial genomes using in silico and wet lab approaches
  Puranik, BMC genomics 2015
  • “...hypothetical protein TM0989 TRQ2_1806 CTN_1588 Present hypothetical protein TM0990 TRQ2_1805 CTN_1587 Disrupted hypothetical protein TM0991 TRQ2_1804 CTN_1586 Disrupted hypothetical protein TM0992 Absent CTN_1585 Disrupted hypothetical protein TM0993 Absent CTN_1584 Present hypothetical protein TM0994 Absent CTN_1583 Present hypothetical protein TM0995 Absent CTN_1582 Present hypothetical protein TM0996 TRQ2_1803...”

B8F899 DUF262 domain-containing protein from Glaesserella parasuis serovar 5 (strain SH0165)
Aligns to 8:222 / 680 (31.6%), covers 99.5% of PF03235, 120.4 bits

• Transcriptomics of Haemophilus (Glässerella) parasuis serovar 5 subjected to culture conditions partially mimetic to natural infection for the search of new vaccine antigens.
  Álvarez-Estrada, BMC veterinary research 2018
  • “...protein P CP HAPS_RS09000 hypothetical protein B8F7Q0 |HAPS_1850|Uncharacterized protein P IM HAPS_RS10195 DUF262 domain-containing protein B8F899 |HAPS_2100|Uncharacterized protein P CP HAPS_RS10530 TolC family protein tolC B8F8F2 |tolC|RND efflux system outer membrane lipoprotein/RND superfamily resistance-nodulation-cell division antiporter P OM HAPS_RS10585 ligand-gated channel B8F8G2 |hxuC|Heme/hemopexin utilization protein C/outer...”
  • “...domain HAPS_RS07950 CP Domain of the Thioredoxin-like superfamily HAPS_RS09000 B8F7Q0 IM Homology with permease HAPS_RS10195 B8F899 CP ParB-like and HNH nuclease domains The locus in the reference genome (SH0165 strain) is also indicated. a indicates that this was a single protein recognized as two different ones...”

CJSA_0008, DDR89_00040 DUF262 domain-containing protein from Campylobacter jejuni
Cj0008 hypothetical protein Cj0008 from Campylobacter jejuni subsp. jejuni NCTC 11168
Aligns to 10:260 / 583 (43.1%), covers 98.0% of PF03235, 119.8 bits

• Identification of Novel Phage Resistance Mechanisms in Campylobacter jejuni by Comparative Genomics
  Sørensen, Frontiers in microbiology 2021
  • “...Phage resistant CAMSA2038 Similarity Gene Position Product Gene Position Product Query cover Similarity E -value DDR89_00040 12.64214.393 DUF262 domain-containing protein DDV75_00040 12.65314.344 DUF262 domain-containing protein No significant similarity DDR89_00180 46.40450.144 Eco 57I restriction-modification methylase domain-containing protein DDV75_00180 46.52150.294 Eco 57I restriction-modification methylase domain-containing protein 88% 94.5%...”
  • “...and CAMSA2038 Phage sensitive CAMSA2002 and phage resistant CAMSA2038 both encode a DUF262-containing protein ( DDR89_00040 in CAMSA2002, DDV75_00040 in CAMSA2038) in the same location of the genomes, but the protein sequences show no similarity ( Table 2 ). We therefore conducted a detailed in silico...”
• Small Noncoding RNA CjNC110 Influences Motility, Autoagglutination, AI-2 Localization, Hydrogen Peroxide Sensitivity, and Chicken Colonization in Campylobacter jejuni
  Kreuder, Infection and immunity 2020 (secret)
• Comparison of epidemiologically linked Campylobacter jejuni isolated from human and poultry sources
  Lajhar, Epidemiology and infection 2015
  • “...size for each target gene indicates a positive result. Cj0008, 245 bp; Cj0122, 250 bp; Cj0265, 175 bp; panB (Cj0298c), 150 bp; Cj0423, 148 bp; cfrA (Cj0755),...”
  • “...a significantly higher representation (P < 0*01) of Cj0008, gmhA2 and CJE1733. Interestingly, flgE2 and virB8 were not detected in any isolates regardless of...”
• Same-day subtyping of Campylobacter jejuni and C. coli isolates by use of multiplex ligation-dependent probe amplification-binary typing
  Cornelius, Journal of clinical microbiology 2014
  • “...17 Cj1321 18 Cj0008 GGAATCACTATCCAGACAGCAGTGACATC AGCCGATGAGAATTTATTAAAATCAATTCTCGC AGGCT GCTTTTAAGGTAATAACTTCATTTTTTACTCGTA TAAAAGCCC...”
  • “...gmhA2 flgE2 CJE1500 Cj0423 wlaN cfrA Cj1321 Cj0008 MBIT 80 60 MBIT Region Hurunui Christchurch Darfield Darfield Ashburton Waimakariri Christchurch Hurunui...”
• Cellular response of Campylobacter jejuni to trisodium phosphate
  Riedel, Applied and environmental microbiology 2012
  • “...30 min Systematic Fold change P Fold change P Product Cj0008 Cj0039c Cj0044c Cj0045c Cj0176c 2.2 1.3 -1.3 1.0 2.5 0.000 0.024 0.026 0.859 0.001 1.8 1.8 -2.0...”
  • “...0.090 0.000 0.000 0.000 0.000 Hypothetical protein Cj0008 GTP-binding protein typA homolog Hypothetical protein Cj0044c Putative iron-binding protein Putative...”
• Development and validation of a comparative genomic fingerprinting method for high-resolution genotyping of Campylobacter jejuni
  Taboada, Journal of clinical microbiology 2012
  • “...613 Cj0297c Cj1727c Cj0264c Cj0008 Cj1585c GGCGTTGATATGGTTTTTATCC GGGCTTTTGGAATTCCTGTT GCCTACACAGAAAATGGCAAA TGAAAGCAAGACAGCTTGGA TTGGAATTTAAGGCCTGTGC...”
• Comparison of molecular typing methods useful for detecting clusters of Campylobacter jejuni and C. coli isolates through routine surveillance
  Clark, Journal of clinical microbiology 2012
  • “...CGF_MP3 Cj0297c Cj1727c Cj0264c Cj0008 Cj1585 GGCGTTGATATGGTTTTTATCC GGGCTTTTGGAATTCCTGTT GCCTACACAGAAAATGGCAAA TGAAAGCAAGACAGCTTGGA TTGGAATTTAAGGCCTGTGC...”
• Closely related Campylobacter jejuni strains from different sources reveal a generalist rather than a specialist lifestyle
  Gripp, BMC genomics 2011
  • “...not found in other human strains. The bovine strain 04197 lacked the gene equivalent to Cj0008 (gene designation of strain 11168), which is a gene of unknown function in a metabolic gene cluster relating to a pyridine nucleotide-disulphide oxidoreductase. The allelic diversity between the strains comprised...”
  • “...flagellin glycosylation gene cluster, in the human strain xy259. (B) Loss of ortholog to gene Cj0008 in 04197 nestled in between putative pyridine nucleotide-disulphide oxidoreductase large subunit gene gltB and small subunit gene gltD . (C) Common phage insertion in three ST-21 strains. The flanking genes...”
• Comparison of PCR binary typing (P-BIT), a new approach to epidemiological subtyping of Campylobacter jejuni, with serotyping, pulsed-field gel electrophoresis, and multilocus sequence typing methods
  Cornelius, Applied and environmental microbiology 2010
  • “...on February 18, 2017 by University of California, Berkeley Cj0008 VOL. 76, 2010 RISK-BASED BINARY TYPING SYSTEM FOR C. JEJUNI 1537 TABLE 2--Continued Gene/ORF c...”
• Culture of Campylobacter jejuni with sodium deoxycholate induces virulence gene expression
  Malik-Kale, Journal of bacteriology 2008
  • “...sodium DOC Gene Change (fold) Functional classification dnaN Cj0008 Cj0037c Cj0040 Cj0073c Cj0080 Cj0100 Cj0114 rpmE exbB1 tonB1 Cj0188c Cj0189c Cj0190c tig...”
  • “...http://jb.asm.org/ on April 16, 2019 by guest Cj0002 Cj0008 Cj0037c Cj0040 Cj0073c Cj0080 Cj0100 Cj0114 Cj0155c Cj0179 Cj0181 Cj0188c Cj0189c Cj0190c Cj0193c...”
• More

BC_0944 DUF262 domain-containing protein from Bacillus cereus ATCC 14579
Aligns to 13:221 / 527 (39.7%), covers 99.0% of PF03235, 118.8 bits

• Stoichiometry, Absolute Abundance, and Localization of Proteins in the Bacillus cereus Spore Coat Insoluble Fraction Determined Using a QconCAT Approach
  Stelder, Journal of proteome research 2018
  • “...protein a b BC_0996 Putative uncharacterized protein a b BC_0987 Putative uncharacterized protein a b BC_0944 Putative uncharacterized protein a BC_0825 Putative uncharacterized protein a BC_0212 Small, acid-soluble spore protein2 sasP-2 Spore coat proteinB a b BC_0390 Spore coat proteinB a b BC_0389 Spore coat proteinD...”

YPO3437 conserved hypothetical protein from Yersinia pestis CO92
Aligns to 23:241 / 636 (34.4%), covers 99.5% of PF03235, 118.4 bits

• Redefining the differences in gene content between Yersinia pestis and Yersinia pseudotuberculosis using large-scale comparative genomics
  Califf, Microbial genomics 2015
  • “...YOP2083 Y. pestis Hypothetical protein YPO0387 Y. pestis Hypothetical protein YPO0388 Y. pestis Hypothetical protein YPO3437 Y. pestis XRE family transcriptional regulator WP_002214362 Y. pestis Transcriptional regulator YPO4031 Y. pestis Transposase WP_002214360 Y. pestis Outer membrane receptor YPO3910 Y. pestis Hypothetical protein YPO3948 Y. pestis Hypothetical...”

EF62_1081 DUF262 domain-containing protein from Enterococcus faecalis 62
Aligns to 12:265 / 583 (43.6%), covers 99.5% of PF03235, 117.4 bits

• An ABC transporter is required for secretion of peptide sex pheromones in Enterococcus faecalis
  Varahan, mBio 2014
  • “...predicted CHAP domain-containing amidase, a cation transporter (EF_2556), and two predicted hypothetical proteins (EF_2470 and EF62_1081). Our attention was focused on insertions that were confined to a predicted ABC transporter, as independent transposon insertions localized to either the putative ATP-binding cassette (EF_0688) or the predicted permease...”

HPF57_0653 DUF262 domain-containing protein from Helicobacter pylori F57
Aligns to 8:218 / 682 (30.9%), covers 96.0% of PF03235, 115.3 bits

• Genome-wide association study of gastric cancer- and duodenal ulcer-derived Helicobacter pylori strains reveals discriminatory genetic variations and novel oncoprotein candidates
  Tuan, Microbial genomics 2021
  • “...HP1247 4.1 1111855 HPF57_1042 [1111772 1112203] (+) hemX haem interaction C 84 HP0375 4.1 686823 HPF57_0653 [686461688509] (+) mdr modification-specific restriction restriction C 363 no ortholog position in F57 reference genome. We also conducted a SNP-GWAS using another programme, pyseer, which can adjust for population structure,...”

jhp0955 putative from Helicobacter pylori J99
Aligns to 5:209 / 217 (94.5%), covers 95.0% of PF03235, 114.8 bits

• High-Salt Conditions Alter Transcription of Helicobacter pylori Genes Encoding Outer Membrane Proteins
  Loh, Infection and immunity 2018
  • “...HP1240 HP1193 HP1162 HP1160 HP1546 HP1116 HP0385 HP1412 jhp0955 jhp0954 HP0441 jhp0936 HP0996 jhp1408 HP0008 HP0903 HP0681 HP0682 HP0696 HP0697 HP0724 HP0725...”
• Role of Helicobacter pylori plasticity region genes in development of gastroduodenal diseases
  Sugimoto, Journal of clinical microbiology 2012
  • “...more than 90% of H. pylori (i.e., jhp0915 [100%], jhp0955 [94%], and jhp0957 [94%]). Genes found in less than 20% include jhp0914 (17%), jhp0925 (19%), jhp0926...”
• Roles of the plasticity regions of Helicobacter pylori in gastroduodenal pathogenesis
  Yamaoka, Journal of medical microbiology 2008
  • “...number Page 15 Strains hybridized/positive (%) NIH-PA Author Manuscript jhp0954 63 jhp0955 94 jhp0956 86 jhp0957 94 jhp0958 72 jhp0959 13 jhp0960 38 jhp0961 44...”

jhp0572 putative from Helicobacter pylori J99
Aligns to 8:218 / 683 (30.9%), covers 96.0% of PF03235, 114.1 bits

• The Helicobacter pylori J99 jhp0106 Gene, under the Control of the CsrA/RpoN Regulatory System, Modulates Flagella Formation and Motility
  Kao, Frontiers in microbiology 2017
  • “...OR UNKNOWN FUNCTION jhp0436 HP0484 Putative 3.38 *** /2.45 jhp0550 HP0603 Putative 2.17 *** /2.24 jhp0572 HP0629 Putative 1.54 * /3.54 jhp0753 HP0817 Putative 1.54 *** /1.69 jhp0936 b Putative 1.78 *** /3.24 jhp1049 b Putative 3.53 *** /2.94 jhp1242 HP1322 Putative 2.60 ** /2.48 jhp1302...”
• Differences in genome content among Helicobacter pylori isolates from patients with gastritis, duodenal ulcer, or gastric cancer reveal novel disease-associated genes
  Romo-González, Infection and immunity 2009
  • “...pepA, HP0570, JHP0517 aspS, HP0617, JHP0560 N/A, HP0629, JHP0572 N/A, HP0698, N/A N/A, HP0704, N/A fecA, fecA_2, HP0807, JHP0743 omp19, babB, HP0896, JHP1164...”

alr4229 hypothetical protein from Nostoc sp. PCC 7120
Aligns to 40:224 / 393 (47.1%), covers 98.5% of PF03235, 113.3 bits

• Deep sequencing of HetR-bound DNA reveals novel HetR targets in Anabaena sp. strain PCC7120
  Flaherty, BMC microbiology 2014
  • “...Yes 4740704..4741151 447 alr3926 c NA all3927 c 2.9 Yes 5064797..5065242 445 asr4228 c NA alr4229 7.5 Yes 5303024..5303480 456 all4424 5.2 all4425 c 1.7 Yes 5309952..5310383 431 all4430 4.9 all4431 c 10.3 Yes 5355615..5356047 432 alr4469 c 1.3 asr4470 10.8 Yes 0374646..0375090 444 all0326 Low...”

VC1766 conserved hypothetical protein from Vibrio cholerae O1 biovar eltor str. N16961
Aligns to 14:230 / 663 (32.7%), covers 100.0% of PF03235, 112.4 bits

• Vibrio choleraepathogenicity island 2 encodes two distinct types of restriction systems
  Vizzarro, 2024
• Impact of Gene Repression on Biofilm Formation of Vibrio cholerae
  Pombo, Frontiers in microbiology 2022
  • “...VC1714-1717 VC1714 Cell division protein MukB, chromosome partition protein 1 VC1718 Hypothetical protein 6 VC1766-1769 VC1766 Hypothetical protein 2 VC1768 Hypothetical protein 1 VC1769 DNA methylase HsdM; type I restriction enzyme M protein 1 VC1784 Neuraminidase, sialidase 1 VC1832 Hypothetical protein 2 VC1911 Orotidine 5-phosphate decarboxylase...”

HPG27_887 hypothetical protein from Helicobacter pylori G27
Aligns to 9:263 / 456 (55.9%), covers 99.0% of PF03235, 111.7 bits

• Genetic requirements and transcriptomics of Helicobacter pylori biofilm formation on abiotic and biotic surfaces
  Hathroubi, NPJ biofilms and microbiomes 2020
  • “...2.33 HPG27_1125 Hypothetical protein 2.32 HPG27_957 Cyclopropane fatty acid synthase 2.31 HPG27_1329 Biotin synthetase 2.31 HPG27_887 Hypothetical protein 2.31 HPG27_521 Ribosomal protein S21 2.29 HPG27_1156 Hypothetical protein 2.25 HPG27_1206 NuoB, NADH oxidoreductase I 2.25 HPG27_1273 FumC, fumarase 2.22 HPG27_469 Urease-enhancing factor 2.21 HPG27_549 OorA, 2-oxoglutarate oxidoreductase...”

jhp0873 putative from Helicobacter pylori J99
Aligns to 9:264 / 291 (88.0%), covers 98.5% of PF03235, 111.7 bits

• The orphan response regulator HP1021 of Helicobacter pylori regulates transcription of a gene cluster presumably involved in acetone metabolism
  Pflock, Journal of bacteriology 2007
  • “...VOL. 189, 2007 2343 JHP0881 JHP0887 JHP0938 JHP0872 JHP0873 JHP0882 JHP0880 JHP0089 JHP0227 a Genes listed are those whose transcription, according to...”

EF_B0059 hypothetical protein from Enterococcus faecalis V583
Aligns to 12:254 / 630 (38.6%), covers 99.5% of PF03235, 109.9 bits

• An enterococcal phage protein inhibits type IV restriction enzymes involved in antiphage defense
  Bullen, Nature communications 2024 (no snippet)

HP0629 hypothetical protein from Helicobacter pylori 26695
Aligns to 8:217 / 681 (30.8%), covers 95.5% of PF03235, 107.4 bits

• Helicobacter pylori Modulates Heptose Metabolite Biosynthesis and Heptose-Dependent Innate Immune Host Cell Activation by Multiple Mechanisms
  Hauke, Microbiology spectrum 2023
  • “...2.2 0 HP0602 ( magIII ) 333.82 1.77 3.42 4.91E10 HP0603 80.49 1.86 3.64 2.29E03 HP0629 54.18 0.95 1.94 8.87E05 HP0715 556.56 1.71 3.27 0 HP0751 ( flaG ) 1,284.04 2.40 5.29 0 HP0752 ( fliD ) 688.1 1.59 3.01 0 HP0753 ( fliS ) 270.58...”
• The Helicobacter pylori J99 jhp0106 Gene, under the Control of the CsrA/RpoN Regulatory System, Modulates Flagella Formation and Motility
  Kao, Frontiers in microbiology 2017
  • “...UNKNOWN FUNCTION jhp0436 HP0484 Putative 3.38 *** /2.45 jhp0550 HP0603 Putative 2.17 *** /2.24 jhp0572 HP0629 Putative 1.54 * /3.54 jhp0753 HP0817 Putative 1.54 *** /1.69 jhp0936 b Putative 1.78 *** /3.24 jhp1049 b Putative 3.53 *** /2.94 jhp1242 HP1322 Putative 2.60 ** /2.48 jhp1302 HP1409...”
• Comparative genomic analysis of East Asian and non-Asian Helicobacter pylori strains identifies rapidly evolving genes
  Duncan, PloS one 2013
  • “...HP0635 hypothetical protein Hypothetical Conserved HP0897 hypothetical protein Hypothetical Conserved HP0398 hypothetical protein Hypothetical Conserved HP0629 hypothetical protein Hypothetical Conserved HP0973 hypothetical protein Hypothetical Conserved HP0167 hypothetical protein Hypothetical Conserved HP0120 hypothetical protein Hypothetical Conserved HP0583 hypothetical protein Hypothetical Conserved HP0119 hypothetical protein Hypothetical Conserved HP0681...”
• Differences in genome content among Helicobacter pylori isolates from patients with gastritis, duodenal ulcer, or gastric cancer reveal novel disease-associated genes
  Romo-González, Infection and immunity 2009
  • “...N/A pepA, HP0570, JHP0517 aspS, HP0617, JHP0560 N/A, HP0629, JHP0572 N/A, HP0698, N/A N/A, HP0704, N/A fecA, fecA_2, HP0807, JHP0743 omp19, babB, HP0896,...”

UU527 conserved hypothetical from Ureaplasma parvum serovar 3 str. ATCC 700970
Aligns to 307:527 / 971 (22.8%), covers 98.5% of PF03235, 107.1 bits

• Comparative genome analysis of Ureaplasma parvum clinical isolates
  Momynaliev, Research in microbiology 2007 (PubMed)
  • “...function prediction only (UU480), function unknown (UU033, UU527) and defense mechanisms (UU446, UU447) was low (2.36.6%). Hence, the genetic variability of...”

CDQ83_18880 DUF262 domain-containing protein from Clostridium thermosuccinogenes
Aligns to 11:226 / 611 (35.4%), covers 98.5% of PF03235, 105.6 bits

• Breaking the Restriction Barriers and Applying CRISPRi as a Gene Silencing Tool in Pseudoclostridium thermosuccinogenes
  Ganguly, Microorganisms 2022
  • “...the gene cluster CDQ83_16045, CDQ83_16050, and CDQ83_16055. Scaffold 3 harbors the gene cluster CDQ83_18870, CDQ83_18875, CDQ83_18880, and CDQ83_18885. The ORFs from each Type I RM systems cloned in E. coli are highlighted in bold. Figure 3 Strategies to enhance transformation efficiency by breaking the restriction barriers....”

BF9343_1755 DUF262 domain-containing protein from Bacteroides fragilis NCTC 9343
Aligns to 11:219 / 551 (37.9%), covers 98.5% of PF03235, 103.3 bits

• Analysis of a phase-variable restriction modification system of the human gut symbiont Bacteroides fragilis
  Ben-Assa, Nucleic acids research 2020
  • “...putative XRE family transcriptional regulator, BF9343_1754 encodes a Type I restriction enzyme ( hsdR ), BF9343_1755 encodes a protein with endonuclease motifs, BF9343_1756 encodes a Type I methyltransferase ( hsdM ), and the next four genes or partial genes, BF9343_1757 through BF9343_1760, encode six distinct modules...”

MW0374 hypothetical protein from Staphylococcus aureus subsp. aureus MW2
Aligns to 8:213 / 608 (33.9%), covers 93.5% of PF03235, 102.4 bits

• Vibrio cholerae phage K139: complete genome sequence and comparative genomics of related phages
  Kapfhammer, Journal of bacteriology 2002
  • “...(HP2), Int (S2), Int (HP1), many others MW0374 (Staphylococcus aureus), Alr1266 (Nostoc sp.) Regulator Capsid portal protein RSc0964 (Ralstonia solanacearum),...”

VC1767 conserved hypothetical protein from Vibrio cholerae O1 biovar eltor str. N16961
Aligns to 20:187 / 470 (35.7%), covers 95.0% of PF03235, 101.2 bits

• Vibrio choleraepathogenicity island 2 encodes two distinct types of restriction systems
  Vizzarro, 2024

D7FGE9 DUF262 domain-containing protein from Helicobacter pylori (strain B8)
Aligns to 11:212 / 217 (93.1%), covers 81.4% of PF03235, 100.7 bits

• Alteration of the Helicobacter pylori membrane proteome in response to changes in environmental salt concentration
  Voss, Proteomics. Clinical applications 2015
  • “...uncharacterized protein HP1405 HPB8_1336 * & D7FFD6 NA 2.53 Outer membrane protein HopA HP0229 HPB8_1699 D7FGE9 NA 2.53 Putative uncharacterized protein HP1397 HPB8_957 * & D7FEA7 NA 2.48 Putative uncharacterized protein HP0750 HPB8_1043 D7FEJ3 NA 2.43 Putative uncharacterized protein HP0833 HPB8_385 * D7FCN5 NA 2.4 cysteine-rich...”

ACG06_19220 DUF262 domain-containing protein from Pseudomonas aeruginosa
Aligns to 7:222 / 564 (38.3%), covers 99.0% of PF03235, 98.6 bits

• Comparative genome and transcriptome analysis reveals distinctive surface characteristics and unique physiological potentials of Pseudomonas aeruginosa ATCC 27853
  Cao, BMC genomics 2017
  • “...unique C-terminal domain including a metal-binding cysteine cluster COG1223 ACG06_23485 Predicted ATPase (AAA+ superfamily) COG1479 ACG06_19220 Uncharacterized conserved protein COG1541 ACG06_14110 Coenzyme F390 synthetase COG1783 ACG06_12260 Phage terminase large subunit COG2189 ACG06_23500 Adenine specific DNA methylase Mod COG2253 ACG06_23380 Uncharacterized conserved protein COG2372 ACG06_12630 Uncharacterized protein,...”

Z5949 orf; conserved hypothetical protein from Escherichia coli O157:H7 EDL933
Aligns to 8:93 / 94 (91.5%), covers 38.7% of PF03235, 97.2 bits

• Cassette-like variation of restriction enzyme genes in Escherichia coli C and relatives
  Sibley, Nucleic acids research 2004
  • “...O157:H7 a frameshift breaks this ORF into two parts, Z5949 and Z5950 (29). Similarity to K-12 then resumes, with more framework genes of unknown function found...”
  • “...IB restriction genes (hsdRMS) and two ORFs of unknown function, Z5949 and Z5950; these are fused in C and CFT073 with a 10 amino acid linker relative to the...”

PFLU4242 hypothetical protein from Pseudomonas fluorescens SBW25
Aligns to 8:218 / 527 (40.0%), covers 98.0% of PF03235, 97.1 bits

• Compensatory evolution of chromosomes and plasmids counteracts the plasmid fitness cost
  Liu, Ecology and evolution 2024 (no snippet)
• Superiority of chromosomal compared to plasmid-encoded compensatory mutations
  Wright, 2024
• Compensatory mutations reducing the fitness cost of plasmid carriage occur in plant rhizosphere communities
  Bird, FEMS microbiology ecology 2023
  • “...target either the two-component global regulatory system, gacA/gacS , or the gene of unknown function PFLU4242 , which itself is positively regulated by gacA/gacS (Harrison et al. 2015 , Hall et al. 2021 ). Single mutations affecting either of these genes completely ameliorate the fitness cost...”
  • “...wild-type SBW25 and of SBW25 with a deletion of either the gacS gene or the PFLU4242 gene. Next, we tracked the abundance of SBW25 with or without a plasmid for 4 weeks within bacterial communities inhabiting the rhizospheres of wheat plants. We quantified plasmid maintenance over...”
• Adaptive Evolution Compensated for the Plasmid Fitness Costs Brought by Specific Genetic Conflicts
  Li, Pathogens (Basel, Switzerland) 2023
  • “...carrying the megaplasmids pQBR57 and pQBR103; the specific genetic conflict occurred as the SOS-response-related gene PFLU4242 mutation. However, there have been no studies on the relationship between specific genetic conflicts and the fitness cost of carrying ndm /IncX3 plasmids. Our work has previously revealed that the...”
• The evolution of infectious transmission promotes the persistence of mcr-1 plasmids
  Yang, mBio 2023
  • “...compensatory mutations in Pseudomonas fluorescens that target the two-component system GacA/GacS or the hypothetical protein PFLU4242 reduce the fitness cost of pQBR plasmids and increase their permissiveness ( 18 , 22 ). Several studies have shown that plasmid cost and persistence can often be improved by...”
• Compensatory mutations reducing the fitness cost of plasmid carriage occur in plant rhizosphere communities
  Bird, 2022
• Plasmid fitness costs are caused by specific genetic conflicts enabling resolution by compensatory mutation
  Hall, PLoS biology 2021
  • “...disruption associated with plasmid carriage. We identify one of these compensatory loci, the chromosomal gene PFLU4242 , as the key mediator of the fitness costs of both plasmids, with the other compensatory loci either reducing expression of this gene or mitigating its deleterious effects by up-regulating...”
  • “...mutation in Pseudomonas fluorescens SBW25, targeting the gacA/S global regulatory system or the hypothetical protein PFLU4242 , which individually ameliorate the fitness costs of megaplasmids pQBR103 (425 kb), pQBR57 (307 kb), or pQBR55 (157 kb) [ 29 , 38 ]. In this study, we describe an...”
• Plasmid fitness costs are caused by specific genetic conflicts
  Hall, 2021
• More

DIP1102 Conserved hypothetical protein from Corynebacterium diphtheriae NCTC 13129
Aligns to 10:254 / 602 (40.7%), covers 98.0% of PF03235, 89.9 bits

• The glyceraldehyde-3-phosphate dehydrogenase GapDH of Corynebacterium diphtheriae is redox-controlled by protein S-mycothiolation under oxidative stress
  Hillion, Scientific reports 2017
  • “...protein Cys22 (K)ERPTAGPQLYPVTC 22 EAVVSAIR(A) DIP1026 DIP1026 Conserved ATP-binding protein Cys75 (R)IC 75 LEADLGPVR(F) Rv1278 DIP1102 DIP1102 Putative uncharacterized protein Cys441 (R)LLSAC 441 PESGLYK(G) DIP1250 DIP1250 M18 family aminopeptidase Cys401* (K)AGSSHQVFVGNNSVPC 401 GSTIGPITATR(L) Rv0800* DIP1287 DIP1287 UPF0210 protein DIP1287 Cys324 (K)GGMMAC 324 SR(V) GlmS DIP1700 Glutamine-fructose-6-P...”

alr1266 hypothetical protein from Nostoc sp. PCC 7120
Aligns to 10:181 / 599 (28.7%), covers 94.0% of PF03235, 89.1 bits

• Vibrio cholerae phage K139: complete genome sequence and comparative genomics of related phages
  Kapfhammer, Journal of bacteriology 2002
  • “...Int (HP1), many others MW0374 (Staphylococcus aureus), Alr1266 (Nostoc sp.) Regulator Capsid portal protein RSc0964 (Ralstonia solanacearum), Orf34 (CTX)...”

SCO6638 hypothetical protein from Streptomyces coelicolor A3(2)
Aligns to 9:254 / 605 (40.7%), covers 99.5% of PF03235, 87.7 bits

• Expression of genes of the Pho regulon is altered in Streptomyces coelicolor
  Millan-Oropeza, Scientific reports 2020
  • “..., at all time points on both carbon sources (Fig. S3 ). Interestingly the genes sco6638 , sco5329 and sco0324 encoding putative endonuclease or nucleosidase are present and expressed in SC but absent or truncated in the SL . The abundance of these proteins in SC...”
• Quantitative Proteome and Phosphoproteome Analyses of Streptomyces coelicolor Reveal Proteins and Phosphoproteins Modulating Differentiation and Secondary Metabolism
  Rioseras, Molecular & cellular proteomics : MCP 2018
  • “...-2.7 0.4 0.2 SCO4301 4 - 1.5 - 2.8 SCO6476 n.s. - 1.4 - 2.6 SCO6638 n.s. 1 1.3 2 2.5 SCO6717 n.s. - -1.4 - 0.4 Cell division 1 SCO1416 5 SffA n.s. 0.8 n.s. 1.7 SCO1662 n.s. ParJ 0.33 0.55 1.3 1.5 SCO2077 n.s....”
• Uncovering genes with divergent mRNA-protein dynamics in Streptomyces coelicolor
  Jayapal, PloS one 2008
  • “...regulatory protein AdpA (SCO2792) involved in morphological differentiation [29] and a protein of unknown function (SCO6638) displayed increasing protein trends although the corresponding mRNA levels were relatively constant. This indicates a possible role for growth dependent control of these genes by bldA , the only S....”
• New pleiotropic effects of eliminating a rare tRNA from Streptomyces coelicolor, revealed by combined proteomic and transcriptomic analysis of liquid cultures
  Hesketh, BMC genomics 2007
  • “...N/A down Predicted 6 transmembrane domains; pI = 10.43 SCO6637 hypothetical protein 0.000788 N/A down SCO6638 hypothetical protein 0.000415 N/A down SCO6808 possible ArsR-family regulator 0.00219 N/A down Predicted mwt = 13271 Da SCO6958 putative membrane protein 0.036 N/A up Predicted 3 transmembrane domains; pI= 8.7;...”
  • “...five genes up-regulated in the bldA mutant SCO3088, SCO3285, SCO3286, SCO5166, SCO6958; the TTA-containing gene SCO6638; and the ribosomal protein genes SCO4648, SCO4702, SCO4705, SCO4717. See Additional File 2 for these results. 3 from ScoDB [55] 4 from a Welch t-test applying the Benjamini and Hochberg...”

HP0513 hypothetical protein from Helicobacter pylori 26695
Aligns to 1:173 / 658 (26.3%), covers 80.4% of PF03235, 83.9 bits

• Riboregulation in the Major Gastric Pathogen Helicobacter pylori
  Tejada-Arranz, Frontiers in microbiology 2021
  • “...asRNA Hp1116 Sharma et al. (2010) HPnc6000 asRNA Hp1116 Sharma et al. (2010) HPnc2450 asRNA Hp0513 Sharma et al. (2010) HPnc1470 asRNA Hp0357 Sharma et al. (2010) HPnc7450 asRNA HPr06 Sharma et al. (2010) HPnc3320 asRNA Hp0660 Sharma et al. (2010) HPnc1810 asRNA Hp0423 Sharma et...”
• Alteration of the Helicobacter pylori membrane proteome in response to changes in environmental salt concentration
  Voss, Proteomics. Clinical applications 2015
  • “...D7FCG9 NA 1.78 Outer membrane protein HopQ HP1177 HPB8_729 D7FDN0 NA 1.78 Putative uncharacterized protein HP0513 HPB8_1047 * D7FEJ7 NA 1.78 Putative uncharacterized protein HP0836|HP0837 HPB8_972 * D7FEC2 NA 1.77 Putative uncharacterized protein HP0764 HPB8_24 D7FBM4 oxidation-reduction process 1.75 Riboflavin biosynthesis protein (RibG) HP1505 HPB8_375 *...”
• Using macro-arrays to study routes of infection of Helicobacter pylori in three families
  Raymond, PloS one 2008
  • “...HP0483+ pseudo HP0489 hypothetical protein HP0492 neuraminyl-lactose binding hemagglutinin HP0503 hypothetical protein HP0505 hypothetical protein HP0513 hypothetical protein HP0519 hypothetical protein HP0522 cag pathogenicity island protein (cag3) HP0523 cag pathogenicity island protein (cag4) HP0524 cag pathogenicity island protein (cag5) HP0525 virB11 homolog HP0526 cag pathogenicity island...”
• Requirement of histidine kinases HP0165 and HP1364 for acid resistance in Helicobacter pylori
  Loh, Infection and immunity 2006
  • “...HP0109 HP0110 HP0129 HP0148 HP0225 HP0294 HP0460 HP0490 HP0513 HP0642 HP0668 HP0682 HP0708 HP0723 HP0807 HP0900 HP0948 HP1019 HP1104 HP1203 HP1238 HP1317 HP1329...”
  • “...HP0109 HP0110 HP0118 HP0119 HP0148 HP0225 HP0294 HP0490 HP0513 HP0531 HP0668 HP0708 HP0723 HP0756 HP0772 HP0807 HP0900 HP0948 HP1001 HP1019 HP1084 HP1192 HP1203...”
• Inter-species horizontal transfer resulting in core-genome and niche-adaptive variation within Helicobacter pylori
  Saunders, BMC genomics 2005
  • “...JHP0723 159 176 49 121 hypothetical protein HP0058 JHP0051 394 16 53 122 hypothetical protein HP0513 JHP0462 104 28 15 125 type I restriction enzyme M protein (hsdM) HP1403 JHP1423 299 340 44 132 hypothetical protein HP0731 JHP0668 110 80 32 139 hypothetical protein HP0508 JHP0458...”
  • “...JHP0336 HP1089 27 54 53 hypothetical protein JHP0940 NAH 39 393 54 hypothetical protein JHP0462 HP0513 104 11 55 type II restriction enzyme (methyltransferase) JHP1409 NAH 37 15 58 hypothetical protein JHP1285 HP1371 55 25 59 hypothetical protein JHP0693 HP0756 19 1490 62 cag pathogenicity island...”
• Global analysis of Helicobacter pylori gene expression in human gastric mucosa
  Graham, Gastroenterology 2002
  • “...b Hypothetical protein HP1432 Histidine- and glutamine-rich protein HP0513 Hypothetical protein HP1452 Thiophene and furan oxidizer ( tdhF ) HP0601 b Flagellin...”

VCA0199 hypothetical protein from Vibrio cholerae O1 biovar eltor str. N16961
Aligns to 259:412 / 638 (24.1%), covers 96.5% of PF03235, 83.2 bits

• The quorum sensing transcription factor AphA directly regulates natural competence in Vibrio cholerae
  Haycocks, PLoS genetics 2019
  • “...r 105925 105897 gtatgaaaccttagtcatgg (VCA0098) 180601 180618 ctctgcatccagatgcagga (VCA0162) VCA0163 215501 215472 tcattcaagcgtttgcatag (VCA0198) r VCA0199 220027 219980 tgtggaaacttgttgaatag (VCA0202) 270051 270033 catttccacaggtttcataa VCA0249 a VCA0249 a 292440 292420 tgtggaaacttgttgaatag (VCA0275) 310741 310644 ctatggttttttttgcatag VCA0291 VCA0291 354757 354789 ctatgcgcttttttgcttag VCA0367 a VCA0367 a 428574 428600 ctattcaacaagtttccaca...”
• QstR-dependent regulation of natural competence and type VI secretion in Vibrio cholerae
  Jaskólska, Nucleic acids research 2018
  • “...the probes. Additionally, a few proteins were specifically eluted from the comEA probe. Most notably VCA0199 (uncharacterized protein) was highly enriched on the comEA probe, as well as two other transcriptional regulators ( Supplementary Table S5 ). However, strains carrying deletions of these genes were fully...”
• High-throughput sequencing reveals suppressors of Vibrio cholerae rpoE mutations: one fewer porin is enough
  Davis, Nucleic acids research 2009
  • “...derived from C6706 were used ( 20 ). A related mutant with an insertion in vca0199 was also used, both with the KnR transposon still present (BD2034) and with the majority of the transposon excised by flippase (BD2041). Transposons were also excised from a subset of...”
  • “...alone, followed by patching to plates containing kanamycin, led to similar conclusions.) Point mutations in vca0199, vc2413 and the ompU ( vc0633 ) promoter and 5UTR were introduced using plasmids pBD2038, pBD2036, pBD2049 and pBD2088, respectively. Deletions in ompU and ompT were introduced using the previously...”

orf2 / A0A023I190 6-hydroxypseudooxynicotine oxidase from Shinella sp. (strain HZN7) (see paper)
Aligns to 16:235 / 562 (39.1%), covers 98.0% of PF03235, 81.2 bits

alr5156 hypothetical protein from Nostoc sp. PCC 7120
Aligns to 10:164 / 168 (92.3%), covers 52.8% of PF03235, 74.0 bits

• The insertion sequences of Anabaena sp. strain PCC 7120 and their effects on its open reading frames
  Wolk, Journal of bacteriology 2010
  • “...alr5158) is within a gene that fuses the start of alr5156 and the end of alr5159 and that has homologs in diverse cyanobacteria and other bacteria. BLASTn shows...”

BanLI Type II restriction enzyme recognizing RTCAGG, ?; CCTGAY from Bifidobacterium animalis subsp. lactis CNCM I-2494
Aligns to 23:159 / 372 (36.8%), covers 93.5% of PF03235, 71.6 bits

STM14_2479, STMUK_2024 DUF262 domain-containing protein from Salmonella enterica subsp. enterica serovar Typhimurium str. UK-1
Aligns to 27:163 / 171 (80.1%), covers 31.7% of PF03235, 65.0 bits

• Genome-Scale Mapping of Escherichia coli σ54 Reveals Widespread, Conserved Intragenic Binding
  Bonocora, PLoS genetics 2015
  • “...Enrichment was calculated relative to a control region within the bglB gene for MG1655, or STM14_2479 for S . enterica , and normalized to values for input DNA. Occupancy units were calculated as background-subtracted, fold-enrichment. Relative 54 occupancy at nagB and yqeC intragenic promoters ( Fig...”
• Transcriptional Profiling of a Cross-Protective Salmonella enterica serovar Typhimurium UK-1 dam Mutant Identifies a Set of Genes More Transcriptionally Active Compared to Wild-Type, and Stably Transcribed across Biologically Relevant Microenvironments
  Miller, Pathogens (Basel, Switzerland) 2014
  • “...20.75 3.46 NP Hypothetical bacteriophage protein STMUK_2023 12.09 24.14 2.81 NP Similar to phage protein STMUK_2024 8.37 12.71 NP NP Hypothetical bacteriophage protein STMUK_2025 9.37 10.70 NP NP Hypothetical bacteriophage protein STMUK_2026 10.27 9.84 NP NP Hypothetical bacteriophage protein STMUK_2027 5.98 7.97 7.79 NP Putative bacteriophage...”

AYJ09_01105 DUF262 domain-containing protein from Candidatus Liberibacter solanacearum
Aligns to 10:155 / 361 (40.4%), covers 94.0% of PF03235, 63.0 bits

• Genomic sequence of 'Candidatus Liberibacter solanacearum' haplotype C and its comparison with haplotype A and B genomes
  Wang, PloS one 2017
  • “...236 type-2 restriction enzyme HaeIII - - - AYJ09_01090 149 hypothetical protein - + - AYJ09_01105 361 HNH endonuclease - - - AYJ09_01490 110 hypothetical protein - - - AYJ09_01505 92 hypothetical protein - - - AYJ09_01510 68 hypothetical protein - - - AYJ09_01535 113 hypothetical...”

HP0938 hypothetical protein from Helicobacter pylori 26695
Aligns to 9:81 / 115 (63.5%), covers 24.6% of PF03235, 50.0 bits

• Alteration of the Helicobacter pylori membrane proteome in response to changes in environmental salt concentration
  Voss, Proteomics. Clinical applications 2015
  • “...HPB8_153 D7FC03 NA 1.83 Putative uncharacterized protein HP1326 HPB8_610 D7FDB0 NA 1.83 Putative uncharacterized protein HP0938 HPB8_1264 * & D7FF65 transmembrane transport 1.8 Dipeptide ABC transporter, periplasmic dipeptide-binding protein (DppA) HP0298 HPB8_195 D7FC45 NA 1.78 Putative uncharacterized protein HP1286 HPB8_1079 * ! D7FEM9 bacterial-type flagellum-dependent cell...”
• The orphan response regulator HP1021 of Helicobacter pylori regulates transcription of a gene cluster presumably involved in acetone metabolism
  Pflock, Journal of bacteriology 2007
  • “...JHP1163 JHP0900/JHP0901 Hypothetical HP1242 HP0966 HP1334 HP0937 HP0938 HP0948 HP0946 HP0097 HP0242 HP0945 HP0947 HP0953 HP0990 HP0992 Genome organizationd...”
• Genetic analysis of Helicobacter pylori strain populations colonizing the stomach at different times postinfection
  Salama, Journal of bacteriology 2007
  • “...1 2 s1m1 s2m2 HP0664 HP0719 HP0820 HP0823 HP0938 HP1076 HP1257 HP1392 HP1511 Desciptionb Flagellar protein G Nonfunctional type II restriction endonuclease...”
• A revised annotation and comparative analysis of Helicobacter pylori genomes
  Boneca, Nucleic acids research 2003
  • “...(HP0667/HP0668/ HP0669; HP0732/HP0733; HP0764/HP0765; HP0937/ HP0938; HP0964/HP0965). Most of these pseudogenes were classi(R)ed as hypothetical CDS,...”
• Whole genome comparison of Campylobacter jejuni human isolates using a low-cost microarray reveals extensive genetic diversity
  Dorrell, Genome research 2001
  • “...a gene with unknown function, but an ortholog of HP0938 in the H. pylori 26695 genome. Cj1585 is a probable oxidoreductase. The cluster Cj0055-Cj0058 consists...”

D7FDB0 DUF262 domain-containing protein from Helicobacter pylori (strain B8)
Aligns to 4:81 / 115 (67.8%), covers 24.6% of PF03235, 49.5 bits

• Alteration of the Helicobacter pylori membrane proteome in response to changes in environmental salt concentration
  Voss, Proteomics. Clinical applications 2015
  • “...1.87 50S ribosomal protein L18 HP1303 HPB8_153 D7FC03 NA 1.83 Putative uncharacterized protein HP1326 HPB8_610 D7FDB0 NA 1.83 Putative uncharacterized protein HP0938 HPB8_1264 * & D7FF65 transmembrane transport 1.8 Dipeptide ABC transporter, periplasmic dipeptide-binding protein (DppA) HP0298 HPB8_195 D7FC45 NA 1.78 Putative uncharacterized protein HP1286 HPB8_1079...”

Z5950 orf; conserved hypothetical protein from Escherichia coli O157:H7 EDL933
Aligns to 6:121 / 452 (25.7%), covers 38.2% of PF03235, 47.5 bits

• Cassette-like variation of restriction enzyme genes in Escherichia coli C and relatives
  Sibley, Nucleic acids research 2004
  • “...a PCR product across this gap, one primer in the Z5950 coding sequence (pMS4) and one primer in yjiX (pMS3) from E.coli C genomic DNA. Genes hpaC and hpaB...”
  • “...sequence. dDesignation is from E.coli CFT073 sequence; the Z5950 sequence found in C and CFT073 represents a fusion of the coding sequences designated Z4949...”

HP0187 hypothetical protein from Helicobacter pylori 26695
Aligns to 1:93 / 95 (97.9%), covers 35.2% of PF03235, 44.8 bits

• Inter-species horizontal transfer resulting in core-genome and niche-adaptive variation within Helicobacter pylori
  Saunders, BMC genomics 2005
  • “...28 JHP1426 iron(III) dicitrate transport protein (fecA) HP1400 32 78 111 29 JHP0174 hypothetical protein HP0187 / 8 / 6 47&1127&596 88 90 30 JHP1297 type III restriction enzyme (res) NAH - 63 28 31 JHP0953 hypothetical protein NAH - 26 1463 32 JHP0067 urease beta...”

Or search for genetic data about PF03235 in the Fitness Browser