Family Search for PF04063 (DUF383)
PF04063.14 hits 5 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.
SS1G_04205 hypothetical protein from Sclerotinia sclerotiorum 1980 UF-70
Aligns to 56:241 / 354 (52.5%), covers 98.9% of PF04063, 236.6 bits
SPAC26F1.12c conserved eukaryotic protein (RefSeq) from Schizosaccharomyces pombe
Aligns to 94:278 / 356 (52.0%), covers 98.9% of PF04063, 217.6 bits
HGH1_YEAST / P48362 Protein HGH1; HMG1/2 protein homolog from Saccharomyces cerevisiae (strain ATCC 204508 / S288c) (Baker's yeast) (see paper)
YGR187C Hgh1p (RefSeq) from Saccharomyces cerevisiae
NP_011703 Hgh1p from Saccharomyces cerevisiae S288C
Aligns to 99:301 / 394 (51.5%), covers 99.5% of PF04063, 213.8 bits
- Extending bicluster analysis to annotate unclassified ORFs and predict novel functional modules using expression data
Bryan, BMC genomics 2008 (no snippet) - Identification of coherent patterns in gene expression data using an efficient biclustering algorithm and parallel coordinate visualization
Cheng, BMC bioinformatics 2008 - “...YCL055W, YNL313C, YPL192C ribosome biogenesis and assembly 2.32E-05 2.18E-03 YBR267W, YCR072C, YDL031W, YDR184C, YDR465C, YGL099W, YGR187C, YMR128W, YOL010W, YOR001W 35S primary transcript processing 4.81E-04 4.52E-02 YDL031W, YGR090W, YOL010W, YOL021C, YOR001W 50 pseudohyphal growth 9.72E-04 4.57E-02 YBR083W, YJL164C, YKL185W, YOR127W N-terminal protein myristoylation 5.58E-04 2.62E-02 YIL009W, YOR317W...”
- Probabilistic protein function prediction from heterogeneous genome-wide data
Nariai, PloS one 2007 - “...[30] that YBL028C, YBR271W, YCR016W, YJR003C, YDL167C, YDR361C, YIL096C, YIL127C, YLR449W, YMR310C, YNL022C, YNL132W, YNL175C, YGR187C, YGR283C and YOR021C as rRNA and ribosome biosynthesis (RRB) regulon. It has also been reported [31] that YLR051C encodes a protein involved in pre-rRNA processing, confirming our prediction of ribosome...”
- The deletion of six ORFs of unknown function from Saccharomyces cerevisiae chromosome VII reveals two essential genes: YGR195w and YGR198w
Rodriguez-Peña, Yeast (Chichester, England) 1998 (PubMed)- “...Saccharomyces cerevisiae; chromosome VII; ribonuclease PH; HGH1; YGR187c; YGR189c; YGR194c; YGR195w; YGR196c; YGR198w INTRODUCTION Within the framework of the...”
- “...this study. Sequence* For ORF YGR187C L1 5GAAGCTCTTCATACATCGAGT 3 L2 5GGGGATCCGTCGACCTGCAGCGTAC CATCACTCAATTTTTTGTTGATT 3 L3 5AACGAGCTCGAATTCATCGATGATA...”
- Chaperone Function of Hgh1 in the Biogenesis of Eukaryotic Elongation Factor 2.
Mönkemeyer, Molecular cell 2019 (PubMed)- GeneRIF: Hgh1 binding recruits TRiC to the C-terminal eEF2 module and prevents unproductive interactions of domain III, allowing efficient folding of the N-terminal GTPase module. eEF2 folding is completed upon dissociation of TRiC and Hgh1.
- The Co-chaperone Cns1 and the Recruiter Protein Hgh1 Link Hsp90 to Translation Elongation via Chaperoning Elongation Factor 2.
Schopf, Molecular cell 2019 (PubMed)- GeneRIF: Chaperoning of eEF2 by Cns1 is essential for yeast viability and requires a defined subset of the Hsp90 machinery as well as the identified eEF2 recruiting factor Hgh1.
PBANKA_101870, PBANKA_1018700 conserved Plasmodium protein, unknown function from Plasmodium berghei ANKA
Aligns to 110:275 / 364 (45.6%), covers 85.3% of PF04063, 36.8 bits
- Plasmodium gametocytes display homing and vascular transmigration in the host bone marrow
De, Science advances 2018 - “...In addition, P. berghei lines G623 (820) and G629 (GNPm9), with CFP expression under the PBANKA_101870 promoter, and lines G488 (820), G458 (GNPm9), and G455(HP), with CFP expression under the Hsp70 promoter were used to investigate differences in parasite localization among previously published gametocyte-producing and gametocyte-nonproducing...”
- Lysophosphatidylcholine Regulates Sexual Stage Differentiation in the Human Malaria Parasite Plasmodium falciparum
Brancucci, Cell 2017 - “...assays were performed using a parasite line expressing an RFP reporter under the gametocyte-specific gene PBANKA_1018700 ( Sinha etal., 2014 ) and GFP under the constitutive PBANKA_0905600 promoter, in the 507cl1 background line (RMgm-7). Mature schizonts were intravenously (IV) administered to nave TO mice. Ring stage...”
- A cascade of DNA-binding proteins for sexual commitment and development in Plasmodium
Sinha, Nature 2014 - “...pG306 which integrated to the p230p locus and contains a CFP gene driven by the PBANKA_101870 promoter. This also enabled us to confirm general transfection efficiency in each batch of transfections. After gating on the infected population using DyeCycle Ruby staining the percentage of parasites expressing...”
PF3D7_1425900 conserved Plasmodium protein, unknown function from Plasmodium falciparum 3D7
Aligns to 108:279 / 368 (46.7%), covers 78.9% of PF04063, 33.8 bits
- Epigenetic reader complexes of the human malaria parasite, Plasmodium falciparum
Hoeijmakers, Nucleic acids research 2019 - “...interact with the above described components of the PHD2/SAGA-like complex (NAPS, APL2b, PF3D7_0212100, PF3D7_1019700, PF3D7_0817300, PF3D7_1425900, but not PHD1 and PF3D7_1402800, see previous paragraph and Figures 3D , 4 ). Interestingly, TAF1/BDP5 co-precipitated with a distinct set of proteins and forms a separate module less closely...”
- Predicting functional and regulatory divergence of a drug resistance transporter gene in the human malaria parasite
Siwo, BMC genomics 2015 - “...Plasmodium protein, unknown function PF3D7_0216100; PF3D7_0216200 conserved Plasmodium protein, unknown function PF3D7_0501400 interspersed repeat antigen PF3D7_1425900 conserved Plasmodium protein, unknown function PF3D7_0104100 conserved Plasmodium membrane protein, unknown function While pfcrt s biological function is unknown, it has been proposed to be associated with the catabolism of...”
Or search for genetic data about PF04063 in the Fitness Browser
by Morgan Price,
Arkin group
Lawrence Berkeley National Laboratory