Family Search for PF04064 (DUF384)
April 2024: See Interactive Tools for Functional Annotation of Bacterial Genomes for advice on using these tools.
PF04064 hits 4 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.
HGH1_YEAST / P48362 Protein HGH1; HMG1/2 protein homolog from Saccharomyces cerevisiae (strain ATCC 204508 / S288c) (Baker's yeast) (see paper)
NP_011703 Hgh1p from Saccharomyces cerevisiae S288C
YGR187C Hgh1p from Saccharomyces cerevisiae
Aligns to 306:360 / 394 (14.0%), covers 98.2% of PF04064, 89.8 bits
- Chaperone Function of Hgh1 in the Biogenesis of Eukaryotic Elongation Factor 2.
Mönkemeyer, Molecular cell 2019 (PubMed)- GeneRIF: Hgh1 binding recruits TRiC to the C-terminal eEF2 module and prevents unproductive interactions of domain III, allowing efficient folding of the N-terminal GTPase module. eEF2 folding is completed upon dissociation of TRiC and Hgh1.
- The Co-chaperone Cns1 and the Recruiter Protein Hgh1 Link Hsp90 to Translation Elongation via Chaperoning Elongation Factor 2.
Schopf, Molecular cell 2019 (PubMed)- GeneRIF: Chaperoning of eEF2 by Cns1 is essential for yeast viability and requires a defined subset of the Hsp90 machinery as well as the identified eEF2 recruiting factor Hgh1.
- Violacein-Induced Chaperone System Collapse Underlies Multistage Antiplasmodial Activity
Tavella, ACS infectious diseases 2021 - “...0. The four hits labeled are yeast strains heterozygous for YGR123C ( Sc Ppt1 protein), YGR187C ( Sc Hgh1 protein), YPL135W ( Sc Isu protein), and YJR018W (dubious ORF). 1.3 Violacein Binds Pf Hsp90, Pf Hsp70-1, Sc Hsp82, and Sc Ssa1 Molecular Chaperones Having shown that...”
- Extending bicluster analysis to annotate unclassified ORFs and predict novel functional modules using expression data
Bryan, BMC genomics 2008 - “...large (60S) GO ribosomal large subunit export from nucleus (IMP); Export of Mss4p lipid kinase YGR187C (HGH1) YDR188W (CCT6-Chaperonin Containing TCP-1) GO ribosome biogenesis & assembly (RCA) YIL064W GO ribosome biogenesis & assembly (RCA). S-adenosylmethionine-dependent methyltransferase YIL096C YLR009W (RLP24) 60S ribosomal subunit biogenesis GO ribosome biogenesis...”
- “...and Hughes expression datasets was a set of 19 ORFs: YBR271W, YCR016W, YDL063C, YDL167C, YDR361C, YGR187C, YIL064W, YIL096C, YIL110W, YIL127C, YJR003C, YLR051C, YLR196W, YLR287C, YOL022C, YOR021C, YOR154W, YOR252W, YPL183C. As we can see from Figure 4 this set is highly correlated across all three datasets. The...”
- Identification of coherent patterns in gene expression data using an efficient biclustering algorithm and parallel coordinate visualization
Cheng, BMC bioinformatics 2008 - “...YCL055W, YNL313C, YPL192C ribosome biogenesis and assembly 2.32E-05 2.18E-03 YBR267W, YCR072C, YDL031W, YDR184C, YDR465C, YGL099W, YGR187C, YMR128W, YOL010W, YOR001W 35S primary transcript processing 4.81E-04 4.52E-02 YDL031W, YGR090W, YOL010W, YOL021C, YOR001W 50 pseudohyphal growth 9.72E-04 4.57E-02 YBR083W, YJL164C, YKL185W, YOR127W N-terminal protein myristoylation 5.58E-04 2.62E-02 YIL009W, YOR317W...”
- Probabilistic protein function prediction from heterogeneous genome-wide data
Nariai, PloS one 2007 - “...[30] that YBL028C, YBR271W, YCR016W, YJR003C, YDL167C, YDR361C, YIL096C, YIL127C, YLR449W, YMR310C, YNL022C, YNL132W, YNL175C, YGR187C, YGR283C and YOR021C as rRNA and ribosome biosynthesis (RRB) regulon. It has also been reported [31] that YLR051C encodes a protein involved in pre-rRNA processing, confirming our prediction of ribosome...”
- The deletion of six ORFs of unknown function from Saccharomyces cerevisiae chromosome VII reveals two essential genes: YGR195w and YGR198w
Rodriguez-Peña, Yeast (Chichester, England) 1998 (PubMed)- “...Saccharomyces cerevisiae; chromosome VII; ribonuclease PH; HGH1; YGR187c; YGR189c; YGR194c; YGR195w; YGR196c; YGR198w INTRODUCTION Within the framework of the...”
- “...used in this study. Sequence* For ORF YGR187C L1 5 GAAGCTCTTCATACATCGAGT 3 L2 5 GGGGATCCGTCGACCTGCAGCGTAC CATCACTCAATTTTTTGTTGATT 3 L3 5...”
SPAC26F1.12c conserved eukaryotic protein from Schizosaccharomyces pombe
Aligns to 283:337 / 356 (15.4%), covers 100.0% of PF04064, 88.2 bits
SS1G_04205 hypothetical protein from Sclerotinia sclerotiorum 1980 UF-70
Aligns to 246:300 / 354 (15.5%), covers 100.0% of PF04064, 86.6 bits
Q9BTY7 Protein HGH1 homolog from Homo sapiens
Aligns to 292:346 / 390 (14.1%), covers 98.2% of PF04064, 73.2 bits
Or search for genetic data about PF04064 in the Fitness Browser
by Morgan Price,
Arkin group
Lawrence Berkeley National Laboratory