Family Search for PF04064 (DUF384)

PF04064 hits 4 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.

HGH1_YEAST / P48362 Protein HGH1; HMG1/2 protein homolog from Saccharomyces cerevisiae (strain ATCC 204508 / S288c) (Baker's yeast) (see paper)
NP_011703 Hgh1p from Saccharomyces cerevisiae S288C
YGR187C Hgh1p from Saccharomyces cerevisiae
Aligns to 306:360 / 394 (14.0%), covers 98.2% of PF04064, 89.8 bits

• Chaperone Function of Hgh1 in the Biogenesis of Eukaryotic Elongation Factor 2.
  Mönkemeyer, Molecular cell 2019 (PubMed)
  • GeneRIF: Hgh1 binding recruits TRiC to the C-terminal eEF2 module and prevents unproductive interactions of domain III, allowing efficient folding of the N-terminal GTPase module. eEF2 folding is completed upon dissociation of TRiC and Hgh1.
• The Co-chaperone Cns1 and the Recruiter Protein Hgh1 Link Hsp90 to Translation Elongation via Chaperoning Elongation Factor 2.
  Schopf, Molecular cell 2019 (PubMed)
  • GeneRIF: Chaperoning of eEF2 by Cns1 is essential for yeast viability and requires a defined subset of the Hsp90 machinery as well as the identified eEF2 recruiting factor Hgh1.
• Violacein-Induced Chaperone System Collapse Underlies Multistage Antiplasmodial Activity
  Tavella, ACS infectious diseases 2021
  • “...0. The four hits labeled are yeast strains heterozygous for YGR123C ( Sc Ppt1 protein), YGR187C ( Sc Hgh1 protein), YPL135W ( Sc Isu protein), and YJR018W (dubious ORF). 1.3 Violacein Binds Pf Hsp90, Pf Hsp70-1, Sc Hsp82, and Sc Ssa1 Molecular Chaperones Having shown that...”
• Extending bicluster analysis to annotate unclassified ORFs and predict novel functional modules using expression data
  Bryan, BMC genomics 2008
  • “...large (60S) GO ribosomal large subunit export from nucleus (IMP); Export of Mss4p lipid kinase YGR187C (HGH1) YDR188W (CCT6-Chaperonin Containing TCP-1) GO ribosome biogenesis & assembly (RCA) YIL064W GO ribosome biogenesis & assembly (RCA). S-adenosylmethionine-dependent methyltransferase YIL096C YLR009W (RLP24) 60S ribosomal subunit biogenesis GO ribosome biogenesis...”
  • “...and Hughes expression datasets was a set of 19 ORFs: YBR271W, YCR016W, YDL063C, YDL167C, YDR361C, YGR187C, YIL064W, YIL096C, YIL110W, YIL127C, YJR003C, YLR051C, YLR196W, YLR287C, YOL022C, YOR021C, YOR154W, YOR252W, YPL183C. As we can see from Figure 4 this set is highly correlated across all three datasets. The...”
• Identification of coherent patterns in gene expression data using an efficient biclustering algorithm and parallel coordinate visualization
  Cheng, BMC bioinformatics 2008
  • “...YCL055W, YNL313C, YPL192C ribosome biogenesis and assembly 2.32E-05 2.18E-03 YBR267W, YCR072C, YDL031W, YDR184C, YDR465C, YGL099W, YGR187C, YMR128W, YOL010W, YOR001W 35S primary transcript processing 4.81E-04 4.52E-02 YDL031W, YGR090W, YOL010W, YOL021C, YOR001W 50 pseudohyphal growth 9.72E-04 4.57E-02 YBR083W, YJL164C, YKL185W, YOR127W N-terminal protein myristoylation 5.58E-04 2.62E-02 YIL009W, YOR317W...”
• Probabilistic protein function prediction from heterogeneous genome-wide data
  Nariai, PloS one 2007
  • “...[30] that YBL028C, YBR271W, YCR016W, YJR003C, YDL167C, YDR361C, YIL096C, YIL127C, YLR449W, YMR310C, YNL022C, YNL132W, YNL175C, YGR187C, YGR283C and YOR021C as rRNA and ribosome biosynthesis (RRB) regulon. It has also been reported [31] that YLR051C encodes a protein involved in pre-rRNA processing, confirming our prediction of ribosome...”
• The deletion of six ORFs of unknown function from Saccharomyces cerevisiae chromosome VII reveals two essential genes: YGR195w and YGR198w
  Rodriguez-Peña, Yeast (Chichester, England) 1998 (PubMed)
  • “...Saccharomyces cerevisiae; chromosome VII; ribonuclease PH; HGH1; YGR187c; YGR189c; YGR194c; YGR195w; YGR196c; YGR198w INTRODUCTION Within the framework of the...”
  • “...used in this study. Sequence* For ORF YGR187C L1 5 GAAGCTCTTCATACATCGAGT 3 L2 5 GGGGATCCGTCGACCTGCAGCGTAC CATCACTCAATTTTTTGTTGATT 3 L3 5...”

SPAC26F1.12c conserved eukaryotic protein from Schizosaccharomyces pombe
Aligns to 283:337 / 356 (15.4%), covers 100.0% of PF04064, 88.2 bits

• The Mis6 inner kinetochore subcomplex maintains CENP-A nucleosomes against centromeric non-coding transcription during mitosis
  Hirai, Communications biology 2022
  • “...expressing the Cnp1-GFP gene under an adh21 promoter at the C locus (adjacent to the SPAC26F1.12c gene of chromosome I) were used (the original strain was a gift from Y. Watanabe) 61 . In Fig. 2c, d , GFP-Cnp1 was expressed under the endogenous promoter (a...”
• Duplication and Transformation of the Schizosaccharomyces pombe Collection of Deletion Strains
  Rai, Methods in molecular biology (Clifton, N.J.) 2018
  • “...Hob3 V2-30-G08 SPBC1703.12 ubp9 ubiquitin C-terminal hydrolase Ubp9 V2-32-A08 SPCC794.02 wtf5 wtf element Wtf5 V2-32-D07 SPAC26F1.12c hgh1 conserved eukaryotic protein Hgh1 V2-32-G10 SPCC4G3.04c coq5 C-methyltransferase (predicted)...”

SS1G_04205 hypothetical protein from Sclerotinia sclerotiorum 1980 UF-70
Aligns to 246:300 / 354 (15.5%), covers 100.0% of PF04064, 86.6 bits

• Secretome analysis reveals effector candidates associated with broad host range necrotrophy in the fungal plant pathogen Sclerotinia sclerotiorum
  Guyon, BMC genomics 2014
  • “...(8.1) Cluster186 2-1 SS1G_04200 BC1G_00245, SS1G_01334 Alpha-mannosidase family protein BOTY_LTR (2.2) Cluster187 2-1 SS1G_04207 BC1G_00240, SS1G_04205 Polygalacturonase BOTY_LTR (3.4) Cluster196 2-1 SS1G_05273 SS1G_11068, BC1G_09997 Amidase family protein BOTY_LTR (28.8) Cluster203 2-1 SS1G_03160 SS1G_00233, BC1G_07555 Autophagy related lipase BOTY_LTR (1.2) Cluster204 2-1 SS1G_08110, SS1G_12361 BC1G_12374 - 5SrRNA_AN...”

Q9BTY7 Protein HGH1 homolog from Homo sapiens
NP_057542 protein HGH1 homolog from Homo sapiens
Aligns to 292:346 / 390 (14.1%), covers 98.2% of PF04064, 73.2 bits

• A Proteomic Study Suggests Stress Granules as New Potential Actors in Radiation-Induced Bystander Effects
  Tudor, International journal of molecular sciences 2021
  • “...4.18 145 P04264 Keratin, type II Bystander 0.1 Gy Extracellular exosome 145 1.47 4.67 98 Q9BTY7 Protein HGH1 homolog Bystander 0.1 Gy unknown (interact with Peptidyl-prolyl cis-trans isomerase and Heat shock protein 90) 65 1.81 5.86 72 P06733 Alpha-enolase Bystander 0 Gy negative regulation of cell...”
• BAG3 Proteomic Signature under Proteostasis Stress.
  Hiebel, Cells 2020
  • “...protein 1 1.08 10 2 2.88 O75147 OBSL1 Obscurin-like protein 1 1.44 10 2 2.58 Q9BTY7 HGH1 Protein HGH1 homolog 8.53 10 3 2.57 P46782 RPS5 40S ribosomal protein S5 3.69 10 3 2.50 Q9H0S4 DDX47 Probable ATP-dependent RNA helicase DDX47 2.91 10 2 2.49 Q99615...”
• NSUN2/YBX1 promotes the progression of breast cancer by enhancing HGH1 mRNA stability through m5C methylation.
  Zhang, Breast cancer research : BCR 2024
  • GeneRIF: NSUN2/YBX1 promotes the progression of breast cancer by enhancing HGH1 mRNA stability through m[5]C methylation.

Or search for genetic data about PF04064 in the Fitness Browser