Family Search for PF04074 (DUF386)

PF04074 hits 27 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.

SO4189, SO_4189 conserved hypothetical protein (NCBI ptt file) from Shewanella oneidensis MR-1
Aligns to 1:152 / 153 (99.3%), covers 100.0% of PF04074, 161.0 bits

• Electrochemical selection and characterization of a high current-generating Shewanella oneidensis mutant with altered cell-surface morphology and biofilm-related gene expression
  Kouzuma, BMC microbiology 2014
  • “...transport and metabolism 1.55 SO_3534 murJ Peptidoglycan lipid II flippase General function prediction only 1.17 SO_4189 Hypothetical protein SO_4189 Carbohydrate transport and metabolism 1.04 SO_4233 leuD Isopropylmalate isomerase small subunit Amino acid transport and metabolism 1.69 SO_4596 Copper-transporting ATPase domain-containing protein 2.09 SO_4731 add Adenosine deaminase...”
• Exoprotein production correlates with morphotype changes of nonmotile Shewanella oneidensis mutants
  Shi, Journal of bacteriology 2013
  • “...(arcA) SO4179 (mxdB) SO4180 (mxdA) SO4181 SO4189 SO4488 SO4516 (viuA) Shikimate kinase Putrescine:ornithine antiporter FKBPe-type peptidyl-prolyl cis-trans...”

BT_0770 conserved hypothetical protein (NCBI ptt file) from Bacteroides thetaiotaomicron VPI-5482
Aligns to 1:147 / 148 (99.3%), covers 100.0% of PF04074, 160.7 bits

• A high-resolution transcriptome map identifies small RNA regulation of metabolism in the gut microbe Bacteroides thetaiotaomicron
  Ryan, Nature communications 2020
  • “...BT_1872 operon, which is activated by GibS, encodes a galactosidase and a periplasmic glucosidase, and BT_0770 - BT_0771 , that is repressed by GibS, encodes a glucan-branching enzyme. Together, this suggests a regulatory network, wherein sensing of a specific glycosaminoglycan-derived monosaccharide results in the induction of...”

YjgK / b4252 DUF386 domain-containing toxin-antitoxin biofilm protein TabA from Escherichia coli K-12 substr. MG1655 (see 3 papers)
TABA_ECOLI / P0AF96 Toxin-antitoxin biofilm protein TabA from Escherichia coli (strain K12) (see paper)
b4252 orf, hypothetical protein (VIMSS) from Escherichia coli str. K-12 substr. MG1655
S4500 hypothetical protein (NCBI ptt file) from Shigella flexneri 2a str. 2457T
Aligns to 1:148 / 150 (98.7%), covers 99.3% of PF04074, 152.1 bits

• function: Influences biofilm formation. Represses fimbria genes in 8 hours biofilms. May act in response to the combined activity of several toxin-antitoxin (TA) systems.
  disruption phenotype: Deletion increases biofilm formation after 8 hours and decreases biofilm formation after 24 hours.
• Toxin-antitoxin systems in Escherichia coli influence biofilm formation through YjgK (TabA) and fimbriae
  Kim, Journal of bacteriology 2009
  • “...h. From the whole genome, only one gene, yjgK (b4252), was induced (3.0-fold) by deleting the five TA systems; there were no repressed genes (other than those...”
• Detecting horizontally transferred and essential genes based on dinucleotide relative abundance
  Baran, DNA research : an international journal for rapid publication of reports on genes and genomes 2008
  • “...ending 4474 kb from sequence start, which overlaps (by >300 bp each) two genes, yjgK (b4252) and yjgL (b4253), which encode hypothetical proteins. Classified as a conserved protein in EcoCyc, yjgK has homologs in S . enterica ( E < 10 65 ) and proteobacteria outside...”
• Non-Resorbable Nanocomposite Membranes for Guided Bone Regeneration Based On Polysulfone-Quartz Fiber Grafted with Nano-TiO2.
  Nechifor, Nanomaterials (Basel, Switzerland) 2019
  • “...Germany). The morphology studies were done through SEM analysis equipped with EDX facilities (FESEM Hitachi S4500- Hitachi High-Technologies Europe GmbH, Krefeld, Germany). The thermal properties of the obtained composite membranes were analyzed using a Netzsch Thermal Analyzer (NETZSCH-Gertebau GmbH, Selb, Germany). Measurements for the samples placed...”
  • “...cm) were mounted on aluminum specimen support and introduced into the electron microscope systemFESEM Hitachi S4500 (Hitachi High-Technologies Europe GmbH, Krefeld, Germany). For high resolutions, the samples were covered with gold, but for combined SEMEDX analysis, this procedure was avoided. The electronic microscopy offers the possibility...”
• High-speed imaging of glutamate release with genetically encoded sensors
  Dürst, Nature protocols 2019
  • “...acid (Merck cat. no. G1251) L-Aspartic acid (Merck cat. no. A8949) L-Serine (Merck cat. no. S4500) Testing in cell lines HEK293T cells (Merck cat. no. 85120602) CAUTION : The cell lines used in your research should be regularly checked to ensure they are authentic and are...”
• Antimicrobial Activity of New Materials Based on Lavender and Basil Essential Oils and Hydroxyapatite.
  Predoi, Nanomaterials (Basel, Switzerland) 2018
  • “...of the newly developed materials was investigated by scanning electron microscopy (SEM), using a HITACHI S4500 microscope (Tokyo, Japan) equipped with an energy dispersive X-ray attachment (EDAX) (Tokyo, Japan). Dynamic Light Scattering (DLS) measurements were conducted using a SZ-100 Nanoparticle Analyzer (HORIBA, Ltd., Kyoto, Japan) at...”
• Quantitative Yeast Genetic Interaction Profiling of Bacterial Effector Proteins Uncovers a Role for the Human Retromer in Salmonella Infection
  Patrick, Cell systems 2018
  • “...Methionine Sigma M9625 Para-aminobenzoic acid Sigma A0254 Phenylalanine Sigma P2126 Proline Sigma P0380 Serine Sigma S4500 Threonine Sigma T8625 Tryptophan Sigma T0254 Tyrosine Sigma T3754 Uracil Sigma U0750 Valine Sigma V0500 Critical Commercial Assays Biotin CAPture Kit GE Healthcare product# 28920233 DirectZol RNA miniprep kit Zymo...”
• Afa/Dr diffusely adhering Escherichia coli strain C1845 induces neutrophil extracellular traps that kill bacteria and damage human enterocyte-like cells
  Marin-Esteban, Infection and immunity 2012
  • “...by field emission-gun scanning electron microscopy (FEGSEM; Hitachi S4500, Tokyo, Japan) with a microscope operated at 5 kV at the MIMA2 microscopy platform...”

B2G73_RS15490 YhcH/YjgK/YiaL family protein from Citrobacter werkmanii
Aligns to 1:148 / 150 (98.7%), covers 99.3% of PF04074, 148.9 bits

• Expression of a Shiga-Like Toxin during Plastic Colonization by Two Multidrug-Resistant Bacteria, Aeromonas hydrophila RIT668 and Citrobacter freundii RIT669, Isolated from Endangered Turtles (Clemmys guttata).
  Thomas, Microorganisms 2020
  • “...regulatory protein GGACTGAAGTTGGACAAA 51.5 CGCTGATACTCATTTACCT 50.3 B2G73_RS19460 hmsP biofilm formation regulator GTTAATACTCACGGTAGC 45.1 GGTAATGCCAGTTGATAG 48.5 B2G73_RS15490 tabA Toxin-antitoxin biofilm protein GTCGGCAATATTCACAAC 52.0 TCATATCTTCGGCAATCA 53.3 B2G73_RS09280 csgD transcriptional activator of curli operon GCGTTATTACAGCACTTA 47.1 TTATCTGCCTCCATCATAT 50.3 - viaB Virulence (Vi polysaccharide antigen) TGTCGAGCAGATGGATGAGCAT (VIAB-1) 65.4 ACGGCTGAAGGTTACGGACCGA (VIAB-2)...”

STY4806 conserved hypothetical protein (NCBI ptt file) from Salmonella enterica subsp. enterica serovar Typhi str. CT18
Aligns to 1:148 / 150 (98.7%), covers 99.3% of PF04074, 148.5 bits

• A Salmonella Typhimurium-Typhi genomic chimera: a model to study Vi polysaccharide capsule function in vivo
  Jansen, PLoS pathogens 2011
  • “...from the 5 end of the gltP gene to the intergenic region of STY4805 and STY4806, a total of 298 kb of the S. Typhi genome including the entire SPI-7 genomic island. This indicated that nearly 7% of the S. Typhi genome was present in the...”

SEET0819_06210 YhcH/YjgK/YiaL family protein from Salmonella enterica subsp. enterica serovar Tennessee str.
Aligns to 1:148 / 150 (98.7%), covers 99.3% of PF04074, 147.2 bits

• Whole Genome DNA Sequence Analysis of Salmonella subspecies enterica serotype Tennessee obtained from related peanut butter foodborne outbreaks
  Wilson, PloS one 2016
  • “...protein 1271868 CP007505 coding SEET0819_05995 351 GGA->GGG G->G S + inosose dehydratase 1315853 CP007505 coding SEET0819_06210 94 ACC->CCC T->P N + toxin-antitoxin biofilm protein TabA 1403676 CP007505 coding SEET0819_06580 1151 CCC->CAC P->H N + sigma-54 dependent transcriptional regulator 1583841 CP007505 coding SEET0819_07400 275 TAT->TTT Y->F N...”

SENTW_3768 YhcH/YjgK/YiaL family protein from Salmonella enterica subsp. enterica serovar Weltevreden str.
Aligns to 1:150 / 154 (97.4%), covers 100.0% of PF04074, 146.2 bits

• Transcriptional profile of Salmonella enterica subsp. enterica serovar Weltevreden during alfalfa sprout colonization
  Brankatschk, Microbial biotechnology 2014
  • “...6.12 Putative thiol peroxidase ybdL SENTW_0580 4.55 Putative aminotransferase yjgF SENTW_4564 7.03 Protein TdcF yiaL SENTW_3768 7.86 Protein YiaL ytfK SENTW_4510 8.24 Uncharacterized protein YtfK yhcN3 SENTW_3490 5.82 Protein YdgH ygaU SENTW_2883 5.51 Uncharacterized protein YgaU yggE SENTW_3181 6.70 Uncharacterized protein YggE yfeK SENTW_2617 5.38 Uncharacterized...”

NANQ_HAEIN / P44583 N-acetylneuraminate anomerase; N-acetylneuraminate openase from Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd) (see 2 papers)
1s4cB / P44583 Yhch protein (hi0227) copper complex (see paper)
HI0227 conserved hypothetical protein (NCBI ptt file) from Haemophilus influenzae Rd KW20
Aligns to 1:151 / 155 (97.4%), covers 100.0% of PF04074, 144.5 bits

• function: Opens both the alpha- and beta-forms of N-acetylneuraminate (sialic acid; Neu5Ac) to provide aceneuramate, the preferred substrate for NanA (Probable). Has preferential activity on the beta-anomer rather than the alpha-anomer. Accelerates a reaction that is spontaneous at slightly alkaline pH, facilitates the reaction at acidic pH (By similarity).
  catalytic activity: N-acetyl-alpha-neuraminate = aceneuramate (RHEA:67736)
  catalytic activity: N-acetyl-beta-neuraminate = aceneuramate (RHEA:67740)
  cofactor: Zn(2+) (Has been crystallized with Cu(2+) but reconstitutes with Zn(2+).)
• Ligand: copper (ii) ion (1s4cB)
• Identification and functional analysis of 'hypothetical' genes expressed in Haemophilus influenzae
  Kolker, Nucleic acids research 2004
  • “...on structure and genome context HI0227 HI0315 HI0442 HI0719 P44583 P44634 P44711 P44839 155 246 121 130 2731 0217 0718 0251 1jop 1kon, 1lfp 1j8b 1j7h nanRATEK...”
• A new model for non-typeable Haemophilus influenzae middle ear infection in the Junbo mutant mouse
  Hood, Disease models & mechanisms 2016
  • “...made by insertion of a kanamycin resistance cassette onto a position in the NTHi genome (HI0227) that had no characterized phenotype. These strains enabled antibiotic selection of NTHi during culture and counter-selection against any indigenous bacteria; this increased the number of ME providing quantitative data during...”
• Identification of biofilm proteins in non-typeable Haemophilus Influenzae
  Gallaher, BMC microbiology 2006
  • “...1573163 All 80 6 J RimM protein, required for 16S rRNA processing RimM N N HI0227 1573192 1 4 2731 S Uncharacterized BCR - y y HI0246 1573213 1 3 4 0 x No related COG - y y HI0719 1573721 all 251 J Putative translation...”
• Crystal structure of the bacterial YhcH protein indicates a role in sialic acid catabolism
  Teplyakov, Journal of bacteriology 2005
  • “...Inc., Radnor, Pa. Cloning, expression, and purification. The YhcH (HI0227) gene was cloned by PCR, using genomic H. influenzae DNA as a template, into the...”
  • “...to that of YhcH from H. influenzae (HI0227). Sequences are labeled with the gene tags in the GenBank database (http://www.ncbi.nlm.nih.gov/GenBank)....”
• Identification and functional analysis of 'hypothetical' genes expressed in Haemophilus influenzae
  Kolker, Nucleic acids research 2004
  • “...below), found to be appropriate. In one case (HI0227, a member of COG2731, annotated as beta subunit of beta-galactosidase'), the CDD/COG annotation could not...”
  • “...genes Functional predictions based on structure and genome context HI0227 HI0315 HI0442 HI0719 P44583 P44634 P44711 P44839 155 246 121 130 2731 0217 0718 0251...”
• Convergent pathways for utilization of the amino sugars N-acetylglucosamine, N-acetylmannosamine, and N-acetylneuraminic acid by Escherichia coli
  Plumbridge, Journal of bacteriology 1999
  • “...any proteins in GenBank except an ORF in H. influenzae (HI0227), two ORFs (YigK and YiaL) in E. coli, and an ORF (ORF-1) in Streptococcus pneumoniae. The HI0227...”

STY4129 conserved hypothetical protein (NCBI ptt file) from Salmonella enterica subsp. enterica serovar Typhi str. CT18
Aligns to 1:150 / 154 (97.4%), covers 100.0% of PF04074, 144.2 bits

• Crystal structure of the bacterial YhcH protein indicates a role in sialic acid catabolism
  Teplyakov, Journal of bacteriology 2005
  • “...range from 88% (between Salmonella enterica serovar Typhi STY4129 and Klebsiella oxytoca YiaL) to 18% (between S. enterica serovar Typhi STY4129 and Mycoplasma...”

PBPRA2282 conserved hypothetical protein (NCBI) from Photobacterium profundum SS9
Aligns to 1:159 / 163 (97.5%), covers 100.0% of PF04074, 142.3 bits

• Large-scale transposon mutagenesis of Photobacterium profundum SS9 reveals new genetic loci important for growth at low temperature and high pressure
  Lauro, Journal of bacteriology 2008
  • “...M S Tn5 Tn5 CS CS FL16 FL17 PBPRA2282 PBPRB2009 G G Tn5 Tn10 CS CS FL18 PBPRA0667 Conserved hypothetical protein Phosphotransferase cellobiosespecific component...”
  • “...cellobiose (PBPRB2009), and the conserved hypothetical protein PBPRA2282, which may participate in the metabolism of Nacetylneuraminic acid and its derivatives...”

YiaL / b3576 DUF386 domain-containing protein YiaL from Escherichia coli K-12 substr. MG1655 (see 2 papers)
b3576 hypothetical protein (NCBI) from Escherichia coli str. K-12 substr. MG1655
Aligns to 1:150 / 155 (96.8%), covers 100.0% of PF04074, 141.0 bits

• Evolutionary dynamics of small RNAs in 27 Escherichia coli and Shigella genomes
  Skippington, Genome biology and evolution 2012
  • “...ykgC b0304 omrA 21 Variable Incongruent No csgF b1038 omrA 23 Variable Incongruent No yiaL b3576 omrA 22 Variable Incongruent No ompA b0957 micA, rybB 27 Core Incongruent No gltI b0655 gcvB 26 Variable Incongruent Yes dppA b3544 gcvB 25 Variable Incongruent No argT b2310 gcvB...”
• Complete genome sequence and comparative genomics of Shigella flexneri serotype 2a strain 2457T
  Wei, Infection and immunity 2003
  • “...b2269 b2430 b2519 b2657 b2928 b3074 b3576 K-12 product Homoserine transsuccinylase isomerase Phospho--glucosidase B, cryptic oxygen-insensitive NAD(P)H...”

S3474 hypothetical protein (NCBI ptt file) from Shigella flexneri 2a str. 2457T
Aligns to 1:149 / 154 (96.8%), covers 100.0% of PF04074, 140.6 bits

• Regulation of the yjjQ-bglJ operon, encoding LuxR-type transcription factors, and the divergent yjjP gene by H-NS and LeuO
  Stratmann, Journal of bacteriology 2008
  • “...S541 S3010 S3346 S3108 S3322 S3375 S3469 S3470 S3472 S3474 S3476 S3478 S3480 S3482 S3484 S3486 S3488 S3494 S3496 S3587 S3588 S3590 S3592 S3594 S3596 S3598 S3600...”
  • “...hns::kanKD4 leuO::cat S3472 leuO::cat S3472 hns::kanKD4 S3474 leuO::cat S3474 hns::kanKD4 S3476 leuO::cat S3476 hns::kanKD4 S3478 leuO::cat S3478 hns::kanKD4...”

YhcH / b3221 DUF386 domain-containing protein YhcH from Escherichia coli K-12 substr. MG1655 (see 5 papers)
NANQ_ECOLI / P45424 N-acetylneuraminate anomerase NanQ; N-acetylneuraminate openase from Escherichia coli (strain K12) (see 2 papers)
nanQ / P45424 N-acetylneuraminate anomerase (EC 5.1.3.24) from Escherichia coli (strain K12) (see 3 papers)
yhcH / RF|NP_417688 uncharacterized protein yhcH from Escherichia coli K12 (see paper)
b3221 hypothetical protein (NCBI) from Escherichia coli str. K-12 substr. MG1655
Aligns to 1:149 / 154 (96.8%), covers 100.0% of PF04074, 139.4 bits

• function: Opens both the alpha- and beta-forms of N-acetylneuraminate (sialic acid; Neu5Ac) to provide aceneuramate, the preferred substrate for NanA. Has preferential activity on the beta-anomer rather than the alpha-anomer. Accelerates a reaction that is spontaneous at slightly alkaline pH, facilitates the reaction at acidic pH.
  catalytic activity: N-acetyl-alpha-neuraminate = aceneuramate (RHEA:67736)
  catalytic activity: N-acetyl-beta-neuraminate = aceneuramate (RHEA:67740)
  cofactor: Zn(2+) (The Zn(2+) ion may play a catalytic role.)
  disruption phenotype: No visible effect on growth on Neu5Ac at pH 7.0 and 37 degrees Celsius. Shows slight systematic growth delay at pH 6.0 and 20 degrees Celsius. No visible phenotype on glucose.
• Genome-wide localization of mobile elements: experimental, statistical and biological considerations
  Martinez-Vaz, BMC genomics 2005
  • “...yejO, b2191, yi52_8, ccmH 10. glcC, b2981, yi52_9, b2983, pitB 11. yhcD, yhcE, yi52_10, b3219, b3221, sspB, b3238 12. yhiS, yi52_11 , yhiF, tnaA We confirmed the presence of an IS5 element in the flhDC / yecG intergenic region by PCR. A 2720 bp PCR product...”
• DNA microarray analyses of the long-term adaptive response of Escherichia coli to acetate and propionate
  Polen, Applied and environmental microbiology 2003
  • “...1.02 b3218 yi52_10 1 IS5 transposase 0.61* 0.50* 1.04 b3221 b3222 yhcH nanK 1 1 ORF, hypothetical protein ManNAc kinase 0.27* 0.22* 0.47 0.29 0.86 0.78*...”

SpnNT_01747 YhcH/YjgK/YiaL family protein from Streptococcus pneumoniae
spr1535 Hypothetical protein (NCBI ptt file) from Streptococcus pneumoniae R6
SPD_1503 hypothetical protein (NCBI) from Streptococcus pneumoniae D39
Aligns to 1:148 / 150 (98.7%), covers 100.0% of PF04074, 139.4 bits

• Foreign peptide triggers boost in pneumococcal metabolism and growth
  Nasher, BMC microbiology 2018
  • “...phosphotransferase enzyme IIB component 6.6 0.04 SpnNT_01738 yesO_1 Putative ABC transporter for carbohydrate 6.3 0.001 SpnNT_01747 tabA Toxin-antitoxin biofilm protein TabA 6.2 0.001 SpnNT_01751 nanA_3 Sialidase 5.3 0.001 SpnNT_01537 CsbD-like protein, general stress response protein 4.6 0.001 SpnNT_01944 tRNA-Leu 4.5 0.005 SpnNT_00467 grpE HSP-70 cofactor, heat...”
• The pneumococcal response to oxidative stress includes a role for Rgg
  Bortoni, Microbiology (Reading, England) 2009
  • “...SPR1280 Hypothetical protein 6 0.0000002 SPR1313 Hypothetical protein 3 0.0001 SPR1348 Hypothetical protein 4 0.006 SPR1535 Conserved hypothetical protein 5 0.0007 SPR1537 Hypothetical protein 2 0.001 SPR1572 Hypothetical protein 3 0.0000003 SPR1623 Hypothetical protein 3 0.003 SP2004 Hypothetical protein 4 0.007 SPR1830 Hypothetical protein 3 0.0001...”
• Pneumococcal neuraminidases A and B both have essential roles during infection of the respiratory tract and sepsis
  Manco, Infection and immunity 2006
  • “...comparable. In addition, we measured the transcriptional expression of SPR1535 (the gene downstream of nanA) in both the wild type and in the nanA isogenic...”
  • “...no significant difference in the transcriptional level of SPR1535 in the nanA mutant strain compared to the parent wild-type strain (data not shown). Therefore,...”
• Neuraminidase B controls neuraminidase A-dependent mucus production and evasion
  Hammond, PLoS pathogens 2021
  • “...gnavus [ 36 ]. Once inside the cell, an oxidoreductase (SPD_1498) and a putative isomerase (SPD_1503), also encoded by nan II, covert 2,7-anhydo-Neu5Ac to Neu5Ac, again suggested by the role of a homologous oxidoreductase in R . gnavus [ 36 ]. The nan II operon, therefore,...”
• Deletion of the Zinc Transporter Lipoprotein AdcAII Causes Hyperencapsulation of Streptococcus pneumoniae Associated with Distinct Alleles of the Type I Restriction-Modification System
  Durmort, mBio 2020
  • “...3.29 1.25 SPD_1498 Oxidoreductase 2.21 2.23 1.34 SPD_1501 Sugar ABC transporter permease 3.73 3.58 1.42 SPD_1503 Hypothetical protein 3.25 4.03 1.09 SPD_1513 Hypothetical protein 1.77 2.68 1.40 SPD_1568 GTP cyclohydrolase 1.80 1.55 1.53 SPD_1584 ABC transporter permease 2.30 2.16 2.08 SPD_1650 fatC Iron uptake ABC transporter...”
• Sialic acid-mediated gene expression in Streptococcus pneumoniae and role of NanR as a transcriptional activator of the nan gene cluster
  Afzal, Applied and environmental microbiology 2015
  • “...assays. Chromosomal transcriptional lacZ fusions to the nanA, spd_1503, and nanE promoters were constructed in the integration plasmid pPP2 (30) via double...”
  • “...spd_1488), the nanA gene (spd_1504), and nan operon II (spd_1503 to spd_1498) (Fig. 1A). nanA encodes a sialidase that has been shown to cleave sialic 3124...”

c3975 Hypothetical protein yhcH (NCBI ptt file) from Escherichia coli CFT073
Aligns to 1:149 / 154 (96.8%), covers 100.0% of PF04074, 139.3 bits

• Analysis of promoter targets for Escherichia coli transcription elongation factor GreA in vivo and in vitro
  Stepanova, Journal of bacteriology 2007
  • “...b3098 1.5 2.3 Conserved protein yhcH nanK nanE nanA c3975 b3222 b3223 b3225 2.6 2.4 2.8 3.6 2.6 1.8 3.0 5.4 (CFT073) hypothetical protein Predicted...”

SP_1680 hypothetical protein (RefSeq) from Streptococcus pneumoniae TIGR4
Aligns to 1:148 / 150 (98.7%), covers 99.3% of PF04074, 129.8 bits

• Identification of 88 regulatory small RNAs in the TIGR4 strain of the human pathogen Streptococcus pneumoniae
  Acebo, RNA (New York, N.Y.) 2012
  • “...for interaction, and the translation start site of the SP_1680 mRNA in the TIGR4 genome (Fig. 6A). SP_1680 encodes a hypothetical protein that, upon BLAST...”
  • “...through an antisense mechanism would negatively affect SP_1680 translation. Interestingly, TargetRNA analysis of srn206 rendered several putative mRNA targets...”

SPD_1492 hypothetical protein (NCBI) from Streptococcus pneumoniae D39
Aligns to 1:148 / 150 (98.7%), covers 99.3% of PF04074, 128.7 bits

• Inactivation of Transcriptional Regulator FabT Influences Colony Phase Variation of Streptococcus pneumoniae
  Zhang, mBio 2021
  • “...family transporter 0.91 0.004 SPD_1277 Serine hydrolase 0.79 0.013 SPD_1490 YesL family protein 1.29 0.016 SPD_1492 yjgK Protein YjgK, linked to biofilm formation 1.71 0.003 SPD_1628 xpt Xanthine phosphoribosyltransferase 1.11 0.003 SPD_1629 pbuX Xanthine permease 1.13 0.001 SPD_2043 pcsB Secreted antigen GbpB/SagA/PcsB, putative peptidoglycan hydrolase 1.41...”
• N-acetylglucosamine-Mediated Expression of nagA and nagB in Streptococcus pneumoniae
  Afzal, Frontiers in cellular and infection microbiology 2016
  • “...component 2.3 spd_1246 glucosamine-6-phosphate isomerase, NagB 2.3 spd_0264 PTS system, mannose-specific IIAB components, ManL 2.1 spd_1492 Hypothetical protein 2.0 spd_1491 Hypothetical protein 2.0 spd_1100 Glucose-6-phosphate 1-dehydrogenase, Zwf 2.2 spd_0448 Glutamine synthetase, GlnA 3.3 spd_1099 Amino acid ABC transporter, ATP-binding protein 3.3 spd_0447 Transcriptional regulator, GlnR 3.7...”
• N-acetylgalatosamine-Mediated Regulation of the aga Operon by AgaR in Streptococcus pneumoniae
  Afzal, Frontiers in cellular and infection microbiology 2016
  • “...protein 11.4 spd_1489 N-acetylneuraminate lyase, NanA2 3.7 spd_1490 Hypothetical protein 3.5 spd_1491 Hypothetical protein 7.4 spd_1492 Hypothetical protein 3.9 spd_1493 Sugar ABC transporter, permease protein, NanW 4.8 spd_1494 Sugar ABC transporter, permease protein, NanV 2.5 spd_1495 Sugar ABC transporter, sugar-binding protein, NanU 6.4 spd_1496 PTS system,...”
• Sialic acid-mediated gene expression in Streptococcus pneumoniae and role of NanR as a transcriptional activator of the nan gene cluster
  Afzal, Applied and environmental microbiology 2015
  • “...to spd_1495), three hypothetical proteins (spd_1490 to spd_1492), an N-acetylneuraminate lyase (spd_1489), and a ROK family protein (NanK) (spd_1488). The...”
  • “...spd_1267 spd_1330 spd_1488 spd_1489 spd_1490 spd_1491 spd_1492 spd_1493 spd_1494 spd_1495 spd_1496 spd_1497 spd_1504 spd_1505 spd_1800 spd_2012 spd_2013...”

ESA_03609 hypothetical protein (RefSeq) from Enterobacter sakazakii ATCC BAA-894
ESA_03609 N-acetylneuraminate anomerase from Cronobacter sakazakii ATCC BAA-894
Aligns to 1:148 / 154 (96.1%), covers 99.3% of PF04074, 118.5 bits

• Sialic acid utilization by Cronobacter sakazakii
  Joseph, Microbial informatics and experimentation 2013
  • “...universalis 581 C. muytjensii 530 C. dublinensis 582 C. dublinensis 1210 C. condimenti 1330 yhcH ESA_03609 Putative sugar isomerase + + + + + - - - - - - - - - nanK ESA_03610 N-acetylmannosamine kinase + + + + + - - - -...”
• Comparative analysis of genome sequences covering the seven cronobacter species
  Joseph, PloS one 2012
  • “...to commensal bacteria in the intestinal tract and to pathogens [62] . In C. sakazakii ESA_03609 encodes a putative sugar isomerase (YhcH). Genes ESA_03610-13 encode the nanKTAR genes involved in the N-acetylneuraminate and N-acetylmannosamine degradation pathway. The nanK gene (ESA_03610) encodes N-acetylmannosamine kinase; nanT (ESA_03611) encodes...”

gbs0036 Unknown (NCBI ptt file) from Streptococcus agalactiae NEM316
SAG0037 conserved hypothetical protein (NCBI ptt file) from Streptococcus agalactiae 2603V/R
Aligns to 1:145 / 147 (98.6%), covers 99.3% of PF04074, 115.7 bits

• Computational bacterial genome-wide analysis of phylogenetic profiles reveals potential virulence genes of Streptococcus agalactiae
  Lin, PloS one 2011
  • “...rank(s) Have orthologs in other genomes with annotations; Contains Pfam Motifs (E-value) Predicted function C0036 GBS0036 spb1 DUF386 ( ) C0255 GBS0253 fbsA quinone-reactive Ni/Fe hydrogenase, cytochrome b subunit C0257 GBS0255 cyl lipoprotein C0348 GBS0344 fbsA intercellular adhesion protein C ? adhesin C0429 GBS0488 cfb superfamily...”
• Maltose uptake by the novel ABC transport system MusEFGK2I causes increased expression of ptsG in Corynebacterium glutamicum
  Henrich, Journal of bacteriology 2013
  • “...2603, the ORF sag0038 is separated by one ORF (sag0037), encoding a further hypothetical protein, from the ORFs sag0034, sag0035, and sag0036, which encode the...”

RUMGNA_02700 hypothetical protein (RefSeq) from Ruminococcus gnavus ATCC 29149
RUMGNA_02700 YhcH/YjgK/YiaL family protein from [Ruminococcus] gnavus ATCC 29149
Aligns to 1:148 / 149 (99.3%), covers 100.0% of PF04074, 115.4 bits

• Elucidation of a sialic acid metabolism pathway in mucus-foraging Ruminococcus gnavus unravels mechanisms of bacterial adaptation to the gut
  Bell, Nature microbiology 2019
  • “...Supplementary Table 1 ). In contrast, RUMGNA_02701 with homology to sialic acid esterase proteins and RUMGNA_02700 with homology to the YhcH protein family did not cluster with proteins from the same set of bacteria ( Supplementary Figure 1 and Supplementary Table 1 ). The candidate genes...”
  • “...Diagram depicting the genomic organisation of the nan operon RUMGNA_02701 (putative sialic acid esterase; tan) RUMGNA_02700 (putative YhcH family protein; dark blue), RUMGNA_02699 (predicted transcriptional regulator; purple), RUMGNA_02698 02696 (putative sialic acid ABC transporter of the SAT2 family; green), RUMGNA_02695 (putative oxidoreductase, pink), RUMGNA_02694 (RgNanH (Intramolecular...”
• Utilisation of mucin glycans by the human gut symbiont Ruminococcus gnavus is strain-dependent
  Crost, PloS one 2013
  • “...The first gene of the cluster encodes a protein of unknown function. The second gene (RUMGNA_02700) encodes a putative sugar isomerase involved in sialic acid catabolism. The following one (RUMGNA_02699) encodes a protein with homology with transcriptional regulators of the AraC family. The following 3 genes...”

BN865_07130 YhcH/YjgK/YiaL family protein from Campylobacter coli 76339
Aligns to 1:161 / 162 (99.4%), covers 98.6% of PF04074, 100.0 bits

• Comparative genomics of unintrogressed Campylobacter coli clades 2 and 3
  Skarp-de, BMC genomics 2014
  • “...BN865_07110 NAD-dependent epimerase/dehydratase C1a C1b; C1c; C2 BN865_07120 Putative cyclase superfamily C1a C1b; C1c; C2 BN865_07130 Conserved hypothetical protein 22 C1a C1b; C1c; C2 BN865_07140 Hydrolase, haloacid dehalogenase-like family C1a C1b; C1c; C2 BN865_07150 CMP-N-acetylneuraminate-beta-galactosamide- alpha-2,3-sialyltransferase (EC 2.4.99.-) C1a C1b; C1c; C2 BN865_07160 FIG 00470714: hypothetical...”

c0758 Hypthetical protein (NCBI ptt file) from Escherichia coli CFT073
Aligns to 1:150 / 156 (96.2%), covers 100.0% of PF04074, 97.1 bits

• Defining genomic islands and uropathogen-specific genes in uropathogenic Escherichia coli
  Lloyd, Journal of bacteriology 2007
  • “...c0287 c0294 c0295 c0296 c0297 c0375 c0638 c0646 ybdO c0758 c0761 c0763 c0765 c0807 modD c1650 fecD c1761 c1762 c1766 c1810 c1811 c1812 c1813 c2418 c2419 c2420...”

VP2404 evolved beta-D-galactosidase, beta subunit; cryptic gene (NCBI ptt file) from Vibrio parahaemolyticus RIMD 2210633
Aligns to 1:141 / 150 (94.0%), covers 99.3% of PF04074, 90.8 bits

• Insights into Vibrio parahaemolyticus CHN25 response to artificial gastric fluid stress by transcriptomic analysis
  Sun, International journal of molecular sciences 2014
  • “...Chn25_0834 2.4836 Phosphoglucomutase VP2403 ( ebgA ) Chn25_2266 2.4115 Cryptic beta- d -galactosidase subunit alpha VP2404 ( ebgC ) Chn25_2267 2.9965 Cryptic beta- d -galactosidase subunit beta VP2397 ( galM ) Chn25_2261 2.1978 Aldose 1-epimerase VP2855 ( pfkA ) Chn25_2776 0.3195 6-phosphofructokinase Ribosome biosynthesis VP2772 Chn25_2698...”

EbgC / b3077 DUF386 domain-containing evolved β-D-galactosidase subunit β from Escherichia coli K-12 substr. MG1655 (see paper)
EBGC_ECOLI / P0AC73 Evolved beta-galactosidase subunit beta from Escherichia coli (strain K12) (see paper)
b3077 cryptic beta-D-galactosidase, beta subunit (NCBI) from Escherichia coli str. K-12 substr. MG1655
Aligns to 1:140 / 149 (94.0%), covers 99.3% of PF04074, 87.4 bits

• function: Required for full activity of the EbgA enzyme. Exact function not known
  subunit: Heterooctamer of 4 alpha and 4 beta subunits.
• Characterization and potential mechanisms of highly antibiotic tolerant VBNC Escherichia coli induced by low level chlorination
  Ye, Scientific reports 2020
  • “...substrate unidentified; autokinase rpos 61 , 62 b1188 ycgB SpoVR family stationary phase protein rpos b3077 ebgC volved beta-D-galactosidase, beta subunit; cupin superfamily regulator 63 b2774 ygcW putative SDR family oxidoreductase regulator 64 b0375 yaiV putative transcriptional regulator regulator 65 b0573 cusF periplasmic copper- and silver-binding...”
• DNA microarray analyses of the long-term adaptive response of Escherichia coli to acetate and propionate
  Polen, Applied and environmental microbiology 2003
  • “...sensor receptor, flavoprotein 1.65* 2.08* 0.99 b3076 b3077 ebgA ebgC 2 2 Evolved -D-galactosidase, alpha subunit Evolved -D-galactosidase, beta subunit 0.39*...”

HP1029 hypothetical protein (NCBI ptt file) from Helicobacter pylori 26695
O25673 Flagellar motor switch protein from Helicobacter pylori (strain ATCC 700392 / 26695)
Aligns to 1:170 / 178 (95.5%), covers 89.2% of PF04074, 73.5 bits

• The Role of a Dipeptide Transporter in the Virulence of Human Pathogen, Helicobacter pylori
  Xu, Frontiers in microbiology 2021
  • “...1.1905 HP0960 glyQ 1.6042 HP0961 gpsA 3.3854 HP0983 Predicted gene 1.2053 HP1023 Predicted gene 1.1999 HP1029 Predicted gene 1.2139 HP1036 folK 1.5392 HP1037 Predicted gene 1.2796 HP1038 aroQ 1.0187 HP1055 Predicted gene 1.3617 HP1077 nixA 1.3528 HP1098 Predicted gene 1.0557 HP1114 uvrB 1.6187 HP1162 Predicted gene...”
• The crystal structure of Helicobacter pylori HP1029 highlights the functional diversity of the sialic acid-related DUF386 family
  Vallese, The FEBS journal 2015 (PubMed)
  • “...HP1029 highlights the functional diversity of the sialic acid-related DUF386 family Francesca Vallese1, Riccardo Percudani2, Wolfgang Fischer3 and Giuseppe Zanotti1 1 Department of Biomedical Sciences,...”
  • “...We present here the crystal structure of protein HP1029 from Helicobacter pylori. The protein is a homodimer, in which each monomer comprises a molecular...”
• The HP0256 gene product is involved in motility and cell envelope architecture of Helicobacter pylori
  Douillard, BMC microbiology 2010
  • “...1.271 0.214 HP0908 flagellar hook ( flgE ) 1.175 0.119 HP1028 hypothetical protein 0.852 0.286 HP1029 hypothetical protein 0.799 0.019 HP1030 fliY protein ( fliY ) 0.860** 0.308 HP1031 flagellar motor switch protein ( fliM ) 0.835 0.054 HP1032 alternative transcription initiation factor, sigma28 ( fliA...”
• Effect of FliK mutation on the transcriptional activity of the {sigma}54 sigma factor RpoN in Helicobacter pylori
  Douillard, Microbiology (Reading, England) 2009
  • “...0.909 0.40 HP0908 Flagellar hook ( flgE ) 0.802 0.06 HP1028 Hypothetical protein 1.271 0.17 HP1029 Hypothetical protein 1.035 0.57 HP1030 FliY protein ( fliY ) 1.094 0.54 HP1031 Flagellar motor switch protein ( fliM ) 1.018 0.82 HP1032 Alternative transcription initiation factor, sigma 28 (...”
• The Gaggle: an open-source software system for integrating bioinformatics software and data sources
  Shannon, BMC bioinformatics 2006
  • “...pathogenesis protein [ 33 ]. Another set of interesting unknown function proteins were HP1028 and HP1029 connected via gene cluster (operon) edges to FliY and FliM key flagellar switch proteins. Also present in this operon is an alternate sigma factor ( 28 ) gene fliA which...”
• Acid-adaptive genes of Helicobacter pylori
  Wen, Infection and immunity 2003
  • “...HP0270 HP0369 HP0582 HP0603 HP0838 HP0863 HP0864 HP1029 HP1106 HP1124 HP1217 HP1334 HP1377 HP1502 HP1546 Downloaded from http://iai.asm.org/ on February 11,...”
• Outer Membrane Vesicles Secreted by Helicobacter pylori Transmitting Gastric Pathogenic Virulence Factors
  Wei, ACS omega 2022
  • “...O25229 HP_0485 266 O25781 pgi 267 O25564 HP_0906 268 P56039 rplN 269 P56084 atpC 270 O25673 HP_1029 271 O24949 HP_0137 272 O25452 HP_0757 273 O25553 HP_0893 274 O24865 HP_0020 275 O26035 RibG 276 O25949 HP_1399 277 O25255 HP_0518 278 O26083 CeuE 279 O25213 HP_0466 280 O25253...”
  • “...O25348 HydA 347 P56191 ddl 348 P56153 ppa 349 O25413 HP_0709 350 O25714 MsbA 351 O25673 HP_1029 352 O25991 mnmE 353 P66572 rpsE 354 P55834 rplL 355 P56000 valS 356 P55992 gyrB 357 P56040 rplO 358 O25945 Omp30 359 O25535 HP_0864 360 O25008 iscS 361 P55976...”

4tsdB / O25673 Crystal structure of helicobacter pylori hp1029 (see paper)
Aligns to 1:169 / 181 (93.4%), covers 86.5% of PF04074, 73.2 bits

• Ligand: zinc ion (4tsdB)

jhp0395 putative (NCBI ptt file) from Helicobacter pylori J99
Aligns to 13:170 / 178 (88.8%), covers 78.4% of PF04074, 70.7 bits

• Genome sequence analysis of Helicobacter pylori strains associated with gastric ulceration and gastric cancer
  McClain, BMC genomics 2009
  • “...24 jhp0080 HP0087 d Hypothetical 89 96 8 jhp0173 HP0185 d Hypothetical 88 93 7 jhp0395 HP1029 d Hypothetical 88 95 7 a The sequences of the indicated gene products in strain J99 were compared with corresponding sequences in each of the other 4 strains (26695,...”

Or search for genetic data about PF04074 in the Fitness Browser