Family Search for PF04317 (DUF463)

Running HMMer for PF04317

PF04317 hits 13 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.

NJ56_RS14745 YcjX family protein from Yersinia ruckeri
Aligns to 20:464 / 465 (95.7%), covers 100.0% of PF04317, 622.7 bits

• Comparative genome analysis reveals important genetic differences among serotype O1 and serotype O2 strains of Y. ruckeri and provides insights into host adaptation and virulence
  Cascales, MicrobiologyOpen 2017
  • “...NJ56_RS14755 Transcriptional regulatory protein BI323_16540 UGYR_RS04015 CSF007_RS14590 NJ56_RS14750 Sensor histidine kinase DpiB BI323_16545 UGYR_RS04010 CSF007_RS14595 NJ56_RS14745 [citrate (Pro3S)lyase] ligase BI323_16550 UGYR_RS04005 CSF007_RS14600 NJ56_RS14740 Citrate lyase acyl carrier protein BI323_16555 UGYR_RS04000 CSF007_RS14605 NJ56_RS14735 Citrate lyase subunit beta BI323_16560 UGYR_RS03995 CSF007_RS14610 NJ56_RS14730 Citrate lyase alpha chain BI323_16565 UGYR_RS03990...”

VF_A0314 hypothetical protein from Vibrio fischeri ES114
Aligns to 20:464 / 465 (95.7%), covers 100.0% of PF04317, 622.4 bits

• Alternative Oxidase Activity Reduces Stress in Vibrio fischeri Cells Exposed to Nitric Oxide
  Dunn, Journal of bacteriology 2018
  • “...annotated as encoding hypothetical proteins (VF_A0006 and VF_A0314), and five mapped to ORFs annotated as encoding stress-related proteins (VF_1685, VF_A0005,...”
  • “...VF_1685 VF_1735 VF_A0005 VF_A0006 VF_A0311 VF_A0312 VF_A0313 VF_A0314 VF_A0364 Annotation recR; recombination protein RecR acpP; acyl carrier protein msrAB;...”

plu2582 No description from Photorhabdus luminescens subsp. laumondii TTO1
Aligns to 20:464 / 465 (95.7%), covers 99.8% of PF04317, 614.9 bits

• Proteomic Investigation of Photorhabdus Bacteria for Nematode-Host Specificity
  Kumar, Indian journal of microbiology 2016
  • “...in our study were five novel hypothetical proteins, Plu2059, Plu2582, Plu4585, Plu2060, and Plu1085. It has been found in more than one case that a single gene...”

STM1685 putative ATPase from Salmonella typhimurium LT2
Aligns to 22:466 / 467 (95.3%), covers 100.0% of PF04317, 608.5 bits

• Global transcriptional analysis of dehydrated Salmonella enterica serovar Typhimurium
  Gruzdev, Applied and environmental microbiology 2012
  • “...prpD (STM0370) phoL (STM0669) yceD (STM1190) ycjX (STM1685) sixA (STM2387) iscA (STM2541) yggN (STM3107) exbB (STM3159) pckA (STM3500) slsA (STM3761) aceK...”
• Genome-wide analysis of the PreA/PreB (QseB/QseC) regulon of Salmonella enterica serovar Typhimurium
  Merighi, BMC microbiology 2009
  • “...(26.0) 1.2 STM3175 putative bacterial regulatory helix-turn-helix proteins, AraC family 3.6 (12.1) 4.4 (21.1) 605.3 STM1685 ycjX putative ATPase 2.3 (4.9) 3.8 (13.9) 37.7 STM1252 putative cytoplasmic protein 1.5 (2.8) 2.8 (7.0) 8.6 STM3179 mdaB NADPH specific quinone oxidoreductase (drug modulator) 1.0 (2.0) 2.8 (7.0) 32.5...”

DR76_3474 YcjX family protein from Escherichia coli ATCC 25922
Aligns to 20:464 / 465 (95.7%), covers 100.0% of PF04317, 606.4 bits

• Development of Resistance in Escherichia coli ATCC25922 under Exposure of Sub-Inhibitory Concentration of Olaquindox
  Gu, Antibiotics (Basel, Switzerland) 2020
  • “...formate C-acetyltransferase 3.63 2.89 zraS two-component system, NtrC family, sensor histidine kinase HydH 2.60 2.05 DR76_3474 uncharacterized protein 2.37 2.02 Down-Regulated Genes 1 DNA Binding and Repair pgaA DNA binding; negative regulation of DNA-templated transcription, termination 0 0 rusA crossover junction endodeoxy ribonuclease RusA 0 0.0066...”

SG1431 putative ATP-binding protein from Salmonella enterica subsp. enterica serovar Gallinarum str. 287/91
Aligns to 22:466 / 467 (95.3%), covers 100.0% of PF04317, 604.9 bits

• Regulation of high-affinity iron acquisition homologues in the tsetse fly symbiont Sodalis glossinidius
  Runyen-Janecky, Journal of bacteriology 2010
  • “...to SG0282 Y SG0861 SG1151 SG1275 SG1381 Y Y Y Y SG1431 to SG1436 Y SG1505 Y SG1516 to SG1519 Y SG1526 Y SG1538 to SG1540 Y SG1674 SG1998 SG2280 SG2322 SGP1_0035...”

YcjX / b1321 DUF463 domain-containing protein YcjX from Escherichia coli K-12 substr. MG1655 (see 2 papers)
b1321 conserved protein with nucleoside triphosphate hydrolase domain from Escherichia coli str. K-12 substr. MG1655
Aligns to 20:464 / 465 (95.7%), covers 100.0% of PF04317, 604.3 bits

• Whole-genome sequencing analysis of two heat-evolved Escherichia coli strains
  McGuire, BMC genomics 2023
  • “...b Gene product(s) Mutation(s) c G predicted by DDGun [ 40 ] (kcal/mol) d ycjX b1321 DUF463 domain-containing protein YcjX R278C -0.8 topA * b1274 DNA topoisomerase 1 Silent codon 666 n/a < -hslV- / < -ftsN- b3932 / b3933 peptidase component of the HslVU protease...”
• 18th Congress of the European Hematology Association, Stockholm, Sweden, June 13–16, 2013
  , Haematologica 2013
• Differential gene expression for investigation of Escherichia coli biofilm inhibition by plant extract ursolic acid
  Ren, Applied and environmental microbiology 2005
  • “...and unknown functions cirA entE fxsA mlc osmE prlC b1194 b1321 b1566 b1760 yadN b2674 ybeD ycjF yeiE yhdM yhjH yjjS yrfG b2155 b0594 b4140 b1594 b1739 b3498...”
• Interfering with different steps of protein synthesis explored by transcriptional profiling of Escherichia coli K-12
  Sabina, Journal of bacteriology 2003
  • “...ybgG rpsR priB sgaB ycjT rplI elaC hyfH yjfJ yraJ b1321 b3681 b1068 b1058 b4060 b1630 b3107 b3062 b2578 b1325 b0572 b3583 b3476 b4200 b0040 b2003 b2460 b0732...”
• Combined, functional genomic-biochemical approach to intermediary metabolism: interaction of acivicin, a glutamine amidotransferase inhibitor, with Escherichia coli K-12
  Smulski, Journal of bacteriology 2001
  • “...b1145 b1168 b1178 b1195 b1205 b1256 b1257 b1273 b1285 b1321 b1333 b1376 b1378 b1414 b1446 b1454 b1586 b1598 b1667 b1678 b1725 b1778 b1783 b1816 b1869 b1870...”
• Genome-wide expression profiling in Escherichia coli K-12
  Richmond, Nucleic acids research 1999
  • “...nd b1060b 6.3 9.7 hslE 260 60 nd nd nd hslF 260 51 b1321 3.9c 52.6 hslG 260 41 b1322d 6.7 39.4 hslH 260 39 b1322d 6.7 39.4 hslI 265 36 ldhA 3.4c 36.5 hslJ 265...”

HI1637 conserved hypothetical protein from Haemophilus influenzae Rd KW20
P44280 Ras-like GTPase HI_1637 from Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Aligns to 21:469 / 470 (95.5%), covers 100.0% of PF04317, 594.7 bits

• Functional annotation of conserved hypothetical proteins from Haemophilus influenzae Rd KW20
  Shahbaaz, PloS one 2013
  • “...HI1629 950844 P45280 SNARE associated Golgi protein 275. HP HI1632 950850 Q57525 Aspartokinase 276. HP HI1637 950851 P44280 P-loop containing nucleoside triphosphate hydrolases 277. HP HI1650 950489 P44281 DEAD/DEAH box helicase/type I restriction endonuclease subunit R 278. HP HI1651 950855 P44282 Signal transduction histidine kinase 279....”
• Genetic characterization of the capsulation locus of Haemophilus influenzae serotype e
  Giufrè, Journal of clinical microbiology 2010
  • “...same flanking genes (sodC at the 5 end and HI1637 at the 3 end), confirming previous investigations (19). Sequence analysis of the two end junctions also...”
  • “...hcsAfrw hcsBrev hcsBfrw HI1637 CATGCGCATTTTCCACGCCAGC TAGCGATTCAAGGGAGGGT ACGCCCATAACGAGAGACT TCGCAGGTAAGACACCAGAG AAAGACACCTCGTGGGTCA GCTTTACTGTATAAGTCTAG...”
• Genetic analysis of the capsule locus of Haemophilus influenzae serotype f
  Satola, Infection and immunity 2003
  • “...Fcs2-3-b capfSodC capfBexA capfMerT SodC 3970-2951 capf region III HI1637 Sequence (5-3) 7204 NOTES INFECT. IMMUN. tical (89 to 94% identity) to the region I...”
  • “...influenzae Rd (GenBank accession no. NC_000907): merT, sapA, HI1048, HI1637, and an incomplete copy of dmsA. An additional gene, sodC, not found in the Rd...”
• Functional annotation of conserved hypothetical proteins from Haemophilus influenzae Rd KW20
  Shahbaaz, PloS one 2013
  • “...P45280 SNARE associated Golgi protein 275. HP HI1632 950850 Q57525 Aspartokinase 276. HP HI1637 950851 P44280 P-loop containing nucleoside triphosphate hydrolases 277. HP HI1650 950489 P44281 DEAD/DEAH box helicase/type I restriction endonuclease subunit R 278. HP HI1651 950855 P44282 Signal transduction histidine kinase 279. HP HI1654...”

Q7CZF4 Amino acid regulated cytosolic protein from Agrobacterium fabrum (strain C58 / ATCC 33970)
Atu1357 hypothetical protein from Agrobacterium tumefaciens str. C58 (Cereon)
Aligns to 31:491 / 492 (93.7%), covers 100.0% of PF04317, 585.1 bits

• Agrobacterium tumefaciens Type IV and Type VI Secretion Systems Reside in Detergent-Resistant Membranes
  Czolkoss, Frontiers in microbiology 2021
  • “...proton pump PlsX atu1178 Q8UG63 Phosphate acyltransferase (Acyl-ACP phosphotransacylase) MrcA atu1341 A9CJ77 DD-transpeptidase Atu1357 atu1357 Q7CZF4 Unknown FixG atu1530 A9CIY9 Nitrogen fixation protein FixG Nah atu1574 A9CIX0 Salicylate hydroxylase KefB atu1693 A9CIR7 Glutathione-regulated potassium-efflux system protein Atu2279 atu2279 A9CI32 ABC transporter, nucleotide binding/ATPase protein Atu2284 atu2284...”
• Agrobacterium tumefaciens Type IV and Type VI Secretion Systems Reside in Detergent-Resistant Membranes
  Czolkoss, Frontiers in microbiology 2021
  • “...K(+)-insensitive pyrophosphate-energized proton pump PlsX atu1178 Q8UG63 Phosphate acyltransferase (Acyl-ACP phosphotransacylase) MrcA atu1341 A9CJ77 DD-transpeptidase Atu1357 atu1357 Q7CZF4 Unknown FixG atu1530 A9CIY9 Nitrogen fixation protein FixG Nah atu1574 A9CIX0 Salicylate hydroxylase KefB atu1693 A9CIR7 Glutathione-regulated potassium-efflux system protein Atu2279 atu2279 A9CI32 ABC transporter, nucleotide binding/ATPase protein...”

SMc00467 CONSERVED HYPOTHETICAL PROTEIN from Sinorhizobium meliloti 1021
Aligns to 31:498 / 499 (93.8%), covers 100.0% of PF04317, 579.4 bits

• Dual RpoH sigma factors and transcriptional plasticity in a symbiotic bacterium
  Barnett, Journal of bacteriology 2012
  • “...SMb20708 SMb20707 SMb22023 SMb21566 SMc00109 SMc00117 SMc00467 SMc00466 SMc01142 SMc01224 SMc01256 SMc01441 SMc01440 SMc01465 SMc01905 SMc02110 SMc02109...”

YCJX_SHEON / Q8EG04 Ras-like GTPase YcjX; Stress protein YcjX; EC 3.6.5.2 from Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1) (see paper)
SO1810 hypothetical ATPase from Shewanella oneidensis MR-1
Aligns to 27:484 / 485 (94.4%), covers 100.0% of PF04317, 577.9 bits

• function: Binds GTP and GDP. Has intrinsic GTPase activity. Does not hydrolyze ATP. May act as a transducer of stress responses.
  catalytic activity: GTP + H2O = GDP + H(+) + phosphate (RHEA:19669)
  cofactor: Mg(2+)
  subunit: Monomer in solution.
• Crystal Structure of the YcjX Stress Protein Reveals a Ras-Like GTP-Binding Protein
  Tsai, Journal of molecular biology 2019
  • “...signaling, which is subject to further investigation. MATERIALS AND METHODS Cloning. The ORF of ycjX (SO1810) was PCR amplified from Shewanella oneidensis strain MR-1 genomic DNA (American Type Culture Collection). YcjX was cloned into a modified pPROEX Htb vector harboring a TEV protease cleavable, N-terminal His...”

6nz4A / Q8EG04 Ycjx-gdp (type i) (see paper)
Aligns to 9:466 / 467 (98.1%), covers 100.0% of PF04317, 574.2 bits

• Ligand: guanosine-5'-diphosphate (6nz4A)

RSP_0570 hypothetical protein from Rhodobacter sphaeroides 2.4.1
Aligns to 35:476 / 476 (92.9%), covers 100.0% of PF04317, 555.1 bits

• Convergence of the transcriptional responses to heat shock and singlet oxygen stresses
  Dufour, PLoS genetics 2012
  • “...RSP_1174, RSP_2710, RSP_2806 Other RSP_1825 Protein folding and stabilization RSP_1207 Ribosomal proteins: synthesis and modification RSP_0570 Serine family RSP_2481 Fatty acid and cell envelope Biosynthesis RSP_0473 Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides RSP_2569 Other RSP_3601 DNA metabolism DNA replication, recombination, and repair RSP_2388, RSP_2966...”

Or search for genetic data about PF04317 in the Fitness Browser