Family Search for PF04338 (DUF481)
PF04338.12 hits 18 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.
XAC0623 conserved hypothetical protein (NCBI ptt file) from Xanthomonas axonopodis pv. citri str. 306
Aligns to 46:265 / 266 (82.7%), covers 99.5% of PF04338, 194.6 bits
XC_0650 hypothetical protein (NCBI) from Xanthomonas campestris pv. campestris str. 8004
XCC3510 conserved hypothetical protein (NCBI ptt file) from Xanthomonas campestris pv. campestris str. ATCC 33913
Aligns to 46:265 / 266 (82.7%), covers 99.5% of PF04338, 193.5 bits
- Identification of c-di-GMP Signaling Components in Xanthomonas oryzae and Their Orthologs in Xanthomonads Involved in Regulation of Bacterial Virulence Expression
Yang, Frontiers in microbiology 2019 - “...DNA replication. Among them, the elongation factor P (XC_2359) and a putative outer membrane protein (XC_0650), both widely conserved in bacteria, were characterized as the novel virulence factors regulated by the RpfC/RpfG/RpfF system at post-transcriptional but not transcriptional level (O'Connell et al., 2013 ). RpfG was...”
- A MLVA genotyping scheme for global surveillance of the citrus pathogen Xanthomonas citri pv. citri suggests a worldwide geographical expansion of a single genetic lineage
Pruvost, PloS one 2014 - “...+ hypothetical protein 5 VIC-TGATCGAAGCACCGAGCAGT 3 5 GCAACCGGGCAGACCGTTGT 3 66.0 0.2 8 23 2 (0.116) Xcc3510 24 + aminopeptidase N 5 NED-ACCGCTCTACCGAATACGTCA 3 5 ATCGGCATTGTCCATCAACGTC 3 66.0 0.2 8 13 3 (0.031) Xcc3522 10 NA 5 NED-CCCAGCCACCGAACAGATCCG 3 5 AAATCCCTATCGCGCCCAGGT 3 64.0 0.2 1 25 3...”
- “...from 0.015 to 0.843 ( Table 1 ). Nine TR loci (Xcc1014, Xcc1662, Xcc2229, Xcc3088, Xcc3510, Xcc4071, Xcc4279, Xcc4927 and Xcc4946) had very low levels of polymorphism and differentiated a single isolate or haplotype ( Table 1 ). Strains sharing an identical MLVA-31 allelic profile always...”
STM1327 putative salt-induced outer membrane protein (NCBI ptt file) from Salmonella typhimurium LT2
Aligns to 47:252 / 252 (81.7%), covers 99.1% of PF04338, 186.5 bits
S1625 hypothetical protein (NCBI ptt file) from Shigella flexneri 2a str. 2457T
Aligns to 36:241 / 241 (85.5%), covers 99.1% of PF04338, 186.5 bits
c2120 YdiY family protein from Escherichia coli CFT073
Aligns to 47:252 / 252 (81.7%), covers 99.1% of PF04338, 186.3 bits
YdiY / b1722 acid-inducible putative outer membrane protein YdiY from Escherichia coli K-12 substr. MG1655 (see 4 papers)
TC 1.B.75.1.3 / P76206 YdiY OMP of 252 aas from Escherichia coli (strain K12)
b1722 hypothetical protein (NCBI) from Escherichia coli str. K-12 substr. MG1655
Aligns to 47:252 / 252 (81.7%), covers 99.1% of PF04338, 186.0 bits
- substrates: small molecules
tcdb comment: Acid induces its synthesis (Stancik et al. 2002) - Whole-Transcriptome Analysis of Verocytotoxigenic Escherichia coli O157:H7 (Sakai) Suggests Plant-Species-Specific Metabolic Responses on Exposure to Spinach and Lettuce Extracts
Crozier, Frontiers in microbiology 2016 - “...for high levels of differential expression: e.g., in spinach leaf lysates two hypothetical genes (b3238, b1722) were ranked as #2 and 3 for level of induction, at 50-fold. Probes corresponding to Z5022 and ECs4474 were induced 270- to 300-fold in spinach root exudates, but repressed in...”
- 18th Congress of the European Hematology Association, Stockholm, Sweden, June 13–16, 2013
, Haematologica 2013 - Gene expression analysis indicates extensive genotype-specific crosstalk between the conjugative F-plasmid and the E. coli chromosome
Harr, BMC microbiology 2006 - “...(MG1655)* F vs nonF (DH5)* MG1655 vs. DH5 # P (F-effect) P (strain-effect) Function Process b1722 3.03 2.36 -2.03 0.005 0.012 Conserved-Hypothetical-ORF flhD 2.34 2.61 -5.22 0.002 0.0002 regulator of flagellar biosynthesis, transcriptional initiation factor Motility, chemotaxis, energytaxis (i.e. aerotaxis, redoxtaxis) leuQ 2.78 2.19 3.50 0.050...”
- DNA microarray analyses of the long-term adaptive response of Escherichia coli to acetate and propionate
Polen, Applied and environmental microbiology 2003 - “...or block biosynthesis 0.38* 0.53* 0.57* 0.66* 0.82* 0.60 b1722 b1722 1 ORF, hypothetical protein 2.32* 2.21 0.89 b1729 b1729 2 Part of a kinase 0.96 2.28*...”
- Metabolic context and possible physiological themes of sigma(54)-dependent genes in Escherichia coli
Reitzer, Microbiology and molecular biology reviews : MMBR 2001 - “...caiF, xseB-ispA-dxs, hcaA1, xdhABC (b2866-2868), ndh, pgpB, b1722, tolC, galETKM, ymcC, degQ, yheB, b0540, aer, glyQS, cadCBA, b2374, arsR, mviN, yieP,...”
- The Escherichia coli proteome: past, present, and future prospects
Han, Microbiology and molecular biology reviews : MMBR 2006 - “...P76177 P0AC69 P77552 P0ACX3 P0A8A4 P77748 P76206 P0ACY1 P39173 P76256 5.38/59,928.8 5.07/54,689 9.1/31,910.83 4.75/12,878.76 4.96/9,928 (4.5-5.5) 4.42/42,876.01...”
Z2751 orf, hypothetical protein (NCBI ptt file) from Escherichia coli O157:H7 EDL933
Aligns to 47:252 / 252 (81.7%), covers 97.6% of PF04338, 181.6 bits
ZMO1563 hypothetical protein (RefSeq) from Zymomonas mobilis subsp. mobilis ZM4
Aligns to 111:322 / 327 (64.8%), covers 99.5% of PF04338, 178.1 bits
PP1357 conserved hypothetical protein (NCBI ptt file) from Pseudomonas putida KT2440
Aligns to 167:375 / 375 (55.7%), covers 100.0% of PF04338, 174.2 bits
VF_0300 putative salt-induced outer membrane protein (RefSeq) from Vibrio fischeri ES114
VF_0300 DUF481 domain-containing protein from Aliivibrio fischeri ES114
Aligns to 118:333 / 333 (64.9%), covers 100.0% of PF04338, 173.8 bits
XF1628 hypothetical protein (NCBI ptt file) from Xylella fastidiosa 9a5c
Aligns to 63:282 / 283 (77.7%), covers 99.5% of PF04338, 171.7 bits
PAK_04850 DUF481 domain-containing protein from Pseudomonas aeruginosa PAK
PA4390 hypothetical protein (NCBI) from Pseudomonas aeruginosa PAO1
Aligns to 128:335 / 335 (62.1%), covers 100.0% of PF04338, 168.7 bits
PSPTO_4381 conserved hypothetical protein (NCBI ptt file) from Pseudomonas syringae pv. tomato str. DC3000
Aligns to 127:335 / 335 (62.4%), covers 100.0% of PF04338, 164.1 bits
Pro1529 Homolog of salt-induced outer membrane prototein (NCBI) from Prochlorococcus marinus str. SS120
Aligns to 81:296 / 296 (73.0%), covers 100.0% of PF04338, 143.9 bits
PA4391 hypothetical protein (NCBI) from Pseudomonas aeruginosa PAO1
Aligns to 129:333 / 333 (61.6%), covers 97.2% of PF04338, 112.0 bits
PG1685 hypothetical protein (NCBI) from Porphyromonas gingivalis W83
Aligns to 52:259 / 260 (80.0%), covers 74.5% of PF04338, 33.2 bits
OmpG / b1319 outer membrane porin G from Escherichia coli K-12 substr. MG1655 (see 17 papers)
OMPG_ECOLI / P76045 Outer membrane porin G; Outer membrane protein G from Escherichia coli (strain K12) (see paper)
TC 1.B.21.1.1 / P76045 Non-specific, 14 from Escherichia coli (see 4 papers)
b1319 outer membrane porin (NCBI) from Escherichia coli str. K-12 substr. MG1655
NP_415835 outer membrane porin G from Escherichia coli str. K-12 substr. MG1655
Aligns to 91:212 / 301 (40.5%), covers 50.9% of PF04338, 27.9 bits
- function: Forms channels functionally larger than those of classical porins.
function: May act as a regulator of the RCS-phosphorelay signal transduction pathway.
subunit: Monomer - substrates: small molecules
tcdb comment: β-stranded monomeric OmpG porin (Conlan et al. 2000). pH-induced conformational changes of OmpG have been studied after reconstitution in native E. colilipids (Mari et al., 2010). Encoded by a gene in a gene cluster also encoding an ABC sugar uptake system (TC# 3.A.1.1.46), a glucosyl hydrolase and two oxidoreductases. Therefore it's phsiological function may be glucoside uptake. At neutral/high pH, the channel is open and permeable to substrates of size up to 900Da. At acidic pH, loop L6 folds across the channel and blocks the pore. The channel blockage at acidic pH appears to be triggered by the protonation of a histidine pair on neighboring β-strands, which repel one another, resulting in the rearrangement of loop L6 and channel closure (Köster et al. 2015). Crystallization and analysis by electron microscopy and X-ray crystallography revealed the fundamental mechanisms essential for channel activity. A 28 aa extension has been added to the 14 β-TMS barrel to make a 16 β-TMS barrel with normal activity and stability but differing pH sensitivity (Korkmaz et al. 2015). A minimized OmpG porin of only 220 aas still exhibits gating, but it was 5-fold less frequent than in native OmpG. The residual gating of the minimal pore is independent of L6 rearrangements and involves narrowing of the ion conductance pathway, most probably driven by global stretching-flexing deformations of the membrane-embedded β-barrel (Grosse et al. 2014). pH-dependent gating is controlled by an electrostatic interaction network formed between the gating loop and charged residues in the lumen (Perez-Rathke et al. 2018). 3-d structures of the protein in lipid bilayers have been solved (Retel et al. 2017). OmpG may provide a route for D-lactate/D-3-hydroxybutyrate oligo-ester secretion as well as sugar uptake (Utsunomia et al. 2017). OmpG lacks a central constriction and has an exceptionally wide pore diameter of about 13 Å. The equatorial plane of OmpG harbors an annulus of four alternating basic and acidic patches, and manipulation of charge distribution in the arginine and glutamate clusters alters sugar specificity and ion selectivity (Schmitt et al. 2019) - 18th Congress of the European Hematology Association, Stockholm, Sweden, June 13–16, 2013
, Haematologica 2013 - Further tests of a recombination model in which chi removes the RecD subunit from the RecBCD enzyme of Escherichia coli
Stahl, Genetics 1990 (secret) - Novel bacteriophage lambda cloning vector
Karn, Proceedings of the National Academy of Sciences of the United States of America 1980 - “...was substituted to give h80 Alatt 80 - cIIII cI 857 pad P.P' b1319 81 cIts chi 3. This was then crossed with A sBam 10 b189 int 29 nin L44 cI 857 to give X sBam...”
- “...10; A. Parkinson, b189; M. Gottesman,loint cIIIj; J. Weir, b1319 and chi 3; J. Salstrom, ninL44; F. Blattner, KH54. Rich Roberts kindly supplied us with strains...”
- The isolation and partial characterization of a new restriction endonuclease from Providencia stuartii
Smith, Nucleic acids research 1976 - “...lambda b189 lambda b515 lambda b511 lambda b519 lambda b1319 lambda KH100 nin 5 lambda KH70 lambda imm 434 Reznikoff, W. Parkinson, S. Parkinson, S. Parkinson,...”
- Recombination-deficient deletions in bacteriophage lambda and their interaction with chi mutations
Henderson, Genetics 1975 (secret) - Rec-mediated recombinational hot spot activity in bacteriophage lambda. I. Hot spot activity associated with spi-deletions and bio substitutions
McMilin, Genetics 1974 (secret) - Role of genetic recombination in DNA replication of bacteriophage lambda. I. Genetic characterization of the delta gene
Barta, Journal of virology 1974 - “...of 1 to 2%. Backcrossing of these recombinants with either b1319 or red,gam again yields Spi- phage, indicating that del is to the left and outside of the b1319...”
- “...the original isolate maps to the left and outside the b1319 deletion. Crosses between red,gam and A b2, a TABLE 4. Burst-size after infection of a recA hosta...”
- pH-induced conformational change of the beta-barrel-forming protein OmpG reconstituted into native E. coli lipids.
Mari, Journal of molecular biology 2010 (PubMed)- GeneRIF: Upon lowering the pH to 5.0, the conformation of OmpG molecules changed to close the extracellular entrance of their channel.
- pH-dependent interactions guide the folding and gate the transmembrane pore of the beta-barrel membrane protein OmpG.
Damaghi, Journal of molecular biology 2010 (PubMed)- GeneRIF: At acidic pH, the authors detected a pH-dependent interaction at loop L6. This interaction changed the (un)folding of loop L6 and of beta-strands 11 and 12, which connect loop L6.
- Correlation between the OmpG secondary structure and its pH-dependent alterations monitored by FTIR.
Korkmaz-Ozkan, Journal of molecular biology 2010 (PubMed)- GeneRIF: The X-ray structure of the alanine-substituted OmpG mutant obtained at pH 6.5 confirms the constitutively open conformation.
- Outer membrane protein G: Engineering a quiet pore for biosensing.
Chen, Proceedings of the National Academy of Sciences of the United States of America 2008 - GeneRIF: Molecular dynamics simulations were used to identify regions of OmpG implicated in the gating.
- Structure of outer membrane protein G by solution NMR spectroscopy.
Liang, Proceedings of the National Academy of Sciences of the United States of America 2007 - GeneRIF: Complete backbone assignments were obtained for 234 of 280 residues based on CA, CB, and CO connection pathways determined from a series of TROSY-based 3D experiments at 800 MHz.
- Crystal structure of the monomeric porin OmpG.
Subbarao, Journal of molecular biology 2006 (PubMed)- GeneRIF: The architecture of the channel, together with previous biochemical and other data, suggests that OmpG may form a non-specific channel for the transport of larger oligosaccharides.
- Structure of the monomeric outer-membrane porin OmpG in the open and closed conformation.
Yildiz, The EMBO journal 2006 - GeneRIF: In the 2.7 A structure, OmpG binds one OG and one glucose molecule as sugar substrates in the closed pore.
- Biochemistry and regulation of a novel Escherichia coli K-12 porin protein, OmpG, which produces unusually large channels.
Fajardo, Journal of bacteriology 1998 - GeneRIF: N-terminus verified by Edman degradation on mature peptide
- Participation of the Salmonella OmpD porin in the infection of RAW264.7 macrophages and BALB/c mice
Ipinza, PloS one 2014 - “...Q8XE41, Q8CVW1, P06996, Q48473, P09888, O33507, P0A264, Q54471, P0A263, A0RZH5, P02931, Q56113, O33980, Q56828, P37432, P76045, O54339, O54340, P29739, Q9CNN9, P77747, Q56110, Q56111, A5F934, Q8DBX0, Q87LZ1, P0C6Q6, P20149, P46026, P46027, Q48216, P43839, Q48218, Q48221, P46025, Q48217, Q48219, Q48220, P80672, P38369). To avoid redundance in the searches,...”
- PONDR-FIT: a meta-predictor of intrinsically disordered amino acids.
Xue, Biochimica et biophysica acta 2010 - “...residues in a -structural transmembrane protein, outer membrane protein G from E. coli (Swissprot id: P76045). The transmembrane regions are shown by black lines. Information about these regions is extracted from SwissProt. Structured regions are shown by brown horizontal lines. Brakes between these brown lines correspond...”
Smlt0955 putative outer membrane protein (RefSeq) from Stenotrophomonas maltophilia K279a
Aligns to 14:172 / 366 (43.4%), covers 66.5% of PF04338, 22.2 bits
- Intranasal immunization with recombinant outer membrane protein A induces protective immune response against Stenotrophomonas maltophilia infection
Li, PloS one 2019 - “...NCBI. The OmpA protein of S . maltophilia K279a, deduced from the gene (1,098 bp; Smlt0955), is a 366-amino acid protein with an N-terminal signal peptide of 22 amino acids and a conserved C-terminal OmpA domain. BLAST analysis revealed that OmpA shared 86% to 99% sequence...”
- Identification of immunogenic outer membrane proteins and evaluation of their protective efficacy against Stenotrophomonas maltophilia
Xu, BMC infectious diseases 2018 - “...MS/MS from S. maltophilia OMPs shown in Fig. 1a . Table S3. DNA sequences of Smlt0955 and Smlt4123 of S. maltophilia. OmpA and Smlt4123 genes were amplified by PCR and sequenced. Table S4. Determination of LD50. Fifty percent lethal dose (LD50) value of S.maltophilia to BALB/c...”
- Abundance of the Quorum-Sensing Factor Ax21 in Four Strains of Stenotrophomonas maltophilia Correlates with Mortality Rate in a New Zebrafish Model of Infection
Ferrer-Navarro, PloS one 2013 - “...enoyl-CoA hydratase, MurA, RpoA, LptD, putative TonB-dependent receptors Smlt3444 and Smlt4151, putative FadL, putative OmpA Smlt0955, PepO and putative Ax21. The latter protein, quorum-sensing factor Ax21, shows a strong correlation with the results of virulence in zebrafish challenges ( p =0.022) as well as with the...”
Or search for genetic data about PF04338 in the Fitness Browser
by Morgan Price,
Arkin group
Lawrence Berkeley National Laboratory