Family Search for PF04359 (DUF493)

PF04359 hits 21 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.

BCAL0706 hypothetical protein from Burkholderia cenocepacia J2315
Aligns to 19:102 / 102 (82.4%), covers 100.0% of PF04359, 111.3 bits

• Burkholderia cenocepacia differential gene expression during host-pathogen interactions and adaptation to the host environment
  O'Grady, Frontiers in cellular and infection microbiology 2011
  • “...(HAP3) 3.20 BCAL0621 Putative cyclic-di-GMP signaling protein 1.56 BCAL0705 Putative d -amino acid aminotransferase 1.55 BCAL0706 Conserved hypothetical protein 1.75 BCAL0744 Appr-1-p processing enzyme family protein 1.74 BCAL0771 Non-heme chloroperoxidase 1.82 BCAL0808 P-loop ATPase protein family protein 1.88 BCAL0812 Sigma-54 modulation protein 1.91 BCAL0813 Putative RNA...”

NGO0791 hypothetical protein from Neisseria gonorrhoeae FA 1090
Aligns to 8:91 / 91 (92.3%), covers 98.8% of PF04359, 109.2 bits

• Global Network Analysis of Neisseria gonorrhoeae Identifies Coordination between Pathways, Processes, and Regulators Expressed during Human Infection
  McClure, mSystems 2020
  • “...hypothetical proteins. These hypothetical proteins include NGO0672, NGO1301, NGO1861, NGO2068 (a putative membrane protein), NGO1518, NGO0791 (containing a domain with lipoic acid-binding regulatory protein homology), and NGO0350 (containing a domain with hemolysin binding homology). Degree and betweenness values for all genes in the network are shown...”
• RpoH mediates the expression of some, but not all, genes induced in Neisseria gonorrhoeae adherent to epithelial cells
  Du, Infection and immunity 2006
  • “...NGO1363 NGO1989 NGO0340 NGO0238 NGO1210 NGO0634 NGO0372 NGO0791 NGO1927 NGO0635 NGO1083 NGO0633 NGO1988 NGO0234 NGO0721 NGO1366 NGO1291 NGO0199 NGO1515 NGO1493...”

NMB1218 hypothetical protein from Neisseria meningitidis MC58
Aligns to 8:91 / 91 (92.3%), covers 98.8% of PF04359, 108.0 bits

• Laminin receptor initiates bacterial contact with the blood brain barrier in experimental meningitis models
  Orihuela, The Journal of clinical investigation 2009
  • “...confirmed by PCR analysis. The pilQ gene (NMB1218) and its flanking sequence were amplified using the primers PilQF1 (5-GCCGTCTGAAACAGCTGCCGACAGATGC-3) and...”

y1174 hypothetical protein from Yersinia pestis KIM
YPTB1093 hypothetical protein from Yersinia pseudotuberculosis IP 32953
Aligns to 6:87 / 87 (94.3%), covers 98.8% of PF04359, 107.3 bits

• A new regulatory mechanism for bacterial lipoic acid synthesis
  Zhang, MicrobiologyOpen 2015
  • “...4.4 Salmonella typhimurium LT2 ybeD STM0636 AGTTGTTATTTTTTTTACGTAA AAGTGTGATTTTCGTCCCCATA 35 93 3.9 4.2 Yersinia pestis ybeD y1174 TATTGTGATTAATCTTATATTG 146 4.2 Shewanella baltica lipB Sba_3281 AAATGTGATCTGTCTTACATTT 74 5.2 S. halifaxensis lipB ShaI_3240 AAATGTGATCCGTATTACATTT 76 5.2 S. loihica lipB Shew_2941 AAATGTGATCTACCTTACATTT 70 5.3 S. oneidensis lipB SO1162 AAGTGTGATCTATCTTACATTT 68...”
• IscR is essential for yersinia pseudotuberculosis type III secretion and virulence
  Miller, PLoS pathogens 2014
  • “...Proteins(9) YPTB0391 putative exported protein 2.1 YPTB0449 hypothetical protein 3.3 YPTB0458 putative exported protein 2.2 YPTB1093 hypothetical protein 3.6 YPTB1571 hypothetical protein 2.1 YPTB2255 putative exported protein 2.3 YPTB2277 hypothetical protein 2.6 YPTB2496 hypothetical protein 2.8 YPTB3109 hypothetical protein 4.1 a ORF IDs are derived from...”

Ent638_1166 hypothetical protein from Enterobacter sp. 638
Aligns to 6:87 / 87 (94.3%), covers 98.8% of PF04359, 102.4 bits

• A new regulatory mechanism for bacterial lipoic acid synthesis
  Zhang, MicrobiologyOpen 2015
  • “...species amongst -proteobacteria Organisms Gene Loci CRP site Position 1 Score Enterobacter sp. 638 ybeD Ent638_1166 AAGTGTGATTTCCATCCCCATA 90 4.4 Escherichia coli MG1655 ybeD b0631 AAGTGTAATTTCCGTCCCCATA 94 3.6 Cistrobacter koseri ybeD CKO_02527 AAGTGTGATTTCCATCCCCATA 91 4.4 Klebsiella pneumonia ybeD KPN_00663 AAGTGTGATTTCCATCCCCATA 97 4.4 Salmonella typhimurium LT2 ybeD STM0636...”

SO1163 conserved hypothetical protein from Shewanella oneidensis MR-1
Aligns to 7:88 / 88 (93.2%), covers 100.0% of PF04359, 99.9 bits

• A new regulatory mechanism for bacterial lipoic acid synthesis
  Zhang, MicrobiologyOpen 2015
  • “...species from the RegPrecise database (Novichkov etal. 2010a ). We noted that the ybeD ( SO1163 ) gene is constantly present upstream of the lipB gene (Fig. 2 ), and YbeD protein of E. coli origin exhibits a striking structural homology to the allosteric regulatory domain...”
• Stress responses of shewanella
  Yin, International journal of microbiology 2011
  • “...76 48 GTTGAAAAGAATTGATTTGCCCCAAGATA 12.8 SO1794 clpP ATP-dependent Clp protease, proteolytic subunit 83 55 CTTGACTTGATTAGCAGTTCGCCATTTAT 12.8 SO1163 conserved hypothetical protein 60 31 CTTGAATCGGGTATAATCGCCACCATATAG 12.7 SO3863 modA molybdenum ABC transporter, periplasmic molybdenum-binding protein 206 177 CTTGAGTAAATGTTATTGTCCCCGATCAAT 12.3 SO1196 rrmJ ribosomal RNA large subunit methyltransferase J 65 36 GTTGAAAAACCGCTATTCTACCCTTATATA...”

YbeD / b0631 DUF493 domain-containing protein YbeD from Escherichia coli K-12 substr. MG1655 (see 4 papers)
ybeD / PDB|1RWU UPF0250 protein ybeD from Escherichia coli K12 (see paper)
c0721 Hypothetical protein ybeD from Escherichia coli CFT073
NP_415164 DUF493 domain-containing protein YbeD from Escherichia coli str. K-12 substr. MG1655
b0631 hypothetical protein from Escherichia coli str. K-12 substr. MG1655
ECs0669 hypothetical protein from Escherichia coli O157:H7 str. Sakai
Aligns to 6:87 / 87 (94.3%), covers 98.8% of PF04359, 99.8 bits

• Establishment of a Reverse Genetics System for SARS-CoV-2 Using Circular Polymerase Extension Reaction
  Torii, 2020
• Structural similarity of YbeD protein from Escherichia coli to allosteric regulatory domains.
  Kozlov, Journal of bacteriology 2004
  • GeneRIF: YbeD shows striking structural homology to the regulatory domain from d-3-phosphoglycerate dehydrogenase, hinting at a role in the allosteric regulation of lipoic acid biosynthesis or the glycine cleavage system.
• A new regulatory mechanism for bacterial lipoic acid synthesis
  Zhang, MicrobiologyOpen 2015
  • “...Position 1 Score Enterobacter sp. 638 ybeD Ent638_1166 AAGTGTGATTTCCATCCCCATA 90 4.4 Escherichia coli MG1655 ybeD b0631 AAGTGTAATTTCCGTCCCCATA 94 3.6 Cistrobacter koseri ybeD CKO_02527 AAGTGTGATTTCCATCCCCATA 91 4.4 Klebsiella pneumonia ybeD KPN_00663 AAGTGTGATTTCCATCCCCATA 97 4.4 Salmonella typhimurium LT2 ybeD STM0636 AGTTGTTATTTTTTTTACGTAA AAGTGTGATTTTCGTCCCCATA 35 93 3.9 4.2 Yersinia pestis...”
• Transcriptomic analysis of Escherichia coli O157:H7 and K-12 cultures exposed to inorganic and organic acids in stationary phase reveals acidulant- and strain-specific acid tolerance responses
  King, Applied and environmental microbiology 2010
  • “...ECs4197 ECs4416 ECs5464 b3292 b3585 b3755 b3179 b0380 b0631 b1445 b1848 b2141 b3238 b3346 b3536 b4537 Translation, ribosomal structure and biogenesis Poorly...”
• Sxy induces a CRP-S regulon in Escherichia coli
  Sinha, Journal of bacteriology 2009
  • “...b1322 b2592 b2614 b0014 b2699 b0966 b3686 b3687 b3635 b4140 b0631 bssS ycjF clpB grpE dnaK recA hspQ ibpB ibpA mutM fxsA ybeD 4.48 4.64 5.43 5.47 5.54 5.81...”
• Differential gene expression for investigation of Escherichia coli biofilm inhibition by plant extract ursolic acid
  Ren, Applied and environmental microbiology 2005
  • “...b0594 b4140 b1594 b1739 b3498 b1194 b1321 b1566 b1760 b0141 b2674 b0631 b1322 b2157 b3292 b3525 b4367 b3399 1.4 1.1 1.4 1.3 1.8 1.4 1.6 1.3 1.5 1.6 1.4 1.5 1.0...”
• Interfering with different steps of protein synthesis explored by transcriptional profiling of Escherichia coli K-12
  Sabina, Journal of bacteriology 2003
  • “...b3321 b3308 b3304 b3616 b3339 b2155 b3829 b3317 b3296 b2913 b0631 b2416 b3305 b3303 b1043 b3509 0.03 0.11 0.13 0.16 0.17 0.18 0.21 0.21 0.21 0.22 0.23 0.23 0.24...”
• Transcriptomic analysis of Escherichia coli O157:H7 and K-12 cultures exposed to inorganic and organic acids in stationary phase reveals acidulant- and strain-specific acid tolerance responses
  King, Applied and environmental microbiology 2010
  • “...ENVIRON. MICROBIOL. ECs4157 ECs4461 ECs4697 ECs4058 ECs0430 ECs0669 ECs2049 ECs2558 ECs3033 ECs4111 ECs4197 ECs4416 ECs5464 b3292 b3585 b3755 b3179 b0380 b0631...”

STM0636 putative cytoplasmic protein from Salmonella typhimurium LT2
STM14_0743 DUF493 family protein YbeD from Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S
Aligns to 6:87 / 87 (94.3%), covers 98.8% of PF04359, 99.5 bits

• Inorganic Polyphosphate Is Essential for Salmonella Typhimurium Virulence and Survival in Dictyostelium discoideum
  Varas, Frontiers in cellular and infection microbiology 2018
  • “...STM14_0529 STM0447 tig Trigger factor STM14_0564 STM0479 Putative transposase STM14_0693 STM0595 entC Isochorismate synthase STM14_0743 STM0636 ybeD Hypothetical protein STM14_0806 STM0691 Tricarballylate dehydrogenase STM14_0815 STM0698 pgm Phosphoglucomutase STM14_1013 STM0863 dacC D-alanyl-D-alanine carboxypeptidase fraction C STM14_1056 STM0939 ybjD Hypothetical protein STM14_1106 STM0978 aroA 3-phosphoshikimate 1-carboxyvinyltransferase STM14_1259 STM1109...”
• A new regulatory mechanism for bacterial lipoic acid synthesis
  Zhang, MicrobiologyOpen 2015
  • “...CKO_02527 AAGTGTGATTTCCATCCCCATA 91 4.4 Klebsiella pneumonia ybeD KPN_00663 AAGTGTGATTTCCATCCCCATA 97 4.4 Salmonella typhimurium LT2 ybeD STM0636 AGTTGTTATTTTTTTTACGTAA AAGTGTGATTTTCGTCCCCATA 35 93 3.9 4.2 Yersinia pestis ybeD y1174 TATTGTGATTAATCTTATATTG 146 4.2 Shewanella baltica lipB Sba_3281 AAATGTGATCTGTCTTACATTT 74 5.2 S. halifaxensis lipB ShaI_3240 AAATGTGATCCGTATTACATTT 76 5.2 S. loihica lipB...”
• Inorganic Polyphosphate Is Essential for Salmonella Typhimurium Virulence and Survival in Dictyostelium discoideum
  Varas, Frontiers in cellular and infection microbiology 2018
  • “...protein STM14_0529 STM0447 tig Trigger factor STM14_0564 STM0479 Putative transposase STM14_0693 STM0595 entC Isochorismate synthase STM14_0743 STM0636 ybeD Hypothetical protein STM14_0806 STM0691 Tricarballylate dehydrogenase STM14_0815 STM0698 pgm Phosphoglucomutase STM14_1013 STM0863 dacC D-alanyl-D-alanine carboxypeptidase fraction C STM14_1056 STM0939 ybjD Hypothetical protein STM14_1106 STM0978 aroA 3-phosphoshikimate 1-carboxyvinyltransferase STM14_1259...”

VF_0744 hypothetical protein from Vibrio fischeri ES114
VF_0744 DUF493 family protein YbeD from Aliivibrio fischeri ES114
Aligns to 8:89 / 89 (92.1%), covers 98.8% of PF04359, 99.5 bits

• Characterizing the host and symbiont proteomes in the association between the Bobtail squid, Euprymna scolopes, and the bacterium, Vibrio fischeri
  Schleicher, PloS one 2011
  • “...hydroperoxide reductase, C22 10.54 994 6 59711657 VF_1050 - hypothetical protein 9.35 179 7 59711351 VF_0744 ybeD hypothetical protein 7.94 194 8 59712374 VF_1767 cspD DNA replication inhibitor 7.66 309 9 59714005 VF_A0822 - hypothetical protein 7.55 101 10 59711823 VF_1216 infC protein chain initiation factor...”

KPN_00663 hypothetical protein from Klebsiella pneumoniae subsp. pneumoniae MGH 78578
Aligns to 6:87 / 87 (94.3%), covers 98.8% of PF04359, 99.2 bits

• A new regulatory mechanism for bacterial lipoic acid synthesis
  Zhang, MicrobiologyOpen 2015
  • “...ybeD b0631 AAGTGTAATTTCCGTCCCCATA 94 3.6 Cistrobacter koseri ybeD CKO_02527 AAGTGTGATTTCCATCCCCATA 91 4.4 Klebsiella pneumonia ybeD KPN_00663 AAGTGTGATTTCCATCCCCATA 97 4.4 Salmonella typhimurium LT2 ybeD STM0636 AGTTGTTATTTTTTTTACGTAA AAGTGTGATTTTCGTCCCCATA 35 93 3.9 4.2 Yersinia pestis ybeD y1174 TATTGTGATTAATCTTATATTG 146 4.2 Shewanella baltica lipB Sba_3281 AAATGTGATCTGTCTTACATTT 74 5.2 S. halifaxensis...”

B7V8B5 UPF0250 protein PLES_09781 from Pseudomonas aeruginosa (strain LESB58)
PLES_09781 hypothetical protein from Pseudomonas aeruginosa LESB58
PA3998 hypothetical protein from Pseudomonas aeruginosa PAO1
Aligns to 9:93 / 93 (91.4%), covers 98.8% of PF04359, 98.3 bits

• Proteomic profiling spotlights the molecular targets and the impact of the natural antivirulent umbelliferone on stress response, virulence factors, and the quorum sensing network of Pseudomonas aeruginosa
  Kasthuri, Frontiers in cellular and infection microbiology 2022
  • “...Q8XVS2 Arabinose import ATP-binding protein AraG 0.01 1.96 B7UVT6 Probable cytosol aminopeptidase PepA 0.02 2.71 B7V8B5 UPF0250 protein PLES_09781 0.02 2.31 Q8XWT3 Pantothenate synthetase PanC 0.02 1.79 Q1I2H5 tRNA modification GTPase MnmE 0.02 4.14 P47203 Cell division protein FtsA 0.02 1.24 Q88FY7 Porin-like protein NicP 0.02...”
• Proteomic profiling spotlights the molecular targets and the impact of the natural antivirulent umbelliferone on stress response, virulence factors, and the quorum sensing network of Pseudomonas aeruginosa
  Kasthuri, Frontiers in cellular and infection microbiology 2022
  • “...ATP-binding protein AraG 0.01 1.96 B7UVT6 Probable cytosol aminopeptidase PepA 0.02 2.71 B7V8B5 UPF0250 protein PLES_09781 0.02 2.31 Q8XWT3 Pantothenate synthetase PanC 0.02 1.79 Q1I2H5 tRNA modification GTPase MnmE 0.02 4.14 P47203 Cell division protein FtsA 0.02 1.24 Q88FY7 Porin-like protein NicP 0.02 6.69 Q9HTB6 GDP-6-deoxy-D-mannose...”
• Bacterial fitness in chronic wounds appears to be mediated by the capacity for high-density growth, not virulence or biofilm functions
  Morgan, PLoS pathogens 2019
  • “...0 0.000 nt PA1929 - 165 0 0.000 nt PA3263 - 162 0 0.000 nt PA3998 - 162 0 0.000 nt PA0025 aroE 160 0 0.000 nt PA1479 ccmE 146 0 0.000 nt PA4600 nfxB 129 0 0.000 nt PA5288 glnK 122 0 0.000 nt PA5322...”

FTN_0908 hypothetical protein from Francisella tularensis subsp. novicida U112
FTS_1033 YbeD family protein from Francisella tularensis subsp. holarctica FSC200
Aligns to 11:94 / 94 (89.4%), covers 98.8% of PF04359, 91.6 bits

• The Francisella tularensis Polysaccharides: What Is the Real Capsule?
  Freudenberger, Microbiology and molecular biology reviews : MMBR 2020 (secret)
• Amino acid deprivation and central carbon metabolism regulate the production of outer membrane vesicles and tubes by Francisella
  Sampath, Molecular microbiology 2018 (PubMed)
  • “...tktA, involved in central carbon metabolism, and in FTN_0908 and FTN_1037, of unknown function, resulted in severe defects in OMV/T production. Cysteine...”
  • “...tktA RNA function FTN_0945 rsuA FTN_1063 Unknown function FTN_0908 FTN_1133 FTN_1196 Description Level of FopA on blotsa OMV/T as per TEMb GTP-binding protein...”
• <i>Francisella tularensis</i> D-Ala D-Ala Carboxypeptidase DacD Is Involved in Intracellular Replication and It Is Necessary for Bacterial Cell Wall Integrity
  Spidlova, Frontiers in cellular and infection microbiology 2018
  • “...monitored genes FTS_1038 through FTS_1032 are transcribed in the mutant, but the transcription level of FTS_1033 and FTS_1032 is lower than that in the wild-type (data not shown). In strain complemented in cis the transcription levels were those as for wild-type strain. However, the decreased transcription...”

FTT_1030 hypothetical protein from Francisella tularensis subsp. tularensis SCHU S4
Aligns to 11:94 / 94 (89.4%), covers 98.8% of PF04359, 91.4 bits

• Global Analysis of Genes Essential for Francisella tularensis Schu S4 Growth In Vitro and for Fitness during Competitive Infection of Fischer 344 Rats
  Ireland, Journal of bacteriology 2019
  • “...filter. Nine genes returned hits, including FTT_0346 ( rpmJ ), FTT_0801c, FTT_0839 ( tolA ), FTT_1030, FTT_1275 ( mglA ), FTT_1453c ( wzx ), FTT_1457c ( wbtG ), FTT_1607 ( minE ), and FTT_1730c, and were therefore excluded from the novel essential gene list. BLASTx analysis...”

A1S_2705 hypothetical protein from Acinetobacter baumannii ATCC 17978
Aligns to 12:95 / 95 (88.4%), covers 98.8% of PF04359, 84.9 bits

• Whole transcriptome analysis of Acinetobacter baumannii assessed by RNA-sequencing reveals different mRNA expression profiles in biofilm compared to planktonic cells
  Rumbo-Feal, PloS one 2013
  • “...A1S_2534 sulfate transport protein 21.12 from zero to 24.66 ** A1S_2696 hypothetical protein 1.35 0.20 A1S_2705 hypothetical protein 0.21 0.09 A1S_2718 succinyl-CoA synthetase subunit beta 1.14 7.65 A1S_2719 succinyl-CoA synthetase subunit alpha 1.07 5.76 A1S_2753 hypothetical protein 1.66 3.36 A1S_2840 outer membrane protein A 0.60 0.74...”

XC_0711 hypothetical protein from Xanthomonas campestris pv. campestris str. 8004
Aligns to 9:92 / 92 (91.3%), covers 98.8% of PF04359, 75.1 bits

• Proteolysis of histidine kinase VgrS inhibits its autophosphorylation and promotes osmostress resistance in Xanthomonas campestris
  Deng, Nature communications 2018
  • “...an RT-PCR analysis revealed that prc is located in a four-gene operon that also contains XC_0711 , XC_0712 , and XC_0713 because positive RT-PCR products were amplified from a cDNA template derived from the intergenic transcripts of these genes (Supplementary Fig. 1 ). Fig. 1 prc...”

LOC11438520 uncharacterized protein LOC11438520 from Medicago truncatula
Aligns to 120:205 / 205 (42.0%), covers 98.8% of PF04359, 70.7 bits

• Genome-wide association analysis for drought tolerance and associated traits in faba bean (Vicia faba L.)
  Gutiérrez, Frontiers in plant science 2023
  • “...- MTR_8g058330 Protein transport protein Sec61 subunit alpha Chr8: 23,516,578 - 23,520,693 AX-181157586 3.4 VF2 LOC11438520 - MTR_3g085280 Uncharacterized LOC11438520 Chr3: 41,983,181 - 41,987,055 AX-416766853 2.2 VF4 LOC11439881 - MTR_8g035560 Receptor-like serine/threonine-protein kinase At2g45590 Chr8: 13,391,605 - 13,394,516 PRO AX-416786927 22.3 VF5 LOC11423151 - MTR_7g112460 Topless-related...”

AT1G27385 hypothetical protein from Arabidopsis thaliana
Aligns to 116:201 / 254 (33.9%), covers 97.6% of PF04359, 70.5 bits

• Spatial dissection of the Arabidopsis thaliana transcriptional response to downy mildew using Fluorescence Activated Cell Sorting
  Coker, Frontiers in plant science 2015
  • “...AT1G21440 AT3G28460 AT1G13380 AT3G19450 ATCAD4, AT1G48620 HON5 AT4G11990 AT1G14690 MAP65-7 AT3G45850 AT1G48650 AT4G21270 ATK1, KATAP AT1G27385 AT3G54190 AT1G54820 AT4G22930 PYR4, DHOASE AT1G35780 AT3G60840 MAP65-4 AT1G58060 AT4G30610 BRS1, SCPL24 AT1G48600 AtPMEAMT AT4G37080 AT1G63630 AT4G34210 ASK11, SK11 AT1G53560 AT5G01015 AT1G66510 AT4G37110 AT1G70370 PG2 AT5G15310 ATMYB16, ATMIXTA, AT2G21380 AT5G17220...”
• Ascorbate peroxidase-related (APx-R) is not a duplicable gene
  Dunand, Plant signaling & behavior 2011
  • “...Other At1g10830 15-CIS-ZETA-CAROTENE ISOMERASE (Z-ISO) Chlo At1g27385 Unknown protein Chlo Chlo chloroplast No Yes At1g33290 Sporulation protein-related Chlo...”

PFLU5418 hypothetical protein from Pseudomonas fluorescens SBW25
Aligns to 8:91 / 91 (92.3%), covers 98.8% of PF04359, 68.4 bits

• Use of in vivo expression technology to identify genes important in growth and survival of Pseudomonas fluorescens Pf0-1 in soil: discovery of expressed sequences with novel genetic organization
  Silby, Journal of bacteriology 2004
  • “...No Fusion iiv1 Gene on opposite strande Pflu5418; COG0604: NADPH quinone reductase and related Zn-dependent oxidoreductases Pflu1118; COG1902: NADH flavin...”

B739_1916 DUF493 domain-containing protein from Riemerella anatipestifer RA-CH-1
Aligns to 22:99 / 99 (78.8%), covers 95.2% of PF04359, 47.3 bits

• Identifying the Genes Responsible for Iron-Limited Condition in Riemerella anatipestifer CH-1 through RNA-Seq-Based Analysis
  Liu, BioMed research international 2017
  • “...14 Preprotein translocase subunit SecG 13716420 B739_1898 1.1221 8.61 E 20 3-Oxoacyl-(acyl-carrier-protein) synthase III 13716438 B739_1916 1.1349 1.80 E 07 Hypothetical protein 13716459 B739_1938 1.0469 7.76 E 115 Hypothetical protein 13716524 B739_2003 1.1565 1.21 E 26 Polyisoprenoid-binding protein; YceI-like domain 13716533 B739_2012 1.3031 0.0098864 Prevent-host-death protein;...”

HP0495 hypothetical protein from Helicobacter pylori 26695
Aligns to 7:86 / 86 (93.0%), covers 97.6% of PF04359, 41.4 bits

• NMR study on small proteins from Helicobacter pylori for antibiotic target discovery: a review
  Kang, Molecules (Basel, Switzerland) 2013
  • “...(HP1073), ( B ) 1ZHC (HP1242), ( C ) 2LXR (HP1264), ( D ) 2H9Z (HP0495), ( E ) 1Z8M (HP0894), ( F ) 2KI2 (HP0827), ( G ) 2K6P (HP1423), ( H ) 2QTR (HP0892), ( I ) 1X93 (HP0222), ( J ) 2K4J, (...”
  • “...9 1ZHC HP1242 76 hypothetical protein 2005 10 2LXR HP1264 76 oxidoreductase 2012 11 2H9Z HP0495 86 hypothetical protein 2007 12 1Z8M HP0894 88 hypothetical protein 2005 13 2KI2 HP0827 90 RNA binding protein/ ssDNA binding protein 2009 14 2JOQ - 91 hypothetical protein 2007 15...”
• Structural analysis of hypothetical proteins from Helicobacter pylori: an approach to estimate functions of unknown or hypothetical proteins
  Park, International journal of molecular sciences 2012
  • “...against invasion, or possibly both such as Cas2 and/or a TA system. 4.3. Others: HP0062, HP0495, HP0827, HP1242, HP1423 The 3D structure of hypothetical protein HP0062 (PDB code: 3FX7) at 1.65 resolution was solved [ 91 ]. HP0062 is a small protein composed of 86 amino...”
  • “...HP0062 as a transport chaperone and/or adaptor protein to facilitate interactions with host receptor proteins. HP0495 is an 86-residue hypothetical protein with a molecular weight of 10,192.7 Da. The atomic coordinates of the final structure have been deposited in PDB (2H9Z). HP0495 has two -helices and...”
• Genome-wide survey of mutual homologous recombination in a highly sexual bacterial species
  Yahara, Genome biology and evolution 2012
  • “...Hypothetical 0.053 0.020 7 354 A HP0863 Hypothetical protein Hypothetical 0.050 0.021 35 1,629 A HP0495 Hypothetical protein Hypothetical (other categories) b 0.059 0.027 7 261 A HP1424 Hypothetical protein Hypothetical 0.061 0.027 17 621 A aHP26695_005 rfaJ-2 Putative lipopolysaccharide biosynthesis protein Cell envelope 0.062 0.029...”
• Backbone 1H, 15N, and 13C resonance assignment and secondary structure prediction of HP0495 from Helicobacter pylori
  Seo, Journal of biochemistry and molecular biology 2007 (PubMed)
  • “...Resonance Assignment and Secondary Structure Prediction of HP0495 from Helicobacter pylori Min-Duk Seo1, Sung Jean Park1,#, Hyun-Jung Kim1, Seung-Hyeon Seok1...”
  • “...Received 6 December 2006, Accepted 20 April 2007 HP0495 (Swiss-Prot ID; Y495_HELPY) is an 86-residue hypothetical protein from strain 26695. The function of...”
• Solution structure of hypothetical protein, HP0495 (Y495_HELPY) from Helicobacter pylori
  Seo, Proteins 2007 (PubMed)
  • “...of Hypothetical Protein, HP0495 (Y495_HELPY) From Helicobacter pylori Min-Duk Seo, Sung Jean Park, Hyun-Jung Kim, and Bong-Jin Lee* National Laboratory of...”
  • “...pylori, we have determined the solution structure of HP0495 (Y495_HELPY; Swiss-Prot ID). The HP0495 (Y495_ HELPY) gene of Helicobacter pylori encodes an...”

Cj0253 hypothetical protein Cj0253 from Campylobacter jejuni subsp. jejuni NCTC 11168
Aligns to 10:87 / 87 (89.7%), covers 91.7% of PF04359, 39.8 bits

• Phenotypic screening of a targeted mutant library reveals Campylobacter jejuni defenses against oxidative stress
  Flint, Infection and immunity 2014
  • “...Unknown function cj0040 cj0044c cj0148c cj0171 cj0202c cj0253 cj0260c cj0344 cj0416 cj0524 cj0554 cj0741 cj0786 cj0814 cj0819 cj0900c cj0977 cj1159c cj1242...”

Or search for genetic data about PF04359 in the Fitness Browser