Family Search for PF04402 (SIMPL)
April 2024: See Interactive Tools for Functional Annotation of Bacterial Genomes for advice on using these tools.
PF04402 hits 70 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.
SMc01556 CONSERVED HYPOTHETICAL PROTEIN from Sinorhizobium meliloti 1021
Aligns to 53:258 / 262 (78.6%), covers 100.0% of PF04402, 191.6 bits
BJS_05382 SIMPL domain-containing protein from Bradyrhizobium japonicum SEMIA 5079
Aligns to 33:231 / 239 (83.3%), covers 100.0% of PF04402, 190.8 bits
WP_213621447 SIMPL domain-containing protein from Paenibacillus sp. J22TS3
Aligns to 45:249 / 252 (81.3%), covers 100.0% of PF04402, 187.6 bits
WP_068612997 SIMPL domain-containing protein from Paenibacillus tuaregi
Aligns to 45:249 / 252 (81.3%), covers 100.0% of PF04402, 185.7 bits
BR1475 immunoreactive 28 kDa outer membrane protein from Brucella suis 1330
P0A3U8 26 kDa periplasmic immunogenic protein from Brucella melitensis biotype 1 (strain 16M / ATCC 23456 / NCTC 10094)
P0A3U9 26 kDa periplasmic immunogenic protein from Brucella suis biovar 1 (strain 1330)
Q540I8 BP26 from Brucella suis
Q6YA70 BP26 from Brucella ovis
Q6YA76 BP26 from Brucella abortus
Q71T34 Bp26 from Brucella ceti
Q71T35 Bp26 from Brucella pinnipedialis
BMEI0536 PERIPLASMIC IMMUNOGENIC PROTEIN from Brucella melitensis 16M
BruAb1_1470 Omp28, immunoreactive 28 kDa outer membrane protein from Brucella abortus biovar 1 str. 9-941
Aligns to 40:247 / 250 (83.2%), covers 100.0% of PF04402, 185.5 bits
- Large scale immune profiling of infected humans and goats reveals differential recognition of Brucella melitensis antigens
Liang, PLoS neglected tropical diseases 2010 - “...Product Name Reference for other Brucella species Serodiagnostic for both Humans and Goats BMEI0536 BAB1_1494 BR1475 0.983 26 kDa periplasmic immunogenic protein bp26 {Cloeckaert, 1996; Connolly, 2006; Lindler, 1996; Yang, 2005} BMEI1330 BAB1_0635 BR0611 0.870 Protease Do {Roop, 1994} Serodiagnostic for Humans only BMEI1439 BAB1_0522 BR0497...”
- Design of a multi-epitope vaccine candidate against Brucella melitensis
Li, Scientific reports 2022 - “...P0A3N8), Omp16 (Accession: P0A3S7), Omp19 (Accession: P0A3P1), Omp22 (Accession: Q93SI4), Omp25 (Accession: Q45321), Omp28 (Accession: P0A3U8), Omp31(Accession: E0A8N6), BtpB (Accession: A0A1S6ZGG9), BLS (Accession: X5DV28), BCSP31 (Accession: P0A3T2), and P39 (Accession: F6N110). Through bioinformatics analysis, the antigenicity (Fig. 1 A), instability index (Fig. 1 B), theoretical pi...”
- Enzymatic extraction improves intracellular protein recovery from the industrial carrageenan seaweed Eucheuma denticulatum revealed by quantitative, subcellular protein profiling: A high potential source of functional food ingredients.
Gregersen, Food chemistry: X 2021 - “...Cytoplasm c7052_g1_i1 24.2 8.3% 9.8% 8.6% 9.5% 14.8% 18.4% 14.6% 12.6% 5.8% 6.6% 6.9% 5.2% P0A3U9 303 Extracellular c7052_g1_i2 24.0 3.6% 3.6% 4.3% 4.5% 11.1% 11.5% 9.9% 10.3% 2.7% 2.5% 2.7% 2.6% P0A3U9 331 Extracellular c7216_g1_i1 25.4 3.0% 2.9% 2.5% 2.2% 11.3% 11.6% 5.4% 5.9% 5.3%...”
- Cloning, characterization, and expression of Bartonella henselae p26
Werner, Clinical and vaccine immunology : CVI 2006 - “...H1, Q6G2N4; Brucella abortus, Q6YA76; Brucella suis, Q540I8; Brucella melitensis, Q6GV67; Brucella ovis, Q6YA70; Brucella cetaceae, Q71T34; Brucella Downloaded...”
- Cloning, characterization, and expression of Bartonella henselae p26
Werner, Clinical and vaccine immunology : CVI 2006 - “...suis, Q540I8; Brucella melitensis, Q6GV67; Brucella ovis, Q6YA70; Brucella cetaceae, Q71T34; Brucella Downloaded from http://cvi.asm.org/ on March 3, 2017 by...”
- Cloning, characterization, and expression of Bartonella henselae p26
Werner, Clinical and vaccine immunology : CVI 2006 - “...B. henselae strain H1, Q6G2N4; Brucella abortus, Q6YA76; Brucella suis, Q540I8; Brucella melitensis, Q6GV67; Brucella ovis, Q6YA70; Brucella cetaceae, Q71T34;...”
- Cloning, characterization, and expression of Bartonella henselae p26
Werner, Clinical and vaccine immunology : CVI 2006 - “...melitensis, Q6GV67; Brucella ovis, Q6YA70; Brucella cetaceae, Q71T34; Brucella Downloaded from http://cvi.asm.org/ on March 3, 2017 by University of California,...”
- Cloning, characterization, and expression of Bartonella henselae p26
Werner, Clinical and vaccine immunology : CVI 2006 - “...832 WERNER ET AL. CLIN. VACCINE IMMUNOL. pinnipediae, Q71T35; Agrobacterium tumefaciens, Q8UDG4; and E. coli O157: H7, Q7ADC9. The p26 sequences determined in...”
- Immuno-profiling of Brucella proteins for developing improved vaccines and DIVA capable serodiagnostic assays for brucellosis
Nandini, Frontiers in microbiology 2023 - “...BMEI1330 Branched-chain alpha-keto acid dehydrogenase subunit E2 BMEII0746 Isopropylmalate isomerase large subunit BMEI0157 Immunogenic protein BMEI0536 Hypothetical protein BMEI0916 Periplasmic oligopeptide-binding protein precursor BMEII0735 Hypothetical protein BMEI1060 Hypothetical protein BMEI0179 Hypothetical protein BMEI0368 ATP-dependent protease ATP-binding subunit HslU BMEI2048 Preprotein translocase subunit SecG BMEI0847 NADH dehydrogenase...”
- “...with goat sera. Transporter BMEI1890 30S ribosomal protein S16 BMEI0227 Hypothetical protein BMEI1866 Immunogenic protein BMEI0536 Hypothetical protein BMEI0810 Protease Do BMEI0613 Type I restriction-modification enzyme S subunit BMEII0452 Preprotein translocase subunit SecA BMEI0121 HlyD family secretion protein BR_1060 Periplasmic oligopeptide-binding protein precursor BMEII0735 Nucleoside triphosphate...”
- Proteomic and Antibody Profiles Reveal Antigenic Composition and Signatures of Bacterial Ghost Vaccine of Brucella abortus A19
He, Frontiers in immunology 2022 - “...BMEI0892 0.1075 1.81 BMEI1829 0.084 0.75 BMEI1249 0.0756 0.52 BMEI0454 0.541 1.46 BMEI0178 0.4758 2.23 BMEI0536 0.041 1.82 BMEI0251 0.2174 0.51 BMEI0830 0.564 0.87 BMEI0376 0.2712 1.43 BMEI1249 0.119 0.69 BMEI1334 0.6047 1.21 BMEI1092 0.012 0.88 BMEI0324 0.219 2.25 BMEI0748 0.188 0.87 BMEI1536 0.2373 1.48 BMEII0032...”
- Adhesins of Brucella: Their Roles in the Interaction with the Host
Bialer, Pathogens (Basel, Switzerland) 2020 - “...Potential role in oral infections * [ 63 , 65 ] Bp26 B. melitensis 16M BMEI0536 WP_002964581.1 Uncharacterized Type I collagen, vitronectin, fibronectin ND ND [ 66 ] BmaC B. suis 1330 BRA1148 WP_006191504.1 Monomeric autotransporter Fibronectin, type I collagen Epithelial (HeLa, A549). Synoviocytes. Osteoblasts ND...”
- Immunogenic and invasive properties of Brucella melitensis 16M outer membrane protein vaccine candidates identified via a reverse vaccinology approach
Gomez, PloS one 2013 - “...Proteins. Gene Forward Primer Reverse Primer Protein MW (Da) BMEI0454 5-ATGGCAGCCACCGCGCTC-3 5-TCAGAAACGGTAGGTAATACCGGTG-3 OmpW 23, 541 BMEI0536 5-ATGAACACTCGTGCTAGCAATTTTCT-3 5-TTACTTGATTTCAAAAACGACATTGACCGATACG-3 Bp26 26, 552 BMEI0657 5-ATGGCGCAGGATGGCGGGGATAAG-3 5-TCAGAAATTACGGGTCAGCCC-3 BtuB 64, 807 BMEI0717 5-ATGGGAGGGACCGACTACACCTATAAC-3 5-CTAGAATTTGTAGTTCAGGCCG-3 Omp22 19, 448 BMEI1872 5-ATGCCGATGGCCCGTCATC-3 5-TTAATTGAAGGTATAGCTGAAACCTGCC-3 Hia 37, 461 BMEII0160 5-ATGTCACTTAGTTCTGCTCTTCTGACGG-3 5-TCACACCGCGTTAAGAAGATCATC-3 FlgK 50, 596 Protein...”
- Invasive Escherichia coli vaccines expressing Brucella melitensis outer membrane proteins 31 or 16 or periplasmic protein BP26 confer protection in mice challenged with B. melitensis
Gupta, Vaccine 2012 - “...(LLO) from Listeria monocytogenes. Brucella BMEII0844 ( omp 31 ), BMEI0340 ( omp16 ) and BMEI0536 ( bp26 ) genes were isolated from the Brucella ORFeome (OPEN Biosystems) [ 25 ]. Prokaryotic expression vectors pDEST17/Omp31, pDEST17/Omp16, and pDEST17/BP26 were generated by shuttling the insert from pDONR201/Omps...”
- Antigen-specific acquired immunity in human brucellosis: implications for diagnosis, prognosis, and vaccine development
Cannella, Frontiers in cellular and infection microbiology 2012 - “...and culture-/Rose Bengal+ vs. Peruvian Naive . Locus Tag/Acc#/Ch#; gene position Function Protein mass (kDa) BMEI0536 Periplasmic immunogenic protein (bp26) 26,552 LPS-BM-0.1 LPS None BMEII1048 60kDa chaperonin 57,462 BMEI0805 Putative uncharacterized protein 11,217 BMEII0032 Type IV secretion system protein; VirB8 26,446 BMEI1330 Probable serine protease do-like...”
- Characterization of outer membrane vesicles from Brucella melitensis and protection induced in mice
Avila-Calderón, Clinical & developmental immunology 2012 - “...protein precursor BMEII0844 23.27 OmpA-like domain profile, OM Porin Rhizobium leguminosarum bv. trifolii, (52.5%) BP26 BMEI0536 24.77 Protein of unknown function (DUF541), P Unknown function protein DUF541 Rhizobium leguminosarum bv. trifolii, (64.9%) Precursor YBIS protein BMEI1369 23.51 Domain YkuD, C Hypothetical protein Rhizobium leguminosarum bv. viciae,...”
- Systems biology approach predicts antibody signature associated with Brucella melitensis infection in humans
Liang, Journal of proteome research 2011 - “...25 samples, 143 antigens reactive in 69 samples and 135 antigens reactive in 1042 samples. BMEI0536 and BMEI1079 reacted in all 42 Bm culture positive samples. All serodiagnostic antigens except BMEI0503 reacted in 1042 samples; BMEI0503 reacted in 9 samples. Figure 2 Discovery of new human...”
- “...). The serodiagnostic antigens were ranked by decreasing single antigen AUC. The top four ORFs, BMEI0536 (bp26), BMEI0805 (hypothetical protein), BMEI1330 (protease Do), and BMEI 1890 (transporter), as wells as Bm LPS, all have an individual antigen AUC greater than 0.90 (Table S1, Supporting Information )....”
- More
- Immunoproteomic identification of immunodominant antigens independent of the time of infection in Brucella abortus 2308-challenged cattle
Lee, Veterinary research 2015 - “...218 BruAb2_1009 167 24230 24017 5.65 20 cytoplasm O: Posttranslational modification, protein turnover, chaperones 231 BruAb1_1470 3340810 50S ribosomal protein L25 YP_222213.1 Q57BY2 207 BruAb1_1470 171 22369 22383 5.91 47 ribosome J: Translation, ribosomal structure and biogenesis 239 BruAb1_0588 3339410 Fe-Mn superoxide dismutase YP_221327.1 Q57EG8 199...”
Q6GV67 Omp28 from Brucella melitensis
Aligns to 40:247 / 250 (83.2%), covers 100.0% of PF04402, 185.1 bits
BP26_BRUA1 / Q44642 26 kDa periplasmic immunogenic protein from Brucella abortus (strain S19) (see paper)
BAB1_1494 immunoreactive 28 kDa outer membrane protein from Brucella melitensis biovar Abortus 2308
Q2YS14 Immunoreactive 28 kDa outer membrane protein from Brucella abortus (strain 2308)
WP_002969580 outer membrane protein BP26/OMP28 from Brucella abortus
Aligns to 40:247 / 250 (83.2%), covers 100.0% of PF04402, 184.4 bits
ZMO0286 hypothetical protein from Zymomonas mobilis subsp. mobilis ZM4
Aligns to 51:254 / 257 (79.4%), covers 99.0% of PF04402, 181.6 bits
- Investigation of the impact of a broad range of temperatures on the physiological and transcriptional profiles of Zymomonas mobilis ZM4 for high-temperature-tolerant recombinant strain development
Li, Biotechnology for biofuels 2021 - “...Downregulated gene in ZM4 cultured at 30C compared with 45C ZMO0122 Uncharacterized protein 2.86 9.99 ZMO0286 DUF541 domain-containing protein 2.56 9.78 ZMO0693 OsmC family protein 1.57 8.5 ZMO0740 General stress protein CsbD 3.06 8.03 ZMO1113 FAD-dependent pyridine nucleotide-disulfide oxidoreductase 1.62 8.34 ZMO1237 Lactate dehydrogenase 2.82 9.39...”
- The Magnesium Concentration in Yeast Extracts Is a Major Determinant Affecting Ethanol Fermentation Performance of Zymomonas mobilis
Li, Frontiers in bioengineering and biotechnology 2020 - “...RM OXOID compared with RM BD ZMO1113 NADH dehydrogenase 1.03 2.29 ZMO0918 Catalase 1.21 2.52 ZMO0286 DUF541 domain-containing protein 1.22 2.30 ZMO1776 Aminopeptidase N 1.26 2.98 ZMO1754 Succinate-semialdehyde dehydrogenase SSADH 1.27 2.55 ZMO2024 Hypothetical protein 1.30 2.21 ZMO0740 General stress protein CsbD 1.44 2.56 ZMO1521 Hypothetical...”
- “...gene in ZM4 cultured in RM OXOID compared with RM+8Mg ZMO1522 TonB-dependent receptor 1.47 2.88 ZMO0286 DUF541 domain-containing protein 1.31 2.40 ZMO1754 Succinate-semialdehyde dehydrogenase SSADH 1.21 2.47 ZMO0918 Catalase 1.18 2.49 ZMO1289 Putative transglycosylase-associated protein 1.17 2.35 ZMO1776 Aminopeptidase N 1.17 2.86 ZMO1113 NADH dehydrogenase 1.15...”
- Systems-Level Analysis of Oxygen Exposure in Zymomonas mobilis: Implications for Isoprenoid Production
Martien, mSystems 2019 - “...based on their location in the genome, many are still completely uncharacterized. In particular, ZMO0122, ZMO0286, ZMO0994, ZMO1007, ZMO1563, ZMO1603, and ZMO1750 displayed trends in mRNA and protein levels that strongly suggest that they are involved in the response to oxygen, and yet they have no...”
BH11510 Outer membrane protein from Bartonella henselae str. Houston-1
Aligns to 42:242 / 245 (82.0%), covers 100.0% of PF04402, 178.1 bits
- Immunogenic Peptides from Pap31 and SCS-α of Bartonella bacilliformis: One Step Closer to a Rapid Diagnostic Tool for Carrion's Disease
Gomes, Pathogens (Basel, Switzerland) 2021 - “...PpI, and hemin-biding proteins from B. quintana [ 24 , 25 ] and Pap31 and BH11510 from B. henselae [ 26 ] have been proposed as possible candidates. Access to proteins for the development of immunogenic assays designed to detect specific immunogenic regions is limited and...”
- Hemin-binding proteins as potent markers for serological diagnosis of infections with Bartonella quintana
Matsuoka, Clinical and vaccine immunology : CVI 2013 - “...several bacterial outer membrane proteins, including Pap31 and BH11510 from B. henselae (14-20) and VompA, VompB, PpI, and hemin-binding protein E (HbpE) from...”
- Identification of candidate proteins for the diagnosis of Bartonella henselae infections using an immunoproteomic approach
Saisongkorh, FEMS microbiology letters 2010 (PubMed)- “...Pap31 protein and an outer membrane protein of BH11510 that, in our view, might be useful for the serodiagnosis of bartonellosis. Introduction Bartonella...”
- “...best hits were dihydrolipoamide succinyltransferase (SucB), EF-Tu and Omp (BH11510) that has also been identified as the best marker of IE due to Bartonella in...”
- Cloning, characterization, and expression of Bartonella henselae p26
Werner, Clinical and vaccine immunology : CVI 2006 - “...henselae open reading frames: an outer membrane protein (BH11510; p26) and a hypothetical protein (BH11520). The predicted molecular masses of the outer...”
WP_127199307 SIMPL domain-containing protein from Paenibacillus zeisoli
Aligns to 46:249 / 252 (81.0%), covers 100.0% of PF04402, 175.9 bits
- Purification, Characterization, Mode of Action, and Application of Jileicin, a Novel Antimicrobial from Paenibacillus jilinensis YPG26
Ma, Journal of agricultural and food chemistry 2022 - “...by the BLASTp algorithm showed 88.98% identity to the SIMPL domain-containing protein (GenBank accession no. WP_127199307) compared with the GenBank database ( Figure 1 B). The target protein showed an isoelectric point of 8.00 and a theoretical molecular mass of 22.561 kDa using the ProtParam tool...”
- “...Spliced amino acid sequence of jileicin comparison with the SIMPL domain-containing protein (GenBank accession no. WP_127199307, WP_068612997, WP_213621447) from the GenBank database. Antimicrobial Spectrum of Jileicin The antimicrobial activity of jileicin was assessed against a range of pathogens. Jileicin showed higher antibacterial activity against Gram-positive bacteria...”
PMI2036 hypothetical protein from Proteus mirabilis HI4320
Aligns to 31:238 / 244 (85.2%), covers 100.0% of PF04402, 175.4 bits
RLO149_03347 hypothetical protein from Roseobacter litoralis Och 149
Aligns to 1:186 / 190 (97.9%), covers 93.2% of PF04402, 175.3 bits
- Proteomic responses of Roseobacter litoralis OCh149 to starvation and light regimen
Zong, Microbes and environments 2012 - “...gi|163732693 qor quinone oxidoreductase 34.36 5.88 10 534 2.33 Unkown Proteins SU3 gi|163732454 unkown protein RLO149_03347 19.88 4.66 10 732 3.02 SU7 gi|163731750 unkown protein RLO149_20639 22.84 6.29 3 193 2.54 SU8 gi|163734708 unkown protein RLO149_14813 27.79 4.85 5 99 4.12 SD15 gi|163732606 unkown protein RLO149_12230...”
MAP0440c LpqG from Mycobacterium avium subsp. paratuberculosis str. k10
Aligns to 45:246 / 249 (81.1%), covers 100.0% of PF04402, 175.1 bits
MSMEG_6109 LpqG protein from Mycobacterium smegmatis str. MC2 155
Aligns to 45:240 / 243 (80.7%), covers 100.0% of PF04402, 173.3 bits
- Aureolic Acid Group of Agents as Potential Antituberculosis Drugs
Bespyatykh, Antibiotics (Basel, Switzerland) 2020 - “...a number of genes ( MSMEG_0438 , MSMEG_0704 , MSMEG_0806 , MSMEG_5043 , MSMEG_5879 , MSMEG_6109 , and MSMEG_6369 ) encoding lipoproteins was also documented. For mycobacteria treated with antibiotics, which disrupt formation of the cell wall (such as Cycloserine, ethambutol, and isoniazid), elevated transcription of...”
- “...dipeptidase cell wall and cell processes Cell wall/membrane/ envelope biogenesis Signal transduction| Drug resistance 2.30757 MSMEG_6109 lpqG Rv3623 LpqG protein cell wall and cell processes Function unknown Not assigned to any KEGG category 2.19376 MSMEG_6369 rfbD Rv3783 O-antigen export system, permease cell wall and cell processes...”
SGRAN_2662 SIMPL domain-containing protein from Sphingopyxis granuli
Aligns to 42:246 / 250 (82.0%), covers 98.5% of PF04402, 173.2 bits
- Two paralogous EcfG σ factors hierarchically orchestrate the activation of the General Stress Response in Sphingopyxis granuli TFA
de, Scientific reports 2020 - “...this regulon (e.g., SGRAN_1221 , SGRAN_1797 , SGRAN_1798 , SGRAN_2253 , SGRAN_2364 , SGRAN_2492 or SGRAN_2662 ) 4 . However, some other elements, such as the sphingosine kinase coding gene ( SGRAN_0919 ) 33 or the putative egtB and egtD genes ( SGRAN_4050 and SGRAN_4049 ),...”
SEN2908 hypothetical protein from Salmonella enterica subsp. enterica serovar Enteritidis str. P125109
Aligns to 30:231 / 248 (81.5%), covers 100.0% of PF04402, 173.1 bits
XF1123 outer membrane protein from Xylella fastidiosa 9a5c
Aligns to 39:238 / 242 (82.6%), covers 99.5% of PF04402, 173.0 bits
ETAE_2952 hypothetical protein from Edwardsiella tarda EIB202
Aligns to 32:235 / 239 (85.4%), covers 99.5% of PF04402, 172.2 bits
SFV_2968 putative actin from Shigella flexneri 5 str. 8401
Aligns to 19:219 / 235 (85.5%), covers 100.0% of PF04402, 171.8 bits
- High yield production process for Shigella outer membrane particles
Berlanda, PloS one 2012 - “...gi|74312961 46 2 hypothetical protein SBO_2040 [Shigella boydii Sb227] ycdO gi|82544504 47 2 hypothetical protein SFV_2968 [S. flexneri 5 str. 8401] yggE gi|110806822 Cytoplasmic 48 3 chaperonin GroEL [S. flexneri 2a str. 301] groEL gi|24115498 49 3 dihydrolipoamide dehydrogenase [S. flexneri 2a str. 301] lpdA gi|56479605...”
YggE / b2922 DUF541 domain-containing protein YggE from Escherichia coli K-12 substr. MG1655 (see 12 papers)
yggE / RF|NP_417397 uncharacterized protein yggE from Escherichia coli K12 (see paper)
NP_417397 DUF541 domain-containing protein YggE from Escherichia coli str. K-12 substr. MG1655
P0ADS6 Uncharacterized protein YggE from Escherichia coli (strain K12)
b2922 hypothetical protein from Escherichia coli str. K-12 substr. MG1655
Z4259 putative actin from Escherichia coli O157:H7 EDL933
Aligns to 30:230 / 246 (81.7%), covers 100.0% of PF04402, 171.5 bits
- Expression of the yggE gene protects Escherichia coli from potassium tellurite-generated oxidative stress.
Acuña, Archives of microbiology 2009 (PubMed)- GeneRIF: When exposed to tellurite, E. coli lacking yggE exhibited increased activity of superoxide dismutase and fumarase C, augmented levels of reactive oxygen species and high concentration of carbonyl groups in proteins.
- Comparative Analysis of Outer Membrane Vesicle Isolation Methods With an Escherichia coli tolA Mutant Reveals a Hypervesiculating Phenotype With Outer-Inner Membrane Vesicle Content
Reimer, Frontiers in microbiology 2021 - “...12 Increased in tolA P77318 ydeN Uncharacterized sulfatase YdeN tolA 0.0064 INF Increased in tolA P0ADS6 yggE Uncharacterized protein YggE tolA <0.00010 INF Increased in tolA P0ADT2 ygiB UPF0441 protein YgiB tolA 0.044 INF Increased in tolA P0ADU5 ygiW Protein YgiW WT 0.016 1.8 Increased in...”
- Decoration of outer membrane vesicles with multiple antigens by using an autotransporter approach
Daleke-Schermerhorn, Applied and environmental microbiology 2014 - “...P09394 P05458 P33363 P23847 P0A6F5 P08331 P45523 P0ADS6 P31554 P0C0V0 P02930 P45464 P0A855 P0A940 P06959 Description HbpD-d1 Multivalent Antigen Display on...”
- Formin 3 directs dendritic architecture via microtubule regulation and is required for somatosensory nociceptive behavior
Das, Development (Cambridge, England) 2021 (secret) - Genome-wide analysis of the general stress response network in Escherichia coli: sigmaS-dependent genes, promoters, and sigma factor selectivity
Weber, Journal of bacteriology 2005 - “...5.21 5.17 4.59 4.65 5.65 3.80 OD 4 b2732 b2886 b2922 b3003 b3024 b3362 b3448 b3524 b4045 b4126 b4127 b4178 b4247 b4263 b4310 b1165 b1449 b1678 b1758 b1957 b1953...”
- SigmaS-dependent gene expression at the onset of stationary phase in Escherichia coli: function of sigmaS-dependent genes and identification of their promoter sequences
Lacour, Journal of bacteriology 2004 - “...dehydrogenase protein (b2660) Putative immunogenic protein (b2922) Putative transport periplasmic protein (b3020) Hypothetical (outer membrane) protein (b3024)...”
- A cross-genomic approach for systematic mapping of phenotypic traits to genes
Jim, Genome research 2004 - “...b3356 b3924 b1256 b1813 b2069 b3775 b0610 b1075 b1083 b1688 b2922 b3010 b3328 b4355 b1073 flgF flgG fliG fhiA flhA flhB fliP fliF flgC flil flgE fliR cheR cheW...”
- Combined, functional genomic-biochemical approach to intermediary metabolism: interaction of acivicin, a glutamine amidotransferase inhibitor, with Escherichia coli K-12
Smulski, Journal of bacteriology 2001 - “...b2529 b2530 b2597 b2664 b2665 b2856 b2886 b2889 b2900 b2922 b2941 b2959 b2960 b3010 b3011 b3021 b3022 b3024 b3029 b3068 b3097 b3098 b3099 b3160 b3190 b3203...”
- Characterizing the Escherichia coli O157:H7 proteome including protein associations with higher order assemblies
Pieper, PloS one 2011 - “...uxaC 53927 CY 4.60E-05 0 466 0 carbohydrate metabolic process C3 oxidative stress response protein Z4259 yggE 26634 PP, RIB-ppi 9.62E-06 1541 5964 31 increased by AI-2 quorum signaling C3 agmatinase Z4281 speB 33556 CY, Ho-2 4.24E-06 852 5326 0 2nd step in putrescine biosynthesis C3...”
all0089 hypothetical protein from Nostoc sp. PCC 7120
Aligns to 19:219 / 221 (91.0%), covers 99.5% of PF04402, 171.0 bits
- β-N-Methylamino-L-Alanine (BMAA) Causes Severe Stress in Nostoc sp. PCC 7120 Cells under Diazotrophic Conditions: A Proteomic Study
Koksharova, Toxins 2021 - “...ABC transporter iron binding protein high-affinity iron ion transport Regulatory proteins Signaling all4662 cyclic-di-GMP-binding protein all0089 Uncharacterized conserved protein YggE, contains kinase-interacting SIMPL domain all0129 two-component system, OmpR family, response regulator RpaA Stress response all1541 peroxi- redoxin 2 family protein/ glutaredoxin Transcription all5263 sigA|RNA polymerase sigma...”
- Proteomic Insights into Starvation of Nitrogen-Replete Cells of Nostoc sp. PCC 7120 under β-N-Methylamino-L-Alanine (BMAA) Treatment
Koksharova, Toxins 2020 - “...alr4505, all1411, asr1156 ), and 7 proteins were downregulated at this cyanotoxins presence: alr1526 (RbcS), all0089 (YggE), all0129 (DNA-binding response regulator, OmpR family), all4193 (S13), alr2811 (valine-pyruvate aminotransferase), all4613 (ilvG) and all3570 (inorganic pyrophosphatase) ( Table 2 and Supplementary Table S2 ). In our previous proteomic...”
- “...in nitrogen-starved Nostoc cells under BMAA treatment. Two more proteins, uncharacterized conserved protein YggE ( all0089 ) and MBL (Metallo-Beta-Lactamase domain) fold metallo-hydrolase ( all0268 ), have been identified only in the control samples of Nostoc ( Table 2 ). They were absent in the BMAA-treated...”
- The Integrity of the Cell Wall and Its Remodeling during Heterocyst Differentiation Are Regulated by Phylogenetically Conserved Small RNA Yfr1 in Nostoc sp. Strain PCC 7120
Brenes-Álvarez, mBio 2020 - “...component of a TolC-like secretion system ( alr2887 ). In addition, the proteins encoded by all0089 and all3310 , also predicted targets, have previously been described as being located in the outer membrane, although their possible function is unknown ( 31 ). Among the top 50...”
c3500 Hypothetical protein yggE from Escherichia coli CFT073
Aligns to 30:230 / 246 (81.7%), covers 100.0% of PF04402, 170.3 bits
YPO0917 putative exported protein from Yersinia pestis CO92
Aligns to 34:237 / 259 (78.8%), covers 99.5% of PF04402, 169.9 bits
plu3611 No description from Photorhabdus luminescens subsp. laumondii TTO1
Aligns to 31:236 / 240 (85.8%), covers 99.0% of PF04402, 169.7 bits
- Genetic and proteomic characterization of rpoB mutations and their effect on nematicidal activity in Photorhabdus luminescens LN2
Qiu, PloS one 2012 - “...cancer type 2 susceptibility protein 8.75 82829.5 1 0.05 0 0 0 33 Hypothetical protein, plu3611 P. luminescens TT01 Similar to Unknown protein YggE of E. coli 5.97 25893.5 1 0 2.33 0.2 0.4 34 Hypothetical protein MHP7448_0445 Mycoplasma hyopneumoniae 7448 GI:72080777 9.17 275940.9 1 0.39...”
- “...to Unknown protein YgdH of E. coli 1 0.81 2.74 2.51 1.76 33 Hypothetical protein, plu3611 P. luminescens TT01 Similar to Unknown protein YggE of E. coli 1 2.33 0 0.2 0.4 To confirm these results, the downregulated rhlE and namB , and upregualted dsbA (GenBank...”
SENTW_3181 oxidative stress defense protein from Salmonella enterica subsp. enterica serovar Weltevreden str.
Aligns to 30:231 / 248 (81.5%), covers 100.0% of PF04402, 169.6 bits
HVO_1926 Protein of unknown function (DUF541) superfamily from Haloferax volcanii DS2
Aligns to 44:245 / 250 (80.8%), covers 100.0% of PF04402, 167.4 bits
- Mutations Affecting HVO_1357 or HVO_2248 Cause Hypermotility in Haloferax volcanii, Suggesting Roles in Motility Regulation
Collins, Genes 2020 - “...yes 3 MC4, 6, 7 1,147,136 2 HVO_0576 HVO_2248, + 2 MC36, 45 2,404,062 1 HVO_1926 HVO_2248, + 1 MC34 2,723,422 1 HVO_2229 HVO_2248 1 MC54 2,871,511 1 HVO_2377 HVO_2248, + 1 MC44 621,497 1 HVO_A0546 HVO_2248, + 1 MC52 1,867,146 4 HVO_1357 HVO_2248, + 1...”
Rv3623 PROBABLE CONSERVED LIPOPROTEIN LPQG from Mycobacterium tuberculosis H37Rv
Aligns to 38:237 / 240 (83.3%), covers 100.0% of PF04402, 166.3 bits
- Whole genome sequencing and comparative genomics of Mycobacterium orygis isolated from different animal hosts to identify specific diagnostic markers
Karthik, Frontiers in cellular and infection microbiology 2023 - “...genome analyzed. As reported earlier, RD8 (comprising of Rv3617, Rv3618, Rv3619c, Rv3620c, Rv3621c, Rv3622c, and Rv3623 affected genes) is absent in all M. orygis , and RD236a corresponds to the Rv3617 ( ephA ) gene. Since the Rv3617 gene is common in both RDs, RD236a might...”
- Immunological Characterization of Proteins Expressed by Genes Located in Mycobacterium tuberculosis-Specific Genomic Regions Encoding the ESAT6-like Proteins
Mustafa, Vaccines 2021 - “...414 aa, PPE65, PPE-family protein ORF6 Rv3622c PE32 99 aa, PE32, PE family protein ORF7 Rv3623 lpqG 240 aa, LPQG, probable conserved lipoprotein vaccines-09-00027-t005_Table 5 Table 5 The amino acid sequence identities between ESAT6, and ESAT6-like proteins encoded by RD1, RD7 and RD9. Protein Comparison with...”
- Aureolic Acid Group of Agents as Potential Antituberculosis Drugs
Bespyatykh, Antibiotics (Basel, Switzerland) 2020 - “...wall and cell processes Cell wall/membrane/ envelope biogenesis Signal transduction| Drug resistance 2.30757 MSMEG_6109 lpqG Rv3623 LpqG protein cell wall and cell processes Function unknown Not assigned to any KEGG category 2.19376 MSMEG_6369 rfbD Rv3783 O-antigen export system, permease cell wall and cell processes Carbohydrate transport...”
- Potential Plasticity of the Mannoprotein Repertoire Associated to Mycobacterium tuberculosis Virulence Unveiled by Mass Spectrometry-Based Glycoproteomics
Tonini, Molecules (Basel, Switzerland) 2020 - “...hypothesized: i.e., the extracellular disulfide bond forming protein Dsbf (Rv1677), the LpqE (Rv3584) and LpqG (Rv3623) lipoproteins and the phage shock protein orthologue PspA (Rv2744c)). Indeed, most these mannosylated proteins are classified as integral polytopic membrane proteins that have never been considered, up to now, as...”
- “...Ox -/Cp 1982.96 0.11 164182 56.18 (K)AGQGSVMVPISAGLATPHE(-) Hex Wt/- 1820.91 0.63 164182 110.3 (K)AGQGSVMVPISAGLATPHE(-) Wt/Cp RV3623 hypothetical protein 2219.11 0.33 195215 64.2 (K)VISISEASGAAPTHEAPAPPR(G) Hex Wt/Cp 2057.06 3.52 195215 91.34 (K)VISISEASGAAPTHEAPAPPR(G) Wt/Cp 2454.19 0.84 99120 28.12 (R)VTVAPQYSNPEPAGTATITGYR(A) Hex Wt/- 2292.14 0.79 99120 93.23 (R)VTVAPQYSNPEPAGTATITGYR(A) Wt/- RV3763 lipoprotein...”
- Specific Binding Peptides from Rv3632: A Strategy for Blocking Mycobacterium tuberculosis Entry to Target Cells?
Sánchez-Barinas, BioMed research international 2019 - “...12% uranyl acetate for 15 minutes in the dark before being analysed by microscope. 2.4. Rv3623 Peptide Secondary Structure Determination The Rv3632 protein is formed by six sequential, non-overlapping 20-residue-long peptides (coded 39251 to 39256); these were obtained by solid phase multiple synthesis, purified by reverse-phase,...”
- Mycobacterium tuberculosis H37Rv LpqG Protein Peptides Can Inhibit Mycobacterial Entry through Specific Interactions
Sánchez-Barinas, Molecules (Basel, Switzerland) 2018 - “...proteins which might be involved in host-pathogen interactions, our group found that LpqG surface protein (Rv3623) found in M. tuberculosis complex strains was located on the mycobacterial envelope and that peptide 16661 ( 21 SGCDSHNSGSLGADPRQVTVY 40 ) had high specific binding to U937 monocyte-derived macrophages and...”
- “...16661 sequence should be considered in such design. LpqG lipoprotein Mycobacterium tuberculosis vaccine synthetic peptide Rv3623 mycobacterial entry inhibition 1. Introduction Tuberculosis is an air-born infection caused by the acid-alcohol resistant Mycobacterium tuberculosis ( Mtb ) bacillus and other Mycobacterium tuberculosis complex (MTC) strains [ 1...”
- Deciphering the metabolic response of Mycobacterium tuberculosis to nitrogen stress
Williams, Molecular microbiology 2015 - “...* Not Sig esxW Y 4060630 36 40623514062391 48.07 Rv3622c * 0.81 PE32 Y None Rv3623 Not Sig lpqG Y 4062342 Both a Assigned peak number. b Peak coordinates on the M. tuberculosis genome. c Fold enrichment of each peak compared with the input control calculated...”
- The PhoP-dependent ncRNA Mcr7 modulates the TAT secretion system in Mycobacterium tuberculosis
Solans, PLoS pathogens 2014 - “...Rv1180 pks3 68.01 pks3-pks4-papA3-mmpL10 Rv3487c lipF 39.05 151.59 Rv3488 Rv3488 1.35 Rv3622c PE32 34.48 1.08 Rv3623 lpqG 1.19 Rv2329c narK1 34.15 83.24 Rv2330c lppP 34.15 1.11 Rv2331 Rv2331 55.72 Rv3312A Rv3312A 29.14 165.71 Rv2633c Rv2633c 27.02 16.55 Rv2633c-Rv2632c Rv1185c fadD21 26.09 8.16 Rv1040c PE8 24.85 16.40...”
- More
Vpar_0473 protein of unknown function DUF541 from Veillonella parvula DSM 2008
Aligns to 38:240 / 243 (83.5%), covers 100.0% of PF04402, 163.5 bits
THC0290_1426 SIMPL domain-containing protein from Flavobacterium psychrophilum
Aligns to 29:228 / 231 (86.6%), covers 100.0% of PF04402, 161.0 bits
M892_13325 oxidative stress defense protein from Vibrio campbellii ATCC BAA-1116
Aligns to 30:228 / 231 (86.1%), covers 100.0% of PF04402, 161.0 bits
Q9KUN2 Oxidative stress defense protein from Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
VC0483 conserved hypothetical protein from Vibrio cholerae O1 biovar eltor str. N16961
Aligns to 35:234 / 238 (84.0%), covers 100.0% of PF04402, 156.5 bits
- A communal bacterial adhesin anchors biofilm and bystander cells to surfaces
Absalon, PLoS pathogens 2011 - “...(P0C6C3), ChiA-2 (Q9KND8), HlyA (P09545), and HAP (P24153). Table 2: VC0174 (Q9KVH2), VC0430 (Q9KUT5), VC0483 (Q9KUN2), VC1101 (Q9KT04), VC1154 (Q9KSV2), VC1334 (Q9KSC4), VC1384 (Q9KS75), VC1523 (Q9KRW1), VC1834 (Q9KR13), VC1853 (Q9KQZ4), VC1887 (Q9KQW1), VC1894 (Q9KQV4), VC2168 (Q9KQ36), VC2517 (Q9KP59), VCA0026 (Y2826), VCA0058 (Q9KNA7), VCA0144 (Q9KN22), and VCA0900...”
- A communal bacterial adhesin anchors biofilm and bystander cells to surfaces
Absalon, PLoS pathogens 2011 - “...Table 2 Extracytoplasmic proteins of unknown location. Genomic Locus Annotation VC0174 hypothetical VC0430 immunogenic protein VC0483 hypothetical VC1101 hypothetical VC1154 hypothetical VC1334 hypothetical VC1384 hypothetical VC1523 hypothetical VC1834 hypothetical VC1853 hypothetical VC1887 hypothetical VC1894 hypothetical VC2168 hypothetical VC2517 hypothetical VCA0026 hypothetical VCA0058 conserved, hypothetical VCA0144 immunogenic...”
- “...FlaA (P0C6C3), ChiA-2 (Q9KND8), HlyA (P09545), and HAP (P24153). Table 2: VC0174 (Q9KVH2), VC0430 (Q9KUT5), VC0483 (Q9KUN2), VC1101 (Q9KT04), VC1154 (Q9KSV2), VC1334 (Q9KSC4), VC1384 (Q9KS75), VC1523 (Q9KRW1), VC1834 (Q9KR13), VC1853 (Q9KQZ4), VC1887 (Q9KQW1), VC1894 (Q9KQV4), VC2168 (Q9KQ36), VC2517 (Q9KP59), VCA0026 (Y2826), VCA0058 (Q9KNA7), VCA0144 (Q9KN22), and...”
slr0431 unknown protein from Synechocystis sp. PCC 6803
Aligns to 48:248 / 250 (80.4%), covers 99.5% of PF04402, 155.6 bits
- Proximity-based proteomics reveals the thylakoid lumen proteome in the cyanobacterium Synechococcus sp. PCC 7002
Dahlgren, Photosynthesis research 2021 - “...factor sll0226 Thylakoid membrane (2, 4, 5), Inner membrane (5, 24) A1433 None 5.18 Unknown slr0431 Thylakoid membrane (22), Inner membrane (11, 15), Outer membrane (13, 15) A2606 One 5.07 Prohibitin slr1106 Thylakoid membrane (2, 4, 5, 6, 37), Inner membrane (11, 12, 26, 37) A0339...”
- Proteomic and metabolomic analyses reveal metabolic responses to 3-hydroxypropionic acid synthesized internally in cyanobacterium Synechocystis sp. PCC 6803
Wang, Biotechnology for biofuels 2016 - “...Sll0541, Slr1019, Sll0482, Slr1856, Sll1087 and Slr1200) and 10 proteins were up-regulated (i.e., Slr0420, Sll1773, Slr0431, Slr1227, Sll1869, Sll0385, Sll1699, Slr0844, Sll1598 and Sll1491) according to the iTRAQ proteomic analysis, respectively. Comparative RT-PCR analysis between the 3-HP-producing SM strain and WT showed overall good consistence between...”
- “...ratio Function description Up-regulated slr0420 2.760.05 4.051.88 Hypothetical protein sll1773 2.510.05 4.241.65 Conserved hypothetical protein slr0431 2.420.09 2.610.83 Conserved hypothetical protein slr1227 2.020.36 0.850.15 OMP1 precursor sll1869 1.710.16 2.710.46 A-subunit oxygenase sll0385 1.350.02 0.900.46 ABC transporter sll1699 1.340.04 2.220.34 Extracellular solute binding slr0844 1.370.06 0.880.25 NADH-plastoquinone...”
- Identification and bioinformatic analysis of the membrane proteins of synechocystis sp. PCC 6803
Wang, Proteome science 2009 - “...and outer membrane proteins, including two porins (Slr1841, Slr1908) and four hypothetical proteins (Slr1506, Sll1835, Slr0431 and Slr1270). Finally, 2 proteins were present in all of the three membrane systems, including photosystem II subunit PsbQ (Sll1638) [ 32 - 34 ] and the iron transport system...”
bp26 / CAA90862.1 bp26 from Brucella abortus (see paper)
Aligns to 40:256 / 259 (83.8%), covers 100.0% of PF04402, 153.4 bits
BA4304 conserved hypothetical protein from Bacillus anthracis str. Ames
Aligns to 23:220 / 223 (88.8%), covers 100.0% of PF04402, 150.7 bits
SCO2021 hypothetical protein from Streptomyces coelicolor A3(2)
Aligns to 1:193 / 197 (98.0%), covers 97.6% of PF04402, 145.2 bits
- Expression of genes of the Pho regulon is altered in Streptomyces coelicolor
Millan-Oropeza, Scientific reports 2020 - “...Cluster 2 also includes some proteins involved in the resistance to oxidative stress such as SCO2021, DpsA (SCO0596) that contributes to DNA protection during severe oxidative stress 57 , 58 , the superoxide dismutases (SOD) SCO0999 and SCO2633, the H 2 O 2 scavengers including the...”
- Pre-sporulation stages of Streptomyces differentiation: state-of-the-art and future perspectives
Yagüe, FEMS microbiology letters 2013 - “...SCO2523 SCO3550 SCO5028 SCO5818 SCO6849 SCP2.05c SCO1246 SCO2532 SCO3556 SCO5166 SCO5835 SCO6865 IL1 like (cl01077) SCO2021 DEADc (cd00046) SCO3732 SCO4096 Caspase (cl00042) + Ser/Thr kinases SCO6861 AP-ATPase + TIR (cl02060) SCO4632 SCO5629 HtrA shock-induced-envelope-associated serine proteases (HtrA), Toll/IL-1 Receptor (TIR), AAA ATPases, Ser/Thr kinases, apoptotic ATPases...”
Hlac_2298 protein of unknown function DUF541 from Halorubrum lacusprofundi ATCC 49239
Aligns to 44:246 / 251 (80.9%), covers 100.0% of PF04402, 136.1 bits
- Morphological and proteomic analysis of biofilms from the Antarctic archaeon, Halorubrum lacusprofundi
Liao, Scientific reports 2016 - “...nucleoside-diphosphate-sugar epimerase involved in glycosylation (Hlac_1891) and a range of secreted proteins (Hlac_3146, Hlac_1583, Hlac_0389, Hlac_2298, Hlac_2472, Hlac_1867). Specific transporters, and enzymes requiring the imported solutes as cofactors, had higher abundance in biofilms; these included ABC transporter lipoproteins for molybdate (Hlac_2057) and zinc (Hlac_1191), a zinc-dependent...”
- “...a higher abundance of alkyl hydroperoxide reductase (Ahp; Hlac_1677), a secreted antioxidant protein (YggE homolog; Hlac_2298), the cysteine biosynthesis protein CysK (Hlac_1763), proteins involved in the assembly of iron-sulfur (FeS) clusters (Hlac_0175, Hlac_0176), chromosomal protein MC1 (Hlac_0021), and a predicted DNA helicase (Hlac_3022), and the lower...”
TDE1584 lipoprotein, putative from Treponema denticola ATCC 35405
Aligns to 35:246 / 249 (85.1%), covers 100.0% of PF04402, 129.2 bits
LIC11334 conserved hypothetical protein from Leptospira interrogans serovar Copenhageni str. Fiocruz L1-130
Aligns to 27:220 / 223 (87.0%), covers 100.0% of PF04402, 126.9 bits
Y5A_011315 SIMPL domain-containing protein from Burkholderia glumae AU6208
Aligns to 35:234 / 237 (84.4%), covers 99.0% of PF04402, 126.4 bits
BCAL2669 hypothetical protein from Burkholderia cenocepacia J2315
Aligns to 44:243 / 246 (81.3%), covers 99.0% of PF04402, 126.1 bits
A2VW75 Periplasmic/secreted protein from Burkholderia cenocepacia PC184
Aligns to 44:243 / 246 (81.3%), covers 99.0% of PF04402, 125.7 bits
WP_016560806 SIMPL domain-containing protein from Leptospira kirschneri serovar Cynopteri str. 3522 CT
Aligns to 27:222 / 225 (87.1%), covers 100.0% of PF04402, 125.2 bits
- Discovery of Leptospira spp. seroreactive peptides using ORFeome phage display
Ramli, PLoS neglected tropical diseases 2019 - “...Leptospira sp . P2653] WP_083867789 1329 12 1 DUF541 domain-containing protein [ Leptospira kirschneri ] WP_016560806 5167 13 1 arylsulfatase [Leptospira fainei ] WP_016550521 530550 14 1 sterol desaturase family protein [ Leptospira ] WP_100784316 242260 15 1 hypothetical protein LEP1GSC150_4200 [ Leptospira interrogans serovar Copenhageni...”
BPSL0972 putative exported protein from Burkholderia pseudomallei K96243
Aligns to 43:242 / 245 (81.6%), covers 99.0% of PF04402, 124.0 bits
- Clinical features that affect indirect-hemagglutination-assay responses to Burkholderia pseudomallei
Harris, Clinical and vaccine immunology : CVI 2009 - “...attempted to develop well-defined recombinant antigens, such as BipD, BPSL0972, or OmpA, for use in an EIA format. Of these, the use of OmpA shows encouraging...”
- Evaluation of recombinant antigens for diagnosis of melioidosis
Allwood, FEMS immunology and medical microbiology 2008 (PubMed)- “...purification and evaluation of three recombinant antigenic proteins, BPSL0972, BipD and OmpA from B. pseudomallei 08, for their potential in the serodiagnosis...”
- “...were included. The indirect ELISAs using BipD and BPSL0972 as antigens demonstrated poor to moderate sensitivities (42% and 51%, respectively) but good...”
PA4495 hypothetical protein from Pseudomonas aeruginosa PAO1
Q9HVS6 DUF541 domain-containing protein from Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Aligns to 31:231 / 236 (85.2%), covers 99.5% of PF04402, 120.7 bits
- Targeting the Pseudomonas aeruginosa Virulence Factor Phospholipase C With Engineered Liposomes
Wolfmeier, Frontiers in microbiology 2022 - “...PALES_03441 42 PA0347 Hemolytic phospholipase C plcH PALES_44741 83 PA0844 Hypothetical protein n.a. PALES_48751 25 PA4495 Hypothetical protein n.a. PALES_12461 42 PA3734 Ketol-acid reductoisomerase ilvC PALES_50791 36 PA4694 Major intrinsic multiple antibiotic resistance efflux outer membrane protein OprM oprM PALES_04251 53 PA0427 Ornithine carbamoyltransferase arcB PALES_55641...”
- A Shaving Proteomic Approach to Unveil Surface Proteins Modulation of Multi-Drug Resistant Pseudomonas aeruginosa Strains Isolated From Cystic Fibrosis Patients
Montemari, Frontiers in medicine 2022 - “...PA4874 Uncharacterized protein 0.01 Q9HVE9 PA4643 Uncharacterized protein 100 Q9HVF2 PA4639 Uncharacterized protein 100 Q9HVS6 PA4495 Uncharacterized protein 0.01 Q9HWW2 PA4066 Uncharacterized protein 100 100 Q9HXL0 PA3785 Uncharacterized protein 21.783 Q9HYE2 PA3464 Uncharacterized protein 100 Q9HYI4 PA3421 Uncharacterized protein 100 Q9HYJ1 PA3414 Uncharacterized protein 100 Q9HYJ2...”
- Exoproteomics for Better Understanding Pseudomonas aeruginosa Virulence
Sauvage, Toxins 2020 - “...using Selected Reaction Monitoring (SRM) was undertaken for ten proteins. Five proteins (LasB, CbpD, PasP, PA4495, and PA1342) were more abundant in the AES-1R cultured in ASMDM in contrast to PAO1, suggesting that abundant virulence factors are important for lung infection. Moreover, 2-DE and LC-MS/MS can...”
- Pseudomonas aeruginosa transcriptome during human infection
Cornforth, Proceedings of the National Academy of Sciences of the United States of America 2018 - “...3.2 2.5 PA4570 2.8 2.0 3.2 PA3237 7.0 4.0 7.9 PA2018 mexY 2.3 2.0 2.5 PA4495 4.0 1.5 4.8 PA4709 phuS 2.4 1.9 2.8 PA4710 phuR 3.4 0.8 4.2 PA2662 3.7 1.7 4.4 PA4843 gcbA 3.2 2.6 3.9 PA4470 fumC1 1.8 0.6 2.3 PA2931 cifR 2.2...”
- σ Factor and Anti-σ Factor That Control Swarming Motility and Biofilm Formation in Pseudomonas aeruginosa
McGuffie, Journal of bacteriology 2015 - “...contain the putative promoter regions of sbrI, muiA, and PA4495, respectively, fused to the lacZ gene and integrated in single copy into the CTX locus in the...”
- “...upstream intergenic regions of muiA (122 bp) and PA4495 (275 bp) were also PCR amplified and cloned into mini-CTX-lacZ on HindIII/BamHI fragments to generate...”
- The Pseudomonas aeruginosa periplasmic protease CtpA can affect systems that impact its ability to mount both acute and chronic infections
Seo, Infection and immunity 2013 - “...groEL F groEL R PA2896 F PA2896 R PA4495 F PA4495 R PA1494 F PA1494 R ctpA F ctpA R GTACCGTGATCAGCGAAGAAG GGTCGTAGTCGGAAGTGGTTTC TACCAGGAAACCTGGCTCAG...”
- “...with Taq DNA polymerase (Qiagen), with the exception of PA4495 experiments, in which 100 ng of cDNA was used. Each PCR mixture contained 0.4 M each of...”
- Secretome of transmissible Pseudomonas aeruginosa AES-1R grown in a cystic fibrosis lung-like environment
Scott, Journal of proteome research 2013 (PubMed)- “...levels of PasP, LasB, chitin-binding protein (CbpD), and PA4495 were identified in AES-1R ASMDM supernatants. Quantitative PCR showed elevated pasP in AES-1R...”
- “...| J. Proteome Res. 2013, 12, 5357-5369 5360 PA4495 PA3836 PA4625 PA1249 PA2250 PA0026 PA5119 PA1874 PA5153 PA5426 PA4053 PA3770 PA4175 PA4431 PA0888 PA1074...”
- A theoretical and experimental proteome map of Pseudomonas aeruginosa PAO1
Lecoutere, MicrobiologyOpen 2012 - “...132 PA4483 gatA Glu tRNA amidotransferase J U 51.9 51 5.52 5.32 0.638 0.119 133 PA4495 Hypothetical protein S U 24.9 28 5.79 5.33 0.677 0.146 134 PA4495 Hypothetical protein S U 24.9 28 5.79 5.39 0.677 0.146 135 PA4572 fklB Peptidylprolyl cis-trans isomerase O OM...”
- More
- A Shaving Proteomic Approach to Unveil Surface Proteins Modulation of Multi-Drug Resistant Pseudomonas aeruginosa Strains Isolated From Cystic Fibrosis Patients
Montemari, Frontiers in medicine 2022 - “...Q9HUT9 PA4874 Uncharacterized protein 0.01 Q9HVE9 PA4643 Uncharacterized protein 100 Q9HVF2 PA4639 Uncharacterized protein 100 Q9HVS6 PA4495 Uncharacterized protein 0.01 Q9HWW2 PA4066 Uncharacterized protein 100 100 Q9HXL0 PA3785 Uncharacterized protein 21.783 Q9HYE2 PA3464 Uncharacterized protein 100 Q9HYI4 PA3421 Uncharacterized protein 100 Q9HYJ1 PA3414 Uncharacterized protein 100...”
EY04_RS03745 SIMPL domain-containing protein from Pseudomonas chlororaphis
Aligns to 34:233 / 238 (84.0%), covers 99.0% of PF04402, 118.4 bits
- Investigation of the quorum-sensing regulon of the biocontrol bacterium Pseudomonas chlororaphis strain PA23
Shah, PloS one 2020 - “...-1.74 tccaCCGACAAGCTCAGGCAGGtcat Histidine kinase cl27674 K EY04_RS02720 - 1.91 82 cgaaCCGGCCTGAGCGGCCAGAacca Hypothetical protein cl01077 - EY04_RS03745 - -2.16 474 ttctCCGACCTGTTCGGCAAGGgcct Carbon-nitrogen hydrolase COG0388 R EY04_RS03865 3.14 1.90 397 Protease TldD EY04_RS03870 1.80 - ttcgGCTGCCTGACCGCCATGGcggg N-acetylmuramoyl-L-alanine amidase COG3023 M EY04_RS05345 -2.52 -3.81 265 caggGCGGCATGGGCGGCCAAGtcgt Hypothetical protein -...”
PP0886 conserved hypothetical protein from Pseudomonas putida KT2440
Aligns to 33:231 / 238 (83.6%), covers 98.0% of PF04402, 117.3 bits
A1S_2455 putative signal peptide from Acinetobacter baumannii ATCC 17978
Aligns to 15:213 / 216 (92.1%), covers 99.5% of PF04402, 115.5 bits
- Transcriptome profiling in imipenem-selected Acinetobacter baumannii
Chang, BMC genomics 2014 - “...signal peptide A1S_2325 3.00 1.40 Putative outer membrane protein A1S_2434 2.65 1.60 Putative signal peptide A1S_2455 3.89 0.89 Putative signal peptide A1S_2456 3.38 1.59 LysR family transcriptional regulator A1S_2463 2.16 2.87 Putative ribosomal large subunit pseudouridine synthase A(RluA-like) A1S_2487 -3.93 -4.93 Hypothetical protein A1S_2487 A1S_2511 -1.62...”
ABUW_1108, ABZJ_02909 SIMPL domain-containing protein from Acinetobacter baumannii MDR-ZJ06
V5VB00 DUF541 domain-containing protein from Acinetobacter baumannii
Aligns to 32:230 / 233 (85.4%), covers 99.5% of PF04402, 115.2 bits
PSPTO_4555 conserved hypothetical protein from Pseudomonas syringae pv. tomato str. DC3000
Aligns to 32:232 / 237 (84.8%), covers 99.0% of PF04402, 114.0 bits
FSU_2695 SIMPL domain-containing protein from Fibrobacter succinogenes subsp. succinogenes S85
Aligns to 48:258 / 261 (80.8%), covers 100.0% of PF04402, 104.7 bits
- Influence of Substrates on the Surface Characteristics and Membrane Proteome of Fibrobacter succinogenes S85
Raut, PloS one 2015 - “...in the glucose (control) treatment. Moreover, there are several putative/ uncharacterised proteins (such as Fisuc_2732, FSU_2695, Fisuc_0866, Fisuc_0328, Fisuc_0888, Fisuc_0382, Fisuc_0081, Fisuc_0220, Fisuc_2572, Fisuc_2068, Fisuc_0062, Fisuc_2811, Fisuc_2965, Fisuc_2494) which were only identified or highly abundant in cellulose treatment conditions, which leads us to conclude that these...”
MSMEG_6215 hypothetical protein from Mycobacterium smegmatis str. MC2 155
Aligns to 23:235 / 241 (88.4%), covers 100.0% of PF04402, 97.7 bits
IKBP1_MOUSE / Q9ESJ7 Interleukin-1 receptor-associated kinase 1-binding protein 1; IRAK1-binding protein 1; ActA-binding protein 70; PLK-interacting protein; Signaling molecule that associates with the mouse pelle-like kinase; SIMPL from Mus musculus (Mouse) (see 4 papers)
NP_075362 interleukin-1 receptor-associated kinase 1-binding protein 1 isoform 1 from Mus musculus
Aligns to 52:247 / 259 (75.7%), covers 95.6% of PF04402, 96.1 bits
Q9JZY4 Periplasmic protein from Neisseria meningitidis serogroup B (strain MC58)
Aligns to 27:234 / 234 (88.9%), covers 99.0% of PF04402, 95.3 bits
NMC0788 putative periplasmic protein from Neisseria meningitidis FAM18
Aligns to 27:234 / 234 (88.9%), covers 99.0% of PF04402, 92.4 bits
NMA1059 putative periplasmic protein from Neisseria meningitidis Z2491
Aligns to 27:234 / 234 (88.9%), covers 99.0% of PF04402, 91.1 bits
Q5F9H4 DUF541 domain-containing protein from Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Aligns to 37:244 / 244 (85.2%), covers 99.0% of PF04402, 86.0 bits
PM1566 unknown from Pasteurella multocida subsp. multocida str. Pm70
Aligns to 31:232 / 237 (85.2%), covers 99.5% of PF04402, 79.5 bits
HD0680 conserved hypothetical protein from Haemophilus ducreyi 35000HP
Aligns to 21:222 / 225 (89.8%), covers 97.1% of PF04402, 77.8 bits
Z2800 SIMPL domain-containing protein from Escherichia coli O157:H7 str. EDL933
Aligns to 38:232 / 236 (82.6%), covers 100.0% of PF04402, 67.4 bits
- The Escherichia coli phosphotyrosine proteome relates to core pathways and virulence
Hansen, PLoS pathogens 2013 - “...Z2080 ** Y75 Putative IS-encoded protein in CP-933O NP_287748.1 Z2309 * Y76 Hypothetical protein NP_288200.1 Z2800 * Y68 Hypothetical protein NP_288905.1 Z3594 Y57 Hypothetical protein NP_289066.1 Z3776 Y4 Hypothetical protein NP_289194.1 Z3939 Y56 Hypothetical protein NP_290917.1 Z5897 Y458 Hypothetical protein * Detected in the EHEC wzc...”
ECs2473 hypothetical lipoprotein from Escherichia coli O157:H7 str. Sakai
Aligns to 42:236 / 240 (81.2%), covers 100.0% of PF04402, 67.4 bits
M892_08695 SIMPL domain-containing protein from Vibrio campbellii ATCC BAA-1116
Aligns to 41:235 / 239 (81.6%), covers 79.0% of PF04402, 63.1 bits
SO3101 conserved hypothetical protein from Shewanella oneidensis MR-1
Aligns to 41:228 / 238 (79.0%), covers 79.5% of PF04402, 60.2 bits
CJJ81176_0072 hypothetical protein from Campylobacter jejuni subsp. jejuni 81-176
Aligns to 37:224 / 233 (80.7%), covers 79.5% of PF04402, 57.9 bits
VV0509 conserved hypothetical protein from Vibrio vulnificus YJ016
Aligns to 41:233 / 238 (81.1%), covers 79.5% of PF04402, 56.8 bits
Cj0034c putative periplasmic protein from Campylobacter jejuni subsp. jejuni NCTC 11168
CJE0033 hypothetical protein from Campylobacter jejuni RM1221
YP_002343505 periplasmic protein from Campylobacter jejuni subsp. jejuni NCTC 11168 = ATCC 700819
Aligns to 37:224 / 233 (80.7%), covers 79.5% of PF04402, 55.7 bits
- Local genes for local bacteria: Evidence of allopatry in the genomes of transatlantic Campylobacter populations
Pascoe, Molecular ecology 2017 - “...recombined as numerous substitutions have been introduced (blue in Figure 3 ). Fiftyseven genes (e.g., Cj0034c and Cj0635 ) had a high level (>1%) of nucleotide divergence and high probability of recombination in all 15 pairs. This result did not arise just by chance: overall recombination...”
- “...; Sheppard, Colles etal., 2010 ; Smid etal., 2013 ). Three efflux pump genes ( Cj0034c, Cj0619 and Cj1174 ) which have been implicated in fluoroquinolone resistance, showed elevated recombination and phylogeographical variation (Table S3 ; Ge, McDermott, White, & Meng, 2005 ; Luangtongkum etal., 2009...”
- Efficient inference of recombination hot regions in bacterial genomes
Yahara, Molecular biology and evolution 2014 - “...in Inferred Recombination Hot Regions in Campylobacter jejuni . Locus Tag a Position a Description Cj0034c 5196752668 Putative periplasmic protein, probable integral membrane protein, containing six possible transmembrane domains in C-terminal half, supporting host cell adhesion Cj0035c 5266553867 Putative efflux transporter belonging to the major facilitator...”
- “...(C0032Cj0036) ( Parker et al. 2006 ) in which three genes related to membrane proteins (Cj0034c, Cj0035c, and Cj0038c) are located. Cj0034c was recently reported to be an adhesion and virulence factor in C. jejuni ( Nielsen et al. 2011 ). Cj0035c encodes a putative efflux...”
- Identification of immunogenic and virulence-associated Campylobacter jejuni proteins
Nielsen, Clinical and vaccine immunology : CVI 2012 - “...assays. These investigations revealed C. jejuni antigen 0034c (Cj0034c) to be a novel virulence factor and support the usefulness of the method. Further,...”
- “...as vaccine candidates in two mouse models, in which Cj0034c, Cj0404, and Cj0525c resulted in a reduction of invasion in spleen and liver after challenge. T he...”
- Novel Drug Targets for Food-Borne Pathogen Campylobacter jejuni: An Integrated Subtractive Genomics and Comparative Metabolic Pathway Study
Mehla, Omics : a journal of integrative biology 2015 - “...11 12 13 14 15 16 Pathway ID No. of proteins cje0033 cje00401 cje00473 cje00521 cje00540 cje00550 cje00660 2 4 2 3 20 14 7 cje00680 cje01110 15 167 cje01120 88...”
- Identification of immunogenic and virulence-associated Campylobacter jejuni proteins.
Nielsen, Clinical and vaccine immunology : CVI 2012 - GeneRIF: the Cj0034c gene, may encode a new adhesion factor in C. jejuni, as deletion of this gene resulted in reduced adhesion to epithelial cells
U3KQ34 Interleukin 1 receptor associated kinase 1 binding protein 1 from Homo sapiens
Aligns to 12:161 / 192 (78.1%), covers 64.9% of PF04402, 50.6 bits
XP_011533750 interleukin-1 receptor-associated kinase 1-binding protein 1 isoform X3 from Homo sapiens
Aligns to 53:147 / 157 (60.5%), covers 32.2% of PF04402, 46.2 bits
BBK13 conserved hypothetical protein from Borrelia burgdorferi B31
Aligns to 45:224 / 238 (75.6%), covers 78.0% of PF04402, 40.8 bits
- Articles of Significant Interest in This Issue
, Infection and immunity 2021 - The Infectivity Gene bbk13 Is Important for Multiple Phases of the Borrelia burgdorferi Enzootic Cycle
Aranjuez, Infection and immunity 2021 - “...Washington, DC 8445180 34181460 00216-21 10.1128/IAI.00216-21 Molecular Pathogenesis host-microbial-interactions Host-Microbial Interactions Spotlight The Infectivity Gene bbk13 Is Important for Multiple Phases of the Borrelia burgdorferi Enzootic Cycle Aranjuez George F. a Lasseter Amanda G. a https://orcid.org/0000-0003-3130-3795 Jewett Mollie W. a Mollie.Jewett@ucf.edu a Division of Immunity and...”
- “...School of Veterinary Medicine Citation Aranjuez GF, Lasseter AG, Jewett MW. 2021. The infectivity gene bbk13 is important for multiple phases of the Borrelia burgdorferi enzootic cycle. Infect Immun 89:e00216-21. https://doi.org/10.1128/IAI.00216-21 . 28 6 2021 16 9 2021 10 2021 16 9 2021 89 10 e00216-21...”
- The Borrelia burgdorferi infection critical BBK13 protein forms large oligomers in the spirochete membrane
Kuhn, Biochemical and biophysical research communications 2021 - “...biophysical research communications 0006-291X 1090-2104 33373861 7856088 10.1016/j.bbrc.2020.12.076 NIHMS1658092 Article The Borrelia burgdorferi infection critical BBK13 protein forms large oligomers in the spirochete membrane. Kuhn Hunter W. 1 2 Aranjuez George F. 1 Jewett Mollie W. 1 * 1 Division of Immunity and Pathogenesis, Burnett School...”
- “...mechanisms of B. burgdorferi infection remain largely undefined. Previous work identified the virulence determinant gene, bbk13 , which is critical for B. burgdorferi s ability to establish a productive disseminated infection. BBK13 is an immunogenic, non-surface exposed protein of unknown function predicted to harbor an N-terminal...”
- Lyme Disease Pathogenesis
Coburn, Current issues in molecular biology 2021 - “..., Kuhn HW , Adams PP , and Jewett MW ( 2019 ). Borrelia burgdorferi bbk13 Is Critical for Spirochete Population Expansion in the Skin during Early Infection . Infect Immun 87 . 10.1128/IAI.00887-18 Archibald FS , and Fridovich I ( 1981 ). Manganese, superoxide dismutase,...”
- “...tissues as well as induction of carditis and arthritis ( Casselli et al., 2019 ). BBK13 ( bbkIS ) lp36 Non-surface exposed immunogenic protein ( Aranjuez et al., 2019 ). Promotes B. burgdorferi proliferation and dissemination, especially in skin ( Aranjuez et al., 2019 ) Adhesion...”
- Borrelia burgdorferi bbk13 Is Critical for Spirochete Population Expansion in the Skin during Early Infection
Aranjuez, Infection and immunity 2019 - “...for Microbiology. All Rights Reserved. 1 Borrelia burgdorferi bbk13 is critical for spirochete population expansion in the skin 2 during early infection. 3 4...”
- “...identified a novel infectivity gene of unknown function, bbk13, which 32 encodes an immunogenic, non-surface exposed membrane protein that is important for 33...”
- Articles of Significant Interest in This Issue
, Infection and immunity 2019 - Transposon mutagenesis as an approach to improved understanding of Borrelia pathogenesis and biology
Lin, Frontiers in cellular and infection microbiology 2014 - “...appear to result in reduced infectivity, including those in bbk15 , and putative lipoprotein genes bbk13, bbk36, bbk37 , and bbk45 through bbk50 (Figure 2 ) (Lin et al., 2012 ). In vivo expression technology (IVET) studies by Ellis et al. ( 2013 ) indicated that...”
- HrpA, an RNA helicase involved in RNA processing, is required for mouse infectivity and tick transmission of the Lyme disease spirochete
Salman-Dilgimen, PLoS pathogens 2013 - “...for seven genes ( bb0241 , bb0243 , bb0365 , bba74 , bbi29 , and bbk13 ) that are repressed in an RpoS-dependent manner appear to be stabilized by HrpA ( i.e ., their protein levels are lower in the hrpA mutant compared to the wild-type)....”
- More
WS1329 PUTATIVE PERIPLASMIC PROTEIN from Wolinella succinogenes DSM 1740
Aligns to 51:244 / 246 (78.9%), covers 82.9% of PF04402, 30.1 bits
- Molecular signatures (unique proteins and conserved indels) that are specific for the epsilon proteobacteria (Campylobacterales)
Gupta, BMC genomics 2006 - “...that these proteins are also -proteobacteria-specific. Eight other proteins in this Table (WS0865, WS1211, WS1235, WS1329, WS1640, WS1752, WS1771 and WS2059) are missing in 12 -proteobacteria species, which could be due to selective gene loss [ 33 ]. Of these 8 proteins, WS1211, WS1752 and WS2059...”
- “...in H. hepaticus . WS1244 NP_907424 167 aa Putative lipoprotein All significant hits from -Proteobacteria WS1329 NP_907504 246 aa Putative periplasmic protein All significant hits from -Proteobacteria; absent in H. pylori . WS1344 NP_907515.1 123 aa Putative periplasmic protein All significant hits from -Proteobacteria WS1349 NP_907520.1...”
VV1_0634 hypothetical protein from Vibrio vulnificus CMCP6
Aligns to 38:151 / 170 (67.1%), covers 52.7% of PF04402, 27.9 bits
Or search for genetic data about PF04402 in the Fitness Browser
by Morgan Price,
Arkin group
Lawrence Berkeley National Laboratory