Family Search for PF04480 (DUF559)

PF04480 hits 32 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.

YcjD / b1289 DUF559 domain-containing protein YcjD from Escherichia coli K-12 substr. MG1655
b1289 hypothetical protein from Escherichia coli str. K-12 substr. MG1655
Aligns to 3:111 / 117 (93.2%), covers 99.1% of PF04480, 167.0 bits

• 18th Congress of the European Hematology Association, Stockholm, Sweden, June 13–16, 2013
  , Haematologica 2013
• Sxy induces a CRP-S regulon in Escherichia coli
  Sinha, Journal of bacteriology 2009
  • “...17 18 18 18 19 20 20 20 20 20 21 22 b1289 b0106 b0107 b0108 b0018 b3391 b3392 b3393 b3394 b3395 b2950 b2700 ycjD hofC hofB ppdD mokC hofQ hofP hofO hofN hofM...”
• Interfering with different steps of protein synthesis explored by transcriptional profiling of Escherichia coli K-12
  Sabina, Journal of bacteriology 2003
  • “...yadF aceA nrdI b3668 b2601 b1264 b1493 b3517 b3774 b1289 b2553 b0698 b1004 b0179 b2600 b1260 b3509 b1261 b2342 b2800 b3460 b3458 b1263 b1783 b0907 b0461 b2464...”

Q9JXX1 DUF559 domain-containing protein from Neisseria meningitidis serogroup B (strain MC58)
Aligns to 14:121 / 129 (83.7%), covers 97.2% of PF04480, 164.5 bits

• Towards New Drug Targets? Function Prediction of Putative Proteins of Neisseria meningitidis MC58 and Their Virulence Characterization
  Shahbaaz, Omics : a journal of integrative biology 2015
  • “...ID 114. 115. 116. 117. 118. 119. Q9JXE2 Q9JXH2 Q9JXX1 Q9JYB1 Q7DD99 Q9JYV3 120. 121. 122. 123. 124. Q9JZJ4 Q9JZK2 Q9K050 Q9K132 Q9K1N6 125. 126. 127. Q9K1G9...”

NGO0050 hypothetical protein from Neisseria gonorrhoeae FA 1090
Aligns to 13:121 / 129 (84.5%), covers 98.2% of PF04480, 164.4 bits

• Crystal structure of the 5hmC specific endonuclease PvuRts1I
  Kazrani, Nucleic acids research 2014
  • “...between the N-terminal domain of PvuRts1I and several PD-(D/E)XK endonucleases (DALI Z-scores of 6.9 for Ngo0050 from Neisseria gonorrhoeae , 4.9 for V.EcoKDcm, 4.2 for Hjc, 2.7 for PspGI and 2.5 for NgoMIV), in agreement with the inclusion of PvuRts1I in a bioinformatic survey of highly...”

P44116 Uncharacterized protein HI_1162 from Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
HI1162 conserved hypothetical protein from Haemophilus influenzae Rd KW20
Aligns to 26:134 / 157 (69.4%), covers 98.2% of PF04480, 161.5 bits

• Functional annotation of conserved hypothetical proteins from Haemophilus influenzae Rd KW20
  Shahbaaz, PloS one 2013
  • “...Putative modulator of DNA gyrase 178. HP HI1161 950121 P45083 Thioesterase 179. HP HI1162 950122 P44116 Restriction endonuclease type II-like 180. HP HI1163 950119 Q57252 FAD-linked oxidoreductase 181. HP HI1165 949810 P45085 Glutaredoxin (electron carrier) 182. HP HI1173 950125 P44119 Zinc metal-binding SPRT metallopeptidase 183. HP...”
• Functional annotation of conserved hypothetical proteins from Haemophilus influenzae Rd KW20
  Shahbaaz, PloS one 2013
  • “...P45077 TldD/PmbA, Putative modulator of DNA gyrase 178. HP HI1161 950121 P45083 Thioesterase 179. HP HI1162 950122 P44116 Restriction endonuclease type II-like 180. HP HI1163 950119 Q57252 FAD-linked oxidoreductase 181. HP HI1165 949810 P45085 Glutaredoxin (electron carrier) 182. HP HI1173 950125 P44119 Zinc metal-binding SPRT metallopeptidase...”

DR0221, DR_0221 conserved hypothetical protein from Deinococcus radiodurans R1
Aligns to 58:167 / 167 (65.9%), covers 97.2% of PF04480, 152.8 bits

• N ⁴-Cytosine DNA Methylation Is Involved in the Maintenance of Genomic Stability in Deinococcus radiodurans
  Li, Frontiers in microbiology 2019
  • “...protein DR_B0099 3.3137 5.88E-18 Poly ADP-ribose glycohydrolase, PARG DR_1297 3.09 6.24E-12 Uncharacterized membrane protein, MutK DR_0221 2.7957 1.35E-07 Endonuclease domain-containing protein (DUF559) DR_0596 2.6105 2.51E-14 DNA helicase subunit, RuvB DR_1902 2.6449 2.96E-11 ATP-dependent RecD-like DNA helicase, RecD2 DR_2586 2.4528 0.0001281 Exonuclease VII small subunit, XseB DR_1039...”
• Transcriptome dynamics of Deinococcus radiodurans recovering from ionizing radiation
  Liu, Proceedings of the National Academy of Sciences of the United States of America 2003
  • “...involved in very short patch repair (24), were activated (DR0221, DR2566, and DRB0135; Table 4). The ComEA system, which has been identified PNAS April 1, 2003...”
• Genome of the extremely radiation-resistant bacterium Deinococcus radiodurans viewed from the perspective of comparative genomics
  Makarova, Microbiology and molecular biology reviews : MMBR 2001
  • “...Gene nameb Gene_ID DRA0344, DRA0074 ycjD BS_dinB DR0221, DR2566 13 homologs (see Fig. 5) ham1/yggV DR0179 uve1/BS_ywjD DR1819 yejH/rad25 DRA0131 DR0690...”

P44075 Uncharacterized protein HI_0925 from Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
HI0925 conserved hypothetical protein from Haemophilus influenzae Rd KW20
Aligns to 6:116 / 121 (91.7%), covers 98.2% of PF04480, 152.8 bits

• Functional annotation of conserved hypothetical proteins from Haemophilus influenzae Rd KW20
  Shahbaaz, PloS one 2013
  • “...Peptidase M50 (metalloendopeptidase) 142. HP HI0920 950624 P44938 Undecaprenyl pyrophosphate synthetase 143. HP HI0925 950812 P44075 type I restriction enzyme M protein 144. HP HI0926 949651 P44076 glutaredoxin-like protein (electron transport) 145. HP HI0929 949927 P44940 Bifunctionalglutathionylspermidine synthetase/amidase 146. HP HI0930 949932 P44077 Prokaryotic membrane lipoprotein...”
• Functional annotation of conserved hypothetical proteins from Haemophilus influenzae Rd KW20
  Shahbaaz, PloS one 2013
  • “...949920 P44936 Peptidase M50 (metalloendopeptidase) 142. HP HI0920 950624 P44938 Undecaprenyl pyrophosphate synthetase 143. HP HI0925 950812 P44075 type I restriction enzyme M protein 144. HP HI0926 949651 P44076 glutaredoxin-like protein (electron transport) 145. HP HI0929 949927 P44940 Bifunctionalglutathionylspermidine synthetase/amidase 146. HP HI0930 949932 P44077 Prokaryotic...”
• Codon usage comparison of novel genes in clinical isolates of Haemophilus influenzae
  Gladitz, Nucleic acids research 2005
  • “...cytosine/adenosine deaminase) HI0906 41 173 39.17 PM 0.3 72.95 Conserved hypothetical protein (homol. to methylases) HI0925 36 122 47.52 HFDY 0 76.27 H.influenzae predicted coding region HI0983 HI0983 35 194 40.33 HFRD 0 71.52 H.influenzae predicted coding region HI1055 (type III restriction modification endonulase-like, strong homology...”

CCNA_02930 cytosolic protein from Caulobacter crescentus NA1000
CC2838 conserved hypothetical protein from Caulobacter crescentus CB15
Aligns to 56:161 / 177 (59.9%), covers 98.2% of PF04480, 142.9 bits

• Iron Deficiency Generates Oxidative Stress and Activation of the SOS Response in Caulobacter crescentus
  Leaden, Frontiers in microbiology 2018
  • “...SOS regulon was caused by the presence of DNA damage. Moreover, two genes (CCNA_01596 and CCNA_02930) that are induced by genotoxic treatments even though they do not belong to the SOS regulon are also upregulated in response to DP treatment ( da Rocha et al., 2008...”
• Identification of long intergenic repeat sequences associated with DNA methylation sites in Caulobacter crescentus and other alpha-proteobacteria
  Chen, Journal of bacteriology 2003
  • “...3351954 3616712 . . . 3616825 CC0375 CC0655 CC0716 CC1135 CC2838 CC2867 CC3011 CC3071 CC3071 CC0562 CC0710 CC1019 CC2224 CC2833 CC3117 CC3367 51 18 54 178 54 1...”

NP_946397 conserved hypothetical protein from Rhodopseudomonas palustris CGA009
Aligns to 8:118 / 144 (77.1%), covers 95.4% of PF04480, 125.2 bits

• SegH and Hef: two novel homing endonucleases whose genes replace the mobC and mobE genes in several T4-related phages
  Sandegren, Nucleic acids research 2005
  • “...group of endonucleases (residues 9102 of 144 from Rhodopseudomonas palustris hypothetical protein, GenBank accession no. NP_946397 ). Residues with black shading are conserved, and asterisks denote highly conserved residues among the diverse group of endonucleases. Figure 2 ( A ) PAGE gel 8% of the in...”

M.PspMBI7II Type I methyltransferase recognizing GTCANNNNNNTRCC with methylation at 4(m6A),-4(m6A) from Pokkaliibacter species MBI-7
Aligns to 479:589 / 679 (16.3%), covers 96.3% of PF04480, 121.3 bits

Lsp6406VI Type IIG restriction enzyme/methyltransferase recognizing CRAGCAC, ?; GTGCTYG with methylation at 6(m6A) from Leptolyngbya sp. PCC 6406
Aligns to 693:801 / 1204 (9.1%), covers 96.3% of PF04480, 120.4 bits

FTL_0977 hypothetical protein from Francisella tularensis subsp. holarctica
Aligns to 9:117 / 128 (85.2%), covers 95.4% of PF04480, 98.3 bits

• Comparison of Francisella tularensis genomes reveals evolutionary events associated with the emergence of human pathogenic strains
  Rohmer, Genome biology 2007
  • “...Spermidine synthase Other metabolism FTT0434 FTL_0500 328 33.7 - Hypothetical protein FTT0434 Other metabolism FTT0524 FTL_0977 128 28.4 - Hypothetical protein FTT0524 Hypothetical FTT0572 FTL_1339 484 31.5 - Proton-dependent oligopeptide transport (POT) family protein Transport FTT0601 FTL_0780 39 31.6 - Hypothetical protein FTT0601 Hypothetical FTT0602c FTL_0867...”

IHMA87_01755 endonuclease domain-containing protein from Pseudomonas aeruginosa
Aligns to 5:85 / 92 (88.0%), covers 66.1% of PF04480, 82.5 bits

• Genome-wide screen in human plasma identifies multifaceted complement evasion of Pseudomonas aeruginosa
  Janet-Maitre, PLoS pathogens 2023
  • “...pabB 9.79 2.55E-22 IHMA87_05840 PA5315 rpmG 9.71 2.60E-07 IHMA87_03022 PA2122 -/lipid biosynthetic process 9.65 1.27E-13 IHMA87_01755 NA - 9.51 7.37E-23 IHMA87_04617 PA4315 mvaT 9.41 1.21E-23 IHMA87_02603 NA - 9.34 4.46E-17 IHMA87_02570 NA - 9.28 3.29E-13 IHMA87_05344 PA4856 retS 9.11 2.94E-18 * IHMA87 gene identity (ID) (NCBI...”

SGL_RS19135 endonuclease domain-containing protein from Synechocystis sp. PCC 6803
Aligns to 1:69 / 78 (88.5%), covers 61.5% of PF04480, 73.5 bits

• Expression of tardigrade disordered proteins impacts the tolerance to biofuels in a model cyanobacterium Synechocystis sp. PCC 6803
  Zhang, Frontiers in microbiology 2022
  • “...Resolvase ( slr8029 ), cNMP-binding ( slr0607 ), Radical_SAM ( sll1876 ), and DUF559 ( SGL_RS19135 ). Table 4 Top20 up-regulated and down-regulated DEGs in 1321DP8. Regulation Gene ID log2FoldChange Value of p Gene description TF family Up-regulated slr5013 6.948 0.000 Hypothetical protein slr8044 5.862 0.023...”
  • “...substrate-binding protein sll0419 1.880 0.033 Hypothetical protein sll1876 1.818 0.000 Oxygen-independent coproporphyrinogen III oxidase Radical_SAM SGL_RS19135 1.806 0.000 DUF559 domain-containing protein DUF559 Down-regulated slr5082 6.447 0.002 Rpn family recombination-promoting nuclease/putative transposase sll5062 6.447 0.002 Hypothetical protein slr6103 6.161 0.007 Protein of unknown function DUF45 DUF45 sll1005...”

VCHC1A2_1623 RecQ family ATP-dependent DNA helicase from Vibrio cholerae HC-1A2
Aligns to 521:597 / 1558 (4.9%), covers 56.9% of PF04480, 38.6 bits

• A new integrative conjugative element detected in Haitian isolates of Vibrio cholerae non-O1/non-O139
  Ceccarelli, Research in microbiology 2013
  • “...Transposition, DNA-mediated VCHC1A2_1621 Hypothetical protein VCHC1A2_1621 126 - VCHC1A2_1622 smf family protein 930 DNA-mediated transformation VCHC1A2_1623 ATP-dependent DNA helicase 4677 DNA recombination VCHC1A2_1624 Hypothetical protein VCHC59A1_0788 489 - VCHC1A2_1625 Hypothetical protein VCHC1A2_1625 117 - VCHC1A2_1626 Endonuclease-1 678 Deoxyribonuclease I activity...”

HD1445 hypothetical protein from Haemophilus ducreyi 35000HP
Aligns to 77:164 / 167 (52.7%), covers 53.2% of PF04480, 34.9 bits

• Complete genome sequence of Haemophilus somnus (Histophilus somni) strain 129Pt and comparison to Haemophilus ducreyi 35000HP and Haemophilus influenzae Rd
  Challacombe, Journal of bacteriology 2007
  • “...nadV (48, 53), which encodes nicotinamide phosphoribosyl transferase (HD1445 fragment, HD1447, and HD1455), which allows strains that possess it to be grown in...”

Cp1002B_0894 type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein from Corynebacterium pseudotuberculosis
D9QCC1 DUF559 domain-containing protein from Corynebacterium pseudotuberculosis (strain C231)
Aligns to 167:268 / 294 (34.7%), covers 80.7% of PF04480, 30.1 bits

• In silico functional prediction of hypothetical proteins from the core genome of Corynebacterium pseudotuberculosis biovar ovis
  Araújo, PeerJ 2020
  • “...receptor HlyB-like Cp1002B_0820 D9QCJ2 LytR cell envelope-related transcriptional attenuator Cp1002B_0871 D9QCE2 Putative threonine/serine exporte ThrE_2 Cp1002B_0894 D9QCC1 Restriction endonuclease-like superfamily Cp1002B_0931 D9QC87 Thiamin pyrophosphokinase, catalytic domain Cp1002B_0998 D9QC41 Major facilitator superfamily domain protein Cp1002B_1042 D9QBZ8 YdcZ inner membrane exporter Cp1002B_1081 D9QBW2 DegV family protein Cp1002B_1090 D9QBV3...”
• In silico functional prediction of hypothetical proteins from the core genome of Corynebacterium pseudotuberculosis biovar ovis
  Araújo, PeerJ 2020
  • “...HlyB-like Cp1002B_0820 D9QCJ2 LytR cell envelope-related transcriptional attenuator Cp1002B_0871 D9QCE2 Putative threonine/serine exporte ThrE_2 Cp1002B_0894 D9QCC1 Restriction endonuclease-like superfamily Cp1002B_0931 D9QC87 Thiamin pyrophosphokinase, catalytic domain Cp1002B_0998 D9QC41 Major facilitator superfamily domain protein Cp1002B_1042 D9QBZ8 YdcZ inner membrane exporter Cp1002B_1081 D9QBW2 DegV family protein Cp1002B_1090 D9QBV3 Tryptophan-associated...”

I-Bth0305I homing endonuclease recognizing ATGTAAACTCACGCTTCGGTGATCCAAACGTGACAACTG, 20; CAGTTGTCACGTTTGGATCACCGAAGCGTGAGTTTACAT, 17 from Bacillus thuringiensis bacteriophage 0305phi8-36
Aligns to 165:258 / 266 (35.3%), covers 63.3% of PF04480, 29.7 bits

CTK_C00980 AAA domain-containing protein from Clostridium tyrobutyricum
Aligns to 1241:1342 / 1368 (7.5%), covers 71.6% of PF04480, 29.6 bits

• Deciphering Clostridium tyrobutyricum Metabolism Based on the Whole-Genome Sequence and Proteome Analyses
  Lee, mBio 2016
  • “...uncharacterized protein 4 3.96 5.32 28 CTK_C12660 Putative glycosyltransferase, group I 4 2.86 5.33 29 CTK_C00980 Hypothetical protein 10 5.16 5.43 30 CTK_C19550 Predicted stage III sporulation protein AH 3 0.12 5.44 31 CTK_C27380 Predicted serine kinase 3 0.43 5.57 32 CTK_C30350 18-kDa heat shock protein...”

MSMEG_5314 hypothetical protein from Mycobacterium smegmatis str. MC2 155
Aligns to 223:289 / 304 (22.0%), covers 49.5% of PF04480, 28.1 bits

• Pathogen roid rage: cholesterol utilization by Mycobacterium tuberculosis
  Wipperman, Critical reviews in biochemistry and molecular biology 2014
  • “...MSMEG_6004 oxidoreductase ? Induced, Essential KstR2 Rv3554 - fdxB ferridoxin B ? Induced Induced Rv3555c MSMEG_5314 conserved hypothetical protein Induced Induced Rv3556c MSMEG_6008 fadA6 thiolase ? Essential Induced, Essential KstR2 Rv3557 MSMEG_6009 kstR2 transcriptional repressor (TetR-like) Induced KstR2 Rv3558 - PPE64 PPE family of glycine rich...”

NGK_0449 putative very-short-patch-repair endonuclease from Neisseria gonorrhoeae NCCP11945
NGO0300 putative very-short-patch-repair endonuclease from Neisseria gonorrhoeae FA 1090
Aligns to 73:135 / 137 (46.0%), covers 38.5% of PF04480, 27.3 bits

• Characterization of type II and III restriction-modification systems from Bacillus cereus strains ATCC 10987 and ATCC 14579
  Xu, Journal of bacteriology 2012
  • “...Cg1997 NMCC_0746 CRES_0474 VSR LBUL_1145 NGO0300 NGK_0449 R1-R2 fusion (NTPase-R) Sulfurovum sp. NBC37-1 Aromatoleum aromaticum EbN1 Rhodopseudomonas palustris...”
• Transcriptional responses of Neisseria gonorrhoeae to glucose and lactate: implications for resistance to oxidative damage and biofilm formation
  Ayala, mBio 2024 (no snippet)
• Characterization of type II and III restriction-modification systems from Bacillus cereus strains ATCC 10987 and ATCC 14579
  Xu, Journal of bacteriology 2012
  • “...NCgl1704 Cg1997 NMCC_0746 CRES_0474 VSR LBUL_1145 NGO0300 NGK_0449 R1-R2 fusion (NTPase-R) Sulfurovum sp. NBC37-1 Aromatoleum aromaticum EbN1 Rhodopseudomonas...”

A1S_2347 hypothetical protein from Acinetobacter baumannii ATCC 17978
Aligns to 5:98 / 100 (94.0%), covers 51.4% of PF04480, 26.1 bits

• ppGpp signaling plays a critical role in virulence of Acinetobacter baumannii
  Kim, Virulence 2021
  • “...genes, an iron acquisition siderophore gene (A1S_2387) was most upregulated (+ 42.11 fold change), and A1S_2347 that encodes a hypothetical protein was the most downregulated ( 11.27 fold change) in the mutant strain. Genes that show at least 2-fold changes in expression in the ppGpp-deficient strain...”

TGME49_269830 RAP domain-containing protein from Toxoplasma gondii ME49
Aligns to 761:849 / 861 (10.3%), covers 45.0% of PF04480, 24.4 bits

• Immune Stimulation of RAP domain binding protein (rTgRA15) from Toxoplasma gondii
  Lew, Pathogens and global health 2018
  • “...tachyzoites [10]. The gene sequence was 99% homologous to TGME49_269830; a T. gondii ME49 protein coding gene on TGME49_chrVIII from 5 586 338 to 5 589 238...”
• Chromerid genomes reveal the evolutionary path from photosynthetic algae to obligate intracellular parasites
  Woo, eLife 2015
  • “...1 with corresponding conditions. ( C ) Sub-cellular localization of RAP proteins encoded by TGME49_237010, TGME49_269830, and TGME49_289200 was tested in T. gondii by 3 tagging of the endogenous genes with the coding sequence for the hemagglutinin epitope, together with a mitochondrial marker Tom40. See Supplementary...”

A1S_1148 hypothetical protein from Acinetobacter baumannii ATCC 17978
Aligns to 2:96 / 98 (96.9%), covers 54.1% of PF04480, 24.0 bits

• A corepressor participates in LexA-independent regulation of error-prone polymerases in Acinetobacter
  Peterson, Microbiology (Reading, England) 2020
  • “...A1S_3704 holin CP14 Regulated by DdrR A1S_1147 site-specific DNA methylase-like CP5 L A1S_3611 A1S_3612 A1S_3613 A1S_1148 A1S_1149 A1S_1151 hypothetical CP5 HNH endonuclease CP5 V hypothetical CP5 hypothetical CP5 S hypothetical CP5 hypothetical CP5 S A1S_3603 hypothetical CP5 A1S_3604 hypothetical CP5 A1S_3608 hypothetical CP5 A1S_3615 hypothetical CP5...”
• Prophage induction and differential RecA and UmuDAb transcriptome regulation in the DNA damage responses of Acinetobacter baumannii and Acinetobacter baylyi
  Hare, PloS one 2014
  • “...A1S_1595 Hypothetical protein recA 7.7 A1S_2017 Hypothetical protein recA 7.7 A1S_3767 Hypothetical protein recA 7.6 A1S_1148 Hypothetical protein recA 7.5 A1S_2036 DNA cytosine methyltransferase recA 7.5 A1S_1152 Putative helicase recA 7.3 A1S_1154 Putative bacteriophage protein recA 7.3 A1S_2033 Hypothetical protein recA 7.3 A1S_1167 Hypothetical protein recA...”

cg0328 hypothetical protein from Corynebacterium glutamicum ATCC 13032
Aligns to 171:281 / 288 (38.5%), covers 55.0% of PF04480, 23.6 bits

• Harnessing novel chromosomal integration loci to utilize an organosolv-derived hemicellulose fraction for isobutanol production with engineered Corynebacterium glutamicum
  Lange, Microbial biotechnology 2018
  • “...d Downstream gene/operon e Experimental verification CgLP1 97220 20 cg0121 cg0120 CgLP2 287966 20 cg0327 cg0328 CgLP3 f 558101 40 cg0634 ( rplO ) g cg0635 CgLP4 836158 10 cg0901 cg0902 xylAB CgLP5 837445 20 cg0903 cg0904 CgLP6 f 857008 20 cg0928 g rrnB CgLP7 1205320...”

MSMEG_0881 hypothetical protein from Mycobacterium smegmatis str. MC2 155
Aligns to 202:271 / 277 (25.3%), covers 56.9% of PF04480, 23.6 bits

• bkaR is a TetR-type repressor that controls an operon associated with branched-chain keto-acid metabolism in Mycobacteria
  Balhana, FEMS microbiology letters 2013
  • “...protein MSMEG_1548 3.0 4.3E-02 Dehydratase (propanediol utilization) MSMEG_1543 3.2 2.3E-02 Rv0458 Rv0458 EPTC-Inducible aldehyde dehydrogenase MSMEG_0881 3.4 2.2E-02 Hypothetical protein MSMEG_0066 3.3 2.2E-02 esxA Rv3875 Early secretory antigenic target The genes in bold are those directly regulated by bkaR . * Occurrence of the motif. Venugopal...”
  • “..., MSMEG_1885 , MSMEG_1548 , MSMEG_1543 , MSMEG_0066 ) or significantly repressed ( MSMEG_4005 , MSMEG_0881 ) are not associated with a motif. We conclude that these are not likely to be under the direct control of BkaR. The changes in expression in these genes may...”

PF3D7_0518100 protein AMR2 from Plasmodium falciparum 3D7
Aligns to 1252:1350 / 1379 (7.2%), covers 76.1% of PF04480, 23.4 bits

• A mutagenesis screen for essential plastid biogenesis genes in human malaria parasites
  Tang, PLoS biology 2019
  • “...for a cytoplasmic pathway for apicoplast biogenesis, and truncations of three proteins of unknown function (Pf3D7_0518100, Pf3D7_1305100, and Pf3D7_1363700) ( Table 1 ). The remaining candidates contained point mutations and had no known prior function in apicoplast biogenesis or localization to the organelle. 10.1371/journal.pbio.3000136.t001 Table 1...”
  • “...FtsH1 Ile437Ser No ND Yes c Pf3D7_1126100 Atg7, putative Gln719 * Yes ND Yes d Pf3D7_0518100 RAP protein, putative Leu1419 * No Yes ND Pf3D7_1305100 Conserved Plasmodium protein, unknown function Lys859 * Yes ND ND Pf3D7_1363700 Conserved Plasmodium protein, unknown function Tyr4669 * Yes Yes ND...”
• Widespread occurrence of lysine methylation in Plasmodium falciparum proteins at asexual blood stages
  Kaur, Scientific reports 2016
  • “...ANAIITnLYLDGTLIIEnk PF3D7_0517500 UTPglucose-1-phosphate uridylyltransferase, putative K19(Dimethyl) HILIC ANAIITNLYLDGTLIIENk PF3D7_0517500 UTPglucose-1-phosphate uridylyltransferase, putative C-Term(Methyl) HILIC VQSINSTkHNNNIK PF3D7_0518100 RAP protein, putative K8(Methyl) HILIC nETLEEYWWcVESALTWGDGDDNGPDMIVDDGGDATLLVHk PF3D7_0520900 S-adenosyl-L-homocysteine hydrolase (SAHH) K41(Methyl) HILIC EDkENLNDMYSVNVTNHnDEk PF3D7_0521300 conserved Plasmodium protein, unknown function K3(Trimethyl); C-Term(Methyl) IP QNLNASNSSGQENkQnESDGK PF3D7_0524600 50S ribosomal protein L12, apicoplast, putative...”

YkrI Type II methyl-directed restriction enzyme recognizing C, 11; G, -9 from Yersinia kristensenii
Aligns to 4:119 / 289 (40.1%), covers 76.1% of PF04480, 22.4 bits

DR2566, DR_2566 hypothetical protein from Deinococcus radiodurans R1
Aligns to 85:159 / 168 (44.6%), covers 47.7% of PF04480, 22.4 bits

• Comparative genomics of Deinococcus radiodurans: unveiling genetic discrepancies between ATCC 13939K and BAA-816 strains
  Jeong, Frontiers in microbiology 2024
  • “...restored in ATCC 13939K and other R1 strains ( Supplementary Table S4 ). The protein DR_2566, which includes the domain of unknown function (DUF) 2,726 ( Supplementary Table S2 ), is presumed to be a very short patch repair (VSR)-like nuclease ( Slade and Radman, 2011...”
• Oxidative stress resistance in Deinococcus radiodurans
  Slade, Microbiology and molecular biology reviews : MMBR 2011
  • “...repair)-like nuclease possibly involved in very-short-patch repair (DR2566), mutT (DR0261 and DR1776), ruvB (DR0596), and ssb (DR0099) (368). The maximum...”
• Transcriptome dynamics of Deinococcus radiodurans recovering from ionizing radiation
  Liu, Proceedings of the National Academy of Sciences of the United States of America 2003
  • “...in very short patch repair (24), were activated (DR0221, DR2566, and DRB0135; Table 4). The ComEA system, which has been identified PNAS April 1, 2003 vol. 100...”
• Genome of the extremely radiation-resistant bacterium Deinococcus radiodurans viewed from the perspective of comparative genomics
  Makarova, Microbiology and molecular biology reviews : MMBR 2001
  • “...Gene nameb Gene_ID DRA0344, DRA0074 ycjD BS_dinB DR0221, DR2566 13 homologs (see Fig. 5) ham1/yggV DR0179 uve1/BS_ywjD DR1819 yejH/rad25 DRA0131 DR0690 DR1721...”

P36434 Type II nicking enzyme V.HpaIIP from Haemophilus parainfluenzae
Aligns to 88:136 / 141 (34.8%), covers 39.4% of PF04480, 22.2 bits

• Differential distribution of novel restriction-modification systems in clonal lineages of Neisseria meningitidis
  Claus, Journal of bacteriology 2000
  • “...78% similarity) of Haemophilus parainfluenzae (SWISS-PROT accession no. P36434). The deduced amino acid sequence of the second ORF (420 aa) showed about 25%...”

NCgl2593 DUF559 domain-containing protein from Corynebacterium glutamicum ATCC 13032
Aligns to 194:302 / 317 (34.4%), covers 88.1% of PF04480, 22.2 bits

• The role of the transcriptional repressor CssR in Corynebacterium glutamicum in response to phenolic compounds
  Zhang, Heliyon 2024
  • “...protein 1.21 2.04E-04 NCgl2566 Threonine efflux protein 3.09 4.22E-03 NCgl2584 Antibiotic biosynthesis monooxygenase 1.16 9.49E-03 NCgl2593 Hypothetical protein 3.31 3.1E-07 NCgl2632 Hypothetical protein 1.38 9.97E-06 NCgl2637 Multicomponent Na+:H+ antiporter subunit F 3.56 1.02E-03 NCgl2638 Multicomponent Na+:H+ antiporter 1.51 2.51E-03 NCgl2704 Adenosylhomocysteine nucleosidase 1.62 2.45E-05 NCgl2713 Permease...”

OCU_05560 DUF559 domain-containing protein from Mycobacterium intracellulare ATCC 13950
Aligns to 171:273 / 278 (37.1%), covers 41.3% of PF04480, 22.0 bits

• Prominent transcriptomic changes in Mycobacterium intracellulare under acidic and oxidative stress
  Park, BMC genomics 2024
  • “...hypothetical protein Conserved hypotheticals 4.05 5.42 OCU_04530 hypothetical protein Insertion seqs and phages 4.49 18.01 OCU_05560 hypothetical protein Conserved hypotheticals 3.82 2.29 OCU_06830 zinc transporter Slc39a7 Cell wall and cell processes -2.95 -2.13 OCU_06840 hypothetical protein Regulatory proteins -3.42 -3.24 OCU_08780 hypothetical protein Conserved hypotheticals 4.88...”

Rv3555c hypothetical protein from Mycobacterium tuberculosis H37Rv
Aligns to 206:283 / 289 (27.0%), covers 44.0% of PF04480, 21.5 bits

• Comprehensive Comparative Analysis of Cholesterol Catabolic Genes/Proteins in Mycobacterial Species
  van, International journal of molecular sciences 2019
  • “...c possible oxidoreductase / 2-nitropropane dioxygenase fdxB Rv3554 e possible electron transfer protein / ferredoxin Rv3555c e CHP kstR2 Rv3557c e Tet-R transcriptional regulator (repressor) PPE64 Rv3558 e PPE Rv3559c c probable oxidoreductase fadD3 Rv3561 c acyl-CoA synthetase (AMP forming) fadE31 Rv3562 e probable acyl-CoA dehydrogenase...”
  • “...None None None None Positive mtv None None None None Positive mtc None None None Rv3555c Positive mra None None None None Positive mtf None None None Rv3566A Positive mtb None None None Rv3566A Positive mtk None None None Rv3566A Positive mtz None None None Rv3566A...”
• Non-replicating Mycobacterium tuberculosis elicits a reduced infectivity profile with corresponding modifications to the cell wall and extracellular matrix
  Bacon, PloS one 2014
  • “...vivo or in vitro data sets used for this comparison ( Table 3 ). Genes Rv3555c, Rv2642, Rv0083 were induced in the human granuloma [27] and gene Rv0251c, encoding heat shock protein hsp , was the only gene induced under all the conditions compared. 10.1371/journal.pone.0087329.t003 Table...”
  • “...dehydrogenase 75 days starvation [10] Rv3173c 4 Transcriptional regulator, tetR acrR-family 75 days starvation [10] Rv3555c 3 Conserved hypothetical protein Human granuloma v in vitro culture in 7H9, Human granuloma v pericavity [27] Table 3 Genes that were up-regulated at 48 h in macrophages [26] and...”
• Whole genome sequencing of Mycobacterium tuberculosis reveals slow growth and low mutation rates during latent infections in humans
  Colangeli, PloS one 2014
  • “...- - G Rv3519 - - - - - - A - - - T Rv3555c - - - - - - - - C - G Rv1081c - - - - A - - - - - C mutA - - - - - -...”
• Pathogen roid rage: cholesterol utilization by Mycobacterium tuberculosis
  Wipperman, Critical reviews in biochemistry and molecular biology 2014
  • “...Rv3553 MSMEG_6004 oxidoreductase ? Induced, Essential KstR2 Rv3554 - fdxB ferridoxin B ? Induced Induced Rv3555c MSMEG_5314 conserved hypothetical protein Induced Induced Rv3556c MSMEG_6008 fadA6 thiolase ? Essential Induced, Essential KstR2 Rv3557 MSMEG_6009 kstR2 transcriptional repressor (TetR-like) Induced KstR2 Rv3558 - PPE64 PPE family of glycine...”
• Transcriptional profiling of mycobacterium tuberculosis during infection: lessons learned
  Ward, Frontiers in microbiology 2010
  • “..., rv1952 , rv2005c , rv2160c , rv2262c , rv2557 , rv2603c , rv3412 , rv3555c , rv3626c , rv3706c , rv3776 , rv3860 , rv3861 rv0150c , rv1190 , rv1291c , rv1518 , rv1587c , rv1734c , rv1945 , rv3706c , rv3845 *Genes were identified...”

Or search for genetic data about PF04480 in the Fitness Browser