PaperBLAST – Find papers about a protein or its homologs

 

Family Search for PF04480 (DUF559)

PF04480.12 hits 26 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.

YcjD / b1289 DUF559 domain-containing protein YcjD from Escherichia coli K-12 substr. MG1655
b1289 hypothetical protein (NCBI) from Escherichia coli str. K-12 substr. MG1655
Aligns to 3:111 / 117 (93.2%), covers 99.1% of PF04480, 166.7 bits

Q9JXX1 DUF559 domain-containing protein from Neisseria meningitidis serogroup B (strain MC58)
Aligns to 14:121 / 129 (83.7%), covers 97.2% of PF04480, 164.3 bits

NGO0050 hypothetical protein (NCBI) from Neisseria gonorrhoeae FA 1090
Aligns to 13:121 / 129 (84.5%), covers 98.2% of PF04480, 164.2 bits

P44116 Uncharacterized protein HI_1162 from Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
HI1162 conserved hypothetical protein (NCBI ptt file) from Haemophilus influenzae Rd KW20
Aligns to 26:134 / 157 (69.4%), covers 98.2% of PF04480, 161.2 bits

P44075 Uncharacterized protein HI_0925 from Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
HI0925 conserved hypothetical protein (NCBI ptt file) from Haemophilus influenzae Rd KW20
Aligns to 6:116 / 121 (91.7%), covers 98.2% of PF04480, 153.6 bits

DR0221, DR_0221 conserved hypothetical protein (NCBI ptt file) from Deinococcus radiodurans R1
Aligns to 58:167 / 167 (65.9%), covers 97.2% of PF04480, 153.6 bits

CC2838 conserved hypothetical protein (NCBI ptt file) from Caulobacter crescentus CB15
CCNA_02930 cytosolic protein (RefSeq) from Caulobacter crescentus NA1000
Aligns to 56:161 / 177 (59.9%), covers 98.2% of PF04480, 142.5 bits

NP_946397 conserved hypothetical protein (NCBI) from Rhodopseudomonas palustris CGA009
Aligns to 8:118 / 144 (77.1%), covers 95.4% of PF04480, 125.2 bits

Lsp6406VI Type IIG restriction enzyme/methyltransferase recognizing CRAGCAC, ?; GTGCTYG with methylation at 6(6mA) from Leptolyngbya sp. PCC 6406
Aligns to 693:801 / 1204 (9.1%), covers 96.3% of PF04480, 120.3 bits

FTL_0977 hypothetical protein (NCBI) from Francisella tularensis subsp. holarctica
Aligns to 9:117 / 128 (85.2%), covers 95.4% of PF04480, 98.4 bits

VCHC1A2_1623 RecQ family ATP-dependent DNA helicase from Vibrio cholerae HC-1A2
Aligns to 521:597 / 1558 (4.9%), covers 56.9% of PF04480, 38.7 bits

HD1445 hypothetical protein (NCBI) from Haemophilus ducreyi 35000HP
Aligns to 77:164 / 167 (52.7%), covers 53.2% of PF04480, 35.0 bits

Cp1002B_0894 DUF559 domain-containing protein from Corynebacterium pseudotuberculosis
D9QCC1 DUF559 domain-containing protein from Corynebacterium pseudotuberculosis (strain C231)
Aligns to 167:268 / 294 (34.7%), covers 80.7% of PF04480, 30.0 bits

I-Bth0305I homing endonuclease recognizing ATGTAAACTCACGCTTCGGTGATCCAAACGTGACAACTG, 20; CAGTTGTCACGTTTGGATCACCGAAGCGTGAGTTTACAT, 17 from Bacillus thuringiensis bacteriophage 0305phi8-36
Aligns to 165:258 / 266 (35.3%), covers 63.3% of PF04480, 29.8 bits

CTK_C00980 DUF559 domain-containing protein from Clostridium tyrobutyricum
Aligns to 1241:1342 / 1368 (7.5%), covers 71.6% of PF04480, 29.6 bits

MSMEG_5314 hypothetical protein (NCBI) from Mycobacterium smegmatis str. MC2 155
Aligns to 223:289 / 304 (22.0%), covers 49.5% of PF04480, 28.1 bits

NGK_0449 putative very-short-patch-repair endonuclease (RefSeq) from Neisseria gonorrhoeae NCCP11945
NGO0300 putative very-short-patch-repair endonuclease (NCBI) from Neisseria gonorrhoeae FA 1090
Aligns to 87:135 / 137 (35.8%), covers 38.5% of PF04480, 27.3 bits

TGME49_269830 RAP domain-containing protein from Toxoplasma gondii ME49
Aligns to 760:849 / 861 (10.5%), covers 45.0% of PF04480, 24.5 bits

A1S_1148 hypothetical protein (RefSeq) from Acinetobacter baumannii ATCC 17978
Aligns to 2:96 / 98 (96.9%), covers 54.1% of PF04480, 24.0 bits

MSMEG_0881 hypothetical protein (NCBI) from Mycobacterium smegmatis str. MC2 155
Aligns to 202:271 / 277 (25.3%), covers 56.9% of PF04480, 23.6 bits

cg0328 hypothetical protein (RefSeq) from Corynebacterium glutamicum ATCC 13032
Aligns to 171:281 / 288 (38.5%), covers 55.0% of PF04480, 23.5 bits

PF3D7_0518100 protein AMR2 from Plasmodium falciparum 3D7
Aligns to 1252:1350 / 1379 (7.2%), covers 76.1% of PF04480, 23.4 bits

DR2566 hypothetical protein (NCBI ptt file) from Deinococcus radiodurans R1
Aligns to 85:159 / 168 (44.6%), covers 47.7% of PF04480, 22.5 bits

YkrI Type II methyl-directed restriction enzyme recognizing C, 11; G, -9 from Yersinia kristensenii
Aligns to 4:119 / 289 (40.1%), covers 76.1% of PF04480, 22.4 bits

P36434 HpaII very short patch repair endonuclease from Haemophilus parainfluenzae
Aligns to 88:136 / 141 (34.8%), covers 39.4% of PF04480, 22.2 bits

Rv3555c hypothetical protein (NCBI) from Mycobacterium tuberculosis H37Rv
Aligns to 206:282 / 289 (26.6%), covers 43.1% of PF04480, 21.5 bits

Or search for genetic data about PF04480 in the Fitness Browser

by Morgan Price, Arkin group
Lawrence Berkeley National Laboratory