Family Search for PF04504 (DUF573)
PF04504.14 hits 21 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.
AT3G04930 transcription regulator (RefSeq) from Arabidopsis thaliana
Aligns to 138:234 / 456 (21.3%), covers 100.0% of PF04504, 118.3 bits
NP_001318667 DNA-binding storekeeper protein-related transcriptional regulator from Arabidopsis thaliana
AT5G28040 transcription regulator (RefSeq) from Arabidopsis thaliana
Aligns to 125:221 / 427 (22.7%), covers 100.0% of PF04504, 117.5 bits
LOC105059742 probable transcription factor At3g04930 from Elaeis guineensis
Aligns to 130:227 / 406 (24.1%), covers 100.0% of PF04504, 115.4 bits
- Genus-wide sequencing supports a two-locus model for sex-determination in Phoenix
Torres, Nature communications 2018 - “...female flower development. NCBI GENE IDs as follows AARF: LOC105059738, GPI: LOC105059739, MY315L: LOC105059740, MAP-1: LOC105059742, CYT DA: LOC105059743, MYB-A: LOC105059783, GPAT3: LOC105059961, GPAT3tr: truncated GPAT3, TIF2: LOC105059784, CYP703: LOC105059962, BAG: LOC105059785. The intervening gene between CYP703 and BAG was not present in either male or...”
AT1G61730 DNA-binding storekeeper protein-related (RefSeq) from Arabidopsis thaliana
Aligns to 155:245 / 376 (24.2%), covers 100.0% of PF04504, 111.6 bits
AT4G00390 transcription regulator (RefSeq) from Arabidopsis thaliana
O23063 Probable transcription factor At4g00390 from Arabidopsis thaliana
Aligns to 157:247 / 364 (25.0%), covers 100.0% of PF04504, 109.4 bits
- Systematic discovery of novel eukaryotic transcriptional regulators using sequence homology independent prediction
Bossi, BMC genomics 2017 - “...AT2G15590, AT2G20590, AT2G24140, AT2G29880, AT2G32050, AT2G33350, AT2G33400, AT2G36540, AT2G36550, AT2G38823, AT2G45260, AT3G01015, AT3G02125, AT3G54520, AT3G54530, AT4G00390, AT4G27660, AT4G30830, AT4G30830, AT5G41380, AT5G59990, AT4G00130. The entry vectors in pDONR221 were obtained from ABRC (except for AT2G45260, whose cloning was described in the previous section) and were transferred to...”
- An unbiased nuclear proteomics approach reveals novel nuclear protein components that participates in MAMP-triggered immunity
Fakih, Plant signaling & behavior 2016 - “...activity suggesting a role in tRNA processing Q8L633 AT2G04530 DNA-binding storekeeper protein-related transcriptional regulator O23063 AT4G00390 157 proteins were only detected in the nucleus of cerk1 plants after chitosan treatment (reported in TableS2). It is striking that so many protein are unique to cerk1 as it...”
- Down-regulation of a single auxin efflux transport protein in tomato induces precocious fruit development
Mounet, Journal of experimental botany 2012 - “...5 0.78 0.62 J0453 U564651 NF-YB5 AT2G47810 5 0.51 0.15 J0498 U571553 DNA-binding storekeeper protein AT4G00390 5 0.79 0.59 J0632 U597825 MADS-box TF AT1G17310 5 0.40 0.26 J0637 U572195 AGAMOUS-like 2AGL20, SOC1 AT2G45660 5 0.59 0.50 J0660 U585967 AGAMOUS-like 66, AGL66 AT1G77980 5 0.55 0.74 J0681...”
- Expression of ROS-responsive genes and transcription factors after metabolic formation of H(2)O(2) in chloroplasts
Balazadeh, Frontiers in plant science 2012 - “...GeBP 0.08 1.08 At2g36610 HB 3.29 1.15 At4g00270 GeBP 0.40 0.57 At2g44910 HB 0.16 0.13 At4g00390 GeBP 0.62 1.34 At2g46680 HB 1.05 1.08 At3g01220 HB 0.78 1.01 At3g01470 HB 0.33 0.28 At4g25210 GeBP 0.14 0.80 At5g14280 GeBP 0.06 0.25 At3g03660 HB 0.86 0.97 At5g28040 GeBP 0.49...”
- Incorporating Deep Learning With Word Embedding to Identify Plant Ubiquitylation Sites
Wang, Frontiers in cell and developmental biology 2020 - “...no ubiquitylation sites reported. As shown in Table 5 , the protein with Uniport AC O23063 contains 47 lysine and the positions of 142, 222, 225 are ubiquitylated ( Walton et al., 2016 ). The iUbiq-Lys predicted five ubiquitylated sites, and only one is correct. The...”
- “...AC Organism Sequence length Number of lysine Reported ubiquitylated sites Predicted ubiquitylated sites Tools Results O23063 Arabidopsis thaliana (Mouse-ear cress) 364 47 142; 222; 225 iUbiq-Lys 3; 4; 103; 217; 225; 363 UbPred 98; 142; 197 Ubisite 142; 225; 265; 297 Proposed model 142; 222; 225;...”
- An unbiased nuclear proteomics approach reveals novel nuclear protein components that participates in MAMP-triggered immunity
Fakih, Plant signaling & behavior 2016 - “...Z activity suggesting a role in tRNA processing Q8L633 AT2G04530 DNA-binding storekeeper protein-related transcriptional regulator O23063 AT4G00390 157 proteins were only detected in the nucleus of cerk1 plants after chitosan treatment (reported in TableS2). It is striking that so many protein are unique to cerk1 as...”
AT1G11510 DNA-binding storekeeper protein-related (RefSeq) from Arabidopsis thaliana
Aligns to 138:229 / 352 (26.1%), covers 100.0% of PF04504, 108.3 bits
- Identification of Chimeric Repressors that Confer Salt and Osmotic Stress Tolerance in Arabidopsis
Kazama, Plants (Basel, Switzerland) 2013 - “...screen. Among them, CRES-T lines for ADA2b (AT4G16420), Msantd (AT4G31270), DDF1 (AT1G21610), DREB26 (AT1G21910), AtGeBP (AT1G11510), and ATHB23 (AT1G26960) listed in Table 1 showed higher germination rate and/or earlier development of cotyledons than WT plants on medium, supplemented with 175 mM NaCl ( Appendix Figure A1...”
- “...family protein DDF1 Wound-responsive DREB26-SRDX AT1G21910 AP2 domain-containing transcription factor family protein DREB26 AP2-EREBP AtGeBP-SRDX AT1G11510 DNA-binding storekeeper protein-related AtGeBP GeBP ATHB23-SRDX AT1G26960 DNA binding/transcription factor ATHB23 HB 2.2. Germination of CRES-T Lines on Medium Supplemented with Different Concentrations of NaCl and Mannitol 2.2.1. Germination Rate...”
- Integrating Rare-Variant Testing, Function Prediction, and Gene Network in Composite Resequencing-Based Genome-Wide Association Studies (CR-GWAS)
Zhu, G3 (Bethesda, Md.) 2011 - “...there was at least one significant functional SNP by functional prediction within each fragment. T23J18.17 (AT1G11510) and SMD1 (AT4G11130) met the requirements. Both genes were associated with SDV ( Table S13 ). Associations of rare variants When rare variants were considered, all collapsed methods suggested an...”
STKLS_ARATH / Q9SB42 GLABROUS1 enhancer-binding protein-like; Mediator-associated protein 1; Protein GeBPL; Storekeeper-like protein At4g25210; Transcription factor At4g25210 from Arabidopsis thaliana (Mouse-ear cress) (see 2 papers)
AT4G25210 transcription regulator (RefSeq) from Arabidopsis thaliana
NP_194251 DNA-binding storekeeper protein-related transcriptional regulator from Arabidopsis thaliana
Aligns to 141:238 / 368 (26.6%), covers 100.0% of PF04504, 100.8 bits
- function: Transcription factor that binds promoters containing the CryR2 element, 5'-ACATAWCT-3' (PubMed:25877331). The DNA-binding activity is decreased upon direct physical interaction with the mediator subunits and is modulated by redox conditions (PubMed:25877331). The oxidized protein is the preferential binding form (PubMed:25877331).
subunit: Mono-, di- and oligomers (PubMed:25877331). Associated with the Mediator complex (PubMed:17560376). Interacts with MED6 (PubMed:17560376). Interacts with MED10A, MED28 and MED32 (PubMed:25877331). - Expression of ROS-responsive genes and transcription factors after metabolic formation of H(2)O(2) in chloroplasts
Balazadeh, Frontiers in plant science 2012 - “...GeBP 0.62 1.34 At2g46680 HB 1.05 1.08 At3g01220 HB 0.78 1.01 At3g01470 HB 0.33 0.28 At4g25210 GeBP 0.14 0.80 At5g14280 GeBP 0.06 0.25 At3g03660 HB 0.86 0.97 At5g28040 GeBP 0.49 0.46 At3g11260 HB 0.27 0.71 At5g28040 GeBP 0.46 0.71 At3g18010 HB 0.78 1.05 At3g22760 CPP(Zn) 0.35...”
- High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes
Fahlgren, PloS one 2007 - “...3 (0) - Triacylglycerol lipase At1g06250 (3) e miR864-3p UAAAGUCAAUAAUACCUUGAAG - 2 (0) Expressed protein At4g25210 (3) e miR865-5p AUGAAUUUGGAUCUAAUUGAG 1 N Y 3 (0) - Serine carboxypeptidase, sulfate transporter At5g42240 (3.5) e , At3g51895 (3.5) e miR865-3p UUUUUCCUCAAAUUUAUCCAA - 1 (0) DEAD box RNA helicase,...”
- Dynamic evolution at pericentromeres
Hall, Genome research 2006 - “...0) (1, 0) (2, 1) At2g20410 At4g37780 At4g25210 At4g25210 At3g43470 At1g52940 At5g67350 At2g03330 At2g26610 At5g06480 At5g06480 At3g42150 At4g10080 At5g35695...”
- Proteomic analysis of the Arabidopsis nucleolus suggests novel nucleolar functions
Pendle, Molecular biology of the cell 2005 - “...(Q-T) proteins with unknown function: plant-specific proteins (At4g25210 and At5g64680), and conserved proteins in both plant and human proteomes (At3g56990 and...”
- Biochemical and redox characterization of the mediator complex and its associated transcription factor GeBPL, a GLABROUS1 enhancer binding protein.
Shaikhali, The Biochemical journal 2015 (PubMed)- GeneRIF: Data suggest that presence of mediator complex subunits MED10a, MED28, and MED32 or changes in redox state affect DNA-binding capacity of GeBPL (GLABROUS1/GL1 enhancer-binding protein-like). [GeBPL] [GLABROUS1/GL1 enhancer-binding protein-like]
STKLH_ARATH / Q8VYD2 GLABROUS1 enhancer-binding protein-like 1; Protein GPL1; Storekeeper-like protein At2g25650 from Arabidopsis thaliana (Mouse-ear cress) (see 3 papers)
NP_565602 DNA-binding storekeeper protein-related transcriptional regulator from Arabidopsis thaliana
AT2G25650 DNA-binding storekeeper protein-related (RefSeq) from Arabidopsis thaliana
Aligns to 65:159 / 386 (24.6%), covers 98.9% of PF04504, 99.5 bits
- function: Probable transcription factor. May play redundant roles with GEBP and GPL2 in cytokinin responses by regulating the transcript levels of type-A ARR response genes (PubMed:18162594). Involved in stress responses (PubMed:21875893). Plays a repressive role in cell expansion by counteracting the positive role of CPR5 in this process, but does not regulate cell proliferation or endoreduplication (PubMed:21875893).
subunit: Homo- and heterodimers. Interacts with GEBP, GPL2 and GPL3. Interacts with GEBP (PubMed:29192025). - GeBP/GPL transcription factors regulate a subset of CPR5-dependent processes.
Perazza, Plant physiology 2011 - GeneRIF: GeBP/GPLs regulate a set of genes that represents a subset of the CPR5 pathway.[GPL1]
- Expression of ROS-responsive genes and transcription factors after metabolic formation of H(2)O(2) in chloroplasts
Balazadeh, Frontiers in plant science 2012 - “...HB 0.03 0.55 At1g61730 GeBP 0.28 0.49 At2g27990 HB 1.10 0.32 At2g28610 HB 0.64 0.68 At2g25650 GeBP 0.03 0.63 At5g16470 C2H2 0.01 0.53 At5g43250 CCAAT-HAP5 0.08 0.78 At5g16540 C2H2 0.15 0.85 At5g50470 CCAAT-HAP5 1.23 0.96 At5g18550 C2H2 1.57 0.12 At5g50480 CCAAT-HAP5 1.61 0.40 At5g63470 CCAAT-HAP5 0.08...”
- Contribution of transcriptional regulation to natural variations in Arabidopsis
Chen, Genome biology 2005 - “...The L er sequences of genes 12222_s_at (At2g20990), 14097_at (At2g47770), 20561_at (At2g46930), 14634_s_at (At4g27440), 13483_at (At2g25650), 15290_at (At2g20840), 13111_at (At2g38040), 14072_at (At1g67480), 14172_at (At3g54140), 14947_at (At4g37450), 16892_at (At5g45890), 17860_at (At4g27410), 20545_at (At5g27470) were obtained by BLASTing the full-length cDNA sequences or coding sequences of these genes...”
STKLO_ARATH / Q9ASZ1 GLABROUS1 enhancer-binding protein; Probable transcription factor At4g00270; Protein GeBP; Protein STOREKEEPER RELATED 1; Storekeeper-like protein At4g00270 from Arabidopsis thaliana (Mouse-ear cress) (see 5 papers)
AT4G00270 DNA-binding storekeeper protein-related (RefSeq) from Arabidopsis thaliana
Aligns to 64:158 / 302 (31.5%), covers 98.9% of PF04504, 95.7 bits
- function: DNA-binding protein, which specifically recognizes the GL1 enhancer sequence (PubMed:12535344). May be involved in leaf initiation (PubMed:12535344). May play redundant roles with GPL1 and GPL2 in cytokinin responses by regulating the transcript levels of type-A ARR response genes (PubMed:18162594). Involved in stress responses (PubMed:21875893). Plays a repressive role in cell expansion by counteracting the positive role of CPR5 in this process, but does not regulate cell proliferation or endoreduplication (PubMed:21875893). May play a role in plant defense (PubMed:29192025).
subunit: Homo- and heterodimers (PubMed:18162594, PubMed:29192025). Interacts with GPL1, GPL2 and GPL3 (PubMed:18162594). Interacts with KIN10, KIN11 and FLZ4 (PubMed:24600465). Interacts with KIN10 and KIN11 via its N-terminal part (PubMed:29192025). Interacts with GPL1 and GPL3 via its C-terminal part (PubMed:29192025).
disruption phenotype: No visible phenotype. - EffectorK, a comprehensive resource to mine for Ralstonia, Xanthomonas, and other published effector interactors in the Arabidopsis proteome
González-Fuente, Molecular plant pathology 2020 - “...6 exo70e2 mutant showed reduced flg22induced callose deposition. Redditt et al . ( 2019 ) AT4G00270 STOREKEEPERrelated 1 (STKR1) 6 STKR1 overexpressing plants showed reduced Hyaloperonospora arabidopsidis spore formation Nietzsche et al . ( 2018 ) AT3G01670 SIEVE ELEMENT OCLUSSIONrelated 2 (SEOR2) 4 Myzus persicae feeding...”
- The Agrobacterium F-Box Protein Effector VirF Destabilizes the Arabidopsis GLABROUS1 Enhancer/Binding Protein-Like Transcription Factor VFP4, a Transcriptional Activator of Defense Response Genes
García-Cano, Molecular plant-microbe interactions : MPMI 2018 - “...of VFP4 ( At5g28040 ) was aligned with those of proteins encoded by At3g04930 and At4g00270 (GeBP) using ClustalX (ver. 2.1). The DNA-binding domain and the overlapping DUF573 domain are delineated by a gray box. A white box delineates the putative monopartite nuclear localization signal (NLS)...”
- The complex becomes more complex: protein-protein interactions of SnRK1 with DUF581 family proteins provide a framework for cell- and stimulus type-specific SnRK1 signaling in plants
Nietzsche, Frontiers in plant science 2014 - “...shown). In addition, multiple clones encoded a protein annotated as DNA-binding storekeeper protein-related transcriptional regulator (At4g00270; hereafter referred to as STKR1 for storekeeper related 1), member of a protein family that has been associated with sucrose-regulated gene expression in potato (Zourelidou et al., 2002 ). A...”
- Expression of ROS-responsive genes and transcription factors after metabolic formation of H(2)O(2) in chloroplasts
Balazadeh, Frontiers in plant science 2012 - “...GeBP 0.10 0.87 At2g34710 HB 1.04 0.32 At4g00250 GeBP 1.42 2.65 At2g35940 HB 0.53 0.95 At4g00270 GeBP 0.08 1.08 At2g36610 HB 3.29 1.15 At4g00270 GeBP 0.40 0.57 At2g44910 HB 0.16 0.13 At4g00390 GeBP 0.62 1.34 At2g46680 HB 1.05 1.08 At3g01220 HB 0.78 1.01 At3g01470 HB 0.33...”
STKLT_ARATH / P0DKL0 GLABROUS1 enhancer-binding protein-like 2; Protein GPL2; Storekeeper-like protein At5g14280 from Arabidopsis thaliana (Mouse-ear cress) (see 2 papers)
Aligns to 61:155 / 301 (31.6%), covers 97.9% of PF04504, 93.1 bits
- function: Probable transcription factor. May play redundant roles with GEBP and GPL1 in cytokinin responses by regulating the transcript levels of type-A ARR response genes. Involved in stress responses (PubMed:21875893). Plays a repressive role in cell expansion by counteracting the positive role of CPR5 in this process, but does not regulate cell proliferation or endoreduplication (PubMed:21875893).
subunit: Homo- and heterodimers. Interacts with GEBP, GPL1 and GPL3.
STK_SOLTU / Q94IK2 STOREKEEPER protein from Solanum tuberosum (Potato) (see paper)
Aligns to 156:247 / 399 (23.1%), covers 97.9% of PF04504, 92.5 bits
- function: May act as a transcriptional regulator. Binds specifically to the B-box motif, a promoter element that is required for the tuber- specific and sucrose inducible expression of the patatin gene.
AT4G01260 transcription regulator (RefSeq) from Arabidopsis thaliana
Aligns to 107:204 / 325 (30.2%), covers 100.0% of PF04504, 92.2 bits
Sb03g005180 No description from Sorghum bicolor
Aligns to 86:184 / 406 (24.4%), covers 98.9% of PF04504, 91.5 bits
AT5G14280 DNA-binding storekeeper protein-related (RefSeq) from Arabidopsis thaliana
Aligns to 61:155 / 572 (16.6%), covers 97.9% of PF04504, 91.5 bits
AT1G66420 transcription regulator (RefSeq) from Arabidopsis thaliana
Aligns to 87:174 / 282 (31.2%), covers 100.0% of PF04504, 90.9 bits
- Global scale transcriptome analysis of Arabidopsis embryogenesis in vitro
Wickramasuriya, BMC genomics 2015 - “...C2H2-type zinc finger family protein AT5G52600 3.52 MYB MYB82 AT5G40220 3.28 MADS Protein agamous-like 43 AT1G66420 3.27 GeBP DNA-binding storekeeper protein-related transcriptional regulator AT1G13260 3.26 RAV AP2/ERF and B3 domain-containing TF AT2G47190 3.09 MYB R2R3 MYB DNA binding domain TF (MYB2) AT3G56970 3.01 bHLH ORG2 (BHLH038)...”
AT1G44810 transcription regulator (RefSeq) from Arabidopsis thaliana
NP_564491 DNA-binding storekeeper protein-related transcriptional regulator from Arabidopsis thaliana
Aligns to 122:210 / 296 (30.1%), covers 100.0% of PF04504, 87.7 bits
- Drought stress induces a biphasic NO accumulation in Arabidopsis thaliana
Ederli, Plant signaling & behavior 2019 (secret) - Root avoidance of toxic metals requires the GeBP-LIKE 4 transcription factor in Arabidopsis thaliana
Khare, The New phytologist 2017 - “...with 70M CdCl 2 (Fig.S1). We identified a novel TF belonging to the GeBP family (At1g44810, Fig. 1 a) and confirmed the Cd tolerance with independently generated CREST lines. We named this TF GeBPLIKE 4 (GPL4) because it is the fourth GeBPlike TF to be identified...”
- Genome-scale cold stress response regulatory networks in ten Arabidopsis thaliana ecotypes
Barah, BMC genomics 2013 - “...WRKY50, At1g16640, At3g06160, At4g34400, At4g00940, At5g49300, At3g57480, At5g10970, At2g05160, At5g40880, At3g16940, t5g38140, At2g20110, At1g07520, At1g63100, At1g44810, At4g00232, At4g26170, At1g09710, At1g33420, At2g01810, At3g53370, At5g51910, At1g76870, At1g26260, At1g62975, At4g00870, At4g14410, At4g29930, At5g46830, At5g65320 Kas.1 AtGRF3, BPC6, HAt3, HSFA8, IAA29, SSL2, SWN, WRKY3, WRKY32, WRKY66, At3g45260, At1g67310, At2g45460 AL1,...”
- Expression of ROS-responsive genes and transcription factors after metabolic formation of H(2)O(2) in chloroplasts
Balazadeh, Frontiers in plant science 2012 - “...HB 1.44 1.14 At5g59570 GARP-G2-like 0.60 0.87 At2g22430 HB 1.79 1.63 At2g22800 HB 0.69 0.49 At1g44810 GeBP 0.70 0.32 At2g23760 HB 0.03 0.55 At1g61730 GeBP 0.28 0.49 At2g27990 HB 1.10 0.32 At2g28610 HB 0.64 0.68 At2g25650 GeBP 0.03 0.63 At5g16470 C2H2 0.01 0.53 At5g43250 CCAAT-HAP5 0.08...”
- Root avoidance of toxic metals requires the GeBP-LIKE 4 transcription factor in Arabidopsis thaliana.
Khare, The New phytologist 2017 - GeneRIF: GPL4 inhibits the growth of roots exposed to toxic metals by modulating reactive oxygen species concentrations, thereby allowing roots to colonize noncontaminated regions of the rhizosphere.[GPL4]
STKLN_ARATH / O23077 Transcription factor STKL2; Protein Storekeeper-like 2 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
AT4G00250 DNA-binding storekeeper protein-related (RefSeq) from Arabidopsis thaliana
NP_567161 DNA-binding storekeeper protein-related transcriptional regulator from Arabidopsis thaliana
Aligns to 115:203 / 319 (27.9%), covers 98.9% of PF04504, 87.1 bits
- function: Transcription repressor that binds DNA in a sequence-specific manner, 5'-GCCT-3', to regulate the expression of PGR. Acts as a modulatory component for the glucose-triggered developmental leaf growth process.
- Regulation of Gene Expression of Methionine Sulfoxide Reductases and Their New Putative Roles in Plants
Kalemba, International journal of molecular sciences 2019 - “..., AtMsrB8 , OsMsrA2.2 , OsMsrA5 , OsMsrB1 , OsMsrB3 DNA-binding storekeeper protein-related transcriptional regulator (AT4G00250) aaaat tGATCc aaagct AtMsrB2 , AtMsrB6 , AtMsrB7 , AtPMSR3 , OsMsrA2.2 , PtMsrA4.1 Class I GATA factors aagat GATA aatgtgtg AtMsrB6 , AtPMSR2 , OsMsrA2.2 , OsMsrA5 , OsMsrB1...”
- Induction of desiccation tolerance in desiccation sensitive Citrus limon seeds
Marques, Journal of integrative plant biology 2019 - “...2.11E04 23 625 AT3G20840 PLETHORA 1 (PLT1) 2.12E04 17 402 AT5G08130 (BIM1) 2.62E04 30 917 AT4G00250 (ATSTKL2) 2.85E04 17 412 AT2G35530 BASIC REGION/LEUCINE ZIPPER TRANSCRIPTION FACTOR 16 (bZIP16) 2.86E04 53 1,945 AT5G61270 PHYTOCHROMEINTERACTING FACTOR7 (PIF7) 3.39E04 41 1,409 AT5G02840 LHY/CCA1LIKE 1 (LCL1) 5.31E04 21 587 AT1G10120...”
- The modulation of acetic acid pathway genes in Arabidopsis improves survival under drought stress
Rasheed, Scientific reports 2018 - “...AT5G50770 Hydroxysteroid dehydrogenase 6 (HSD6) 0.98 1.01 2.25 AT2G18193 Nucleoside triphosphate hydrolases 1.06 4.43 2.23 AT4G00250 ATSTKL2 1.59 1.10 2.21 AT1G71200 bHLH superfamily protein 1.11 1.80 2.20 AT3G10790 F-box associated ubiquitination effector 1.15 1.00 2.20 AT2G17950 WUSCHEL (WUS) 3.82 1.49 2.19 AT5G24640 Hypothetical protein 1.20 3.13...”
- The Sugar-Signaling Hub: Overview of Regulators and Interaction with the Hormonal and Metabolic Network
Sakr, International journal of molecular sciences 2018 - “...pathways. Response to osmotic stress and salt 5-GCCGCC-3 [ 463 , 464 , 465 ] AT4G00250 ATSTKL2 GeBP Response to sugar signaling 5-GCCT-3 [ 440 ] The code of bind site follows the IUPAC role. * The binding sites are predicted by PlantPAN database ( http://plantpan2.itps.ncku.edu.tw/index.html...”
- Expression of ROS-responsive genes and transcription factors after metabolic formation of H(2)O(2) in chloroplasts
Balazadeh, Frontiers in plant science 2012 - “...17.6 MADS AGL105 Unknown function 5 At3g53340 0.4 6.5 17.5 CCAAT-HAP3 NF-YB10 Unknown function 5 At4g00250 0.4 6.3 16.8 GeBP Indirect regulation of cytokinin response genes 2 At5g26930 0.7 9.6 13.5 C2C2(Zn)GATA GATA-23 Controls lateral root founder cell specification 2 At4g26930 0.4 4.6 13.0 MYB MYB97...”
- “...CPP(Zn) 0.23 0.67 At2g36340 GeBP 0.40 0.23 At3g04930 GeBP 0.10 0.87 At2g34710 HB 1.04 0.32 At4g00250 GeBP 1.42 2.65 At2g35940 HB 0.53 0.95 At4g00270 GeBP 0.08 1.08 At2g36610 HB 3.29 1.15 At4g00270 GeBP 0.40 0.57 At2g44910 HB 0.16 0.13 At4g00390 GeBP 0.62 1.34 At2g46680 HB 1.05...”
- Metabolomic, transcriptional, hormonal, and signaling cross-talk in superroot2
Morant, Molecular plant 2010 - “...SPL3 AT2G33810 prevent early flowering 5.60E04 1.6 GeBP family (16 members according to http://Arabidopsis.med.ohio-state.edu/AtTFDB ) AT4G00250 8.07E04 2.1 bHLH family (161 members according to http://Arabidopsis.med.ohio-state.edu/AtTFDB ) bHLH135 AT1G74500 8.49E04 +1.6 Transcription factors with a known function are shown in bold. To elucidate which biological processes are...”
- Regulation of Arabidopsis thaliana plasma membrane glucose-responsive regulator (AtPGR) expression by A. thaliana storekeeper-like transcription factor, AtSTKL, modulates glucose response in Arabidopsis.
Chung, Plant physiology and biochemistry : PPB 2016 (PubMed)- GeneRIF: AtSTKL1 and AtSTKL2 function both as repressors of AtPGR transcription and as novel transcription factors in the Glc signaling pathway.[AtSTKL2]
STKLI_ARATH / Q9SJM4 GLABROUS1 enhancer-binding protein-like 3; Protein GPL3; Storekeeper-like protein At2g36340 from Arabidopsis thaliana (Mouse-ear cress) (see 3 papers)
AT2G36340 DNA-binding storekeeper protein-related (RefSeq) from Arabidopsis thaliana
Aligns to 59:153 / 414 (22.9%), covers 97.9% of PF04504, 83.7 bits
- function: Probable transcription factor. Involved in stress responses (PubMed:21875893). Plays a repressive role in cell expansion by counteracting the positive role of CPR5 in this process, but does not regulate cell proliferation or endoreduplication (PubMed:21875893).
subunit: Homo- and heterodimers. Interacts with GEBP, GPL1 and GPL2. Interacts with GEBP (PubMed:29192025). - Expression of ROS-responsive genes and transcription factors after metabolic formation of H(2)O(2) in chloroplasts
Balazadeh, Frontiers in plant science 2012 - “...CPP(Zn) 0.14 0.03 At3g04850 CPP(Zn) 0.01 0.08 At5g40710 C2H2 0.13 0.95 At3g16160 CPP(Zn) 0.23 0.67 At2g36340 GeBP 0.40 0.23 At3g04930 GeBP 0.10 0.87 At2g34710 HB 1.04 0.32 At4g00250 GeBP 1.42 2.65 At2g35940 HB 0.53 0.95 At4g00270 GeBP 0.08 1.08 At2g36610 HB 3.29 1.15 At4g00270 GeBP 0.40...”
- Analysis of the cDNAs of hypothetical genes on Arabidopsis chromosome 2 reveals numerous transcript variants
Xiao, Plant physiology 2005 (PubMed)- “...hypothetical genes (At2g02540, At2g31270, At2g33640, At2g35550, and At2g36340) were cloned into report constructs, and their expressions are tissue or...”
- “...genes (At2g02540, At2g31270, At2g33640, At2g35550, and At2g36340). The expression patterns of these five promoter-reporter constructs display highly localized...”
STKLM_ARATH / Q8LG05 Transcription factor STKL1; Protein Storekeeper-like 1 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
NP_567159 DNA-binding storekeeper protein-related (RefSeq) from Arabidopsis thaliana
AT4G00238, NP_567159 DNA-binding storekeeper protein-related transcriptional regulator from Arabidopsis thaliana
Aligns to 140:228 / 345 (25.8%), covers 98.9% of PF04504, 79.7 bits
- function: Transcription repressor that binds DNA in a sequence-specific manner, 5'-GCCT-3', to regulate the expression of PGR. Acts as a modulatory component for the glucose-triggered developmental leaf growth process.
- The phosphoproteome in regenerating protoplasts from Physcomitrella patens protonemata shows changes paralleling postembryonic development in higher plants
Wang, Journal of experimental botany 2014 - “...36.5 6.91 NP_188063 CID9 (CTC-interacting domain 9); RNA binding/protein binding Unknown NFFES#ACGEVTR C45 38.2 8.81 NP_567159 DNA-binding storekeeper protein-related Nucleus T#LNS#PSAAVAVSDDSES#EK C46 36.8 8.33 NP_174084 CYCT1;3 (CYCLIN T 1;3); cyclin-dependent protein kinase Nucleus NVSLFESPQCET#S#K Signal transduction (12.96%) C47 71.7 6.43 Q8H0V1 CDK5RAP1-like protein Unknown AT#HAS#SS#SSSALLPR C48...”
- Drought stress induces a biphasic NO accumulation in Arabidopsis thaliana
Ederli, Plant signaling & behavior 2019 (secret) - The Sugar-Signaling Hub: Overview of Regulators and Interaction with the Hormonal and Metabolic Network
Sakr, International journal of molecular sciences 2018 - “...AT3G44290 NAC060 NAC Response to sugar-and ABA signaling cascade Unknown [ 315 , 439 ] AT4G00238 AtSTKL1 GeBP Involved in mediating certain glucose responses 5-GCCT-3 [ 440 ] AT5G08790 ATAF2 NAC Response to sugar, jasmonic signaling pathways. Seedling photomorphogenesis and leaf senescence 5-RTKVCGTR-3 * [ 441...”
- Regulation of Arabidopsis thaliana plasma membrane glucose-responsive regulator (AtPGR) expression by A. thaliana storekeeper-like transcription factor, AtSTKL, modulates glucose response in Arabidopsis.
Chung, Plant physiology and biochemistry : PPB 2016 (PubMed)- GeneRIF: AtSTKL1 and AtSTKL2 function both as repressors of AtPGR transcription and as novel transcription factors in the Glc signaling pathway.[AtSTKL1]
AT4G00232 hypothetical protein (RefSeq) from Arabidopsis thaliana
Aligns to 43:135 / 154 (60.4%), covers 96.8% of PF04504, 68.0 bits
- Genome-scale cold stress response regulatory networks in ten Arabidopsis thaliana ecotypes
Barah, BMC genomics 2013 - “...At1g16640, At3g06160, At4g34400, At4g00940, At5g49300, At3g57480, At5g10970, At2g05160, At5g40880, At3g16940, t5g38140, At2g20110, At1g07520, At1g63100, At1g44810, At4g00232, At4g26170, At1g09710, At1g33420, At2g01810, At3g53370, At5g51910, At1g76870, At1g26260, At1g62975, At4g00870, At4g14410, At4g29930, At5g46830, At5g65320 Kas.1 AtGRF3, BPC6, HAt3, HSFA8, IAA29, SSL2, SWN, WRKY3, WRKY32, WRKY66, At3g45260, At1g67310, At2g45460 AL1, BT4,...”
AT4G00130 hypothetical protein (RefSeq) from Arabidopsis thaliana
Aligns to 22:90 / 194 (35.6%), covers 60.0% of PF04504, 41.2 bits
- Induction of epigenetic variation in Arabidopsis by over-expression of DNA METHYLTRANSFERASE1 (MET1)
Brocklehurst, PloS one 2018 - “...A1+ 2.816 3.50E-15 upstream CML41, calmodulin-like 41 FUNCTIONS IN: calcium ion binding A1- -0.948 0.00018459 AT4G00130 A1+ 2.452 6.56E-08 region DNA-binding storekeeper protein-related transcriptional regulator A1- -3.355 4.03E-63 Several of the genes listed in Table 2 have been shown to be sensitive to DNA methylation changes....”
- Systematic discovery of novel eukaryotic transcriptional regulators using sequence homology independent prediction
Bossi, BMC genomics 2017 - “...entry vectors containing the genes AT3G29180, AT3G13990, AT4G28300, AT5G46780, AT1G78310, AT2G33350, AT1G04500, AT5G41380, AT5G59990 and AT4G00130 were obtained from ABRC. Dr. Enrico Magnani provided the entry vector containing the ATHB1 gene (INRA, Centre de Versailles-Grignon, France) and Dr. Zhiyong Wang donated the entry vector containing the...”
- “...AT2G33400, AT2G36540, AT2G36550, AT2G38823, AT2G45260, AT3G01015, AT3G02125, AT3G54520, AT3G54530, AT4G00390, AT4G27660, AT4G30830, AT4G30830, AT5G41380, AT5G59990, AT4G00130. The entry vectors in pDONR221 were obtained from ABRC (except for AT2G45260, whose cloning was described in the previous section) and were transferred to the yeast destination vector pDEST32 using...”
- A transcriptional dynamic network during Arabidopsis thaliana pollen development
Wang, BMC systems biology 2011 - “...AT1G52520) are activated during pollen development, while the genes for the rest 3 TFs (AT3G63350, AT4G00130, AT3G04100) remain relatively high expression without significant change (Figure 1 ). AT4G17490 (ATERF6) gene, encoding the ethylene responsive element binding factor 6 [ 22 ], belongs to AP2-EREBP gene family...”
- “...BCP. Its gene expression has been confirmed as pollen specific [ 31 - 33 ]. AT4G00130 (F6N15.6) gene presents a rapidly reduced activity from BCP to HP and a sharp increase from HP to 0.5 hr stage. AT3G20670 (HTA13) gene, which is expressed in pollen tube...”
Or search for genetic data about PF04504 in the Fitness Browser
by Morgan Price,
Arkin group
Lawrence Berkeley National Laboratory