Family Search for PF04504 (DUF573)
PF04504 hits 23 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.
AT3G04930 transcription regulator (RefSeq) from Arabidopsis thaliana
Aligns to 138:234 / 456 (21.3%), covers 100.0% of PF04504, 116.3 bits
- Proteolytic Activation of Plant Membrane-Bound Transcription Factors
De, Frontiers in plant science 2022 - “...AT2G29660 N 0.477 I 126-149 9-29 sec, mt, nuc ph(1) * R(1) K(6) R(4) * AT3G04930 C 0.486 II 137-235 372-395 nuc | | PM ph(5) * 0 K(1) 1 AT5G25475 N 0.606 I 78-155 52-75 Mt [PxxN] K(1) K(1)R(5) * 2 AT5G63280 C 0.836 II...”
- “...specific functions were assigned to the other atMB-TFs: water deprivation (ANAC028), cell-to-cell transport of viruses (AT3G04930), JA responses (SPL14), regulation of root development and cell junctions (AT2G29960), regulation of pigment biosynthesis (AT5G63280), and regulation of the phenylpropanoid pathway and suberin biosynthesis (bZIP7). However, further experimental studies...”
- Proteome profiles during early stage of somatic embryogenesis of two Eucalyptus species
Chen, BMC plant biology 2022 - “...deregulated in the two Eucalyptus species during SE (Table 1 ). The 4 TFs included At3g04930, ASR3, RAP2-1 and NFYB3. It is notable that WOX8 (WUSCHEL-related homeobox 8, NP_001289667.1) was upregulated in the early SE of the two Eucalyptus species. In addition, we found ARF19, PIN1...”
- Molecular Targets and Biological Functions of cAMP Signaling in Arabidopsis.
Xu, Biomolecules 2021 - “...Transcription (gene description) GO:0006355~regulation of transcription AT1G61470 (CCR4-ASSOCIATED FACTOR 1E, CAF1E), AT2G40130 (SMAX1-LIKE 8, SMXL8), AT3G04930 (DNA-binding storekeeper protein-related transcriptional regulator), AT5G36740 (Acyl-CoA N-acyltransferase with RING/FYVE/PHD-type zinc finger), AT5G57180 (CHLOROPLAST IMPORT APPARATUS 2, CIA2) * Transcription factor (TF) family indicated in parenthesis was determined following the...”
- The Agrobacterium F-Box Protein Effector VirF Destabilizes the Arabidopsis GLABROUS1 Enhancer/Binding Protein-Like Transcription Factor VFP4, a Transcriptional Activator of Defense Response Genes
García-Cano, Molecular plant-microbe interactions : MPMI 2018 - “...acid sequence of VFP4 ( At5g28040 ) was aligned with those of proteins encoded by At3g04930 and At4g00270 (GeBP) using ClustalX (ver. 2.1). The DNA-binding domain and the overlapping DUF573 domain are delineated by a gray box. A white box delineates the putative monopartite nuclear localization...”
- CrY2H-seq: a massively multiplexed assay for deep-coverage interactome mapping
Trigg, Nature methods 2017 - “...interacting partners found co-expressed in this study, but five of AT5G60142s partners (ASIL2, AT3G58630, AT1G76870, AT3G04930, and STKL1) were significantly up-regulated in cells from the same distinct domain. These interactions may form part of a previously unrecognized module underlying early stage reproductive development. We also found...”
- Expression of ROS-responsive genes and transcription factors after metabolic formation of H(2)O(2) in chloroplasts
Balazadeh, Frontiers in plant science 2012 - “...CPP(Zn) 0.01 0.08 At5g40710 C2H2 0.13 0.95 At3g16160 CPP(Zn) 0.23 0.67 At2g36340 GeBP 0.40 0.23 At3g04930 GeBP 0.10 0.87 At2g34710 HB 1.04 0.32 At4g00250 GeBP 1.42 2.65 At2g35940 HB 0.53 0.95 At4g00270 GeBP 0.08 1.08 At2g36610 HB 3.29 1.15 At4g00270 GeBP 0.40 0.57 At2g44910 HB 0.16...”
NP_001318667 DNA-binding storekeeper protein-related transcriptional regulator from Arabidopsis thaliana
AT5G28040 transcription regulator (RefSeq) from Arabidopsis thaliana
Aligns to 125:221 / 427 (22.7%), covers 100.0% of PF04504, 115.4 bits
- The Agrobacterium F-Box Protein Effector VirF Destabilizes the Arabidopsis GLABROUS1 Enhancer/Binding Protein-Like Transcription Factor VFP4, a Transcriptional Activator of Defense Response Genes.
García-Cano, Molecular plant-microbe interactions : MPMI 2018 - GeneRIF: Gain-of-function lines of VFP4 and ATL31 exhibited recalcitrance to Agrobacterium tumorigenicity, suggesting that A. tumefaciens may utilize the host ubiquitin/proteasome system to destabilize transcriptional regulators of the host disease response machinery.
- Genome-Wide Association Study for Agro-Morphological Traits in Eggplant Core Collection
Ro, Plants (Basel, Switzerland) 2022 - “...factor genes (Trihelix transcription factor ASIL2, Probable WRKY transcription factor 35, and Probable transcription factor At5g28040) were found to have a significant association with stem prickles. One of the three SNPs was linked to both leaf and stem prickles. This SNP was located on Ch01 (14404622...”
- The Agrobacterium F-Box Protein Effector VirF Destabilizes the Arabidopsis GLABROUS1 Enhancer/Binding Protein-Like Transcription Factor VFP4, a Transcriptional Activator of Defense Response Genes
García-Cano, Molecular plant-microbe interactions : MPMI 2018 - “...2B ). The VFP4 gene is located on chromosome 5 in the Arabidopsis genome ( At5g28040 ). Sequence analysis of the full-length VFP4 cDNA predicted a single open reading frame (ORF) that would encode a protein of 427 amino acid residues with a molecular mass of...”
- “...alignment of VFP4 and its selected Arabidopsis homologs. The amino acid sequence of VFP4 ( At5g28040 ) was aligned with those of proteins encoded by At3g04930 and At4g00270 (GeBP) using ClustalX (ver. 2.1). The DNA-binding domain and the overlapping DUF573 domain are delineated by a gray...”
- Assessing the transcriptional regulation of L-cysteine desulfhydrase 1 in Arabidopsis thaliana
Laureano-Marín, Frontiers in plant science 2014 - “...consists of 2836 bp from the intergenic region between DES1 (At5g28030) and the upstream gene At5g28040, 14 bp of the first exon containing the 5-UTR region, 118 bp of the first intron and 34 bp of the second exon that contains the remainder of the 5-UTR...”
- Expression of ROS-responsive genes and transcription factors after metabolic formation of H(2)O(2) in chloroplasts
Balazadeh, Frontiers in plant science 2012 - “...HB 0.33 0.28 At4g25210 GeBP 0.14 0.80 At5g14280 GeBP 0.06 0.25 At3g03660 HB 0.86 0.97 At5g28040 GeBP 0.49 0.46 At3g11260 HB 0.27 0.71 At5g28040 GeBP 0.46 0.71 At3g18010 HB 0.78 1.05 At3g22760 CPP(Zn) 0.35 0.13 At5g43170 C2H2 0.48 1.24 At3g22780 CPP(Zn) 0.13 0.19 At5g43540 C2H2 1.44...”
STKLD_ARATH / Q9SYA9 Probable transcription factor At1g61730; Storekeeper-like protein At1g61730 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
AT1G61730 DNA-binding storekeeper protein-related (RefSeq) from Arabidopsis thaliana
Aligns to 155:245 / 376 (24.2%), covers 100.0% of PF04504, 113.6 bits
LOC105059742 probable transcription factor At3g04930 from Elaeis guineensis
Aligns to 130:227 / 406 (24.1%), covers 100.0% of PF04504, 111.4 bits
- Genus-wide sequencing supports a two-locus model for sex-determination in Phoenix
Torres, Nature communications 2018 - “...female flower development. NCBI GENE IDs as follows AARF: LOC105059738, GPI: LOC105059739, MY315L: LOC105059740, MAP-1: LOC105059742, CYT DA: LOC105059743, MYB-A: LOC105059783, GPAT3: LOC105059961, GPAT3tr: truncated GPAT3, TIF2: LOC105059784, CYP703: LOC105059962, BAG: LOC105059785. The intervening gene between CYP703 and BAG was not present in either male or...”
AT4G00390 transcription regulator (RefSeq) from Arabidopsis thaliana
O23063 Probable transcription factor At4g00390 from Arabidopsis thaliana
Aligns to 157:247 / 364 (25.0%), covers 100.0% of PF04504, 110.4 bits
- Fine mapping and characterization of RLL6 locus required for anti-silencing of a transgene and DNA demethylation in Arabidopsis thaliana
Wang, Frontiers in genetics 2022 - “...AT4G00280 ER protein carbohydrate-binding protein AT4G00295 fringe-like protein AT4G00305 RING/U-box superfamily protein AT4G00342 hypothetical protein AT4G00390 DNA-binding storekeeper protein-related transcriptional regulator AT4G00416 MBD3, Protein containing methyl-CpG-binding domain AT4G00420 Double-stranded RNA-binding domain-containing protein AT4G00480 MYC1, MYC-related protein with a basic helix-loop-helix motif at the C-terminus AT4G00540 MYB3R2,...”
- Interdependent iron and phosphorus availability controls photosynthesis through retrograde signaling
Nam, Nature communications 2021 - “...SALK_023173 (AT1G13608), SAIL_1243_E04 (AT1G13609), SAIL_897_D11 (AT1G13610), N469134 (At4g00355), SALK_128714 (AT4G00360), N469134 (AT4G00370), SAIL_842_E09 (AT4G00380), N866595 (At4g00390), SAIL_633_E10 (At4g00400), SALK_077222 (AT3G02870) SALK_053900 (AT3G46980), SALK_114708 (AT5G20380), SAIL_809_B01 (AT5G44370), SALK_067629 (AT4G28610), and SALK_039445 (AT5G20150) were obtained from the Nottingham Arabidopsis Stock Centre (NASC). Homozygous mutant lines were confirmed by...”
- Pathogen and drought stress affect cell wall and phytohormone signaling to shape host responses in a sorghum COMT bmr12 mutant
Khasin, BMC plant biology 2021 - “...Pink scarecrow-like protein 1 SbZHD7 Sobic.005G019800 Dark grey NA SbGBP14 Sobic.007G153700 Brown probable transcription factor At4g00390 SbOrphan149 Sobic.009G126700 Orange SNF2 domain-containing protein CLASSY 4 SbMYB2 Sobic.001G075300 Priming Dark orange myb-related protein Hv1 SbWRKY85 Sobic.009G234100 Priming Red probable WRKY transcription factor 34 SbZIM2 Sobic.001G100100 Smaller lesion Turquoise...”
- Systematic discovery of novel eukaryotic transcriptional regulators using sequence homology independent prediction
Bossi, BMC genomics 2017 - “...AT2G15590, AT2G20590, AT2G24140, AT2G29880, AT2G32050, AT2G33350, AT2G33400, AT2G36540, AT2G36550, AT2G38823, AT2G45260, AT3G01015, AT3G02125, AT3G54520, AT3G54530, AT4G00390, AT4G27660, AT4G30830, AT4G30830, AT5G41380, AT5G59990, AT4G00130. The entry vectors in pDONR221 were obtained from ABRC (except for AT2G45260, whose cloning was described in the previous section) and were transferred to...”
- An unbiased nuclear proteomics approach reveals novel nuclear protein components that participates in MAMP-triggered immunity
Fakih, Plant signaling & behavior 2016 - “...activity suggesting a role in tRNA processing Q8L633 AT2G04530 DNA-binding storekeeper protein-related transcriptional regulator O23063 AT4G00390 157 proteins were only detected in the nucleus of cerk1 plants after chitosan treatment (reported in TableS2). It is striking that so many protein are unique to cerk1 as it...”
- Down-regulation of a single auxin efflux transport protein in tomato induces precocious fruit development
Mounet, Journal of experimental botany 2012 - “...5 0.78 0.62 J0453 U564651 NF-YB5 AT2G47810 5 0.51 0.15 J0498 U571553 DNA-binding storekeeper protein AT4G00390 5 0.79 0.59 J0632 U597825 MADS-box TF AT1G17310 5 0.40 0.26 J0637 U572195 AGAMOUS-like 2AGL20, SOC1 AT2G45660 5 0.59 0.50 J0660 U585967 AGAMOUS-like 66, AGL66 AT1G77980 5 0.55 0.74 J0681...”
- Expression of ROS-responsive genes and transcription factors after metabolic formation of H(2)O(2) in chloroplasts
Balazadeh, Frontiers in plant science 2012 - “...GeBP 0.08 1.08 At2g36610 HB 3.29 1.15 At4g00270 GeBP 0.40 0.57 At2g44910 HB 0.16 0.13 At4g00390 GeBP 0.62 1.34 At2g46680 HB 1.05 1.08 At3g01220 HB 0.78 1.01 At3g01470 HB 0.33 0.28 At4g25210 GeBP 0.14 0.80 At5g14280 GeBP 0.06 0.25 At3g03660 HB 0.86 0.97 At5g28040 GeBP 0.49...”
- Incorporating Deep Learning With Word Embedding to Identify Plant Ubiquitylation Sites
Wang, Frontiers in cell and developmental biology 2020 - “...no ubiquitylation sites reported. As shown in Table 5 , the protein with Uniport AC O23063 contains 47 lysine and the positions of 142, 222, 225 are ubiquitylated ( Walton et al., 2016 ). The iUbiq-Lys predicted five ubiquitylated sites, and only one is correct. The...”
- “...AC Organism Sequence length Number of lysine Reported ubiquitylated sites Predicted ubiquitylated sites Tools Results O23063 Arabidopsis thaliana (Mouse-ear cress) 364 47 142; 222; 225 iUbiq-Lys 3; 4; 103; 217; 225; 363 UbPred 98; 142; 197 Ubisite 142; 225; 265; 297 Proposed model 142; 222; 225;...”
- An unbiased nuclear proteomics approach reveals novel nuclear protein components that participates in MAMP-triggered immunity
Fakih, Plant signaling & behavior 2016 - “...Z activity suggesting a role in tRNA processing Q8L633 AT2G04530 DNA-binding storekeeper protein-related transcriptional regulator O23063 AT4G00390 157 proteins were only detected in the nucleus of cerk1 plants after chitosan treatment (reported in TableS2). It is striking that so many protein are unique to cerk1 as...”
AT1G11510 DNA-binding storekeeper protein-related (RefSeq) from Arabidopsis thaliana
Aligns to 138:229 / 352 (26.1%), covers 100.0% of PF04504, 109.1 bits
- Identification of Chimeric Repressors that Confer Salt and Osmotic Stress Tolerance in Arabidopsis
Kazama, Plants (Basel, Switzerland) 2013 - “...screen. Among them, CRES-T lines for ADA2b (AT4G16420), Msantd (AT4G31270), DDF1 (AT1G21610), DREB26 (AT1G21910), AtGeBP (AT1G11510), and ATHB23 (AT1G26960) listed in Table 1 showed higher germination rate and/or earlier development of cotyledons than WT plants on medium, supplemented with 175 mM NaCl ( Appendix Figure A1...”
- “...family protein DDF1 Wound-responsive DREB26-SRDX AT1G21910 AP2 domain-containing transcription factor family protein DREB26 AP2-EREBP AtGeBP-SRDX AT1G11510 DNA-binding storekeeper protein-related AtGeBP GeBP ATHB23-SRDX AT1G26960 DNA binding/transcription factor ATHB23 HB 2.2. Germination of CRES-T Lines on Medium Supplemented with Different Concentrations of NaCl and Mannitol 2.2.1. Germination Rate...”
- Integrating Rare-Variant Testing, Function Prediction, and Gene Network in Composite Resequencing-Based Genome-Wide Association Studies (CR-GWAS)
Zhu, G3 (Bethesda, Md.) 2011 - “...there was at least one significant functional SNP by functional prediction within each fragment. T23J18.17 (AT1G11510) and SMD1 (AT4G11130) met the requirements. Both genes were associated with SDV ( Table S13 ). Associations of rare variants When rare variants were considered, all collapsed methods suggested an...”
STKLS_ARATH / Q9SB42 GLABROUS1 enhancer-binding protein-like; Mediator-associated protein 1; Protein GeBPL; Storekeeper-like protein At4g25210; Transcription factor At4g25210 from Arabidopsis thaliana (Mouse-ear cress) (see 3 papers)
AT4G25210 transcription regulator (RefSeq) from Arabidopsis thaliana
NP_194251 DNA-binding storekeeper protein-related transcriptional regulator from Arabidopsis thaliana
Aligns to 141:238 / 368 (26.6%), covers 100.0% of PF04504, 103.1 bits
- function: Transcription factor that binds promoters containing the CryR2 element, 5'-ACATAWCT-3' (PubMed:25877331). The DNA-binding activity is decreased upon direct physical interaction with the mediator subunits and is modulated by redox conditions (PubMed:25877331). The oxidized protein is the preferential binding form (PubMed:25877331).
subunit: Mono-, di- and oligomers (PubMed:25877331). Associated with the Mediator complex (PubMed:17560376). Interacts with MED6 (PubMed:17560376). Interacts with MED10A, MED28 and MED32 (PubMed:25877331). Interacts with DEK3 (PubMed:25387881). - Expression of ROS-responsive genes and transcription factors after metabolic formation of H(2)O(2) in chloroplasts
Balazadeh, Frontiers in plant science 2012 - “...GeBP 0.62 1.34 At2g46680 HB 1.05 1.08 At3g01220 HB 0.78 1.01 At3g01470 HB 0.33 0.28 At4g25210 GeBP 0.14 0.80 At5g14280 GeBP 0.06 0.25 At3g03660 HB 0.86 0.97 At5g28040 GeBP 0.49 0.46 At3g11260 HB 0.27 0.71 At5g28040 GeBP 0.46 0.71 At3g18010 HB 0.78 1.05 At3g22760 CPP(Zn) 0.35...”
- High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes
Fahlgren, PloS one 2007 - “...3 (0) - Triacylglycerol lipase At1g06250 (3) e miR864-3p UAAAGUCAAUAAUACCUUGAAG - 2 (0) Expressed protein At4g25210 (3) e miR865-5p AUGAAUUUGGAUCUAAUUGAG 1 N Y 3 (0) - Serine carboxypeptidase, sulfate transporter At5g42240 (3.5) e , At3g51895 (3.5) e miR865-3p UUUUUCCUCAAAUUUAUCCAA - 1 (0) DEAD box RNA helicase,...”
- Dynamic evolution at pericentromeres
Hall, Genome research 2006 - “...0) (1, 0) (2, 1) At2g20410 At4g37780 At4g25210 At4g25210 At3g43470 At1g52940 At5g67350 At2g03330 At2g26610 At5g06480 At5g06480 At3g42150 At4g10080 At5g35695...”
- Proteomic analysis of the Arabidopsis nucleolus suggests novel nucleolar functions
Pendle, Molecular biology of the cell 2005 - “...(Q-T) proteins with unknown function: plant-specific proteins (At4g25210 and At5g64680), and conserved proteins in both plant and human proteomes (At3g56990 and...”
- Biochemical and redox characterization of the mediator complex and its associated transcription factor GeBPL, a GLABROUS1 enhancer binding protein.
Shaikhali, The Biochemical journal 2015 (PubMed)- GeneRIF: Data suggest that presence of mediator complex subunits MED10a, MED28, and MED32 or changes in redox state affect DNA-binding capacity of GeBPL (GLABROUS1/GL1 enhancer-binding protein-like). [GeBPL] [GLABROUS1/GL1 enhancer-binding protein-like]
STKLH_ARATH / Q8VYD2 GLABROUS1 enhancer-binding protein-like 1; Protein GPL1; Storekeeper-like protein At2g25650 from Arabidopsis thaliana (Mouse-ear cress) (see 3 papers)
NP_565602 DNA-binding storekeeper protein-related transcriptional regulator from Arabidopsis thaliana
AT2G25650 DNA-binding storekeeper protein-related (RefSeq) from Arabidopsis thaliana
Aligns to 65:159 / 386 (24.6%), covers 98.9% of PF04504, 101.2 bits
- function: Probable transcription factor. May play redundant roles with GEBP and GPL2 in cytokinin responses by regulating the transcript levels of type-A ARR response genes (PubMed:18162594). Involved in stress responses (PubMed:21875893). Plays a repressive role in cell expansion by counteracting the positive role of CPR5 in this process, but does not regulate cell proliferation or endoreduplication (PubMed:21875893).
subunit: Homo- and heterodimers. Interacts with GEBP, GPL2 and GPL3. Interacts with GEBP (PubMed:29192025). - GeBP/GPL transcription factors regulate a subset of CPR5-dependent processes.
Perazza, Plant physiology 2011 - GeneRIF: GeBP/GPLs regulate a set of genes that represents a subset of the CPR5 pathway.[GPL1]
- Expression of ROS-responsive genes and transcription factors after metabolic formation of H(2)O(2) in chloroplasts
Balazadeh, Frontiers in plant science 2012 - “...HB 0.03 0.55 At1g61730 GeBP 0.28 0.49 At2g27990 HB 1.10 0.32 At2g28610 HB 0.64 0.68 At2g25650 GeBP 0.03 0.63 At5g16470 C2H2 0.01 0.53 At5g43250 CCAAT-HAP5 0.08 0.78 At5g16540 C2H2 0.15 0.85 At5g50470 CCAAT-HAP5 1.23 0.96 At5g18550 C2H2 1.57 0.12 At5g50480 CCAAT-HAP5 1.61 0.40 At5g63470 CCAAT-HAP5 0.08...”
- Contribution of transcriptional regulation to natural variations in Arabidopsis
Chen, Genome biology 2005 - “...The L er sequences of genes 12222_s_at (At2g20990), 14097_at (At2g47770), 20561_at (At2g46930), 14634_s_at (At4g27440), 13483_at (At2g25650), 15290_at (At2g20840), 13111_at (At2g38040), 14072_at (At1g67480), 14172_at (At3g54140), 14947_at (At4g37450), 16892_at (At5g45890), 17860_at (At4g27410), 20545_at (At5g27470) were obtained by BLASTing the full-length cDNA sequences or coding sequences of these genes...”
STKLO_ARATH / Q9ASZ1 GLABROUS1 enhancer-binding protein; Probable transcription factor At4g00270; Protein GeBP; Protein STOREKEEPER RELATED 1; Storekeeper-like protein At4g00270 from Arabidopsis thaliana (Mouse-ear cress) (see 5 papers)
AT4G00270 DNA-binding storekeeper protein-related (RefSeq) from Arabidopsis thaliana
Aligns to 64:158 / 302 (31.5%), covers 98.9% of PF04504, 97.5 bits
- function: DNA-binding protein, which specifically recognizes the GL1 enhancer sequence (PubMed:12535344). May be involved in leaf initiation (PubMed:12535344). May play redundant roles with GPL1 and GPL2 in cytokinin responses by regulating the transcript levels of type-A ARR response genes (PubMed:18162594). Involved in stress responses (PubMed:21875893). Plays a repressive role in cell expansion by counteracting the positive role of CPR5 in this process, but does not regulate cell proliferation or endoreduplication (PubMed:21875893). May play a role in plant defense (PubMed:29192025).
subunit: Homo- and heterodimers (PubMed:18162594, PubMed:29192025). Interacts with GPL1, GPL2 and GPL3 (PubMed:18162594). Interacts with KIN10, KIN11 and FLZ4 (PubMed:24600465). Interacts with KIN10 and KIN11 via its N-terminal part (PubMed:29192025). Interacts with GPL1 and GPL3 via its C-terminal part (PubMed:29192025).
disruption phenotype: No visible phenotype. - EffectorK, a comprehensive resource to mine for Ralstonia, Xanthomonas, and other published effector interactors in the Arabidopsis proteome
González-Fuente, Molecular plant pathology 2020 - “...6 exo70e2 mutant showed reduced flg22induced callose deposition. Redditt et al . ( 2019 ) AT4G00270 STOREKEEPERrelated 1 (STKR1) 6 STKR1 overexpressing plants showed reduced Hyaloperonospora arabidopsidis spore formation Nietzsche et al . ( 2018 ) AT3G01670 SIEVE ELEMENT OCLUSSIONrelated 2 (SEOR2) 4 Myzus persicae feeding...”
- The Agrobacterium F-Box Protein Effector VirF Destabilizes the Arabidopsis GLABROUS1 Enhancer/Binding Protein-Like Transcription Factor VFP4, a Transcriptional Activator of Defense Response Genes
García-Cano, Molecular plant-microbe interactions : MPMI 2018 - “...of VFP4 ( At5g28040 ) was aligned with those of proteins encoded by At3g04930 and At4g00270 (GeBP) using ClustalX (ver. 2.1). The DNA-binding domain and the overlapping DUF573 domain are delineated by a gray box. A white box delineates the putative monopartite nuclear localization signal (NLS)...”
- The complex becomes more complex: protein-protein interactions of SnRK1 with DUF581 family proteins provide a framework for cell- and stimulus type-specific SnRK1 signaling in plants
Nietzsche, Frontiers in plant science 2014 - “...shown). In addition, multiple clones encoded a protein annotated as DNA-binding storekeeper protein-related transcriptional regulator (At4g00270; hereafter referred to as STKR1 for storekeeper related 1), member of a protein family that has been associated with sucrose-regulated gene expression in potato (Zourelidou et al., 2002 ). A...”
- Expression of ROS-responsive genes and transcription factors after metabolic formation of H(2)O(2) in chloroplasts
Balazadeh, Frontiers in plant science 2012 - “...GeBP 0.10 0.87 At2g34710 HB 1.04 0.32 At4g00250 GeBP 1.42 2.65 At2g35940 HB 0.53 0.95 At4g00270 GeBP 0.08 1.08 At2g36610 HB 3.29 1.15 At4g00270 GeBP 0.40 0.57 At2g44910 HB 0.16 0.13 At4g00390 GeBP 0.62 1.34 At2g46680 HB 1.05 1.08 At3g01220 HB 0.78 1.01 At3g01470 HB 0.33...”
STKLT_ARATH / P0DKL0 GLABROUS1 enhancer-binding protein-like 2; Protein GPL2; Storekeeper-like protein At5g14280 from Arabidopsis thaliana (Mouse-ear cress) (see 2 papers)
Aligns to 61:155 / 301 (31.6%), covers 97.9% of PF04504, 94.6 bits
- function: Probable transcription factor. May play redundant roles with GEBP and GPL1 in cytokinin responses by regulating the transcript levels of type-A ARR response genes. Involved in stress responses (PubMed:21875893). Plays a repressive role in cell expansion by counteracting the positive role of CPR5 in this process, but does not regulate cell proliferation or endoreduplication (PubMed:21875893).
subunit: Homo- and heterodimers. Interacts with GEBP, GPL1 and GPL3.
AT4G01260 transcription regulator (RefSeq) from Arabidopsis thaliana
Aligns to 107:204 / 325 (30.2%), covers 100.0% of PF04504, 93.9 bits
AT1G66420 transcription regulator (RefSeq) from Arabidopsis thaliana
Aligns to 87:174 / 282 (31.2%), covers 100.0% of PF04504, 93.4 bits
- Global scale transcriptome analysis of Arabidopsis embryogenesis in vitro
Wickramasuriya, BMC genomics 2015 - “...C2H2-type zinc finger family protein AT5G52600 3.52 MYB MYB82 AT5G40220 3.28 MADS Protein agamous-like 43 AT1G66420 3.27 GeBP DNA-binding storekeeper protein-related transcriptional regulator AT1G13260 3.26 RAV AP2/ERF and B3 domain-containing TF AT2G47190 3.09 MYB R2R3 MYB DNA binding domain TF (MYB2) AT3G56970 3.01 bHLH ORG2 (BHLH038)...”
AT5G14280 DNA-binding storekeeper protein-related (RefSeq) from Arabidopsis thaliana
Aligns to 61:155 / 572 (16.6%), covers 97.9% of PF04504, 93.0 bits
STK_SOLTU / Q94IK2 STOREKEEPER protein from Solanum tuberosum (Potato) (see paper)
Aligns to 156:247 / 399 (23.1%), covers 97.9% of PF04504, 89.5 bits
- function: May act as a transcriptional regulator. Binds specifically to the B-box motif, a promoter element that is required for the tuber- specific and sucrose inducible expression of the patatin gene.
STKLN_ARATH / O23077 Transcription factor STKL2; Protein Storekeeper-like 2 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
AT4G00250 DNA-binding storekeeper protein-related (RefSeq) from Arabidopsis thaliana
NP_567161 DNA-binding storekeeper protein-related transcriptional regulator from Arabidopsis thaliana
Aligns to 115:203 / 319 (27.9%), covers 98.9% of PF04504, 89.1 bits
- function: Transcription repressor that binds DNA in a sequence-specific manner, 5'-GCCT-3', to regulate the expression of PGR. Acts as a modulatory component for the glucose-triggered developmental leaf growth process.
- Regulation of Gene Expression of Methionine Sulfoxide Reductases and Their New Putative Roles in Plants.
Kalemba, International journal of molecular sciences 2019 - “..., AtMsrB8 , OsMsrA2.2 , OsMsrA5 , OsMsrB1 , OsMsrB3 DNA-binding storekeeper protein-related transcriptional regulator (AT4G00250) aaaat tGATCc aaagct AtMsrB2 , AtMsrB6 , AtMsrB7 , AtPMSR3 , OsMsrA2.2 , PtMsrA4.1 Class I GATA factors aagat GATA aatgtgtg AtMsrB6 , AtPMSR2 , OsMsrA2.2 , OsMsrA5 , OsMsrB1...”
- Induction of desiccation tolerance in desiccation sensitive Citrus limon seeds
Marques, Journal of integrative plant biology 2019 - “...2.11E04 23 625 AT3G20840 PLETHORA 1 (PLT1) 2.12E04 17 402 AT5G08130 (BIM1) 2.62E04 30 917 AT4G00250 (ATSTKL2) 2.85E04 17 412 AT2G35530 BASIC REGION/LEUCINE ZIPPER TRANSCRIPTION FACTOR 16 (bZIP16) 2.86E04 53 1,945 AT5G61270 PHYTOCHROMEINTERACTING FACTOR7 (PIF7) 3.39E04 41 1,409 AT5G02840 LHY/CCA1LIKE 1 (LCL1) 5.31E04 21 587 AT1G10120...”
- The modulation of acetic acid pathway genes in Arabidopsis improves survival under drought stress
Rasheed, Scientific reports 2018 - “...AT5G50770 Hydroxysteroid dehydrogenase 6 (HSD6) 0.98 1.01 2.25 AT2G18193 Nucleoside triphosphate hydrolases 1.06 4.43 2.23 AT4G00250 ATSTKL2 1.59 1.10 2.21 AT1G71200 bHLH superfamily protein 1.11 1.80 2.20 AT3G10790 F-box associated ubiquitination effector 1.15 1.00 2.20 AT2G17950 WUSCHEL (WUS) 3.82 1.49 2.19 AT5G24640 Hypothetical protein 1.20 3.13...”
- The Sugar-Signaling Hub: Overview of Regulators and Interaction with the Hormonal and Metabolic Network.
Sakr, International journal of molecular sciences 2018 - “...pathways. Response to osmotic stress and salt 5-GCCGCC-3 [ 463 , 464 , 465 ] AT4G00250 ATSTKL2 GeBP Response to sugar signaling 5-GCCT-3 [ 440 ] The code of bind site follows the IUPAC role. * The binding sites are predicted by PlantPAN database ( http://plantpan2.itps.ncku.edu.tw/index.html...”
- Expression of ROS-responsive genes and transcription factors after metabolic formation of H(2)O(2) in chloroplasts
Balazadeh, Frontiers in plant science 2012 - “...17.6 MADS AGL105 Unknown function 5 At3g53340 0.4 6.5 17.5 CCAAT-HAP3 NF-YB10 Unknown function 5 At4g00250 0.4 6.3 16.8 GeBP Indirect regulation of cytokinin response genes 2 At5g26930 0.7 9.6 13.5 C2C2(Zn)GATA GATA-23 Controls lateral root founder cell specification 2 At4g26930 0.4 4.6 13.0 MYB MYB97...”
- “...CPP(Zn) 0.23 0.67 At2g36340 GeBP 0.40 0.23 At3g04930 GeBP 0.10 0.87 At2g34710 HB 1.04 0.32 At4g00250 GeBP 1.42 2.65 At2g35940 HB 0.53 0.95 At4g00270 GeBP 0.08 1.08 At2g36610 HB 3.29 1.15 At4g00270 GeBP 0.40 0.57 At2g44910 HB 0.16 0.13 At4g00390 GeBP 0.62 1.34 At2g46680 HB 1.05...”
- Metabolomic, transcriptional, hormonal, and signaling cross-talk in superroot2
Morant, Molecular plant 2010 - “...SPL3 AT2G33810 prevent early flowering 5.60E04 1.6 GeBP family (16 members according to http://Arabidopsis.med.ohio-state.edu/AtTFDB ) AT4G00250 8.07E04 2.1 bHLH family (161 members according to http://Arabidopsis.med.ohio-state.edu/AtTFDB ) bHLH135 AT1G74500 8.49E04 +1.6 Transcription factors with a known function are shown in bold. To elucidate which biological processes are...”
- Regulation of Arabidopsis thaliana plasma membrane glucose-responsive regulator (AtPGR) expression by A. thaliana storekeeper-like transcription factor, AtSTKL, modulates glucose response in Arabidopsis.
Chung, Plant physiology and biochemistry : PPB 2016 (PubMed)- GeneRIF: AtSTKL1 and AtSTKL2 function both as repressors of AtPGR transcription and as novel transcription factors in the Glc signaling pathway.[AtSTKL2]
AT1G44810 transcription regulator (RefSeq) from Arabidopsis thaliana
NP_564491 DNA-binding storekeeper protein-related transcriptional regulator from Arabidopsis thaliana
Aligns to 122:210 / 296 (30.1%), covers 100.0% of PF04504, 88.9 bits
- Drought stress induces a biphasic NO accumulation in Arabidopsis thaliana
Ederli, Plant signaling & behavior 2019 (secret) - Root avoidance of toxic metals requires the GeBP-LIKE 4 transcription factor in Arabidopsis thaliana
Khare, The New phytologist 2017 - “...with 70M CdCl 2 (Fig.S1). We identified a novel TF belonging to the GeBP family (At1g44810, Fig. 1 a) and confirmed the Cd tolerance with independently generated CREST lines. We named this TF GeBPLIKE 4 (GPL4) because it is the fourth GeBPlike TF to be identified...”
- Genome-scale cold stress response regulatory networks in ten Arabidopsis thaliana ecotypes
Barah, BMC genomics 2013 - “...WRKY50, At1g16640, At3g06160, At4g34400, At4g00940, At5g49300, At3g57480, At5g10970, At2g05160, At5g40880, At3g16940, t5g38140, At2g20110, At1g07520, At1g63100, At1g44810, At4g00232, At4g26170, At1g09710, At1g33420, At2g01810, At3g53370, At5g51910, At1g76870, At1g26260, At1g62975, At4g00870, At4g14410, At4g29930, At5g46830, At5g65320 Kas.1 AtGRF3, BPC6, HAt3, HSFA8, IAA29, SSL2, SWN, WRKY3, WRKY32, WRKY66, At3g45260, At1g67310, At2g45460 AL1,...”
- Expression of ROS-responsive genes and transcription factors after metabolic formation of H(2)O(2) in chloroplasts
Balazadeh, Frontiers in plant science 2012 - “...HB 1.44 1.14 At5g59570 GARP-G2-like 0.60 0.87 At2g22430 HB 1.79 1.63 At2g22800 HB 0.69 0.49 At1g44810 GeBP 0.70 0.32 At2g23760 HB 0.03 0.55 At1g61730 GeBP 0.28 0.49 At2g27990 HB 1.10 0.32 At2g28610 HB 0.64 0.68 At2g25650 GeBP 0.03 0.63 At5g16470 C2H2 0.01 0.53 At5g43250 CCAAT-HAP5 0.08...”
- Root avoidance of toxic metals requires the GeBP-LIKE 4 transcription factor in Arabidopsis thaliana.
Khare, The New phytologist 2017 - GeneRIF: GPL4 inhibits the growth of roots exposed to toxic metals by modulating reactive oxygen species concentrations, thereby allowing roots to colonize noncontaminated regions of the rhizosphere.[GPL4]
AT4G00610 DNA-binding storekeeper protein-related (RefSeq) from Arabidopsis thaliana
Aligns to 149:234 / 328 (26.2%), covers 98.9% of PF04504, 86.7 bits
- Downregulation of GeBP-like α factor by MiR827 suggests their involvement in senescence and phosphate homeostasis
Ma, BMC biology 2021 - “...search for additional candidate miR827 targets using psRNATarget [ 56 ] suggested a GPL gene (At4G00610), hereafter termed GPL . The predicted miR827 -recognition site in the GPL sequence is shown in Additionalfile 3 : Figure S3. To examine actual cleavage of GPL , 5 RACE...”
- “...genes. a c Expression of a NLA (AT1G02860), b PHT5;1 (PHT5;1/VPT1, AT1G63010), and c GPL (AT4G00610) in miR827 -overexpressing lines (35S:8271, 2), Col-0 wild type (WT), and miR827 -silenced lines (827-STTM1, 2) measured by qRT-PCR and representing the mean of three biological repeats. Expression was measured...”
Sb03g005180 No description from Sorghum bicolor
Aligns to 86:184 / 406 (24.4%), covers 98.9% of PF04504, 86.5 bits
STKLI_ARATH / Q9SJM4 GLABROUS1 enhancer-binding protein-like 3; Protein GPL3; Storekeeper-like protein At2g36340 from Arabidopsis thaliana (Mouse-ear cress) (see 3 papers)
AT2G36340 DNA-binding storekeeper protein-related (RefSeq) from Arabidopsis thaliana
Aligns to 59:153 / 414 (22.9%), covers 98.9% of PF04504, 85.8 bits
- function: Probable transcription factor. Involved in stress responses (PubMed:21875893). Plays a repressive role in cell expansion by counteracting the positive role of CPR5 in this process, but does not regulate cell proliferation or endoreduplication (PubMed:21875893).
subunit: Homo- and heterodimers. Interacts with GEBP, GPL1 and GPL2. Interacts with GEBP (PubMed:29192025). - Expression of ROS-responsive genes and transcription factors after metabolic formation of H(2)O(2) in chloroplasts
Balazadeh, Frontiers in plant science 2012 - “...CPP(Zn) 0.14 0.03 At3g04850 CPP(Zn) 0.01 0.08 At5g40710 C2H2 0.13 0.95 At3g16160 CPP(Zn) 0.23 0.67 At2g36340 GeBP 0.40 0.23 At3g04930 GeBP 0.10 0.87 At2g34710 HB 1.04 0.32 At4g00250 GeBP 1.42 2.65 At2g35940 HB 0.53 0.95 At4g00270 GeBP 0.08 1.08 At2g36610 HB 3.29 1.15 At4g00270 GeBP 0.40...”
- Analysis of the cDNAs of hypothetical genes on Arabidopsis chromosome 2 reveals numerous transcript variants
Xiao, Plant physiology 2005 (PubMed)- “...hypothetical genes (At2g02540, At2g31270, At2g33640, At2g35550, and At2g36340) were cloned into report constructs, and their expressions are tissue or...”
- “...genes (At2g02540, At2g31270, At2g33640, At2g35550, and At2g36340). The expression patterns of these five promoter-reporter constructs display highly localized...”
STKLM_ARATH / Q8LG05 Transcription factor STKL1; Protein Storekeeper-like 1 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
NP_567159 DNA-binding storekeeper protein-related (RefSeq) from Arabidopsis thaliana
AT4G00238, NP_567159 DNA-binding storekeeper protein-related transcriptional regulator from Arabidopsis thaliana
Aligns to 140:228 / 345 (25.8%), covers 98.9% of PF04504, 82.0 bits
- function: Transcription repressor that binds DNA in a sequence-specific manner, 5'-GCCT-3', to regulate the expression of PGR. Acts as a modulatory component for the glucose-triggered developmental leaf growth process.
- The phosphoproteome in regenerating protoplasts from Physcomitrella patens protonemata shows changes paralleling postembryonic development in higher plants
Wang, Journal of experimental botany 2014 - “...36.5 6.91 NP_188063 CID9 (CTC-interacting domain 9); RNA binding/protein binding Unknown NFFES#ACGEVTR C45 38.2 8.81 NP_567159 DNA-binding storekeeper protein-related Nucleus T#LNS#PSAAVAVSDDSES#EK C46 36.8 8.33 NP_174084 CYCT1;3 (CYCLIN T 1;3); cyclin-dependent protein kinase Nucleus NVSLFESPQCET#S#K Signal transduction (12.96%) C47 71.7 6.43 Q8H0V1 CDK5RAP1-like protein Unknown AT#HAS#SS#SSSALLPR C48...”
- Comparative DNA Methylome of Phytoplasma Associated Retrograde Metamorphosis in Sesame (Sesamum indicum L.)
Verma, Biology 2022 - “...as transcription factors. Ectopic expression of two Arabidopsis thaliana stk-like genes, stk01 (At1g61730) and stk03 (At4g00238), in tobacco increases the number of vegetative internodes and preferred plant and leaf size, stem diameter and hardiness [ 39 ]. It is also known to regulate patatin expression in...”
- A genome-scale TF-DNA interaction network of transcriptional regulation of Arabidopsis primary and specialized metabolism
Tang, Molecular systems biology 2021 - “...Biological Resource Center SALK_117411 Arabidopsis thaliana at3g536802 Arabidopsis Biological Resource Center GABI_180C10 Arabidopsis thaliana atstkl11, AT4G00238 Arabidopsis Biological Resource Center SALK_083259 Arabidopsis thaliana atstkl12, AT4G00238 Arabidopsis Biological Resource Center SALK_019920 Arabidopsis thaliana atstkl13, AT4G00238 Arabidopsis Biological Resource Center SALK_068662 Arabidopsis thaliana gata92, AT4G32890 Arabidopsis Biological Resource...”
- Drought stress induces a biphasic NO accumulation in Arabidopsis thaliana
Ederli, Plant signaling & behavior 2019 (secret) - The Sugar-Signaling Hub: Overview of Regulators and Interaction with the Hormonal and Metabolic Network.
Sakr, International journal of molecular sciences 2018 - “...AT3G44290 NAC060 NAC Response to sugar-and ABA signaling cascade Unknown [ 315 , 439 ] AT4G00238 AtSTKL1 GeBP Involved in mediating certain glucose responses 5-GCCT-3 [ 440 ] AT5G08790 ATAF2 NAC Response to sugar, jasmonic signaling pathways. Seedling photomorphogenesis and leaf senescence 5-RTKVCGTR-3 * [ 441...”
- Regulation of Arabidopsis thaliana plasma membrane glucose-responsive regulator (AtPGR) expression by A. thaliana storekeeper-like transcription factor, AtSTKL, modulates glucose response in Arabidopsis.
Chung, Plant physiology and biochemistry : PPB 2016 (PubMed)- GeneRIF: AtSTKL1 and AtSTKL2 function both as repressors of AtPGR transcription and as novel transcription factors in the Glc signaling pathway.[AtSTKL1]
LOC105159820 STOREKEEPER protein-like from Sesamum indicum
Aligns to 91:183 / 306 (30.4%), covers 100.0% of PF04504, 78.3 bits
AT4G00232 hypothetical protein (RefSeq) from Arabidopsis thaliana
Aligns to 42:135 / 154 (61.0%), covers 96.8% of PF04504, 70.5 bits
- Fine mapping and characterization of RLL6 locus required for anti-silencing of a transgene and DNA demethylation in Arabidopsis thaliana
Wang, Frontiers in genetics 2022 - “...luminescence. TABLE 1 Ten candidate genes residing within the mapping region. Gene Locus Functional Annotation AT4G00232 DNA-binding storekeeper protein-related transcriptional regulator AT4G00280 ER protein carbohydrate-binding protein AT4G00295 fringe-like protein AT4G00305 RING/U-box superfamily protein AT4G00342 hypothetical protein AT4G00390 DNA-binding storekeeper protein-related transcriptional regulator AT4G00416 MBD3, Protein containing...”
- Genome-scale cold stress response regulatory networks in ten Arabidopsis thaliana ecotypes
Barah, BMC genomics 2013 - “...At1g16640, At3g06160, At4g34400, At4g00940, At5g49300, At3g57480, At5g10970, At2g05160, At5g40880, At3g16940, t5g38140, At2g20110, At1g07520, At1g63100, At1g44810, At4g00232, At4g26170, At1g09710, At1g33420, At2g01810, At3g53370, At5g51910, At1g76870, At1g26260, At1g62975, At4g00870, At4g14410, At4g29930, At5g46830, At5g65320 Kas.1 AtGRF3, BPC6, HAt3, HSFA8, IAA29, SSL2, SWN, WRKY3, WRKY32, WRKY66, At3g45260, At1g67310, At2g45460 AL1, BT4,...”
AT4G00130 hypothetical protein (RefSeq) from Arabidopsis thaliana
Aligns to 23:90 / 194 (35.1%), covers 60.0% of PF04504, 42.0 bits
- Induction of epigenetic variation in Arabidopsis by over-expression of DNA METHYLTRANSFERASE1 (MET1)
Brocklehurst, PloS one 2018 - “...A1+ 2.816 3.50E-15 upstream CML41, calmodulin-like 41 FUNCTIONS IN: calcium ion binding A1- -0.948 0.00018459 AT4G00130 A1+ 2.452 6.56E-08 region DNA-binding storekeeper protein-related transcriptional regulator A1- -3.355 4.03E-63 Several of the genes listed in Table 2 have been shown to be sensitive to DNA methylation changes....”
- Systematic discovery of novel eukaryotic transcriptional regulators using sequence homology independent prediction
Bossi, BMC genomics 2017 - “...entry vectors containing the genes AT3G29180, AT3G13990, AT4G28300, AT5G46780, AT1G78310, AT2G33350, AT1G04500, AT5G41380, AT5G59990 and AT4G00130 were obtained from ABRC. Dr. Enrico Magnani provided the entry vector containing the ATHB1 gene (INRA, Centre de Versailles-Grignon, France) and Dr. Zhiyong Wang donated the entry vector containing the...”
- “...AT2G33400, AT2G36540, AT2G36550, AT2G38823, AT2G45260, AT3G01015, AT3G02125, AT3G54520, AT3G54530, AT4G00390, AT4G27660, AT4G30830, AT4G30830, AT5G41380, AT5G59990, AT4G00130. The entry vectors in pDONR221 were obtained from ABRC (except for AT2G45260, whose cloning was described in the previous section) and were transferred to the yeast destination vector pDEST32 using...”
- A transcriptional dynamic network during Arabidopsis thaliana pollen development
Wang, BMC systems biology 2011 - “...AT1G52520) are activated during pollen development, while the genes for the rest 3 TFs (AT3G63350, AT4G00130, AT3G04100) remain relatively high expression without significant change (Figure 1 ). AT4G17490 (ATERF6) gene, encoding the ethylene responsive element binding factor 6 [ 22 ], belongs to AP2-EREBP gene family...”
- “...BCP. Its gene expression has been confirmed as pollen specific [ 31 - 33 ]. AT4G00130 (F6N15.6) gene presents a rapidly reduced activity from BCP to HP and a sharp increase from HP to 0.5 hr stage. AT3G20670 (HTA13) gene, which is expressed in pollen tube...”
Or search for genetic data about PF04504 in the Fitness Browser
by Morgan Price,
Arkin group
Lawrence Berkeley National Laboratory