Family Search for PF04535 (DUF588)

PF04535.12 hits 52 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.

C5Y9U6 Casparian strip membrane protein 4 from Sorghum bicolor
Aligns to 27:176 / 192 (78.1%), covers 99.3% of PF04535, 163.6 bits

• Growth Stimulatory Effects and Genome-Wide Transcriptional Changes Produced by Protein Hydrolysates in Maize Seedlings.
  Santi, Frontiers in plant science 2017
  • “...Bio vs. Aa (FC) GRMZM2G070913_T01 K7VZR1 Pectinesterase 3.77 2.81 GRMZM2G112619_T01 K7U9U0 Xyloglucan endotransglucosylase/hydrolase 3.28 GRMZM2G083888_T01 C5Y9U6 Casparian strip membrane protein 4 2.93 GRMZM5G886185_T01 A0A096UH62 Xyloglucan endotransglucosylase/hydrolase 2.80 GRMZM5G858456_T01 B6SRP0 Fucosyltransferase 7 2.80 GRMZM2G455564_T01 K7TZQ3 Pectinesterase 2.41 GRMZM2G127184_T01 B6SRP0 Fucosyltransferase 7 2.39 GRMZM2G073079_T01 Q9ZT66 Endo-1,3;1,4-beta-D-glucanase 2.24 GRMZM2G110832_T01...”

CASP5_ARATH / Q9LXF3 Casparian strip membrane protein 5; AtCASP5 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
AT5G15290 integral membrane family protein (RefSeq) from Arabidopsis thaliana
Aligns to 22:171 / 187 (80.2%), covers 99.3% of PF04535, 163.5 bits

• function: Regulates membrane-cell wall junctions and localized cell wall deposition. Required for establishment of the Casparian strip membrane domain (CSD) and the subsequent formation of Casparian strips, a cell wall modification of the root endodermis that determines an apoplastic barrier between the intraorganismal apoplasm and the extraorganismal apoplasm and prevents lateral diffusion.
  subunit: Homodimer and heterodimers with other CASP proteins. Interacts with CASP1, CASP3 and CASP4.
• MYB36 regulates the transition from proliferation to differentiation in the Arabidopsis root
  Liberman, Proceedings of the National Academy of Sciences of the United States of America 2015
  • “...AT3G11550 CASP2; AT2G27370 CASP3; AT5G06200 CASP4; AT5G15290 CASP5; AT5G03150 JACKDAW; AT1G03840 MAGPIE; AT5G44160 NUTCRACKER; AT4G11290 PER39; AT5G42180 PER64;...”
• Apoplastic diffusion barriers in Arabidopsis
  Nawrath, The arabidopsis book 2013
  • “...CASP2, At3g11550; CASP3, At2g27370; CASP4, At5g06200; and CASP5, At5g15290). CASPs have all the expected features for structural proteins of the CSD. They show...”

AT2G35760 integral membrane family protein (RefSeq) from Arabidopsis thaliana
Aligns to 24:174 / 201 (75.1%), covers 98.7% of PF04535, 154.2 bits

• Cell Wall Remodeling in Abscission Zone Cells during Ethylene-Promoted Fruit Abscission in Citrus
  Merelo, Frontiers in plant science 2017
  • “...0.90 CASPARIAN STRIP MEMBRANE DOMAIN PROTEINS (CASPs) CitCASPL1D1a aCL6688Contig1 C04010H11 AT4G15610 0.74 CitCASPL2B2 aCL5933Contig1 C32104D12 AT2G35760 0.82 CitCASPL4A4 aC08028B10SK_c C08028B10 AT4G11655 0.93 0.61 , No significant regulation. Putative gene identifications are based on sequence homology with Arabidopsis thaliana. Additional data are shown in Figure S7 ....”

CASP1_LOTJA / P0DKC2 Casparian strip membrane protein 1; LjCASP1 from Lotus japonicus (Lotus corniculatus var. japonicus) (see paper)
Aligns to 22:171 / 186 (80.6%), covers 98.0% of PF04535, 153.9 bits

• function: Regulates membrane-cell wall junctions and localized cell wall deposition. Required for establishment of the Casparian strip membrane domain (CSD) and the subsequent formation of Casparian strips, a cell wall modification of the root endodermis that determines an apoplastic barrier between the intraorganismal apoplasm and the extraorganismal apoplasm and prevents lateral diffusion (By similarity).
  subunit: Homodimer and heterodimers.

B6T959 Casparian strip membrane protein 1 from Zea mays
Aligns to 23:172 / 187 (80.2%), covers 98.7% of PF04535, 153.6 bits

• Growth Stimulatory Effects and Genome-Wide Transcriptional Changes Produced by Protein Hydrolysates in Maize Seedlings
  Santi, Frontiers in plant science 2017
  • “...2.80 GRMZM2G455564_T01 K7TZQ3 Pectinesterase 2.41 GRMZM2G127184_T01 B6SRP0 Fucosyltransferase 7 2.39 GRMZM2G073079_T01 Q9ZT66 Endo-1,3;1,4-beta-D-glucanase 2.24 GRMZM2G110832_T01 B6T959 Casparian strip membrane protein 1 2.23 GRMZM2G144898_T01 Q1ZYQ8 Expansin-B10 2.00 GRMZM2G114322_T01 Q8H274 Expansin-like A3 2.02 2.41 GRMZM2G435380_T01 M8BPN6 Polygalacturonase 2.06 GRMZM2G168651_T01 P14918 Extensin 2.11 GRMZM5G870571_T01 M7ZVY5 Galactoside 2-alpha-L-fucosyltransferase 2.16 GRMZM2G392125_T01...”

CASP2_ARATH / Q9CAX3 Casparian strip membrane protein 2; AtCASP2 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
AT3G11550 integral membrane family protein (RefSeq) from Arabidopsis thaliana
Aligns to 40:189 / 204 (73.5%), covers 99.3% of PF04535, 151.1 bits

• function: Regulates membrane-cell wall junctions and localized cell wall deposition. Required for establishment of the Casparian strip membrane domain (CSD) and the subsequent formation of Casparian strips, a cell wall modification of the root endodermis that determines an apoplastic barrier between the intraorganismal apoplasm and the extraorganismal apoplasm and prevents lateral diffusion.
  subunit: Homodimer and heterodimers with other CASP proteins. Interacts with CASP1, CASP3 and CASP4.
• MYB36 regulates the transition from proliferation to differentiation in the Arabidopsis root
  Liberman, Proceedings of the National Academy of Sciences of the United States of America 2015
  • “...selected genes are as follows: AT2G36100 CASP1; AT3G11550 CASP2; AT2G27370 CASP3; AT5G06200 CASP4; AT5G15290 CASP5; AT5G03150 JACKDAW; AT1G03840 MAGPIE;...”
• Apoplastic diffusion barriers in Arabidopsis
  Nawrath, The arabidopsis book 2013
  • “...PROTEINS (CASPs) (encoded by CASP1, At2g36100; CASP2, At3g11550; CASP3, At2g27370; CASP4, At5g06200; and CASP5, At5g15290). CASPs have all the expected features...”

CASP4_ARATH / Q9FFZ7 Casparian strip membrane protein 4; AtCASP4 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
AT5G06200 integral membrane family protein (RefSeq) from Arabidopsis thaliana
NP_196238 Uncharacterized protein family (UPF0497) from Arabidopsis thaliana
Aligns to 38:187 / 202 (74.3%), covers 98.7% of PF04535, 150.9 bits

• function: Regulates membrane-cell wall junctions and localized cell wall deposition. Required for establishment of the Casparian strip membrane domain (CSD) and the subsequent formation of Casparian strips, a cell wall modification of the root endodermis that determines an apoplastic barrier between the intraorganismal apoplasm and the extraorganismal apoplasm and prevents lateral diffusion.
  subunit: Homodimer and heterodimers with other CASP proteins. Interacts with CASP1, CASP2, CASP3 and CASP5.
• MYB36 regulates the transition from proliferation to differentiation in the Arabidopsis root
  Liberman, Proceedings of the National Academy of Sciences of the United States of America 2015
  • “...AT2G36100 CASP1; AT3G11550 CASP2; AT2G27370 CASP3; AT5G06200 CASP4; AT5G15290 CASP5; AT5G03150 JACKDAW; AT1G03840 MAGPIE; AT5G44160 NUTCRACKER; AT4G11290 PER39;...”
• A receptor-like kinase mutant with absent endodermal diffusion barrier displays selective nutrient homeostasis defects
  Pfister, eLife 2014
  • “..., At1g07940 ) 5-GTCGATTCTGGAAAGTCGACC-3 and 5-AATGTCAATGGTGATACCACGC-3; CASP1 ( At2g36100 ) 5-AGAGAGGTTTGGCTATATT-3 and 5-CTACGGCTATCACAAAGTA-3; CASP4 ( At5g06200 ) 5-AGACTTCTCTTGCTTGTTCT-3 and 5-GACAGAAATCTCCAAACTG-3; AKT1 ( At2G26650 ) 5-TCTAAATTGTGTTCTTCTTCTGTTGGA-3 and 5-CCTTCCGCGTCTCTGCAA-3; HAK5 ( At4g13420 ) 5-CGAGACGGACAAAGAAGAGGAACC-3 and 5- CACGACCCTTCCCGACCTAATCT-3. Statistical analysis All statistical analyses were done in the R environment...”
• Apoplastic diffusion barriers in Arabidopsis
  Nawrath, The arabidopsis book 2013
  • “...CASP1, At2g36100; CASP2, At3g11550; CASP3, At2g27370; CASP4, At5g06200; and CASP5, At5g15290). CASPs have all the expected features for structural proteins of...”
• The Arabidopsis chloroplast protein S-RBP11 is involved in oxidative and salt stress responses.
  Lee, Plant cell reports 2014 (PubMed)
  • GeneRIF: S-RBP11 is a chloroplast protein involved in the responses to salt and oxidative stresses.

CASP1_ARATH / Q9SIH4 Casparian strip membrane protein 1; AtCASP1 from Arabidopsis thaliana (Mouse-ear cress) (see 2 papers)
AT2G36100 integral membrane family protein (RefSeq) from Arabidopsis thaliana
Aligns to 42:191 / 206 (72.8%), covers 98.7% of PF04535, 150.1 bits

• function: Regulates membrane-cell wall junctions and localized cell wall deposition. Required for establishment of the Casparian strip membrane domain (CSD) and the subsequent formation of Casparian strips, a cell wall modification of the root endodermis that determines an apoplastic barrier between the intraorganismal apoplasm and the extraorganismal apoplasm and prevents lateral diffusion.
  subunit: Homodimer and heterodimers with other CASP proteins. Interacts with CASP2, CASP3, CASP4 and CASP5.
  disruption phenotype: Disorganised deposition of Casparian strips.
• Uclacyanin Proteins Are Required for Lignified Nanodomain Formation within Casparian Strips
  Reyt, Current biology : CB 2020
  • “...are: UCC1 , AT2G32300; UCC2 , AT2G44790; SGN3 , At4g20140; MYB36 , At5g57620; CASP1 , At2g36100; CASP3 , AT2G27370; ESB1 , At2g28670; RBOHF , At1g64060. Growth Conditions All seeds were surface sterilized, and then stratified for two days at 4C. Seeds were directly germinated on plates...”
• Spatial Expression and Functional Analysis of Casparian Strip Regulatory Genes in Endodermis Reveals the Conserved Mechanism in Tomato
  Li, Frontiers in plant science 2018
  • “...0 Solyc03g112680 SlSGN3b AT4G20140 SGN3 47.48 0 Solyc08g081690 SlSGN4 AT1G64060 RBOHF 77.11 0 Solyc10g083250 SlCASP1a AT2G36100 CASP1 55.5 9.00E-68 Solyc06g074230 SlCASP1b AT2G36100 CASP1 58.91 3.00E-66 Solyc09g010200 SlCASP1c AT2G36100 CASP1 55.14 1E-065 Solyc04g005620 SlCASP1d AT2G36100 CASP1 46.37 2E-050 Solyc06g075630 SlESB1a AT2G28670 ESB1 64.68 1.00E-94 Solyc11g073030 SlESB1b AT2G28670...”
• Diffusible repression of cytokinin signalling produces endodermal symmetry and passage cells
  Andersen, Nature 2018
  • “...in supplementary table 1 or are as follows: ABI1, At4g26080; AHP6 , At1g80100; CASP1 , At2g36100; CDEF1 , At4g30140; ELTP , At2g48140; GPAT5, At3g11430; LOG3 , At2g37210; LOG4 , At3g53450; SYP122 , At3g52400 Imaging Confocal laser scanning microscopy experiments were performed on a Zeiss LSM 880...”
• Stress-Related Mitogen-Activated Protein Kinases Stimulate the Accumulation of Small Molecules and Proteins in Arabidopsis thaliana Root Exudates
  Strehmel, Frontiers in plant science 2017
  • “...Nguyen-Kim et al., 2016 AT2G22170 Lipase/lipooxygenase, PLAT/LH2 family protein Extracellular/PM De Michele et al., 2016 AT2G36100 Uncharacterised protein (UPF0497), trans-membrane plant subgroup Extracellular Nguyen-Kim et al., 2016 AT3G07470 Protein of unknown function, DUF538 Extracellular (secreted) Charmont et al., 2005 ; Nguyen-Kim et al., 2016 AT5G19860 Protein...”
• MYB36 regulates the transition from proliferation to differentiation in the Arabidopsis root
  Liberman, Proceedings of the National Academy of Sciences of the United States of America 2015
  • “...identifiers for selected genes are as follows: AT2G36100 CASP1; AT3G11550 CASP2; AT2G27370 CASP3; AT5G06200 CASP4; AT5G15290 CASP5; AT5G03150 JACKDAW; AT1G03840...”
• AtMYB41 activates ectopic suberin synthesis and assembly in multiple plant species and cell types
  Kosma, The Plant journal : for cell and molecular biology 2014
  • “...3.80.7 CAD5 At4g34230 36.17.7 C4H/REF3 At2g30490 5.31.7 PRXR9/PER30 At3g21770 27.56.8 Casparian strip assembly genes CASP1 At2g36100 20.2 ESB1 At2g28670 10.3 The accumulation of cuticle biosynthetic gene transcripts was either unaffected or slightly lower in AtMYB41 OE-9 leaves (Table 1 ). GPAT4 was the only exception, having...”
• A receptor-like kinase mutant with absent endodermal diffusion barrier displays selective nutrient homeostasis defects
  Pfister, eLife 2014
  • “...n.a. Baxter I et al. (2009) PLOS Genet, Lahner B et al. (2003) Nat Biotechnol AT2G36100 Col-0 SAIL_265_H05 casp1-1 LP: GCGTTTCAGTACGTCCCTTC RP: CACGTGAGGGAAGTGAGTCTC Roppolo et al. (2011) Nature AT2G27370 Col-0 SALK_011092 casp3-1 LP: GACTCTTCCTTTCTTCACTC RP: GACCAACACAACCGTACGAAC Roppolo et al. (2011) Nature Vector construction and transgenic lines...”
  • “...were used EF1 ( At1g07920 , At1g07930 , At1g07940 ) 5-GTCGATTCTGGAAAGTCGACC-3 and 5-AATGTCAATGGTGATACCACGC-3; CASP1 ( At2g36100 ) 5-AGAGAGGTTTGGCTATATT-3 and 5-CTACGGCTATCACAAAGTA-3; CASP4 ( At5g06200 ) 5-AGACTTCTCTTGCTTGTTCT-3 and 5-GACAGAAATCTCCAAACTG-3; AKT1 ( At2G26650 ) 5-TCTAAATTGTGTTCTTCTTCTGTTGGA-3 and 5-CCTTCCGCGTCTCTGCAA-3; HAK5 ( At4g13420 ) 5-CGAGACGGACAAAGAAGAGGAACC-3 and 5- CACGACCCTTCCCGACCTAATCT-3. Statistical analysis All statistical...”
• Apoplastic diffusion barriers in Arabidopsis
  Nawrath, The arabidopsis book 2013
  • “...STRIP DOMAIN PROTEINS (CASPs) (encoded by CASP1, At2g36100; CASP2, At3g11550; CASP3, At2g27370; CASP4, At5g06200; and CASP5, At5g15290). CASPs have all the...”

LOC101267864 casparian strip membrane protein 3-like from Solanum lycopersicum
Aligns to 18:167 / 182 (82.4%), covers 98.7% of PF04535, 149.7 bits

• Transcriptome analysis and functional validation reveal a novel gene, BcCGF1, that enhances fungal virulence by promoting infection-related development and host penetration
  Zhang, Molecular plant pathology 2020
  • “...Reticuline oxidaselike protein Solyc02g038740.2 HMG2 88.0 3hydroxy3methylglutarylcoenzyme A reductase 2 Solyc01g087280.1 LOC101263946 88.0 Polygalacturonase Solyc02g088160.2 LOC101267864 87.3 Casparian strip membrane protein Solyc05g046340.1 LOC101264724 84.0 Phosphomannomutase Solyc02g078930.1 LOC101268840 82.6 Hypothetical protein Solyc09g075700.1 LOC101255920 79.7 Probable carboxylesterase 13 Solyc04g083140.1 LOC101251277 78.9 Premnaspirodiene oxygenase Solyc04g071070.2 LOC544158 73.4 Hypothetical protein...”

CSPLP_ARATH / Q8L9B5 CASP-like protein 2B1; AtCASPL2B1 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
Aligns to 5:155 / 182 (83.0%), covers 99.3% of PF04535, 148.2 bits

• subunit: Homodimer and heterodimers.

CSPL2_ARATH / Q9XI72 CASP-like protein 1A1; AtCASPL1A1 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
Aligns to 45:194 / 209 (71.8%), covers 99.3% of PF04535, 143.1 bits

• subunit: Homodimer and heterodimers.

CASP3_ARATH / Q9ZQI2 Casparian strip membrane protein 3; AtCASP3 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
AT2G27370 integral membrane family protein (RefSeq) from Arabidopsis thaliana
Aligns to 56:205 / 221 (67.9%), covers 98.7% of PF04535, 142.7 bits

• function: Regulates membrane-cell wall junctions and localized cell wall deposition. Required for establishment of the Casparian strip membrane domain (CSD) and the subsequent formation of Casparian strips, a cell wall modification of the root endodermis that determines an apoplastic barrier between the intraorganismal apoplasm and the extraorganismal apoplasm and prevents lateral diffusion.
  subunit: Homodimer and heterodimers with other CASP proteins. Interacts with CASP1, CASP2, CASP4 and CASP5.
  disruption phenotype: Disorganised deposition of Casparian strips.
• Uclacyanin Proteins Are Required for Lignified Nanodomain Formation within Casparian Strips
  Reyt, Current biology : CB 2020
  • “...AT2G32300; UCC2 , AT2G44790; SGN3 , At4g20140; MYB36 , At5g57620; CASP1 , At2g36100; CASP3 , AT2G27370; ESB1 , At2g28670; RBOHF , At1g64060. Growth Conditions All seeds were surface sterilized, and then stratified for two days at 4C. Seeds were directly germinated on plates containing MS medium...”
• MYB36 regulates the transition from proliferation to differentiation in the Arabidopsis root
  Liberman, Proceedings of the National Academy of Sciences of the United States of America 2015
  • “...are as follows: AT2G36100 CASP1; AT3G11550 CASP2; AT2G27370 CASP3; AT5G06200 CASP4; AT5G15290 CASP5; AT5G03150 JACKDAW; AT1G03840 MAGPIE; AT5G44160 NUTCRACKER;...”
• Phylloxera (Daktulosphaira vitifoliae Fitch) alters the carbohydrate metabolism in root galls to allowing the compatible interaction with grapevine (Vitis ssp.) roots
  Griesser, Plant science : an international journal of experimental plant biology 2015
  • “...Wound-induced protein WI12 at5g01740 TC123291 3.06 1.32E07 15 0.00000 GSVIVT01036085001 VIT_06s0080g00840 Integral membrane family protein at2g27370 TC121390 3.08 4.61E07 112 0.00005 GSVIVT01009902001 VIT_18s0001g14270 Gibberellin-regulated protein 1 (GASA1) at1g75750 TC133463 3.20 7.14E07 178 0.00013 GSVIVT01029241001 VIT_11s0052g00650 Peroxidase at2g18980 TC132265 3.31 8.80E07 230 0.00020 GSVIVT01019452001 VIT_02s0025g00750 Pinoresinol forming...”
• A receptor-like kinase mutant with absent endodermal diffusion barrier displays selective nutrient homeostasis defects
  Pfister, eLife 2014
  • “...Nat Biotechnol AT2G36100 Col-0 SAIL_265_H05 casp1-1 LP: GCGTTTCAGTACGTCCCTTC RP: CACGTGAGGGAAGTGAGTCTC Roppolo et al. (2011) Nature AT2G27370 Col-0 SALK_011092 casp3-1 LP: GACTCTTCCTTTCTTCACTC RP: GACCAACACAACCGTACGAAC Roppolo et al. (2011) Nature Vector construction and transgenic lines For generation of expression constructs, Gateway Cloning Technology (Invitrogen, Carlsbad, CA) or standard...”
• Apoplastic diffusion barriers in Arabidopsis
  Nawrath, The arabidopsis book 2013
  • “...(encoded by CASP1, At2g36100; CASP2, At3g11550; CASP3, At2g27370; CASP4, At5g06200; and CASP5, At5g15290). CASPs have all the expected features for structural...”

CSPLM_ARATH / Q9FE29 CASP-like protein 1D1; AtCASPL1D1 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
AT4G15610, NP_567472 integral membrane family protein (RefSeq) from Arabidopsis thaliana
Aligns to 23:176 / 193 (79.8%), covers 99.3% of PF04535, 142.1 bits

• subunit: Homodimer and heterodimers.
• pH-dependent transcriptional profile changes in iron-deficient Arabidopsis roots
  Tsai, BMC genomics 2020
  • “...Dehydrin family protein 0.47 2.31 0.20 AT5G13750 ZIFL1, ZINC INDUCED FACILITATOR-LIKE 1 0.38 2.05 0.18 AT4G15610 Uncharacterized protein family 0.45 2.45 0.18 AT3G21690 MATE efflux family protein 0.41 2.31 0.18 AT5G66170 STR18, SULFURTRANSFERASE 18 0.41 2.41 0.17 AT1G13600 BZIP58, BASIC LEUCINE-ZIPPER 58 0.45 2.65 0.17 AT3G14990...”
• Characterization and transcriptome analysis of a dominant genic male sterile cotton mutant
  Cheng, BMC plant biology 2020
  • “...0.99678203 Gh_A04G0891 AT1G24020 MLP-like protein 423 0.991487505 Gh_A11G0981 AT2G47190 myb domain protein 2 0.988614125 Gh_A09G2048 AT4G15610 Uncharacterised protein family (UPF0497) 0.986062006 Gh_A12G1505 AT1G69490 NAC-like, activated by AP3/PI 0.985852055 Gh_D09G0861 AT3G47340 glutamine-dependent asparagine synthase 1 0.984832341 Gh_D11G0639 AT5G13870 xyloglucan endotransglucosylase/hydrolase 5 0.975723499 Gh_A03G1429 AT5G54510 Auxin-responsive GH3 family...”
• Identification of Candidate Ergosterol-Responsive Proteins Associated with the Plasma Membrane of Arabidopsis thaliana
  Khoza, International journal of molecular sciences 2019
  • “...protein RABE1c At3g46060 P28186 Signaling GTPase 1071.641 0.7 394.8 8.40 A9, A12 CASP-like protein 1D1 At4g15610 Q9FE29 --- --- 1127.657 0.3 389.4 9.41 A11 Plasma membrane ATPase At4g30190 F4JPJ7 Transport Translocase 1040.574 0.2 381.3 8.04 A11 ATPase 5, plasma membrane-type At2g24520 Q9SJB3 Transport Translocase 1040.574 0.0...”
• Cell Wall Remodeling in Abscission Zone Cells during Ethylene-Promoted Fruit Abscission in Citrus
  Merelo, Frontiers in plant science 2017
  • “...(CADs) CitCAD3 aCL33Contig1 C18001A01 AT4G37970 0.90 CASPARIAN STRIP MEMBRANE DOMAIN PROTEINS (CASPs) CitCASPL1D1a aCL6688Contig1 C04010H11 AT4G15610 0.74 CitCASPL2B2 aCL5933Contig1 C32104D12 AT2G35760 0.82 CitCASPL4A4 aC08028B10SK_c C08028B10 AT4G11655 0.93 0.61 , No significant regulation. Putative gene identifications are based on sequence homology with Arabidopsis thaliana. Additional data are...”
• Systems-wide analysis of manganese deficiency-induced changes in gene activity of Arabidopsis roots
  Rodríguez-Celma, Scientific reports 2016
  • “...0.93 Robustly Mn-responsive genes (i.e. changed at the mRNA and protein level) with miscellaneous functions AT4G15610 Uncharacterised protein family (UPF0497) 93.23 1.78 AT1G18670 IBS1 Protein kinase superfamily protein 21.49 1.58 AT5G42250 Zinc-binding alcohol dehydrogenase family protein 21.69 1.58 AT1G45145 H5 Thioredoxin H-type 5 107.51 1.5 AT3G26450...”
• Unraveling the iron deficiency responsive proteome in Arabidopsis shoot by iTRAQ-OFFGEL approach
  Zargar, Plant signaling & behavior 2013
  • “...0.115 1.301 0.146 AT1G02930 glutathione S-transferase 6 1.7 33.2 3.693 0.317 2.091 0.203 0.958 0.121 AT4G15610 Uncharacterised protein family (UPF0497) 3.0 14.5 3.470 1.610 2.406 0.911 0.906 0.102 AT4G38540 FAD/NAD(P)-binding oxidoreductase family protein 2.3 4.8 3.291 0.443 2.702 0.507 1.156 0.177 AT5G67330 natural resistance associated macrophage...”
• Relative abundance of integral plasma membrane proteins in Arabidopsis leaf and root tissue determined by metabolic labeling and mass spectrometry
  Bernfur, PloS one 2013
  • “...1 1 1.00 2 lR AT2G39530 Unknown molecular functions 19191 3 1 1.00 13 R AT4G15610 Unknown molecular functions 20796 4 1 0.81 12 lR AT5G44550 Unknown molecular functions 21019 4 1 1.00 7 R Proteins are grouped according to function and all annotation is via...”
• Arsenomics: omics of arsenic metabolism in plants
  Tripathi, Frontiers in physiology 2012
  • “...() 1.55 Os12g05394 () 3.27 Os09g12240 () 3.49 Integral membrane family protein Os04g45520 () 18.34 At4g15610 () 1.58 NAC domain-containing protein Os10g21630 (+) 5.81 At5g08790 () 1.53 Os02g15340 () 3.71 Compilation of data based on monocot O. sativa (Chakrabarty et al., 2009 ) and dicot (A....”
• More
• Identification of Candidate Ergosterol-Responsive Proteins Associated with the Plasma Membrane of Arabidopsis thaliana
  Khoza, International journal of molecular sciences 2019
  • “...RABE1c At3g46060 P28186 Signaling GTPase 1071.641 0.7 394.8 8.40 A9, A12 CASP-like protein 1D1 At4g15610 Q9FE29 --- --- 1127.657 0.3 389.4 9.41 A11 Plasma membrane ATPase At4g30190 F4JPJ7 Transport Translocase 1040.574 0.2 381.3 8.04 A11 ATPase 5, plasma membrane-type At2g24520 Q9SJB3 Transport Translocase 1040.574 0.0 362.8...”
• Transcriptomic and metabolite analyses of Cabernet Sauvignon grape berry development
  Deluc, BMC genomics 2007
  • “...ENERGY 11 2.73 1622517_at CB970523 TC54809 Q8W4Z5 Hypothetical Protein ENERGY 3 2.39 1621903_at CF404558 TC62294 Q9FE29 Hypothetical Protein ENERGY 13 2.23 1612648_at CD798203 CD798203 O80763 Hypothetical Protein ENERGY 21 2.15 1622345_at CB970837 TC55633 Q7XTZ0 Mandelonitrile lyase Flavoprotein 2 4.87 1606948_at CF404230 CF404230 Q01JW7 Mandelonitrile lyase Flavoprotein...”

CSPLK_ARATH / Q9ZT81 CASP-like protein 1C1; AtCASPL1C1 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
AT4G03540 integral membrane family protein (RefSeq) from Arabidopsis thaliana
Aligns to 3:143 / 164 (86.0%), covers 97.3% of PF04535, 141.7 bits

• subunit: Homodimer and heterodimers.
• Construction of high quality Gateway™ entry libraries and their application to yeast two-hybrid for the monocot model plant Brachypodium distachyon
  Cao, BMC biotechnology 2011
  • “...None NAD(P)-linked oxidoreductase superfamily ACC Bradi1g57590 Os10g11500 At4G33720 OsPR1#101 Pathogenesis-related 1 superfamily BL Bradi2g31700 Os05g15630 At4G03540 OsBLE3 Unknown molecular function GA3 Bradi2g31760 Os05g19600 At1G20190 OsEXP3, AtEXPA11 Alpha-expansin gene family IBA Bradi2g50840 Os01g55940 At4G37390 OsGH3-2, AtAUR3 IAA-amido synthase MeJA Bradi3g30860 Os10g37340 At1G64660 OsRRJ1, AtMGL Methionine gamma-lyase KT...”

AT5G44550 integral membrane family protein (RefSeq) from Arabidopsis thaliana
Aligns to 12:168 / 197 (79.7%), covers 98.0% of PF04535, 139.5 bits

• Relative abundance of integral plasma membrane proteins in Arabidopsis leaf and root tissue determined by metabolic labeling and mass spectrometry
  Bernfur, PloS one 2013
  • “...3 1 1.00 13 R AT4G15610 Unknown molecular functions 20796 4 1 0.81 12 lR AT5G44550 Unknown molecular functions 21019 4 1 1.00 7 R Proteins are grouped according to function and all annotation is via the database TAIR. a Predicted transmembrane domains determined by Phobius...”

CSPL3_ARATH / Q8VZQ3 CASP-like protein 2A1; AtCASPL2A1 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
AT1G17200 integral membrane family protein (RefSeq) from Arabidopsis thaliana
Aligns to 27:169 / 204 (70.1%), covers 97.3% of PF04535, 139.1 bits

• subunit: Homodimer and heterodimers.
• Membrane Proteomics of Arabidopsis Glucosinolate Mutants cyp79B2/B3 and myb28/29
  Mostafa, Frontiers in plant science 2017
  • “...0.020 Water deficiency response and transport D, H, S, T, M Kammerloher et al., 1994 Q8VZQ3 At1g17200 CASP-like protein At1g17200 AT1G17200 0.590 0.016 Binding activity D, H, S, T, M Tair Q9M386 At3g54200 Late embryogenesis abundant hydroxyproline-rich glycoprotein F24B22.160 0.588 0.004 . D, H, S, T,...”
• Membrane Proteomics of Arabidopsis Glucosinolate Mutants cyp79B2/B3 and myb28/29
  Mostafa, Frontiers in plant science 2017
  • “...Water deficiency response and transport D, H, S, T, M Kammerloher et al., 1994 Q8VZQ3 At1g17200 CASP-like protein At1g17200 AT1G17200 0.590 0.016 Binding activity D, H, S, T, M Tair Q9M386 At3g54200 Late embryogenesis abundant hydroxyproline-rich glycoprotein F24B22.160 0.588 0.004 . D, H, S, T, M...”
• Arabidopsis thaliana resistance to fusarium oxysporum 2 implicates tyrosine-sulfated peptide signaling in susceptibility and resistance to root infection
  Shen, PLoS genetics 2013
  • “...same gene that correlated with enhanced resistance in 1A3 transformants, whereas insertion in Salk_140524 interrupts At1g17200, a gene outside the overlapping sequence in Kpn1.2 and Sal1.2. Salk_051677, which was previously named Atrlp3-1 without a reported phenotype, was renamed rfo2 [31] . 10.1371/journal.pgen.1003525.g003 Figure 3 T-DNA insertion...”
  • “...rfo2 abolishes RFO2 QTL. (A) Fractions of n F 1 hybrids of Ty-0 and Salk_014524 (At1g17200) or Salk_051677 (At1g17250) were susceptible or resistant or had intermediate resistance, according to HI scores at 21 dpi. Median ranks of the two F 1 hybrids are dissimilar, according to...”

CSPLD_ARATH / Q9SQU2 CASP-like protein 1D2; AtCASPL1D2 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
Aligns to 32:185 / 199 (77.4%), covers 97.3% of PF04535, 138.7 bits

• subunit: Homodimer and heterodimers.
• Molecular responses of Lotus japonicus to parasitism by the compatible species Orobanche aegyptiaca and the incompatible species Striga hermonthica
  Hiraoka, Journal of experimental botany 2009
  • “...( Medicago truncatula ; ABD32291) 7.0E-14 BB999960 LjSh107s UPF0497 membrane protein ( Arabidopsis thaliana ; Q9SQU2) 2.0E-17 BB999935 LjSh11 Integral membrane family protein ( Arabidopsis thaliana ; NP_567472) 3.1E-56 BB999955 LjSh290s UVI1 ( Pisum sativum ; Q9AUH7) 1.5E-54 BB999972 No homology LjSh24-1 None BB999966 Seven genes...”

CSPLQ_ARATH / Q9SUP0 CASP-like protein 1B2; AtCASPL1B2 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
Aligns to 12:168 / 197 (79.7%), covers 98.7% of PF04535, 137.1 bits

• subunit: Homodimer and heterodimers.

CSPLO_ARATH / Q8L8Z1 CASP-like protein 1E1; AtCASPL1E1 from Arabidopsis thaliana (Mouse-ear cress) (see 2 papers)
AT4G15630 integral membrane family protein (RefSeq) from Arabidopsis thaliana
Aligns to 21:177 / 190 (82.6%), covers 98.0% of PF04535, 135.9 bits

• subunit: Homodimer and heterodimers.
• Glycosylphosphatidylinositol-Anchored Proteins in Arabidopsis and One of Their Common Roles in Signaling Transduction
  Zhou, Frontiers in plant science 2019
  • “...required for nitrogen recycling from purine ring in plants ( Werner et al., 2008 ). AT4g15630 CASPL1E1 AT4g15620 CASPL1E2 Not typical GPI-Aps Transmembrane protein with predicted omega domain at C terminus 8 AT4g02420 AT1g53210 AT1g55910 ZIP11 AT3g48200 AT1g42470 ATNPC1-1 AT1g70940 PIN3 Auxin efflux carrier family protein...”
• Membrane Proteomics of Arabidopsis Glucosinolate Mutants cyp79B2/B3 and myb28/29
  Mostafa, Frontiers in plant science 2017
  • “...and ion transport D, H, S, T, M Rai et al., 2016 ; tair Q8L8Z1 At4g15630 CASP-like protein At4g15630 AT4G15630 0.701 0.024 Binding of protein D, H, S, T, M Tair Q9FYK0 At1g24650 Leucine-rich repeat protein kinase F21J9.31 LRR-RLK 0.701 0.043 Growth process. D, S, T,...”
• Unraveling the iron deficiency responsive proteome in Arabidopsis shoot by iTRAQ-OFFGEL approach
  Zargar, Plant signaling & behavior 2013
  • “...0.502 0.061 1.073 0.073 AT4G16155 dihydrolipoyl dehydrogenases 3.0 0.2 0.381 0.124 0.507 0.095 0.808 0.351 AT4G15630 Uncharacterised protein family (UPF0497) 2.0 0.1 0.387 0.082 0.544 0.009 0.900 0.063 AT1G68530 3-ketoacyl-CoA synthase 6 1.7 0.0 0.394 0.104 0.600 0.207 1.080 0.396 AT3G16950 lipoamide dehydrogenase 1 2.0 0.2...”
• Transcriptome analyses of early cucumber fruit growth identifies distinct gene modules associated with phases of development
  Ando, BMC genomics 2012
  • “...3); actin binding 5.0E-63 153 715 766 317 No hits found 12937 953 418 312 AT4G15630 integral membrane family protein 3.0E-37 11169 949 792 284 AT1G28330 DYL1 (DORMANCY-ASSOCIATED PROTEIN-LIKE 1) 3.0E-41 2993 1046 494 270 No hits found 2805 767 757 267 No hits found 13496...”
• Membrane Proteomics of Arabidopsis Glucosinolate Mutants cyp79B2/B3 and myb28/29
  Mostafa, Frontiers in plant science 2017
  • “...response and ion transport D, H, S, T, M Rai et al., 2016 ; tair Q8L8Z1 At4g15630 CASP-like protein At4g15630 AT4G15630 0.701 0.024 Binding of protein D, H, S, T, M Tair Q9FYK0 At1g24650 Leucine-rich repeat protein kinase F21J9.31 LRR-RLK 0.701 0.043 Growth process. D, S,...”

Q8W4Z5 CASP-like protein F16 from Gossypium hirsutum
Aligns to 32:173 / 207 (68.6%), covers 99.3% of PF04535, 132.6 bits

• Transcriptomic and metabolite analyses of Cabernet Sauvignon grape berry development.
  Deluc, BMC genomics 2007
  • “...ENERGY 3 3 1614875_at CF518552 TC69033 A5AU55 Hypothetical Protein ENERGY 11 2.73 1622517_at CB970523 TC54809 Q8W4Z5 Hypothetical Protein ENERGY 3 2.39 1621903_at CF404558 TC62294 Q9FE29 Hypothetical Protein ENERGY 13 2.23 1612648_at CD798203 CD798203 O80763 Hypothetical Protein ENERGY 21 2.15 1622345_at CB970837 TC55633 Q7XTZ0 Mandelonitrile lyase Flavoprotein...”

CSPLN_ARATH / O23413 CASP-like protein 1E2; AtCASPL1E2 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
AT4G15620 integral membrane family protein (RefSeq) from Arabidopsis thaliana
Aligns to 22:177 / 190 (82.1%), covers 97.3% of PF04535, 129.8 bits

• subunit: Homodimer and heterodimers.
• Glycosylphosphatidylinositol-Anchored Proteins in Arabidopsis and One of Their Common Roles in Signaling Transduction
  Zhou, Frontiers in plant science 2019
  • “...nitrogen recycling from purine ring in plants ( Werner et al., 2008 ). AT4g15630 CASPL1E1 AT4g15620 CASPL1E2 Not typical GPI-Aps Transmembrane protein with predicted omega domain at C terminus 8 AT4g02420 AT1g53210 AT1g55910 ZIP11 AT3g48200 AT1g42470 ATNPC1-1 AT1g70940 PIN3 Auxin efflux carrier family protein AT2g01420 PIN4...”
• Arabidopsis flower specific defense gene expression patterns affect resistance to pathogens
  Ederli, Frontiers in plant science 2015
  • “...Ribonuclease 1 AT4G24000 CA Cellulose synthase G2 AT4G23680 Polyketide cyclase, lipid transport AT1G02790 CA Exopolygalacturonase AT4G15620 UPF 497 membrane protein AT3G27810 MYB21, R2R3-MYB family AT1G80160 CA Lactoylglutathione lyase AT5G15800 Developmental protein SEPALLATA 1 AT1G54570 CA Acyltransferase-like protein, chloroplast AT2G47030 CA Pectinesterase 4 AT4G33040 CA Glutaredoxin-C6 AT5G02580...”

M8BCR3 CASP-like protein from Aegilops tauschii
Aligns to 28:169 / 204 (69.6%), covers 98.7% of PF04535, 129.1 bits

• Identification of Two Novel Wheat Drought Tolerance-Related Proteins by Comparative Proteomic Analysis Combined with Virus-Induced Gene Silencing.
  Wang, International journal of molecular sciences 2018
  • “...randomly selected 4 XN979-specific DAPs (B1P766, W5DYH0, W5ERN8, and W5EI90), 5 LA379-specific DAPs (A0MA43, M8BCN0, M8BCR3, M8BTH4, and T1N5G8), and 3 common responsive proteins in both varieties (W5H6J0, V9QGR5, and Q8VYX1) for analysis of their RNA levels. TaActin and TaGAPDH were used as reference genes to...”

CSPLF_ARATH / Q3EB59 CASP-like protein 3A1; AtCASPL3A1 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
Aligns to 41:196 / 212 (73.6%), covers 98.7% of PF04535, 126.9 bits

• subunit: Homodimer and heterodimers.

GRMZM5G806387 CASP-like protein 2A1 from Zea mays
Aligns to 36:177 / 213 (66.7%), covers 98.7% of PF04535, 126.6 bits

• Genome-wide association study Identified multiple Genetic Loci on Chilling Resistance During Germination in Maize
  Hu, Scientific reports 2017
  • “...RDT50/RGI ss196436428 GRMZM2G178486 *# exon 248.98 0.81 Zinc finger proteins: C3HC4-type family proteins RDT50/RGI ss196436428 GRMZM5G806387 *# exon 366.49 0.8 Casp-like protein 2a1 RDT50/RGI ss196436428 GRMZM2G148793 # intron 216.19 0.86 TPA: hypothetical protein ZEAMMB73_617749 All candidate genes contain either an associated SNP or a SNP in...”
  • “...GRMZM2G462797 ZEAMMB73_597353 AT1G12650.1 LOC_Os09g35670.1 12 GRMZM2G704005 ZEAMMB73_876334 AT2G32090.1 LOC_Os03g45720 13 GRMZM5G802338 NA NA NA 14 GRMZM5G806387 ZEAMMB73_117651 AT1G17200.1 LOC_Os04g21320 15 GRMZM2G113158 ZEAMMB73_572941 AT1G34300.1 LOC_Os03g62180 16 GRMZM2G318156 ZEAMMB73_082780 NA NA 17 GRMZM5G871707 NA NA NA 18 GRMZM2G148793 NA NA NA Functional prediction of candidate genes We found...”

N24_MEDTR / O24088 CASP-like protein N24; CASP-like protein 4A1; MtCASPL4A1; Nodulin 24; MtN24 from Medicago truncatula (Barrel medic) (Medicago tribuloides) (see paper)
Aligns to 61:218 / 234 (67.5%), covers 98.0% of PF04535, 122.6 bits

• subunit: Homodimer and heterodimers.

AT4G25830 integral membrane family protein (RefSeq) from Arabidopsis thaliana
Aligns to 1:147 / 175 (84.0%), covers 98.0% of PF04535, 121.5 bits

• Arabidopsis flower specific defense gene expression patterns affect resistance to pathogens
  Ederli, Frontiers in plant science 2015
  • “...Unknown protein in the cell wall AT5G62360 CW * Unknown protein in the cell wall AT4G25830 UPF0497 membrane protein AT5G47550 CW EXE Cysteine proteinase inhibitor 5 AT1G12090 Extensin-like protein (ELP) AT1G24260 Sepallata 3 AT1G11850 Unknown protein CW, Cell wall (GO: 000 5618, FDR: 4.5e 06 );...”

BLE3_ORYSJ / Q84UT5 CASP-like protein BLE3; CASP-like protein 1C2; OsCASPL1C2; Protein brassinolide-enhanced 3; OsBLE3; Protein BL-enhanced 3 from Oryza sativa subsp. japonica (Rice) (see paper)
XP_015638091 CASP-like protein BLE3 from Oryza sativa Japonica Group
Aligns to 2:142 / 162 (87.0%), covers 97.3% of PF04535, 121.3 bits

• function: Involved in cell elongation in rice through dual regulation by brassinolide and auxin.
  subunit: Homodimer and heterodimers.
• OsBLE3, a brassinolide-enhanced gene, is involved in the growth of rice.
  Yang, Phytochemistry 2006 (PubMed)
  • GeneRIF: OsBLE3 is involved in cell elongation in rice through dual regulation by brassinolide and IAA

Sb09g008190 No description from Sorghum bicolor
Aligns to 2:142 / 162 (87.0%), covers 97.3% of PF04535, 120.3 bits

• The physical map of wheat chromosome 1BS provides insights into its gene space organization and evolution
  Raats, Genome biology 2013
  • “..., rice Os5 between genes LOC_Os05g01020 through LOC_Os05g15630 and sorghum Sb9 between genes Sb09g000200 through Sb09g008190 [ 35 ]. Brachypodium contains 600 genes in the 1S syntenic region (after filtering for TE sequences and possible annotation artifacts [ 35 ]). To account for genes that might...”

CSPLR_ARATH / Q9M0L3 CASP-like protein 1F1; AtCASPL1F1 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
Aligns to 14:155 / 170 (83.5%), covers 96.0% of PF04535, 118.3 bits

• subunit: Homodimer and heterodimers.

AT3G55390 integral membrane family protein (RefSeq) from Arabidopsis thaliana
Aligns to 31:168 / 194 (71.1%), covers 97.3% of PF04535, 112.1 bits

• A Casparian strip domain-like gene, CASPL, negatively alters growth and cold tolerance
  Yang, Scientific reports 2015
  • “...membrane protein in watermelon 13 . The orthologue to this gene was identified to be At3g55390 in Arabidopsis thaliana , where it is annotated as the CASP-LIKE PROTEIN 4C1. At3g55390 belongs to the CASP protein family containing the five CASP genes ( CASP1/2/3/4/5) , which are...”
  • “...of Arabidopsis ( Arabidopsis thaliana) (Col-0) were used for amplification of ClCASPL and AtCASPL4C1 ( At3G55390 ) genes. WT Arabidopsis thaliana (Col-0) was used for transformation to construct OX-ClCASPL of Arabidopsis. The SALK_034800C line was used for screening of homozygous Atcaspl4c1 knock-out mutant plants. 3-week-old plants...”
• Requirement of the C3HC4 zinc RING finger of the Arabidopsis PEX10 for photorespiration and leaf peroxisome contact with chloroplasts
  Schumann, Proceedings of the National Academy of Sciences of the United States of America 2007
  • “...a prokaryotic membrane lipoprotein with a lipid attachment site (At3g55390). In Zn2, the integration was found 140 bp downstream of the stop codon within the 3...”
  • “...809777 with an insertion in the third exon of the gene At3g55390 affected in the Zn1 line, and SALK line 537722 with an insertion in the fifth exon of the gene...”

CSPLE_ARATH / Q9LUL1 CASP-like protein 2A2; AtCASPL2A2 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
AT3G14380 integral membrane family protein (RefSeq) from Arabidopsis thaliana
Aligns to 17:172 / 178 (87.6%), covers 98.0% of PF04535, 109.8 bits

• function: Involved in floral organ shedding.
  subunit: Homodimer and heterodimers.
  disruption phenotype: Delayed timing of petal abscission.
• In silico analysis of high affinity potassium transporter (HKT) isoforms in different plants
  Zamani, Aquatic biosystems 2014
  • “...response MYB21 MYB3 Lipase class 3 family protein MYB24 DNA binding-jasmonic & giberellic acid response At3g14380 Integral membrane family protein At5g49130 MATE efflux family protein AtUGT85A3 Glucuronosyl transferase CYP76C3 Electron carrier activity At1g29490 Auxin-responsive family protein At3g55870 Anthranilate synthase, alpha subunit, putative AtMYB57 DNA binding-jasmonic &...”
• High-throughput sequencing and de novo assembly of Brassica oleracea var. Capitata L. for transcriptome analysis
  Kim, PloS one 2014
  • “...2984 . 8039494 40 Zhang L (2007) Expression and function analyses of abscission related gene At3g14380. 18th International Conference on Arabidopsis Research Available: http://www.arabidopsis.org/news/2007_18thICAR_CompleteProgram.pdf . 41 Schmid M , Davison TS , Henz SR , Pape UJ , Demar M , et al ( 2005 )...”
• A novel approach to dissect the abscission process in Arabidopsis
  González-Carranza, Plant physiology 2012 (PubMed)
  • “...and an IDA-overexpressing line. Phenotypic analysis of an At3g14380 transfer DNA insertion line indicates that this gene plays a functional role in floral organ...”
  • “...expression of seven genes, At1g64405, At2g23630, At2g44010, At3g14380, At3g53040, At3g56350, and At5g50540, four of which (At1g64405, At2g44010, At3g53040, and...”

LOC110788005 CASP-like protein XL3 from Spinacia oleracea
Aligns to 1:155 / 190 (81.6%), covers 96.7% of PF04535, 109.7 bits

• Identification and Initial Characterization of the Effectors of an Anther Smut Fungus and Potential Host Target Proteins
  Kuppireddy, International journal of molecular sciences 2017
  • “...of fungal gene MVLG_06175 interacts with a host CASP-like protein 2C1 orthologue of Spinacia oleracea (LOC110788005), transcript mRNA (XM_021992637.1); it also matched CASP-like protein 2C1, AT4G25830.1 of A. thaliana . The corresponding transcript from Silene expression data (Toh et al. submitted) similarly matched the same S....”

CSPLX_ARATH / Q9FFT2 CASP-like protein 2D1; AtCASPL2D1 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
Aligns to 26:166 / 194 (72.7%), covers 98.0% of PF04535, 109.5 bits

• subunit: Homodimer and heterodimers.
• Transcriptomic and metabolite analyses of Cabernet Sauvignon grape berry development
  Deluc, BMC genomics 2007
  • “...ENERGY 10 4.82 1616241_at CD797326 CD797326 Q8VYC5 Hypothetical Protein ENERGY 16 4.08 1609285_at CF414528 TC57440 Q9FFT2 Hypothetical Protein ENERGY 2 3.44 1611820_at CB914713 TC69253 O80763 Hypothetical Protein ENERGY 3 3.09 1606562_at CF404246 TC59415 A3J369 Nitrilase 1 ENERGY 11 3.04 1621817_at CB978007 TC64650 O80763 Hypothetical Protein ENERGY...”

Q20BM9 CASP-like protein 1 from Panax ginseng
Aligns to 1:130 / 148 (87.8%), covers 83.3% of PF04535, 106.4 bits

• Microarray analysis of siberian ginseng cyclic somatic embryogenesis culture systems provides insight into molecular mechanisms of embryogenic cell cluster generation
  Zhou, PloS one 2014
  • “...No significant similarity found 2.00E-04 JZ511890 44.91 2.14 3.16 Down CASP-like protein 1, Panax ginseng (Q20BM9) 3.00E-30 JZ514138 2.31 6.33 2.38 Down SDR, R. communis (XM_002509770.1) 4.00E-63 JZ514908 36.95 2.60 3.59 Down Thaumatin-like protein, V. vinifera (XM_002265816.1) 6.00E-23 JZ514859 26.63 2.27 2.19 Down No significant similarity...”

CSPLU_ARATH / Q9LZM5 CASP-like protein 5B1; AtCASPL5B1 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
AT5G02060 integral membrane protein, putative (RefSeq) from Arabidopsis thaliana
Aligns to 6:139 / 152 (88.2%), covers 99.3% of PF04535, 106.0 bits

• subunit: Homodimer and heterodimers.
• Using intron position conservation for homology-based gene prediction
  Keilwagen, Nucleic acids research 2016
  • “...matches the sequenced cDNA confirming among others the alternative splicing for At3g57910. In case of At5g02060, we found a 1 bp deletion in the reference sequence leading two a 4 bp difference at the donor splice site of exon 2, which GeMoMa is conceptually unable to...”
  • “...Sc_19.43 () 367369 missing gene as predicted At4g16566 Sc_29.148 () 15591575 missing gene as predicted At5g02060 Sc_33 () 16651673 missing gene well matching At3g57910 Sc_85 () 586589 1 missing exon as predicted At4g38240 Sc_28580 () 411 2 missing exons well matching At3g13120 Sc_12 (+) 15681570 2...”

CSPLI_ARATH / Q945M8 CASP-like protein 5B2; AtCASPL5B2 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
AT3G53850 hypothetical protein (RefSeq) from Arabidopsis thaliana
Aligns to 6:139 / 154 (87.0%), covers 98.0% of PF04535, 103.3 bits

• subunit: Homodimer and heterodimers.
• Genetical genomics identifies the genetic architecture for growth and weevil resistance in spruce
  Porth, PloS one 2012
  • “...WS00912_K11 0.080 2.1E47 AT2G19680 mitochondrial ATP synthase g subunit family protein miscellaneous WS00927_K21 0.082 2.10E026 AT3G53850 similar to integral membrane protein, putative [Arabidopsis thaliana] miscellaneous WS00712_A12 0.091 8.40E084 AT1G60420 DC1 domain-containing protein miscellaneous WS0032_G24 0.095 3.90E057 AT2G37270 ATRPS5B ATRPS5B (RIBOSOMAL PROTEIN 5B); structural constituent of ribosome...”

B6U769 CASP-like protein 2C1 from Zea mays
Aligns to 8:153 / 187 (78.1%), covers 96.0% of PF04535, 102.5 bits

• Distinguishing proteins from arbitrary amino acid sequences.
  Yau, Scientific reports 2015
  • “...0.000036147 16 240 P06676 Glycine (G) 0.000036147 17 267 P04698 Glycine (G) 0.000070559 18 187 B6U769 Proline (P) 0.0037...”

CSPL6_ARATH / Q9SKN3 CASP-like protein 5A2; AtCASPL5A2 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
AT2G28370 hypothetical protein (RefSeq) from Arabidopsis thaliana
Aligns to 34:164 / 179 (73.2%), covers 99.3% of PF04535, 97.7 bits

• subunit: Homodimer and heterodimers.
• Transcriptome analysis of resistant soybean roots infected by Meloidogyne javanica
  de, Genetics and molecular biology 2012
  • “...Positives = 39/80 (48%) Plasmodium yoelii ref|XP_730210.1| 3.0 0 2 2 Contig62 UPF0497 membrane protein At2g28370, Positives = 49/55 (89%) Arabidopsis thaliana sp|Q9SKN3.1|U4977_ARATH 1e-20 0 2 2 Contig63 MADS-box protein SOC1 (protein suppressor of constans overexpression 1) Positives = 77/82 (93%) Glycine max gb|ABC75835.1| 3e-33 0...”
• A single Banana streak virus integration event in the banana genome as the origin of infectious endogenous pararetrovirus
  Gayral, Journal of virology 2008
  • “...found No significant similarity found Hypothetical protein At2g28370 (Arabidopsis thaliana) NA ATPase subunit (Calycanthus fertilis) NA 1e.15 8e.07 Result NA No...”
• Conserved features of germination and polarized cell growth: a few insights from a pollen-fern spore comparison
  Bushart, Annals of botany 2007
  • “...AT1G23750, AT2G21870, AT2G29040, AT2G32910, AT4G10440, AT1G64980, AT2G28370, AT4G22310, AT4G28050, AT4G31420, AT4G39230, AT5G67490 No. of Ceratopteris ESTs* 4 3...”

C6TFK6 CASP-like protein (Fragment) from Glycine max
Aligns to 6:137 / 152 (86.8%), covers 98.0% of PF04535, 92.7 bits

• NanoUPLC-MSE proteomic data assessment of soybean seeds using the Uniprot database
  Murad, BMC biotechnology 2012
  • “...C6T0W4 C6T4U1 27 C6T5Q9 C6T6R9 C6T0Z7 C6TFK5 C6T124 C6T614 C6T0X4 C6T5Y9 28 C6T5V9 C6T6V2 C6T0Z9 C6TFK6 C6T128 C6T635 C6T0Y2 C6T5Z3 29 C6T5W3 C6T6X9 C6T101 C6TFL5 C6T130 C6T656 C6T0Y4 C6T604 30 C6T602 C6T6Y2 C6T122 C6TFS1 C6T132 C6T676 C6T0Z0 C6T661 31 C6T606 C6T7V8 C6T143 C6TFT9 C6T137 C6T6A8 C6T0Z5...”
  • “...Q9S8R7 91 C6TLD5 C6TEN7 Q9S8X5 92 C6TLV0 C6TF61 Q9S926 93 C6TN00 C6TF86 Q9S9H5 94 C6TN18 C6TFK6 95 C6TN83 C6TFW2 96 Q2PMN5 C6TFY6 97 Q3HM31 C6TH40 98 Q8S3C5 C6THI2 99 Q9S8F2 C6TIA8 100 Q9S8F3 C6TJW9 101 Q9SBB0 C6TK75 102 C6TKY5 103 C6TLF7 104 C6TMR8 105 C6TNC0 106...”

Q8LE26 CASP-like protein 4B1 from Arabidopsis thaliana
AT2G38480 integral membrane protein, putative (RefSeq) from Arabidopsis thaliana
Aligns to 41:170 / 188 (69.1%), covers 98.0% of PF04535, 92.1 bits

• Membrane Proteomics of Arabidopsis Glucosinolate Mutants cyp79B2/B3 and myb28/29
  Mostafa, Frontiers in plant science 2017
  • “...serine/threonine-protein kinase AT1G11410 0.733 0.049 Kinase and binding activities D, H, S, T, M Tair Q8LE26 At2g38480 CASP-like protein At2g38480 AT2G38480 0.729 0.002 D, H, T, M Tair P43287 At2g37170 Aquaporin PIP2-2 PIP2-2 0.725 0.011 Water deficiency response and transport D, H, S, T, M Javot,...”
• Overexpression and cosuppression of xylem-related genes in an early xylem differentiation stage-specific manner by the AtTED4 promoter
  Endo, Plant biotechnology journal 2018
  • “...0.194 0.018 20 At5g17600 7.397 3.301 0 At1g70550 0.225 0.023 5 At1g75410 15.512 2.736 3 At2g38480 0.231 0.021 2 At4g28500 18.555 0.095 2 At5g26330 0.263 ( n =2) 1 At5g03170 23.441 3.623 0 At5g08370 0.311 ( n =2) 13 At2g38080 27.376 0.503 5 At1g78340 0.386 0.077...”
• Extra Large G-Protein Interactome Reveals Multiple Stress Response Function and Partner-Dependent XLG Subcellular Localization
  Liang, Frontiers in plant science 2017
  • “...ATP synthase subunit gamma 0.235 5.8E-28 Y2H SAL XLG3 At2g34410 O-acetyltransferase-like protein Y2H GLUC XLG3 At2g38480 * CASP-like protein 0.135 1.3E-12 Y2H/BiFC GLUC XLG3 At2g40140 * Zinc finger CCCH domain-containing protein 29 0.137 1.1E-35 Y2H/BiFC GLUC XLG3 At2g41430 * Dehydration-induced protein ERD15 0.162 2.0E-32 Y2H GLUC...”
  • “...XLG1 and 3 interacting proteins outside the nucleus. (A) At1g71030 (B) At1g44170 (C) At4g02380 (D) At2g38480 (E) At3g19640 (F) At5g66240. The XLGs were fused to the N-terminus of YFP and the prey proteins were fused to the C-terminus of YFP. The bait constructs nYFP-XLG1 and XLG3...”
• Membrane Proteomics of Arabidopsis Glucosinolate Mutants cyp79B2/B3 and myb28/29
  Mostafa, Frontiers in plant science 2017
  • “...kinase AT1G11410 0.733 0.049 Kinase and binding activities D, H, S, T, M Tair Q8LE26 At2g38480 CASP-like protein At2g38480 AT2G38480 0.729 0.002 D, H, T, M Tair P43287 At2g37170 Aquaporin PIP2-2 PIP2-2 0.725 0.011 Water deficiency response and transport D, H, S, T, M Javot, 2003...”
• The hunt for hypoxia responsive natural antisense short interfering RNAs
  Moldovan, Plant signaling & behavior 2010
  • “...under hypoxia. The results showed that three genes AT2G38480, AT3G61300 and AT1G55390 had lost repression under hypoxia in the nrpd1a mutant by at least...”
  • “...between genes was found, although none belonging to AT2G38480, AT3G61300 or AT1G55390. However, the deep sequencing had not reached saturation, and most of the...”

B6U8R7 CASP-like protein 2C4 from Zea mays
Aligns to 6:162 / 184 (85.3%), covers 96.0% of PF04535, 90.2 bits

• Proteomic profiling of vetiver grass (Chrysopogon zizanioides) under 2,4,6-trinitrotoluene (TNT) stress.
  Das, GeoHealth 2017
  • “...to Control, Annotated Using UniProt Database UniProt Accession Numbers Entry Names Protein Names Gene Names B6U8R7 CSPL9_MAIZE CASPlike protein 2C4 (ZmCASPL2C4) P24274 DRP90_SOYBN DNAbinding protein DRP90 DRP90 A9PHC5 METK4_POPTR Sadenosylmethionine synthase 4 (AdoMet synthase 4) (EC 2.5.1.6) (methionine adenosyltransferase 4) (MAT 4) METK4 POPTR_0006s12510g Q9M8Y0 SEC_ARATH...”

Q2R2T4 CASP-like protein 4D1 from Oryza sativa subsp. japonica
Aligns to 6:157 / 171 (88.9%), covers 98.0% of PF04535, 88.5 bits

• Genome-wide association mapping of iron homeostasis in the maize association population
  Benke, BMC genetics 2015
  • “...11.09 GRMZM2G460958 Q9LRB7 E3 ubiquitin-protein ligase EL5 S5_175221001 5 175,221,001 1.2e-07 T/G 1.28 11.52 GRMZM2G128029 Q2R2T4 CASP-like protein Os11g0549625 S7_106685037 7 106,685,037 1.0e-06 T/G 1.21 10.05 Simultaneous fit 30.78 RW S4_167072278 4 167,072,278 3.7e-10 C/A -6.23 18.81 GRMZM2G015049 Q9LR00 SAUR-like auxin-responsive protein S6_160330734 6 160,330,734 1.5e-07...”

NP_001237047 uncharacterized protein LOC100527764 from Glycine max
Aligns to 37:167 / 182 (72.0%), covers 98.0% of PF04535, 87.3 bits

• Cellular and Transcriptional Responses of Resistant and Susceptible Cultivars of Alfalfa to the Root Lesion Nematode, Pratylenchus penetrans
  Vieira, Frontiers in plant science 2019
  • “...Livak and Schmittgen, 2001 ). The reference gene for alfalfa in all qPCR experiments was NP_001237047, a gene of unknown function with little variation in expression levels ( Postnikova et al., 2013 ). For the qPCRs of P. penetrans transcripts, the 18S rDNA gene was used...”
• Transcriptome analysis of resistant and susceptible alfalfa cultivars infected with root-knot nematode Meloidogyne incognita
  Postnikova, PloS one 2015
  • “...qPCRs was made from the same RNA samples that were used for RNA-sequencing. Previously detected NP_001237047, an unknown gene with little variation in expression levels, was used as a reference in all qPCR experiments [ 21 ]. The specificity of all amplifications was confirmed by single-peak...”

C6TD51 CASP-like protein from Glycine max
Aligns to 6:137 / 152 (86.8%), covers 98.0% of PF04535, 87.3 bits

• NanoUPLC-MSE proteomic data assessment of soybean seeds using the Uniprot database
  Murad, BMC biotechnology 2012
  • “...Q41267 85 C6TC31 C6TBR9 Q4W666 86 C6TCV3 C6TBS2 Q6J5U8 87 C6TDZ9 C6TBV4 Q6LBP7 88 C6TE40 C6TD51 Q6LED6 89 C6TFL5 C6TD69 Q7M1K4 90 C6TGX9 C6TE34 Q9S8R7 91 C6TLD5 C6TEN7 Q9S8X5 92 C6TLV0 C6TF61 Q9S926 93 C6TN00 C6TF86 Q9S9H5 94 C6TN18 C6TFK6 95 C6TN83 C6TFW2 96 Q2PMN5 C6TFY6...”

CSPLG_ARATH / Q8L7R5 CASP-like protein 5B3; AtCASPL5B3 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
AT3G23200 hypothetical protein (RefSeq) from Arabidopsis thaliana
Aligns to 6:137 / 152 (86.8%), covers 98.0% of PF04535, 85.7 bits

• subunit: Homodimer and heterodimers.
• miRNA and Degradome Sequencing Reveal miRNA and Their Target Genes That May Mediate Shoot Growth in Spur Type Mutant "Yanfu 6"
  Song, Frontiers in plant science 2017
  • “...novel_mir_249 MDP0000540293 Protein phosphatase 2A subunit A2 AT3G25800 PP2AA2 novel_mir_249 MDP0000541775 Uncharacterised protein family (UPF0497) AT3G23200 novel_mir_249 MDP0000651056 AT5G05800 novel_mir_249 MDP0000674456 novel_mir_249 MDP0000690147 ARM repeat superfamily protein AT4G16490 novel_mir_249 MDP0000701629 novel_mir_263 MDP0000165935 Nucleotide/sugar transporter family protein AT5G17630 novel_mir_266 MDP0000368249 novel_mir_292 MDP0000530198 EXORDIUM like 3 AT5G51550 EXL3...”

CSPL4_ARATH / Q3ECT8 CASP-like protein 5C3; AtCASPL5C3 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
Aligns to 6:136 / 152 (86.2%), covers 98.7% of PF04535, 85.0 bits

• subunit: Homodimer and heterodimers.

C6TE71 CASP-like protein from Glycine max
Aligns to 6:137 / 152 (86.8%), covers 98.0% of PF04535, 84.0 bits

• NanoUPLC-MSE proteomic data assessment of soybean seeds using the Uniprot database
  Murad, BMC biotechnology 2012
  • “...47 C6T6J9 Q6JC68 C6T631 Q2PMS0 C6T620 C6TDT6 C6T4B2 C6T9A8 48 C6T6K2 Q7M212 C6T633 Q2PMT7 C6T643 C6TE71 C6T5V1 C6T9K4 49 C6T6L0 Q84U84 C6T639 Q39829 C6T652 C6TG02 C6T5X3 C6TA51 50 C6T6L7 Q8S3C5 C6T645 Q4W663 C6T664 C6TGS5 C6T5Y8 C6TAK0 51 C6T6N6 Q8S3C6 C6T649 Q6LBP7 C6T666 C6TIG4 C6T608 C6TBL2 52...”

PIMP1_CAPAN / A1XGB4 CASP-like protein PIMP1; CASP-like protein 4D1; CaCASPL4D1; Pathogen-induced membrane protein 1; CaPIMP1 from Capsicum annuum (Capsicum pepper) (see 2 papers)
Aligns to 9:157 / 166 (89.8%), covers 96.0% of PF04535, 83.3 bits

• function: Required for defense response to Xanthomonas campestris pv. vesicatoria (Xcv). In heterologous systems, confers resistance to bacterial pathogens such as Pseudomonas syringae pv. tomato but susceptibility to pathogenic oomycetes such as Hylaloperonospora parasitica when expressed in Arabidopsis thaliana. May be involved in the regulation of responses to bitoic and abiotic stresses.
  subunit: Homodimer and heterodimers.

AT4G11655 transmembrane protein, putative (RefSeq) from Arabidopsis thaliana
Aligns to 49:190 / 208 (68.3%), covers 98.7% of PF04535, 82.6 bits

• Cell Wall Remodeling in Abscission Zone Cells during Ethylene-Promoted Fruit Abscission in Citrus
  Merelo, Frontiers in plant science 2017
  • “...PROTEINS (CASPs) CitCASPL1D1a aCL6688Contig1 C04010H11 AT4G15610 0.74 CitCASPL2B2 aCL5933Contig1 C32104D12 AT2G35760 0.82 CitCASPL4A4 aC08028B10SK_c C08028B10 AT4G11655 0.93 0.61 , No significant regulation. Putative gene identifications are based on sequence homology with Arabidopsis thaliana. Additional data are shown in Figure S7 . Figure 8 Lignin biosynthesis and...”

CSPLC_ARATH / Q8GWD5 CASP-like protein 4D1; AtCASPL4D1 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
AT2G39530 integral membrane protein, putative (RefSeq) from Arabidopsis thaliana
Aligns to 10:158 / 178 (83.7%), covers 98.0% of PF04535, 79.6 bits

• subunit: Homodimer and heterodimers.
• A comprehensive expression analysis of the expansin gene family in potato (Solanum tuberosum) discloses stress-responsive expansin-like B genes for drought and heat tolerances
  Chen, PloS one 2019
  • “...Zhu Y , Cai H , Ji W , et al Arabidopsis UPF0497 family member At2g39530 is responsive to different abiotic stresses . J. Northeast Agr Univ . 2013 ; 44 : 139 144 . 10.19720/j.cnki.issn.1005-9369.2013.10.024 60 Cho HT , Cosgrove DJ . Regulation of root...”
• Relative abundance of integral plasma membrane proteins in Arabidopsis leaf and root tissue determined by metabolic labeling and mass spectrometry
  Bernfur, PloS one 2013
  • “...(0.01) 2 LR Unknown AT1G58270 ZW9 Unknown molecular functions 45235 1 1 1.00 2 lR AT2G39530 Unknown molecular functions 19191 3 1 1.00 13 R AT4G15610 Unknown molecular functions 20796 4 1 0.81 12 lR AT5G44550 Unknown molecular functions 21019 4 1 1.00 7 R Proteins...”

AT2G39518 hypothetical protein (RefSeq) from Arabidopsis thaliana
Aligns to 10:158 / 174 (85.6%), covers 98.7% of PF04535, 74.5 bits

• Comparative transcriptome analysis reveals significant differences in the regulation of gene expression between hydrogen cyanide- and ethylene-treated Arabidopsis thaliana
  Yu, BMC plant biology 2019
  • “...storage/lipid transfer protein (LTP) family protein 9.00 3.17 AT5G05340 PRX52, Peroxidase superfamily protein 8.11 3.02 AT2G39518 Uncharacterized protein family (UPF0497) 8.11 3.02 AT3G23250 MYB15, myb domain protein 15 7.78 2.96 AT1G18290 DUF4228 domain protein 7.62 2.93 AT1G05680 Uridine diphosphate glycosyltransferase 74E2 6.96 2.80 AT4G24570 Dicarboxylate carrier...”
• Nitric Oxide Mediated Transcriptome Profiling Reveals Activation of Multiple Regulatory Pathways in Arabidopsis thaliana
  Hussain, Frontiers in plant science 2016
  • “...and flower opening 6 AT2G22760 0.04000 44.05000 10.18870 Basic helix-loop-helix (bHLH) DNA-binding superfamily protein 7 AT2G39518 0.06000 61.96000 10.09650 Encodes an unknown protein 8 AT1G22810 0.15000 153.56000 9.96553 Encodes a member of the DREB subfamily A-5 of ERF/AP2 transcription factor family. The protein contains one AP2...”

LOC103976748 CASP-like protein 4D1 from Musa acuminata subsp. malaccensis
Aligns to 5:165 / 180 (89.4%), covers 76.0% of PF04535, 71.9 bits

• Banana (Musa acuminata) transcriptome profiling in response to rhizobacteria: Bacillus amyloliquefaciens Bs006 and Pseudomonas fluorescens Ps006
  Gamez, BMC genomics 2019
  • “...81 CACCTGAGTGCATGGGGATT CCCTAGAGCAAGCTACAGCC 60 5560 LOC103971548 Cyclic dof factor 3-like 86 GCACAGGCTTCTGATCTGGT GCCTTGACAAACCTTGCCTG 60 55 LOC103976748 CASP-like protein 4D1 89 AATGGCCTCTTCGACCAAGG TGACGACGAGGGAAACCAAG 60 55 LOC103987539 U-Box domain-containing protein 21-like 89 CCACGCGATACGGAAGATGA TCACCGGAATCTTAGGCGTG 60 55 LOC103990849 Serine/threonine-protein kinase 115 AACTGATCGGGTACTGCTGC GACCACGGCAACGAAGAAAC 60 55 LOC103972371 Cycle dof factor...”
  • “...Protein family and a transmembrane protein involved in plant growth [ 27 ]. CASP-like 4D1, LOC103976748 was transcriptionally regulated in the presence of Bs006, with a fold change value of 6.03 (Fig. 7 b). CASP-like 4D1, as well as the extensin LRX3, are influenced by the...”

Or search for genetic data about PF04535 in the Fitness Browser