Family Search for PF04751 (DUF615)

Running HMMer for PF04751

PF04751 hits 19 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.

HI1151 conserved hypothetical protein from Haemophilus influenzae Rd KW20
Aligns to 21:172 / 178 (85.4%), covers 99.3% of PF04751, 191.7 bits

• Gene expression changes triggered by exposure of Haemophilus influenzae to novobiocin or ciprofloxacin: combined transcription and translation analysis
  Gmuender, Genome research 2001
  • “...protein hi0983 Conserved hypothetical protein hi1151 Conserved hypothetical protein h1159 Conserved hypothetical protein hi1163 D-Lactate dehydrogenase...”

STM4437 putative cytoplasmic protein from Salmonella typhimurium LT2
AEX15_17525, SeKA_A4089 ribosome biogenesis factor YjgA from Salmonella enterica subsp. enterica serovar Kentucky
Aligns to 25:176 / 183 (83.1%), covers 99.3% of PF04751, 191.6 bits

• Effect of iacP mutation on flagellar phase variation in Salmonella enterica serovar typhimurium strain UK-1
  Eom, Journal of bacteriology 2012
  • “...STM3241 STM4269 STM2879 STM2248 STM4348 STM4437 STM1911 STM4258 STM0486 STM4229 Mannose-1-phosphate guanylyltransferase Sugar-specific enzyme IIB Pyruvate...”
• The genome of Salmonella enterica serovar gallinarum: distinct insertions/deletions and rare rearrangements
  Wu, Journal of bacteriology 2005
  • “...to regions STM3022 to STM3034 (recB-pepP), STM4417 to STM4437, STM4488 to STM4498, STM4520 to STM-4527, and STM4571 to STM4575 (purA-serB), not inclusive, in...”
• Genomic and Evolutionary Analysis of Two Salmonella enterica Serovar Kentucky Sequence Types Isolated from Bovine and Poultry Sources in North America
  Haley, PloS one 2016
  • “...of interest within the ST198 genomes consists of 15 ORFs involved inositol catabolism (region 4) (AEX15_17525, AEX15_17625). This region was also identified in several other serovars and has been identified as a myo-Inositol utilization island by Krger and Fuchs [ 67 ]. Chaudhuri et al ....”
  • “...acid metabolism (transport) D 9036 AEX15_07510, AEX15_07550 (tRNA-Ser) SeKA_A0529, SeKA_A0537 (tRNA-Ser) 4 inositol catabolism 23081 AEX15_17525, AEX15_17625 SeKA_A4089, SeKA_A4088 5 SPI-6 [Typhi colonization factor ( tcf ) operon] D 8399 AEX15_23130, AEX15_23170 SeKA_A4630, SeKA_A4631 6 anaerobic dimethyl sulfoxide reductase chain A, B, C E 13280 AEX15_10355,...”
  • “...(transport) D 9036 AEX15_07510, AEX15_07550 (tRNA-Ser) SeKA_A0529, SeKA_A0537 (tRNA-Ser) 4 inositol catabolism 23081 AEX15_17525, AEX15_17625 SeKA_A4089, SeKA_A4088 5 SPI-6 [Typhi colonization factor ( tcf ) operon] D 8399 AEX15_23130, AEX15_23170 SeKA_A4630, SeKA_A4631 6 anaerobic dimethyl sulfoxide reductase chain A, B, C E 13280 AEX15_10355, AEX15_10415 C...”

YjgA / b4234 DUF615 domain-containing protein YjgA from Escherichia coli K-12 substr. MG1655 (see 3 papers)
YJGA_ECOLI / P0A8X0 UPF0307 protein YjgA; x96 protein from Escherichia coli (strain K12) (see paper)
B21_04066 ribosome biogenesis factor YjgA from Escherichia coli B26-1
NP_418655 putative ribosome biogenesis factor YjgA from Escherichia coli str. K-12 substr. MG1655
b4234 hypothetical protein from Escherichia coli str. K-12 substr. MG1655
ECs5211 putative alpha helix protein from Escherichia coli O157:H7 str. Sakai
Aligns to 25:176 / 183 (83.1%), covers 99.3% of PF04751, 191.5 bits

• ColiSeq: a multiplex amplicon assay that provides strain level resolution of Escherichia coli directly from clinical specimens
  Williamson, Microbiology spectrum 2024
  • “...208 66 T G,C,A CP032667.1 4072460 4072289 31605 527 Reverse AYTCTTCTTTTGCGGTATCA 58.7 MSS - SNP B21_04066 Forward AGTTTATGGAACA RYACCAC 58 144 180 75 G A CP032667.1 4065665 4065522 31615 527 Reverse CCAGCGTATTAA RATGGAAG 57.4 SLIM v1 B21_02129 Forward TGTCATTAGTGAAGCCTCTA 58.1 262 298 N/A N/A N/A CP032667.1...”
• YjgA plays dual roles in enhancing PTC maturation.
  Du, Nucleic acids research 2024
  • GeneRIF: YjgA plays dual roles in enhancing PTC maturation.
• YcfR (BhsA) influences Escherichia coli biofilm formation through stress response and surface hydrophobicity
  Zhang, Journal of bacteriology 2007
  • “...yfhO b2135 b0331 b0334 b0453 b2392 b1678 b1676 b4234 b4382 b4381 b4384 b2780 b2529 b2530 Predicted GTP-binding transport protein, essential for E. coli growth...”
• Combined, functional genomic-biochemical approach to intermediary metabolism: interaction of acivicin, a glutamine amidotransferase inhibitor, with Escherichia coli K-12
  Smulski, Journal of bacteriology 2001
  • “...b3995 b4030 b4126 b4127 b4135 b4178 b4189 b4199 b4206 b4234 b4255 b4311 b4325 b4326 b2300 b2302 b2303 b2442 b2529 b2530 b2597 b2664 b2665 b2856 b2886 b2889...”
  • “...b3928 b3937 b3995 b4030 b4126 b4127 b4135 b4178 b4189 b4199 b4206 b4234 b4255 b4311 b4325 b4326 3.2 3.6 2.8 2.2 2.1 2.7 23.6 3.2 4.7 2.6 2.1 2.1 2.0 2.3 5.0 3.5...”
• Global transcriptional response of Escherichia coli O157:H7 to growth transitions in glucose minimal medium
  Bergholz, BMC microbiology 2007
  • “...ytfT 3.32 2 ECs5007 lysC -3.43 1 ECs5208 yjfF 2.59 2 ECs5038 pfkA 2.14 2 ECs5211 yjgA 2.20 2 ECs5039 yjbR 2.21 2 ECs5213 cybC 2.20 2 ECs5049 actP 4.17 2 ECs5222 pyrB -2.95 1 ECs5050 yjcH 3.78 2 ECs5253 O157 2.70 2 ECs5089 phnB 4.22...”

PP0941, PP_0941 conserved hypothetical protein from Pseudomonas putida KT2440
Aligns to 11:163 / 173 (88.4%), covers 99.3% of PF04751, 190.5 bits

• UEG Week 2024 Poster Presentations
  , United European gastroenterology journal 2024
• UEG Week 2023 Poster Presentations
  , United European gastroenterology journal 2023
• ArdC, a ssDNA-binding protein with a metalloprotease domain, overpasses the recipient hsdRMS restriction system broadening conjugation host range
  González-Montes, PLoS genetics 2020
  • “...KT2440 cell lysate by the pull-down technique. The only protein that co-eluted with ArdC was PP_0941, a protein of unknown function similar to the 50S ribosome subunit associated protein YjgA ( S3 Fig ). SOS response is activated in P . putida recipient cells by the...”
  • “...next residue is P) in SwissProt database for P . putida KT2440. Matched peptides with pp_0941 protein are shown in purple (sequence coverage of 45%). pp_0941 has 173 amino acids and a molecular weight of 20238 Da. (TIF) Click here for additional data file. S4 Fig...”

7bl58 / P0A8X0 Pre-50s-obge particle (see paper)
Aligns to 1:150 / 157 (95.5%), covers 98.7% of PF04751, 189.8 bits

• Ligand: rna (7bl58)

Bcep18194_A4194 protein of unknown function DUF615 from Burkholderia sp. 383
Aligns to 25:179 / 204 (76.0%), covers 99.3% of PF04751, 183.1 bits

• Proteogenomic Analysis of Burkholderia Species Strains 25 and 46 Isolated from Uraniferous Soils Reveals Multiple Mechanisms to Cope with Uranium Stress
  Agarwal, Cells 2018
  • “...Uncharacterized Proteins The expression of uncharacterized proteins in SRS-46 like UPF0234 protein Bmul_0741/BMUL1_02519, UPF0307 protein Bcep18194_A4194, UPF0301 protein Bamb_0737 was found higher in the presence of U. These hetherto uncharacterized proteins may be involved in conferring U resistance or providing some form of protection to the...”
  • “...upregulation of previously uncharacterized proteins in SRS-46, such as the UPF0234 protein Bmul_0741/BMUL1_02519, UPF0307 protein Bcep18194_A4194, and UPF0301 protein Bamb_0737, which were higher in the presence of uranium. Other studies on Geobacter sp., Microbacterium sp., Acidithiobacillus sp., have also led to the identification of uncaracterized proteins...”

Q9JZZ2 UPF0307 protein NMB0840 from Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Aligns to 7:158 / 168 (90.5%), covers 99.3% of PF04751, 179.5 bits

• Towards New Drug Targets? Function Prediction of Putative Proteins of Neisseria meningitidis MC58 and Their Virulence Characterization
  Shahbaaz, Omics : a journal of integrative biology 2015
  • “...Q9JYT8 Q9JYC7 Q7DD45 Q9K1M3 Q9JXG7 19. 20. 21. Q7DD54 P67217 Q9JZZ2 22. 23. 24. 25. 26. 27. 28. 29. 30. 31. 32. Q7DDP4 Q9JZL2 Q9JZE3 Q9JZE2 Q9JZD8 Q9JZD6 Q9JYB9...”

XC_1511 hypothetical protein from Xanthomonas campestris pv. campestris str. 8004
Aligns to 12:167 / 193 (80.8%), covers 98.7% of PF04751, 178.3 bits

• RpfC regulates the expression of the key regulator hrpX of the hrp/T3SS system in Xanthomonas campestris pv. campestris
  Jiang, BMC microbiology 2018
  • “...with a Tn5 insertion in the intergenetic region This work between the ORFs XC_1510 and XC_1511 ; Rif r ; Kan r ; Tc r XB003 8004/pL6 hrpXsacB with a Tn5 insertion in XC_2333 ; Rif r ; Kan r ; Tc r This work XB004...”
  • “...(XB004), XC_3951 (XB005) and XC_0124 (XB006), and the intergenetic region between the ORFs XC_1510 and XC_1511 (XB002), respectively. Interestingly, the ORF XC_2333 is the rpfC gene. The others were annotated to encode hypothetical proteins ( XC_4007 and XC_1511 ), antifreeze glycopeptide AFGP related protein ( XC_1192...”

HD1362 conserved hypothetical protein from Haemophilus ducreyi 35000HP
Aligns to 20:171 / 176 (86.4%), covers 99.3% of PF04751, 178.0 bits

• Haemophilus ducreyi Seeks Alternative Carbon Sources and Adapts to Nutrient Stress and Anaerobiosis during Experimental Infection of Human Volunteers
  Gangaiah, Infection and immunity 2016
  • “...HD1504 HD_RS06150 guaA HD0250 HD0673 HD1089 HD1354 HD1362 HD1614 HD_RS00990 HD_RS02750 HD_RS04480 HD_RS05525 HD_RS05560 HD_RS06570 HD0458 HD0746 HD0926 HD1524...”
  • “...8.83 2.91 1.5E04 HD0250 HD0673 HD1089 HD1354 HD1362 HD1614 Hypothetical protein Membrane protein Hypothetical protein Hypothetical protein Hypothetical protein...”

lpl0022 hypothetical protein from Legionella pneumophila str. Lens
Aligns to 3:155 / 159 (96.2%), covers 99.3% of PF04751, 175.3 bits

• Comparative and functional genomics of legionella identified eukaryotic like proteins as key players in host-pathogen interactions
  Gomez-Valero, Frontiers in microbiology 2011
  • “...lpc0009 lpa0011 lpw00071 ravA Unknown lpg0012 lpp0012 lpl0012 lpc0013 lpa0016 lpw00111 cegC1 Ankyrin lpg0021 lpp0021 lpl0022 lpc0022 lpa0030 lpw00221 llo0047 llb1841 + + + Unknown lpg0030 lpp0030 lpl0031 lpc0031 lpa0040 lpw00311 ravB Unknown lpg0038 lpp0037 lpl0038 lpc0039 lpa0049 lpw00381 ankQ/legA10 Ankyrin repeat lpg0041 lpc0042 lpa0056 Putative...”

lpg0021 alpha helix protein from Legionella pneumophila subsp. pneumophila str. Philadelphia 1
Aligns to 3:155 / 159 (96.2%), covers 99.3% of PF04751, 173.0 bits

• Comparative analyses of Legionella species identifies genetic features of strains causing Legionnaires' disease
  Gomez-Valero, Genome biology 2014
  • “...motif Gene name Amino acid identity a L. fallonii L. long. L. micdadeii L. hack lpg0021 / lpp0021 Protein of unknown function [ribosome associated protein] 75 75 68 68 lpg0103 / lpp0117 N-terminal acetyltransferase, GNAT family vipF 62 61 50 47 lpg0107 / lpp0121 b Conserved...”
• Comprehensive identification of protein substrates of the Dot/Icm type IV transporter of Legionella pneumophila
  Zhu, PloS one 2011
  • “...immunoblot. The isocitrate dehydrogenase (ICDH) was probed as a loading control. Samples: 1. Lpg1776; 2, Lpg0021; 3, Lpg2425; 4, Lpg1147; 5, Lpg0181; 6, Lpg2555; 7, Lpg2874; 8, Lpg0405; 9, Lpg0195. Recognition of diverse translocation signals by the Dot/Icm transporter In our efforts to identify common features...”
• Comparative and functional genomics of legionella identified eukaryotic like proteins as key players in host-pathogen interactions
  Gomez-Valero, Frontiers in microbiology 2011
  • “...lpp0008 lpl0008 lpc0009 lpa0011 lpw00071 ravA Unknown lpg0012 lpp0012 lpl0012 lpc0013 lpa0016 lpw00111 cegC1 Ankyrin lpg0021 lpp0021 lpl0022 lpc0022 lpa0030 lpw00221 llo0047 llb1841 + + + Unknown lpg0030 lpp0030 lpl0031 lpc0031 lpa0040 lpw00311 ravB Unknown lpg0038 lpp0037 lpl0038 lpc0039 lpa0049 lpw00381 ankQ/legA10 Ankyrin repeat lpg0041 lpc0042...”

lpp0021 hypothetical protein from Legionella pneumophila str. Paris
Aligns to 3:155 / 159 (96.2%), covers 99.3% of PF04751, 171.6 bits

• Comparative analyses of Legionella species identifies genetic features of strains causing Legionnaires' disease
  Gomez-Valero, Genome biology 2014
  • “...name Amino acid identity a L. fallonii L. long. L. micdadeii L. hack lpg0021 / lpp0021 Protein of unknown function [ribosome associated protein] 75 75 68 68 lpg0103 / lpp0117 N-terminal acetyltransferase, GNAT family vipF 62 61 50 47 lpg0107 / lpp0121 b Conserved protein of...”
• Comparative and functional genomics of legionella identified eukaryotic like proteins as key players in host-pathogen interactions
  Gomez-Valero, Frontiers in microbiology 2011
  • “...lpl0008 lpc0009 lpa0011 lpw00071 ravA Unknown lpg0012 lpp0012 lpl0012 lpc0013 lpa0016 lpw00111 cegC1 Ankyrin lpg0021 lpp0021 lpl0022 lpc0022 lpa0030 lpw00221 llo0047 llb1841 + + + Unknown lpg0030 lpp0030 lpl0031 lpc0031 lpa0040 lpw00311 ravB Unknown lpg0038 lpp0037 lpl0038 lpc0039 lpa0049 lpw00381 ankQ/legA10 Ankyrin repeat lpg0041 lpc0042 lpa0056...”

FTN_1258 hypothetical protein from Francisella tularensis subsp. novicida U112
Aligns to 24:178 / 182 (85.2%), covers 98.7% of PF04751, 144.9 bits

• Structural and functional analysis of the Francisella lysine decarboxylase as a key actor in oxidative stress resistance
  Felix, Scientific reports 2021
  • “...(POT) family protein, di- or tripeptide:H+symporter 1.243209089 1.20616E05 dapD FTN_1727 2,3,4,5-tetrahydropyridine-2,6-carboxylate N -succinyltransferase 1.185622324 0.000977552 FTN_1258 Hypothetical protein 1.11437438 0.000177817 hsdM FTN_1152 Type I restriction-modification system, subunit M (methyltransferase) 1.098834276 0.000436818 FTN_1316 Hypothetical protein 1.075883638 0.005337719 FTN_1628 LysR family transcriptional regulator 1.010217775 0.001268379 hdsR FTN_0710 Type...”

AB57_0693 hypothetical protein from Acinetobacter baumannii AB0057
Aligns to 18:168 / 178 (84.8%), covers 90.2% of PF04751, 113.1 bits

• The lytic transglycosylase MltB connects membrane homeostasis and in vivo fitness of Acinetobacter baumannii
  Crépin, Molecular microbiology 2018
  • “...protein 9.09 0.0094 AB57_2745 membrane protein 9.08 0.0000 AB57_0172 PadR family transcriptional regulator 9.08 0.0094 AB57_0693 hypothetical protein 9.07 0.0038 Calculated fitness defect in the spleen at 24 hpi. John Wiley & Sons, Ltd The most representative functional categories of the putative fitness factors identified in...”

ACICU_00593 hypothetical protein from Acinetobacter baumannii ACICU
Aligns to 18:168 / 178 (84.8%), covers 90.2% of PF04751, 112.9 bits

• The antibiotic resistome and microbiota landscape of refugees from Syria, Iraq and Afghanistan in Germany
  Häsler, Microbiome 2018
  • “...vanC1; vanC2-C3-1; vanC2-C3-2 Endogenous control 16S (bacterial); GAPDH (human) Inhibition control, exogenous exoIPC Species-specific genes ACICU_00593 ( Acinetobacter baumannii ); femA SA ( Staphylococcus aureus ); femA SE ( Staphylococcus epidermidis ) Detection of antibiotic resistance genes via microfluidic real-time PCR To detect the 42 of...”

AT4G24175 hypothetical protein from Arabidopsis thaliana
Aligns to 85:282 / 306 (64.7%), covers 94.1% of PF04751, 104.0 bits

• The Consequences of a Disruption in Cyto-Nuclear Coadaptation on the Molecular Response to a Nitrate Starvation in Arabidopsis
  Chardon, Plants (Basel, Switzerland) 2020
  • “...the 12 genes identified as specific markers for mt dysfunction ( AT2G04030 , AT2G40080 and AT4G24175 ), and 1 out of the 15 genes identified as specific markers for cp dysfunction ( AT5G27290 ), were differentially expressed between cytolines and their parents ( Table S4 )....”
• Comparison of transcriptional changes to chloroplast and mitochondrial perturbations reveals common and specific responses in Arabidopsis
  Van, Frontiers in plant science 2012
  • “...0 AT5G48470 Unknown protein n 252563_at 7 1 AT3G45970 Expansin ATEXLA1 ec 254208_at 7 0 AT4G24175 Unknown protein p 256060_at 7 1 AT1G07050 CONSTANS-like protein n 256252_at 7 0 AT3G11340 UGT76B1 glycosyltransferase pm 263483_at 7 0 AT2G04030 Heat shock protein 90.5kDa p 267237_s_at 7 0 AT2G44040;...”
  • “...Unknown protein AT2G40080 ELF4 (EARLY FLOWERING 4) 1 AT5G48470 Unknown protein AT3G45970 Expansin ATEXLA1 1 AT4G24175 Unknown protein AT1G07050 CONSTANS-like protein 1 1 AT3G11340 UGT76B1 glycosyltransferase AT2G04030 Heat shock protein 90.5kDa 1 AT2G44040 Dihydrodipicolinate reductase family 1 AT2G02740 ATWHY3 transcription factor CHLOROPLAST PERTURBATIONS AGI Code Description...”

LOC105044077 LOW QUALITY PROTEIN: uncharacterized protein LOC105044077 from Elaeis guineensis
Aligns to 70:266 / 281 (70.1%), covers 88.9% of PF04751, 101.2 bits

• Characterization of Hemerocallis citrina Transcriptome and Development of EST-SSR Markers for Evaluation of Genetic Diversity and Population Structure of Hemerocallis Collection
  Li, Frontiers in plant science 2020
  • “...SAU00047 0.04347** 0.04721** c18505.graph_c0 Pre-mRNA-processing protein 40A isoform X1 SAU00055 0.02924* 0.03254* c24436.graph_c0 Uncharacterized protein LOC105044077 SAU00063 0.04051** 0.04161** c33464.graph_c0 Protein LHY-like SAU00064 0.02803* 0.03182* c22731.graph_c0 Eukaryotic translation initiation factor 2D isoform X1 SAU00109 0.08038** 0.08781** c22731.graph_c0 Eukaryotic translation initiation factor 2D isoform X1 SAU00121 0.0373**...”

LOC4335309 uncharacterized protein from Oryza sativa Japonica Group
Aligns to 69:266 / 276 (71.7%), covers 89.5% of PF04751, 100.0 bits

• Combined miRNA and mRNA sequencing reveals the defensive strategies of resistant YHY15 rice against differentially virulent brown planthoppers
  Yu, Frontiers in plant science 2024
  • “...miR5801b 1.07 1.34 LOC9266659; LOC4340263; LOC107282017; LOC9268610; LOC112936211 miR5816 1.41 LOC107279289;LOC107275804;LOC107278811;LOC9269030;LOC112937448 miR818b 1.14 LOC4329368; LOC107277317; LOC4335309; LOC4329911; LOC107275634 miR818d 1.06 LOC4329368; LOC107277317; LOC4335309; LOC4329911; LOC107275634 miR818e 1.14 LOC4329368; LOC107277317; LOC4335309; LOC4329911; LOC107275634 miR827 -1.06 -1.12 LOC4345821; LOC4350156; LOC4352108; LOC4335589; LOC9272252 In comparison, PCA of the RNA-seq...”

LOC101304935 uncharacterized protein LOC101304935 from Fragaria vesca subsp. vesca
Aligns to 89:289 / 300 (67.0%), covers 90.8% of PF04751, 94.2 bits

• Early metabolic and transcriptional variations in fruit of natural white-fruited Fragaria vesca genotypes
  Härtl, Scientific reports 2017
  • “...gene08062 7.1 0 10 10 CDT1-like protein b (LOC101298288) gene08537 2.5 82 339 403 uncharacterized LOC101304935 (LOC101304935) gene09254 4.5 3 8 442 uncharacterized LOC101298543 (LOC101298543) gene12602 6.4 0 1 99 uncharacterized LOC101291726 (LOC101291726) gene12786 3.8 4 8 138 B3 domain-containing transcription factor VRN1-like (LOC101297387) gene13191 1.5...”

Or search for genetic data about PF04751 in the Fitness Browser