Family Search for PF04884 (UVB_sens_prot)
April 2024: See Interactive Tools for Functional Annotation of Bacterial Genomes for advice on using these tools.
PF04884 hits 14 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.
RUSF1_DICDI / Q86K80 RUS family member 1 from Dictyostelium discoideum (Social amoeba) (see paper)
Aligns to 49:292 / 527 (46.3%), covers 98.8% of PF04884, 343.8 bits
- disruption phenotype: No visible phenotype.
PADG_04473 uncharacterized protein from Paracoccidioides brasiliensis Pb18
Aligns to 58:298 / 500 (48.2%), covers 98.8% of PF04884, 342.6 bits
Q499P8 RUS family member 1 from Rattus norvegicus
Aligns to 62:301 / 466 (51.5%), covers 97.1% of PF04884, 327.8 bits
- Predicted molecules and signaling pathways for regulating seizures in the hippocampus in lithium-pilocarpine induced acute epileptic rats: A proteomics study
Wang, Frontiers in cellular neuroscience 2022 - “...Q3T1J1 Eukaryotic translation initiation factor 5A-1 Eif5a 1.288 0.203 0.781 0.069 0.952 0.053 0.004786577 0.00397991 Q499P8 RUS1 family protein C16orf58 homolog 1.034 0.009 0.827 0.01 0.951 0.111 0.021371489 0.01825009 Q4FZZ3 Glutathione S-transferase alpha-5 Gsta5 1.898 0.124 0.571 0.047 0.51 0.034 0.0000009 0.0000021 Q4KLL7 Vacuolar protein sorting...”
- “...Alpha-methylacyl-CoA racemase Amacr 1.096 0.053 0.867 0.054 1.048 0.091 0.012544079 0.013376436 Down Plasma membrane (18%) Q499P8 RUS1 family protein C16orf58 homolog 1.034 0.009 0.827 0.01 0.951 0.111 0.021371489 0.018250087 Down A0A0A0MY39 ATP-binding cassette sub-family B member 9 Abcb9 1.246 0.16 0.922 0.042 0.839 0.071 0.004760401 0.017790941...”
- Gonadal transcriptomics elucidate patterns of adaptive evolution within marine rockfishes (Sebastes).
Heras, BMC genomics 2015 - “...2.269 276 O95352 4.22E-63 Q5ZKY2 6.44E-33 upf0420 protein c16orf58 0.034 0.029 1.188 435 Q96GQ5 3.11E-40 Q499P8 5.73E-29 vacuolar protein sorting-associated protein 16 homolog 0.016 0.012 1.312 477 Q5E9L7 2.96E-110 Q5E9L7 1.89E-91 wd repeat-containing protein 5 0.121 0.08 1.513 288 Q2KIG2 2.23E-27 Q2KIG2 3.23E-45 zinc finger cchc...”
NP_073581 RUS family member 1 from Homo sapiens
Q96GQ5 RUS family member 1 from Homo sapiens
Aligns to 65:303 / 468 (51.1%), covers 96.7% of PF04884, 325.6 bits
- ROOT UV-B SENSITIVE2 acts with ROOT UV-B SENSITIVE1 in a root ultraviolet B-sensing pathway.
Leasure, Plant physiology 2009 - GeneRIF: Functional characterization of related Arabidopsis proteins that contain a DUF647 domain and are involved in UV-B sensing in roots. C16orf58 is the closest human homolog.
- Predicting Functions of Uncharacterized Human Proteins: From Canonical to Proteoforms.
Poverennaya, Genes 2020 - “...Q5THK1, Q68CR1, Q6P1M9, Q6P995, Q86X40, Q8IV32, Q8IW50, Q8N7X4, Q8NCJ5, Q8NCT3, Q8NCU4, Q8TBZ0, Q8TDY8, Q8WUB2, Q96BQ5, Q96GQ5, Q9BVG4, Q9H106, Q9H5V9, Q9H910, Q9Y546. Figure 3 Functional prediction of molecular functions for 60 uPE1 proteins. Figure 4 Cellular components predicted for 93 uPE1 proteins. * denotes the following set...”
- “...Q53LP3, Q68CR1, Q6P995, Q6ZRI6-2, Q86X40, Q8IV32, Q8IW50, Q8N6V9, Q8NCJ5, Q8NCT3, Q8NCU4, Q8NEF3, Q8TBZ0, Q8WUB2, Q96BQ5, Q96GQ5, Q96MY1, Q9H106, Q9H693. Figure 5 The largest connected component of the obtained PPI network showing canonical proteins (lower level) and their corresponding splice forms (upper level). Hub proteins with more...”
- Identification of the cis‑molecular neighbours of the immune checkpoint protein B7‑H4 in the breast cancer cell‑line SK‑BR‑3 by proteomic proximity labelling.
Rees, International journal of oncology 2020 - “...Suppressor of tumorigenicity 14 protein homolog 0.14 4 5.6 Q6EMK4 VASN Vasorin 0.14 4 7.8 Q96GQ5 C16orf58 RUS1 family protein C16orf58 0.13 2.17 2 7.6 Q9Y5L3-2 ENTPD2 Isoform short of ectonucleoside triphosphate diphosphohydrolase 2 0.13 2 4.6 Q53G72 BCAP31 B-cell receptor-associated protein 31 variant 0.12 2...”
- Gonadal transcriptomics elucidate patterns of adaptive evolution within marine rockfishes (Sebastes).
Heras, BMC genomics 2015 - “...0.031 0.013 2.269 276 O95352 4.22E-63 Q5ZKY2 6.44E-33 upf0420 protein c16orf58 0.034 0.029 1.188 435 Q96GQ5 3.11E-40 Q499P8 5.73E-29 vacuolar protein sorting-associated protein 16 homolog 0.016 0.012 1.312 477 Q5E9L7 2.96E-110 Q5E9L7 1.89E-91 wd repeat-containing protein 5 0.121 0.08 1.513 288 Q2KIG2 2.23E-27 Q2KIG2 3.23E-45 zinc...”
AT1G13770 hypothetical protein from Arabidopsis thaliana
Aligns to 43:283 / 440 (54.8%), covers 97.9% of PF04884, 300.7 bits
- RLPredictiOme, a Machine Learning-Derived Method for High-Throughput Prediction of Plant Receptor-like Proteins, Reveals Novel Classes of Transmembrane Receptors
Silva, International journal of molecular sciences 2022 - “...DUF1279 domain containing protein, expressed AT5G49540 0.0 0.33333333 1 4 transmembrane protein 93, putative, expressed AT1G13770 0.0 0.33333333 1 4 DUF647 domain containing protein, putative, expressed AT1G29060 0.0 0.33333333 1 4 expressed protein AT4G14455 0.0 0.33333333 1 4 SNARE domain containing protein, putative, expressed AT4G25360 0.0...”
- RUS6, a DUF647-containing protein, is essential for early embryonic development in Arabidopsis thaliana
Perry, BMC plant biology 2021 - “...functional roles for all RUS members, we screened and identified knockout mutants for RUS3 ( AT1G13770 ), RUS4 ( AT2G23470 ), RUS5 ( AT5G01510 ) and RUS6 ( AT5G49820 ). Potential T-DNA insertional lines were identified in the public database and verified by gene-specific PCR markers....”
- “...RUS3 , RUS4 and RUS5 . a T-DNA insertion position in the RUS3 gene ( AT1G13770 ) was detected and confirmed in the SALK_135717C T-DNA line. b T-DNA insertion position in the RUS4 ( AT2G23470 ) gene was detected and confirmed in GK-447F02 T-DNA line. c...”
- [Specific gene silencing of At1g13770 and At2g23470 by artificial mi-croRNAs in Arabidopsis]
Li, Yi chuan = Hereditas 2012 (PubMed)- “...www.chinagene.cn DOI: 10.3724/SP.J.1005.2012.00348 microRNAs At1g13770 At2g23470 , ,, 030006 : DUF647 (Domain of unknown function 647) 6 , DUF647 4 MIR319a ,...”
- “...microRNAs(Artifical microRNAs, amiRNAs) WMD(Web microRNA designer) At1g13770 At2g23470 amiRNAs , PCR MIR319a amiRNAs pCHF3-amiRNAs, RT-PCR , amiRNAs At1g13770...”
RUS1_ARATH / Q7X6P3 Protein root UVB sensitive 1, chloroplastic; Protein WEAK AUXIN RESPONSE 3 from Arabidopsis thaliana (Mouse-ear cress) (see 4 papers)
AT3G45890 RUS1 (ROOT UVB SENSITIVE 1) from Arabidopsis thaliana
NP_190175 root UVB sensitive-like protein (Protein of unknown function, DUF647) from Arabidopsis thaliana
Aligns to 184:422 / 608 (39.3%), covers 97.5% of PF04884, 267.7 bits
- function: Involved in a root UV-B sensing pathway and in the protection against the hypersensitivity to very low-fluence-rate (VLF) UV-B. RSU1 and RUS2 are probably both negative modulators of the same UV-B perception pathway, which when overstimulated in the roots causes a block to postgermination development. Required for polar auxin transport by maintaining the proper levels of auxin transporters AUX1 (AC Q96247) and PIN proteins on the plasma membrane.
subunit: Interacts (via the DUF647 domain) with RUS2 (via the DUF647 domain).
disruption phenotype: No visible phenotype under normal growth conditions. Extremely stunted growth, failure to develop true postembryonic leaves and arrested primary root elongation, when grown in vitro. - Unraveling the Diverse Roles of Neglected Genes Containing Domains of Unknown Function (DUFs): Progress and Perspective
Lv, International journal of molecular sciences 2023 - “...growth, and development. Cucumis sativus [ 98 , 99 , 100 ] UV-B RUS1 ( At3g45890 ) DUF647 ( UVB_sens_prot ) PF04884 Role of root UV-B sensing in Arabidopsis early seedling development Arabidopsis [ 22 ] ijms-24-04187-t003_Table 3 Table 3 Bioinformatics databases and tools. Category Name...”
- Transcriptome analysis of aphid-resistant and susceptible near isogenic lines reveals candidate resistance genes in cowpea (Vigna unguiculata)
MacWilliams, BMC plant biology 2023 - “...1, chloroplast precursor, putative, expressed/CAROTENOID CLEAVAGE DIOXYGENASE 4 Resistant Baseline resistance 0.61 Vu02 26,389,32426,394,122 Vigun02g110100 AT3G45890 LOC_Os04g22360 DUF647 domain containing protein, putative, expressed/Ribonuclease P protein subunit P38-like protein Resistant AphidResD6 0.64 Vu02 26,414,66726,416,541 Vigun02g110300 AT1G14130 LOC_Os04g39980 gibberellin 20 oxidase 2, putative, expressed/DIOXYGENASE FOR AUXIN OXIDATION 1...”
- COMPILE: a GWAS computational pipeline for gene discovery in complex genomes
Hill, BMC plant biology 2022 - “...domain-containing protein 462 3.30E164 3 162,993,079 1.85E06 1834 Zm00001d042355 None Os04g0290800 Predicted protein 813 0.0 At3g45890 RUS1 UVB sensitive-like (DUF647) 596 0.0 7* [181090142] Zm00001d022613 DLF1 Os09g0540800 Leucine zipper (-ZIP) 125 2.73E36 At2g17770 Leucine zipper motif 27 79.7 1.90E18 8 116,806,871 7.35E10 1222 Zm00001d010470 UbiE3 AT5G13530...”
- Arabidopsis antibody resources for functional studies in plants
Oh, Scientific reports 2020 - “...Negative 41.8 OK V Invertase 61 At1g12240 Sheep Yes Positive 73.8 ~50, 30 WXR3y 62 At3g45890 Sheep Yes Positive 66.4 ~50, 45, 43 a Single correct size bands are indicated as OK. Where bands do not match the correct size or there are multiple bands, approximate...”
- HpeNet: Co-expression Network Database for de novo Transcriptome Assembly of Paeonia lactiflora Pall
Sheng, Frontiers in genetics 2020 - “...LHC unigenes in Arabidopsis ( Supplementary Table 7 ). Cluster-55448.207014 and Cluster-55448.124893, both homologous to AT3G45890 (LHCA1), were selected, and their detailed information and co-expression networks were searched in the database (MR 50) ( Figures 3A,B ). In the KEGG pathway annotation, both of the unigenes...”
- Validation of SNP allele frequencies determined by pooled next-generation sequencing in natural populations of a non-model plant species
Rellstab, PloS one 2013 - “...PCR forward CTTGACCTTTGGAAGCAATTGTA 106 58 PCR reverse bio-ACCAAAGAAATCGCACATGA Pyrosequencing AATTGTAAGTCCGTAGTTCA A Y ATCTCGTTAGTGTTTTT 8 RUS1 AT3G45890 1 & 2 1982/1996 NODE_69242 24280/24294 PCR forward GAACGGCTTCAACTAGGGTCA 129 58 PCR reverse bio-GCTTACGCAGAATCTTCCTCTGT Pyrosequencing AACAAGGAAGAAGCAATAG CA Y TGTTTGATCTGTA Y CGC 6/5 RUS1 AT3G45890 3 2430 NODE_69242 24722 PCR forward...”
- Role of root UV-B sensing in Arabidopsis early seedling development
Tong, Proceedings of the National Academy of Sciences of the United States of America 2008 - “...to transform rus1-1 (35). A 9-kb fragment containing At3g45890 complemented rus1-1 completely, and sequencing of this gene in the rus1-1 background revealed...”
- “...is responsible for the rus1-1 phenotypes, we fused the At3g45890 gene with its promoter to the GFP coding sequence and PNAS December 30, 2008 vol. 105 no....”
- Host origin of plastid solute transporters in the first photosynthetic eukaryotes
Tyra, Genome biology 2007 - “...(glaucophyte homologs were found for some of these genes; for example, ADP/ATP translocase, hypothetical protein At3g45890). Eleven proteins were restricted to green algae and land plants, seven were plant-specific, and two were limited to red algae and land plants. The distribution of these proteins with respect...”
- “...Ligand-effect modulator 3 LEM3 family At3g17690 Cyclic nucleotide-binding transporter 2 At3g17700 Cyclic nucleotide-binding transporter 1 At3g45890 Expressed protein At3g52310 ABC transporter At4g00370 Anion transporter 2 (ANTR2) At4g13590 Expressed protein At4g17340 Major intrinsic family protein At4g25750 ABC transporter At4g32400 Adenine nucleotide uniporter At4g32650 Arabidopsis thaliana K +...”
- Diurnal variation of transitory starch metabolism is regulated by plastid proteins WXR1/WXR3 in Arabidopsis young seedlings.
Zou, Journal of experimental botany 2021 (PubMed)- GeneRIF: Diurnal variation of transitory starch metabolism is regulated by plastid proteins WXR1/WXR3 in Arabidopsis young seedlings.
- ROOT ULTRAVIOLET B-SENSITIVE1/weak auxin response3 is essential for polar auxin transport in Arabidopsis.
Yu, Plant physiology 2013 - GeneRIF: RUS1 plays an essential role in the regulation of polar auxin transport by maintaining the proper level of auxin transporters on the plasma membrane.
- root uv-b sensitive mutants are suppressed by specific mutations in ASPARTATE AMINOTRANSFERASE2 and by exogenous vitamin B6.
Leasure, Molecular plant 2011 - GeneRIF: Specific asp2 mutations partially suppresses the rus1 and rus2 mutant phenotype.
- ROOT UV-B SENSITIVE2 acts with ROOT UV-B SENSITIVE1 in a root ultraviolet B-sensing pathway.
Leasure, Plant physiology 2009 - GeneRIF: RUS2 works with RUS1 in a root UV-B-sensing pathway that plays a vital role in Arabidopsis early seedling morphogenesis and development.
B4FMW4 Protein root UVB sensitive 1, chloroplastic from Zea mays
Aligns to 41:279 / 451 (53.0%), covers 98.3% of PF04884, 263.4 bits
- Quantitative Proteomic Analyses Identify ABA-Related Proteins and Signal Pathways in Maize Leaves under Drought Conditions
Zhao, Frontiers in plant science 2016 - “...up-regulated by drought stress in an ABA-dependent manner; drought stress decreased the expression of protein B4FMW4 by a similar extent in Vp5 and vp5 , indicating that the protein was down-regulated by drought stress in an ABA-independent manner; drought stress significantly decreased the expression of two...”
- “...0.504 0.518 0.514 1.599 0.002 0.512 0.001 0.000 Up-regulated by drought in an ABA-dependent way B4FMW4 Uncharacterized protein 0.601 0.613 0.526 0.546 0.545 0.542 0.580 0.003 0.544 0.001 0.334 Down-regulated by drought in an ABA-independent way B7ZX39 Uncharacterized protein 1.615 1.627 1.540 0.541 0.552 0.546 1.594...”
GRMZM5G833124 uncharacterized protein LOC100278802 from Zea mays
Aligns to 113:346 / 511 (45.8%), covers 97.9% of PF04884, 256.9 bits
LOC106769438 protein root UVB sensitive 6 from Vigna radiata var. radiata
Aligns to 95:330 / 494 (47.8%), covers 97.5% of PF04884, 256.7 bits
- Genome-wide Association Study for Yield and Yield-Related Traits in Diverse Blackgram Panel (Vigna mungo L. Hepper) Reveals Novel Putative Alleles for Future Breeding Programs
Singh, Frontiers in genetics 2022 - “...-174.544 UV-B-induced protein, chloroplastic isoform X1 Q.HI.5 HI LOC106760579 -189.197 cytochrome P450 CYP72A219-like Q.HI.7 HI LOC106769438 105.344 protein root UVB sensitive 6 Q.HI.8.2 HI LOC111242272 116.438 alpha-mannosidase-like LOC106771274 129.392 putative 12-oxophytodienoate reductase 11 Q.HSW.6 HSW LOC106764301 -15.52 putative pentatricopeptide repeat-containing protein At1g12700, mitochondrial isoform X1 LOC106765194...”
- “...was found in the proximity of Q. HI.5 coding cytochrome P450 CYP72A219-like enzyme. The gene LOC106769438 with protein root UVB sensitive six enzyme function was lying 105.344kb of Q. HI.7 . Two genes LOC111242272 (116.438kb) and LOC106771274 (129.392kb), with enzymes alpha-mannosidase-like and putative 12-oxophytodienoate reductase 11...”
RUS2_ARATH / Q9SJX7 Protein root UVB sensitive 2, chloroplastic; Protein WEAK AUXIN RESPONSE 1 from Arabidopsis thaliana (Mouse-ear cress) (see 3 papers)
NP_565718 root UVB sensitive protein (Protein of unknown function, DUF647) from Arabidopsis thaliana
Aligns to 58:294 / 433 (54.7%), covers 97.9% of PF04884, 248.3 bits
RUS6_ARATH / Q93YU2 Protein root UVB sensitive 6 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
AT5G49820, NP_568713 root UVB sensitive protein (Protein of unknown function, DUF647) from Arabidopsis thaliana
Aligns to 99:333 / 497 (47.3%), covers 97.1% of PF04884, 247.3 bits
- function: Required for normal embryo development.
- Weighted Gene Correlation Network Analysis (WGCNA) of Arabidopsis Somatic Embryogenesis (SE) and Identification of Key Gene Modules to Uncover SE-Associated Hub Genes
de, International journal of genomics 2022 - “...also exhibited an embryonic expression pattern. In addition, ROOT UV-B SENSITIVE 6 ( RUS6 ; AT5G49820), which encodes a DUF647 (DOMAIN OF UNKNOWN FUNCTION 647) containing protein, an ankyrin repeat-containing gene designated as AT5G65860 and a gene that encodes hydroxyproline- O -glycosyltransferases (Hyp- O -GALT), GALT4...”
- RUS6, a DUF647-containing protein, is essential for early embryonic development in Arabidopsis thaliana
Perry, BMC plant biology 2021 - GeneRIF: RUS6, a DUF647-containing protein, is essential for early embryonic development in Arabidopsis thaliana.
- “...RUS3 ( AT1G13770 ), RUS4 ( AT2G23470 ), RUS5 ( AT5G01510 ) and RUS6 ( AT5G49820 ). Potential T-DNA insertional lines were identified in the public database and verified by gene-specific PCR markers. Homozygous knockout mutants were identified for RUS3 (two lines: SALK_135717C and SALK_042033C, which...”
- QTL and candidate genes associated with leaf anion concentrations in response to phosphate supply in Arabidopsis thaliana
El-Soda, BMC plant biology 2019 - “...5.3 1.06 2.12 Leucine-rich repeat protein kinase family protein involved in protein phosphorylation. AT5G49810 - AT5G49820 - AT5G49830 5 AT5G60410 24,293 0.08 4.3 0.76 1.63 SIZ1 , encodes a plant small ubiquitin-like modifier (SUMO) E3 ligase that is a focal controller of Pi starvation-dependent responses. AT5G60440...”
- SFGD: a comprehensive platform for mining functional information from soybean transcriptome data and its use in identifying acyl-lipid metabolism pathways
Yu, BMC genomics 2014 - “...(RRM)-containing protein Glyma05g31820 GmaAffx.29450.1.S1_at AT1G10500 ATCPISCA (chloroplast-localized IscA-like protein); structural molecule Glyma17g00580 Gma.10258.1.A1_s_at, Gma.10258.2.S1_at, GmaAffx.83788.1.S1_at AT5G49820 emb1879 (embryo defective 1879) Glyma07g03350 Gma.11469.1.S1_at, GmaAffx.67403.1.S1_at, GmaAffx.67403.1.A1_at AT3G15820 phosphatidic acid phosphatase-related/PAP2-related Glyma18g44350 Gma.6041.1.S1_at AT1G62640 KAS III (3-KETOACYL-ACYL CARRIER PROTEIN SYNTHASE III); 3-oxoacyl-[acyl-carrier-protein] synthase/catalytic/transferase, transferring acyl groups other than amino-acyl...”
- Role of root UV-B sensing in Arabidopsis early seedling development
Tong, Proceedings of the National Academy of Sciences of the United States of America 2008 - “...have sequence data available. Only the RUS1-like gene At5g49820 (EMB1879) was previously isolated in a screen for defective embryo development, and no defined...”
- RUS6, a DUF647-containing protein, is essential for early embryonic development in Arabidopsis thaliana
Perry, BMC plant biology 2021 - “...development [ 21 , 22 ]. Proteomic analysis suggested that the RUS6 protein (Uniprot # Q93YU2) is ubiquitously expressed in all tissues analyzed ( https://www.proteomicsdb.org/proteomicsdb/ ), but the highest RUS6 protein expression was found in mature embryos and pollen [ 21 , 22 ]. Our RUS6-GFP...”
AT5G01510 hypothetical protein from Arabidopsis thaliana
Aligns to 105:354 / 509 (49.1%), covers 96.7% of PF04884, 232.8 bits
- RUS6, a DUF647-containing protein, is essential for early embryonic development in Arabidopsis thaliana
Perry, BMC plant biology 2021 - “...and identified knockout mutants for RUS3 ( AT1G13770 ), RUS4 ( AT2G23470 ), RUS5 ( AT5G01510 ) and RUS6 ( AT5G49820 ). Potential T-DNA insertional lines were identified in the public database and verified by gene-specific PCR markers. Homozygous knockout mutants were identified for RUS3 (two...”
- “...and confirmed in GK-447F02 T-DNA line. c T-DNA insertion position in the RUS5 gene ( AT5G01510 ) was detected and confirmed in SALK_038772 T-DNA line. Filled boxes indicate exons. Positions for the start (ATG) and stop codons (TGA in RUS3 ; TAA in RUS4 and RUS5...”
AT2G23470 hypothetical protein from Arabidopsis thaliana
NP_179928 root UVB sensitive protein (Protein of unknown function, DUF647) from Arabidopsis thaliana
Aligns to 109:349 / 520 (46.3%), covers 96.7% of PF04884, 226.3 bits
- Spatial and temporal regulation of parent-of-origin allelic expression in the endosperm
van, Plant physiology 2023 - “...0.1 Transmembrane protein 1.0 d AT4G12080 2.6 0.1 AHL1 AT-hook motif nuclear-localized protein 1 1.0 AT2G23470 3.9 0.3 RUS4 Root UV-B sensitive 4 0.7 AT4G12690 4.5 0.3 DUF868 family protein 0.1 B AT2G38480 0.1 3.2 CASPL4B1 CASP-like protein 4B1 1.2 AT5G50990 0.1 4.1 Tetratricopeptide repeat (TPR)-like...”
- Mining the Roles of Cucumber DUF966 Genes in Fruit Development and Stress Response
Tian, Plants (Basel, Switzerland) 2022 - “...the first reported DUF domain-containing protein in rice, can control leaf rolling [ 3 ]. At2g23470 , a member of the DUF647 family in Arabidopsis , plays a role in controlling fertility [ 4 ]. PdDUF231A , a member of the DUF231 family, was found to...”
- “...9 37 10.1186/s12284-016-0105-6 27473144 4. Li W.-C. Zhao S.-Q. Specific gene silencing of At1g13770 and At2g23470 by artificial microRNAs in arabidopsis Yi Chuan 2012 34 348 355 10.3724/SP.J.1005.2012.00348 22425954 5. Yang Y. Yoo C.G. Winkeler K.A. Collins C.M. Hinchee M.A.W. Jawdy S.S. Gunter L.E. Engle N.L....”
- Global transcriptome analysis reveals potential genes associated with genic male sterility of rapeseed (Brassica napus L.)
Jiang, Frontiers in plant science 2022 - “...MYB21 and MYB24 to regulate stamen development. Cheng etal., 2009 BnaA04g13670D / / / -1.29 AT2G23470 RUS4 DUF647 domain containing protein. Mutants are male sterile with defects in endothecium, tapetum and stamen maturation. Chen etal., 2020 In previous studies, MS5 (BnaA08g25920D) was a key gene that...”
- RUS6, a DUF647-containing protein, is essential for early embryonic development in Arabidopsis thaliana
Perry, BMC plant biology 2021 - “...RUS members, we screened and identified knockout mutants for RUS3 ( AT1G13770 ), RUS4 ( AT2G23470 ), RUS5 ( AT5G01510 ) and RUS6 ( AT5G49820 ). Potential T-DNA insertional lines were identified in the public database and verified by gene-specific PCR markers. Homozygous knockout mutants were...”
- “...and confirmed in the SALK_135717C T-DNA line. b T-DNA insertion position in the RUS4 ( AT2G23470 ) gene was detected and confirmed in GK-447F02 T-DNA line. c T-DNA insertion position in the RUS5 gene ( AT5G01510 ) was detected and confirmed in SALK_038772 T-DNA line. Filled...”
- Knockdown of the DUF647 family member RUS4 impairs stamen development and pollen maturation in Arabidopsis
Chen, Plant science : an international journal of experimental plant biology 2020 (PubMed)- “...in this article are as follows: RUS4 (AT2G23470), DAD1 (AT2G44810), LOX3 (AT1G17420), AOS (AT5 G42650), AOC4 (AT1G13280), OPR3 (AT2G06050), JAR1 (AT2G46370),...”
- Genome-Wide Mining of Wheat DUF966 Gene Family Provides New Insights Into Salt Stress Responses
Zhou, Frontiers in plant science 2020 - “...grain hull ( Yan et al., 2013 ). In Arabidopsis thaliana , silencing of the At2g23470 gene, which encodes a member of the DUF647 protein family, results in severe infertility ( Li and Zhao, 2012 ). Li et al. (2016) determined the role of DUF1313 gene...”
- “...Li W. C. Zhao S. Q. ( 2012 ). Specific gene silencing of At1g13770 and At2g23470 by artificial microRNAs in Arabidopsis . Hered. (Beijing) 34 , 348 355 . 10.3724/sp.j.1005.2012.00348 Li J. Chang S. S. Liu F. Q. Shao M. ( 2012 ). Silencing of OsDUF500...”
- Knockdown of Arabidopsis ROOT UVB SENSITIVE4 Disrupts Anther Dehiscence by Suppressing Secondary Thickening in the Endothecium
Zhao, Plant & cell physiology 2019 (PubMed)- “...in this article are as follows: RUS4 (At2g23470), MYB26 (At3g13890), MYB85 (At4g22680), MYB103 (At1g63910), NST1 (At2g46770), NST2 (At3g61910), IRX1...”
- “...(RUS1, At3g45890), RUS2 (At2g31190), RUS3 (At1g13770), RUS4 (At2g23470), RUS5 (At5g01510) and RUS6/EMB1879 (At5g49820) (Tong et al. 2008, Leasure et al. 2009)....”
- Characterization of a recently evolved flavonol-phenylacyltransferase gene provides signatures of natural light selection in Brassicaceae
Tohge, Nature communications 2016 - “...chromosome 9 (BrChr.9). Syntenic blocks were found with 116 genes in AtFPT genomic region (AT2G22500- AT2G23470) using Plaza (http://bioinformatics.psb.ugent.be/plaza/versions/plaza_v3_dicots/). Red indicates FPT/SCPL related genes. Supplementary Data 4 Identification of syntenic genes located in the intrasyntenic genomic region of AtFPT/SCPL genomic region in the Brassicaceae species. Syntenic...”
- More
- Knockdown of the DUF647 family member RUS4 impairs stamen development and pollen maturation in Arabidopsis.
Chen, Plant science : an international journal of experimental plant biology 2020 (PubMed)- GeneRIF: Knockdown of the DUF647 family member RUS4 impairs stamen development and pollen maturation in Arabidopsis.
- Knockdown of Arabidopsis ROOT UVB SENSITIVE4 Disrupts Anther Dehiscence by Suppressing Secondary Thickening in the Endothecium.
Zhao, Plant & cell physiology 2019 (PubMed)- GeneRIF: The results suggest that RUS4, probably functions redundantly with other genes, may play an important role in the secondary thickening formation in the anther endothecium by indirectly affecting the expression of secondary cell wall biosynthetic genes.
An18g06120 uncharacterized protein from Aspergillus niger
Aligns to 62:244 / 484 (37.8%), covers 67.2% of PF04884, 189.2 bits
Or search for genetic data about PF04884 in the Fitness Browser
by Morgan Price,
Arkin group
Lawrence Berkeley National Laboratory