Family Search for PF04884 (DUF647)

PF04884.14 hits 12 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.

PADG_04473 hypothetical protein from Paracoccidioides brasiliensis Pb18
Aligns to 58:298 / 500 (48.2%), covers 98.8% of PF04884, 359.9 bits

• Comparison of the RNA Content of Extracellular Vesicles Derived from Paracoccidioides brasiliensis and Paracoccidioides lutzii
  Peres, Cells 2019
  • “...hypothetical protein PADG_04157 5R cellobiose dehydrogenase PADG_04417 3F hypothetical protein PADG_04448 5F polarized growth protein PADG_04473 MR duf647 domain-containing protein PADG_04629 3R protein PADG_04760 5F multiple myeloma tumor-associated protein 2 like PADG_04828 MF/MR adenylosuccinate lyase biosynthetic process PADG_05226 MF protein PADG_05352 5R ubiquitin carboxyl-terminal hydrolase 19...”

An18g06120 hypothetical protein from Aspergillus niger CBS 513.88
Aligns to 62:303 / 525 (46.1%), covers 98.8% of PF04884, 356.0 bits

• Genomic analysis of the secretion stress response in the enzyme-producing cell factory Aspergillus niger
  Guillemette, BMC genomics 2007
  • “...1.6 0.4 *1.4 0.09 An08g09860 hypothetical protein 2.3 0.6 *1.2 0.4 7.4 1.0 *-1.4 0.1 An18g06120 similar to secreted protein vc33_1 1.9 0.2 *-1.1 0.1 2.2 0.1 *1.0 0.05 An14g06550 hypothetical protein 2.1 0.3 *1.2 0.1 2.8 0.6 *1.2 0.1 An15g02650 hypothetical protein 2.8 1.5 *1.1...”

RUSF1_DICDI / Q86K80 RUS family member 1 from Dictyostelium discoideum (Slime mold) (see paper)
Aligns to 49:292 / 527 (46.3%), covers 98.8% of PF04884, 328.2 bits

• disruption phenotype: No visible phenotype.

Q499P8 RUS family member 1 from Rattus norvegicus
Aligns to 61:301 / 466 (51.7%), covers 97.1% of PF04884, 316.4 bits

• Gonadal transcriptomics elucidate patterns of adaptive evolution within marine rockfishes (Sebastes).
  Heras, BMC genomics 2015
  • “...2.269 276 O95352 4.22E-63 Q5ZKY2 6.44E-33 upf0420 protein c16orf58 0.034 0.029 1.188 435 Q96GQ5 3.11E-40 Q499P8 5.73E-29 vacuolar protein sorting-associated protein 16 homolog 0.016 0.012 1.312 477 Q5E9L7 2.96E-110 Q5E9L7 1.89E-91 wd repeat-containing protein 5 0.121 0.08 1.513 288 Q2KIG2 2.23E-27 Q2KIG2 3.23E-45 zinc finger cchc...”

Q96GQ5 RUS family member 1 from Homo sapiens
NP_073581 RUS family member 1 from Homo sapiens
Aligns to 66:303 / 468 (50.9%), covers 95.9% of PF04884, 309.5 bits

• Predicting Functions of Uncharacterized Human Proteins: From Canonical to Proteoforms.
  Poverennaya, Genes 2020
  • “...Q5THK1, Q68CR1, Q6P1M9, Q6P995, Q86X40, Q8IV32, Q8IW50, Q8N7X4, Q8NCJ5, Q8NCT3, Q8NCU4, Q8TBZ0, Q8TDY8, Q8WUB2, Q96BQ5, Q96GQ5, Q9BVG4, Q9H106, Q9H5V9, Q9H910, Q9Y546. Figure 3 Functional prediction of molecular functions for 60 uPE1 proteins. Figure 4 Cellular components predicted for 93 uPE1 proteins. * denotes the following set...”
  • “...Q53LP3, Q68CR1, Q6P995, Q6ZRI6-2, Q86X40, Q8IV32, Q8IW50, Q8N6V9, Q8NCJ5, Q8NCT3, Q8NCU4, Q8NEF3, Q8TBZ0, Q8WUB2, Q96BQ5, Q96GQ5, Q96MY1, Q9H106, Q9H693. Figure 5 The largest connected component of the obtained PPI network showing canonical proteins (lower level) and their corresponding splice forms (upper level). Hub proteins with more...”
• Identification of the cis‑molecular neighbours of the immune checkpoint protein B7‑H4 in the breast cancer cell‑line SK‑BR‑3 by proteomic proximity labelling.
  Rees, International journal of oncology 2020
  • “...Suppressor of tumorigenicity 14 protein homolog 0.14 4 5.6 Q6EMK4 VASN Vasorin 0.14 4 7.8 Q96GQ5 C16orf58 RUS1 family protein C16orf58 0.13 2.17 2 7.6 Q9Y5L3-2 ENTPD2 Isoform short of ectonucleoside triphosphate diphosphohydrolase 2 0.13 2 4.6 Q53G72 BCAP31 B-cell receptor-associated protein 31 variant 0.12 2...”
• Gonadal transcriptomics elucidate patterns of adaptive evolution within marine rockfishes (Sebastes).
  Heras, BMC genomics 2015
  • “...0.031 0.013 2.269 276 O95352 4.22E-63 Q5ZKY2 6.44E-33 upf0420 protein c16orf58 0.034 0.029 1.188 435 Q96GQ5 3.11E-40 Q499P8 5.73E-29 vacuolar protein sorting-associated protein 16 homolog 0.016 0.012 1.312 477 Q5E9L7 2.96E-110 Q5E9L7 1.89E-91 wd repeat-containing protein 5 0.121 0.08 1.513 288 Q2KIG2 2.23E-27 Q2KIG2 3.23E-45 zinc...”
• ROOT UV-B SENSITIVE2 acts with ROOT UV-B SENSITIVE1 in a root ultraviolet B-sensing pathway.
  Leasure, Plant physiology 2009
  • GeneRIF: Functional characterization of related Arabidopsis proteins that contain a DUF647 domain and are involved in UV-B sensing in roots. C16orf58 is the closest human homolog.

AT1G13770 hypothetical protein (RefSeq) from Arabidopsis thaliana
Aligns to 43:283 / 440 (54.8%), covers 98.3% of PF04884, 289.2 bits

• Genome-Wide Mining of Wheat DUF966 Gene Family Provides New Insights Into Salt Stress Responses
  Zhou, Frontiers in plant science 2020
  • “...10.1093/nar/gkh088 14681379 Li W. C. Zhao S. Q. ( 2012 ). Specific gene silencing of At1g13770 and At2g23470 by artificial microRNAs in Arabidopsis . Hered. (Beijing) 34 , 348 355 . 10.3724/sp.j.1005.2012.00348 Li J. Chang S. S. Liu F. Q. Shao M. ( 2012 ). Silencing...”
• [Specific gene silencing of At1g13770 and At2g23470 by artificial mi-croRNAs in Arabidopsis]
  Li, Yi chuan = Hereditas 2012 (PubMed) (secret)

B4FMW4 Uncharacterized protein from Zea mays
Aligns to 41:279 / 451 (53.0%), covers 98.8% of PF04884, 250.1 bits

• Quantitative Proteomic Analyses Identify ABA-Related Proteins and Signal Pathways in Maize Leaves under Drought Conditions
  Zhao, Frontiers in plant science 2016
  • “...up-regulated by drought stress in an ABA-dependent manner; drought stress decreased the expression of protein B4FMW4 by a similar extent in Vp5 and vp5 , indicating that the protein was down-regulated by drought stress in an ABA-independent manner; drought stress significantly decreased the expression of two...”
  • “...0.504 0.518 0.514 1.599 0.002 0.512 0.001 0.000 Up-regulated by drought in an ABA-dependent way B4FMW4 Uncharacterized protein 0.601 0.613 0.526 0.546 0.545 0.542 0.580 0.003 0.544 0.001 0.334 Down-regulated by drought in an ABA-independent way B7ZX39 Uncharacterized protein 1.615 1.627 1.540 0.541 0.552 0.546 1.594...”

RUS1_ARATH / Q7X6P3 Protein root UVB sensitive 1, chloroplastic; Protein WEAK AUXIN RESPONSE 3 from Arabidopsis thaliana (Mouse-ear cress) (see 4 papers)
AT3G45890 RUS1 (ROOT UVB SENSITIVE 1) (RefSeq) from Arabidopsis thaliana
NP_190175 root UVB sensitive-like protein (Protein of unknown function, DUF647) from Arabidopsis thaliana
Aligns to 185:422 / 608 (39.1%), covers 97.1% of PF04884, 248.6 bits

• function: Involved in a root UV-B sensing pathway and in the protection against the hypersensitivity to very low-fluence-rate (VLF) UV-B. RSU1 and RUS2 are probably both negative modulators of the same UV-B perception pathway, which when overstimulated in the roots causes a block to postgermination development. Required for polar auxin transport by maintaining the proper levels of auxin transporters AUX1 (AC Q96247) and PIN proteins on the plasma membrane.
  subunit: Interacts (via the DUF647 domain) with RUS2 (via the DUF647 domain).
  disruption phenotype: No visible phenotype under normal growth conditions. Extremely stunted growth, failure to develop true postembryonic leaves and arrested primary root elongation, when grown in vitro.
• HpeNet: Co-expression Network Database for de novo Transcriptome Assembly of Paeonia lactiflora Pall
  Sheng, Frontiers in genetics 2020
  • “...LHC unigenes in Arabidopsis ( Supplementary Table 7 ). Cluster-55448.207014 and Cluster-55448.124893, both homologous to AT3G45890 (LHCA1), were selected, and their detailed information and co-expression networks were searched in the database (MR 50) ( Figures 3A,B ). In the KEGG pathway annotation, both of the unigenes...”
• Validation of SNP allele frequencies determined by pooled next-generation sequencing in natural populations of a non-model plant species
  Rellstab, PloS one 2013
  • “...PCR forward CTTGACCTTTGGAAGCAATTGTA 106 58 PCR reverse bio-ACCAAAGAAATCGCACATGA Pyrosequencing AATTGTAAGTCCGTAGTTCA A Y ATCTCGTTAGTGTTTTT 8 RUS1 AT3G45890 1 & 2 1982/1996 NODE_69242 24280/24294 PCR forward GAACGGCTTCAACTAGGGTCA 129 58 PCR reverse bio-GCTTACGCAGAATCTTCCTCTGT Pyrosequencing AACAAGGAAGAAGCAATAG CA Y TGTTTGATCTGTA Y CGC 6/5 RUS1 AT3G45890 3 2430 NODE_69242 24722 PCR forward...”
• Role of root UV-B sensing in Arabidopsis early seedling development
  Tong, Proceedings of the National Academy of Sciences of the United States of America 2008
  • “...to transform rus1-1 (35). A 9-kb fragment containing At3g45890 complemented rus1-1 completely, and sequencing of this gene in the rus1-1 background revealed...”
  • “...is responsible for the rus1-1 phenotypes, we fused the At3g45890 gene with its promoter to the GFP coding sequence and PNAS December 30, 2008 vol. 105 no....”
• Host origin of plastid solute transporters in the first photosynthetic eukaryotes
  Tyra, Genome biology 2007
  • “...(glaucophyte homologs were found for some of these genes; for example, ADP/ATP translocase, hypothetical protein At3g45890). Eleven proteins were restricted to green algae and land plants, seven were plant-specific, and two were limited to red algae and land plants. The distribution of these proteins with respect...”
  • “...Ligand-effect modulator 3 LEM3 family At3g17690 Cyclic nucleotide-binding transporter 2 At3g17700 Cyclic nucleotide-binding transporter 1 At3g45890 Expressed protein At3g52310 ABC transporter At4g00370 Anion transporter 2 (ANTR2) At4g13590 Expressed protein At4g17340 Major intrinsic family protein At4g25750 ABC transporter At4g32400 Adenine nucleotide uniporter At4g32650 Arabidopsis thaliana K +...”
• ROOT ULTRAVIOLET B-SENSITIVE1/weak auxin response3 is essential for polar auxin transport in Arabidopsis.
  Yu, Plant physiology 2013
  • GeneRIF: RUS1 plays an essential role in the regulation of polar auxin transport by maintaining the proper level of auxin transporters on the plasma membrane.
• root uv-b sensitive mutants are suppressed by specific mutations in ASPARTATE AMINOTRANSFERASE2 and by exogenous vitamin B6.
  Leasure, Molecular plant 2011
  • GeneRIF: Specific asp2 mutations partially suppresses the rus1 and rus2 mutant phenotype.
• ROOT UV-B SENSITIVE2 acts with ROOT UV-B SENSITIVE1 in a root ultraviolet B-sensing pathway.
  Leasure, Plant physiology 2009
  • GeneRIF: RUS2 works with RUS1 in a root UV-B-sensing pathway that plays a vital role in Arabidopsis early seedling morphogenesis and development.

GRMZM5G833124 uncharacterized protein LOC100278802 from Zea mays
Aligns to 113:346 / 511 (45.8%), covers 97.9% of PF04884, 226.8 bits

• Expression Profiling Coupled with In-silico Mapping Identifies Candidate Genes for Reducing Aflatoxin Accumulation in Maize
  Dhakal, Frontiers in plant science 2017
  • “...F:TTAGCACTCGCAGGTCACAG R:CGGATGTAGCTCCCGTAGTT 25 P5F05 GRMZM5G877316 Basic leucine zipper W2 domain-containing protein F:TCTGGTTGCCAAAGGGATAG R:CTCGTGCAAAAAGCATTCAA 26 P5G05 GRMZM5G833124 Ubiquitin C-terminal hydrolase F:GAGCAAGATTGTGTGGAGCA R:AAACAAATCAGCCGATGACC 27 GRMZM2G126069 Actin1 F:TGACCTCACCGACCACCTAA R:CCAGGGACGTGATCTCCTTG a Clones in bold font were used for qRT-PCR . Validation of selected genes in germplasms by quantitative RT-PCR (qRT-PCR)...”

RUS2_ARATH / Q9SJX7 Protein root UVB sensitive 2, chloroplastic; Protein WEAK AUXIN RESPONSE 1 from Arabidopsis thaliana (Mouse-ear cress) (see 3 papers)
NP_565718 root UVB sensitive protein (Protein of unknown function, DUF647) from Arabidopsis thaliana
Aligns to 58:294 / 433 (54.7%), covers 97.9% of PF04884, 223.7 bits

• function: Involved in a root UV-B sensing pathway and in the protection against the hypersensitivity to very low-fluence-rate (VLF) UV-B. RSU1 and RUS2 are probably both negative modulators of the same UV-B perception pathway, which when overstimulated in the roots causes a block to postgermination development. Required for polar auxin transport and to maintain the normal levels of PIN proteins in the root.
  subunit: Interacts (via the DUF647 domain) with RUS1 (via the DUF647 domain).
  disruption phenotype: No visible phenotype under normal growth conditions. Extremely stunted growth, failure to develop true postembryonic leaves and arrested primary root elongation, when grown in vitro.
• root uv-b sensitive mutants are suppressed by specific mutations in ASPARTATE AMINOTRANSFERASE2 and by exogenous vitamin B6.
  Leasure, Molecular plant 2011
  • GeneRIF: Specific asp2 mutations partially suppresses the rus1 and rus2 mutant phenotype.
• Arabidopsis ROOT UVB SENSITIVE2/WEAK AUXIN RESPONSE1 is required for polar auxin transport.
  Ge, The Plant cell 2010
  • GeneRIF: RUS2/WXR1 is required for auxin transport and to maintain the normal levels of PIN proteins in the root.
• ROOT UV-B SENSITIVE2 acts with ROOT UV-B SENSITIVE1 in a root ultraviolet B-sensing pathway.
  Leasure, Plant physiology 2009
  • GeneRIF: RUS2 works with RUS1 in a root UV-B-sensing pathway that plays a vital role in Arabidopsis early seedling morphogenesis and development.[RUS2]

RUS6_ARATH / Q93YU2 Protein root UVB sensitive 6 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
AT5G49820 root UVB sensitive protein (Protein of unknown function, DUF647) from Arabidopsis thaliana
Aligns to 100:333 / 497 (47.1%), covers 96.3% of PF04884, 217.3 bits

• function: Required for normal embryo development.
• QTL and candidate genes associated with leaf anion concentrations in response to phosphate supply in Arabidopsis thaliana
  El-Soda, BMC plant biology 2019
  • “...5.3 1.06 2.12 Leucine-rich repeat protein kinase family protein involved in protein phosphorylation. AT5G49810 - AT5G49820 - AT5G49830 5 AT5G60410 24,293 0.08 4.3 0.76 1.63 SIZ1 , encodes a plant small ubiquitin-like modifier (SUMO) E3 ligase that is a focal controller of Pi starvation-dependent responses. AT5G60440...”
• SFGD: a comprehensive platform for mining functional information from soybean transcriptome data and its use in identifying acyl-lipid metabolism pathways
  Yu, BMC genomics 2014
  • “...(RRM)-containing protein Glyma05g31820 GmaAffx.29450.1.S1_at AT1G10500 ATCPISCA (chloroplast-localized IscA-like protein); structural molecule Glyma17g00580 Gma.10258.1.A1_s_at, Gma.10258.2.S1_at, GmaAffx.83788.1.S1_at AT5G49820 emb1879 (embryo defective 1879) Glyma07g03350 Gma.11469.1.S1_at, GmaAffx.67403.1.S1_at, GmaAffx.67403.1.A1_at AT3G15820 phosphatidic acid phosphatase-related/PAP2-related Glyma18g44350 Gma.6041.1.S1_at AT1G62640 KAS III (3-KETOACYL-ACYL CARRIER PROTEIN SYNTHASE III); 3-oxoacyl-[acyl-carrier-protein] synthase/catalytic/transferase, transferring acyl groups other than amino-acyl...”
• Role of root UV-B sensing in Arabidopsis early seedling development
  Tong, Proceedings of the National Academy of Sciences of the United States of America 2008
  • “...have sequence data available. Only the RUS1-like gene At5g49820 (EMB1879) was previously isolated in a screen for defective embryo development, and no defined...”

AT2G23470 hypothetical protein (RefSeq) from Arabidopsis thaliana
NP_179928 root UVB sensitive protein (Protein of unknown function, DUF647) from Arabidopsis thaliana
Aligns to 109:349 / 520 (46.3%), covers 96.7% of PF04884, 216.8 bits

• Genome-Wide Mining of Wheat DUF966 Gene Family Provides New Insights Into Salt Stress Responses
  Zhou, Frontiers in plant science 2020
  • “...grain hull ( Yan et al., 2013 ). In Arabidopsis thaliana , silencing of the At2g23470 gene, which encodes a member of the DUF647 protein family, results in severe infertility ( Li and Zhao, 2012 ). Li et al. (2016) determined the role of DUF1313 gene...”
  • “...Li W. C. Zhao S. Q. ( 2012 ). Specific gene silencing of At1g13770 and At2g23470 by artificial microRNAs in Arabidopsis . Hered. (Beijing) 34 , 348 355 . 10.3724/sp.j.1005.2012.00348 Li J. Chang S. S. Liu F. Q. Shao M. ( 2012 ). Silencing of OsDUF500...”
• Knockdown of Arabidopsis ROOT UVB SENSITIVE4 Disrupts Anther Dehiscence by Suppressing Secondary Thickening in the Endothecium
  Zhao, Plant & cell physiology 2019 (PubMed)
  • “...in this article are as follows: RUS4 (At2g23470), MYB26 (At3g13890), MYB85 (At4g22680), MYB103 (At1g63910), NST1 (At2g46770), NST2 (At3g61910), IRX1...”
  • “...(RUS1, At3g45890), RUS2 (At2g31190), RUS3 (At1g13770), RUS4 (At2g23470), RUS5 (At5g01510) and RUS6/EMB1879 (At5g49820) (Tong et al. 2008, Leasure et al. 2009)....”
• Characterization of a recently evolved flavonol-phenylacyltransferase gene provides signatures of natural light selection in Brassicaceae
  Tohge, Nature communications 2016
  • “...chromosome 9 (BrChr.9). Syntenic blocks were found with 116 genes in AtFPT genomic region (AT2G22500- AT2G23470) using Plaza (http://bioinformatics.psb.ugent.be/plaza/versions/plaza_v3_dicots/). Red indicates FPT/SCPL related genes. Supplementary Data 4 Identification of syntenic genes located in the intrasyntenic genomic region of AtFPT/SCPL genomic region in the Brassicaceae species. Syntenic...”
• [Specific gene silencing of At1g13770 and At2g23470 by artificial mi-croRNAs in Arabidopsis]
  Li, Yi chuan = Hereditas 2012 (PubMed) (secret)
• Forward chemical genetic screens in Arabidopsis identify genes that influence sensitivity to the phytotoxic compound sulfamethoxazole
  Schreiber, BMC plant biology 2012
  • “...assays were then performed, revealing Smex hypersensitivity in a line bearing a T-DNA insertion within At2g23470 [GenBank: NM_127911]. Based on our sequencing data, this locus contained a GA mutation at nucleotide 656 of the coding sequence, resulting in a G219E amino acid substitution in ESS 310....”
  • “...Both images were captured after 14 days of growth. ( c ) Gene model of At2g23470. Black regions indicate open reading frames while white areas designate untranslated regions. The location of the point mutation mapped in this study for ESS 310 is indicated by an asterisk,...”
• Knockdown of Arabidopsis ROOT UVB SENSITIVE4 Disrupts Anther Dehiscence by Suppressing Secondary Thickening in the Endothecium.
  Zhao, Plant & cell physiology 2019 (PubMed)
  • GeneRIF: The results suggest that RUS4, probably functions redundantly with other genes, may play an important role in the secondary thickening formation in the anther endothecium by indirectly affecting the expression of secondary cell wall biosynthetic genes.

Or search for genetic data about PF04884 in the Fitness Browser