Family Search for PF05057 (DUF676)
PaperBLAST, GapMind, SitesBLAST, and Sites on a Tree will be down for server maintenance on Friday March 29.
Running HMMer for PF05057
PF05057 hits 100 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.
AT5G51180 hypothetical protein from Arabidopsis thaliana
Aligns to 30:260 / 357 (64.7%), covers 97.2% of PF05057, 253.9 bits
- The Apocarotenoid β-Cyclocitric Acid Elicits Drought Tolerance in Plants
D'Alessandro, iScience 2019 - “...A): the drought marker genes ATAF1 (ANAC002, AT1G01720 ), RD29A ( AT5G52310 ), RD29B ( AT5G51180 ), RD22 ( AT5G25610 ), and bZip60 ( AT1G42990 ) ( Yamaguchi-Shinozaki and Shinozaki, 1993 , Lu etal., 2007 , Xiong etal., 1999 , Wang etal., 2017 ) were induced...”
- Synteny conservation between the Prunus genome and both the present and ancestral Arabidopsis genomes
Jung, BMC genomics 2006 - “...AT5G51050 mitochondrial substrate carrier family protein PP_LEa0034P07f ctg2264 AT5G50550 WD-40 repeat family protein/St12p protein PP_LEa0036H23f AT5G51180 expressed protein similar to auxin down-regulated protein PP_LEa0035K24f pp128 3 AT5G43830 ARG10 PP_LEa0034K23f ctg2264 AT5G44340 tubulin beta-4 chain (TUB4) PP_LEa0035B10f AT5G44090 calcium-binding EF hand family protein PP_LEa0035H07f pp130 3 AT5G15160...”
- “...AT4G27560 glycosyltransferase family protein PP_LEa0036D18f pa61 3 AT5G51050 mitochondrial substrate carrier family protein PP_LEa0034P07f ctg2264 AT5G51180 expressed protein PP_LEa0035K24f AT5G50550 WD-40 repeat family protein/St12p protein PP_LEa0036H23f pa64 3 AT4G14960 tubulin alpha-6 chain (TUA6) PP_LEa0035B10f ctg2264 AT3G22170 far-red impaired responsive protein PP_LEa0036G03f AT3G22850 similar to auxin down-regulated...”
AT4G25770 hypothetical protein from Arabidopsis thaliana
Aligns to 88:315 / 418 (54.5%), covers 97.2% of PF05057, 252.8 bits
AT1G29120 hypothetical protein from Arabidopsis thaliana
Aligns to 97:327 / 455 (50.8%), covers 97.2% of PF05057, 232.0 bits
- Translating the Arabidopsis thaliana Peroxisome Proteome Insights to Solanum lycopersicum: Consensus Versus Diversity
Tarafdar, Frontiers in cell and developmental biology 2022 - “...been shown to contain five unknown/uncharacterized proteins (UPs). Three of the uncharacterized proteins with UP9 (At1g29120), UP7 (AT5G65400), and UP3 (AT2G31670) contained non-canonical PTS1 represented by ASL>, SLM>, and SSL >, respectively. The S. lycopersicum putative ortholog of UP9 was found to be a putative lipase,...”
- Heat stress leads to rapid lipid remodeling and transcriptional adaptations in Nicotiana tabacum pollen tubes
Krawczyk, Plant physiology 2022 - “...E 86 LOC107797353 A0A1S4AGE5 AT2G26560 PLP2 Phospholipase A 2A 1.26 7.3 E 14 LOC107779233 A0A1S3YSB9 AT1G29120 Hydrolase-like protein family 1.27 1.6 E 53 LOC107799608 A0A1S4ANI7 AT1G29120 Hydrolase-like protein family 1.29 2.2 E 32 Steroid biosynthesis LOC107795609 A0A1S4AAX4 AT2G29390 SMO2-2 Sterol 4-alpha-methyl-oxidase 2-2 3.03 9.1 E 11...”
- Characterization of a new high copy Stowaway family MITE, BRAMI-1 in Brassica genome
Sampath, BMC plant biology 2013 - “...Bra025293 - Bra039073 460 A07 1577014 1576769 At2g18230 Bra039627 - Bra037229 467 A07 6402416 6402153 At1g29120 - Bra030121 Bra010851 490 A07 12392864 12392917 At3g57530 Bra007334 - Bra003287 536 A08 12108300 12108552 At4g35150 - Bra017699 Bra034678 545 A08 15271728 15271631 At4g36760 Bra011704 - Bra010574 596 A09 8214071...”
YD109_YEAST / Q12103 Putative lipase YDL109C; EC 3.1.-.- from Saccharomyces cerevisiae (strain ATCC 204508 / S288c) (Baker's yeast) (see 2 papers)
YDL109C Putative lipase; involved in lipid metabolism; YDL109C is not an essential gene from Saccharomyces cerevisiae
Aligns to 189:389 / 647 (31.1%), covers 97.2% of PF05057, 229.8 bits
- function: Involved in lipid metabolism.
- Identification and Potential Participation of Lipases in Autophagic Body Degradation in Embryonic Axes of Lupin (Lupinus spp.) Germinating Seeds
Wleklik, International journal of molecular sciences 2023 - “...0.2629 0.0219 0.0575 0.3940 0.5970 0.1796 0.0034 white and Andean 33. XM_019560336.1 XP_019415881.1 putative lipase YDL109C (LOC109327267) 0.5177 0.2787 0.1145 0.5016 0.2160 0.3013 0.5523 0.5947 0.4328 0.0594 white and Andean 34. XM_019603098.1 XP_019458643.1 GDSL esterase/lipase At2g42990-like (LOC109358701) 0.1742 0.1030 0.6854 0.1671 0.0073 0.1844 0.3105 0.5943 0.1800...”
- High-throughput biochemical fingerprinting of Saccharomyces cerevisiae by Fourier transform infrared spectroscopy
Kohler, PloS one 2015 - “...YKL140W TGL1 22 YBR183W YPC1 62 YKL188C PXA2 23 YDL046W NPC2 63 YLL012W YEH1 24 YDL109C YDL109C 65 YLR023C IZH3 25 YDL142C CRD1 66 1 , 2 YLR133W CKI1 26 YDR018C YDR018C 67 WT WT BY4743 27 YDR072C IPT1 68 YLR189C ATG26 28 YDR147W EKI1 69...”
- Identifying correlations between chromosomal proximity of genes and distance of their products in protein-protein interaction networks of yeast
Santoni, PloS one 2013 - “...14 YNL330C YNR069C 743206 1 (ii) BIOGRID 3 YCR045C YCR051W 5532 6 (i) MINT 4 YDL109C YDL104C 8035 6 (i) MINT 4 YDL107W YDL104C 4816 7 (i) MINT 4 YDL104C YDL102W 4254 6 (i) MINT 4 YDL104C YDL099W 9667 6 (i) MINT 9 YIL166C YIL158W 14756...”
- A highly redundant gene network controls assembly of the outer spore wall in S. cerevisiae
Lin, PLoS genetics 2013 - “...GMC1 YFL041w FET5 Y 65% w/ FET3 Rog set: YGL144c ROG1 Y 63% w/ ROG1 YDL109c N Pes set: YFR023w PES4 Y 59% w/ MIP6 YHR015w MIP6 Y a Indicates whether the transcript is induced during sporulation [55] . b % similarity is based on comparison...”
- “...paralogs listed in Table 2 , five pairs ( LDS1 / LDS2 , ROG1 / YDL109c , NPP1 / NPP2 , OSW7 / SHE10 , PES4 / MIP6 ) can be assigned to the whole genome duplication [34] . Paralogs with overlapping function are predicted to...”
- Regulation of amino acid, nucleotide, and phosphate metabolism in Saccharomyces cerevisiae
Ljungdahl, Genetics 2012 - “...UFO1 ZAP1 APG2 AUT4 BUD23 FLO9 YLH47 PMU1 SHE9 YDL109C QDR1 DML1 SQS1 ZPS1 COS10 GFD2 YHR210C YGR079W YER186C YLR346C YNR014W YNL046W YBL070C YOR343C YMR279C...”
- Chemogenetic fingerprinting by analysis of cellular growth dynamics
Warringer, BMC chemical biology 2008 - “...PIM1, TAT1, YBR074w, PHO3, YBR099c, APE3, APM3, YCL010C, YCL047C, CVT17, YCR073W, SRB8, YCR101C, YCR106W, YCR195C, YDL109c, YDL124w, DLD1, YDL175c, UGA4, GDH2, RRI1, SHS1, YDR026c, YDR101c, YDR132c, SWM1, GLO2, SUM1, YDR384c, HAT2, PRB1, CAN1, VTC1, DOT6, FTR1, YGL010w, ATE1, YGL131c, YGL144c, AMS1, APG1, GTS1, YGL196w, MIG2, KIP3,...”
- Comparative analysis indicates regulatory neofunctionalization of yeast duplicates
Tirosh, Genome biology 2007 - “...YLL010C YLR019W orf19.5406 0.82661 0.11215 13 8 AAP1' APE2 orf19.5197 0.59717 0.14552 7 11 YGL144C YDL109C orf19.3991 0.82365 0.17816 41 21 PMT2 PMT3 orf19.6812 0.75012 0.26011 57 10 NHP6A YBR089CA orf19.4623.3 0.78273 0.3078 1 0 MKK2 MKK1 orf19.6889 0.77227 0.31153 7 10 YBR238C YGL107C orf19.7459 0.69723...”
- Alteration in the cytosolic triacylglycerol biosynthetic machinery leads to decreased cell growth and triacylglycerol synthesis in oleaginous yeast
Gangar, The Biochemical journal 2002 - “...cereisiae that a deletion mutation in oxysterol-binding protein (YDL109c) caused an elevation in TAG levels [33]. By contrast, the isolated TAG-deficient R....”
- More
YGL144C Protein with putative serine active lipase domain from Saccharomyces cerevisiae
NP_011371 putative lipase ROG1 from Saccharomyces cerevisiae S288C
Aligns to 184:384 / 685 (29.3%), covers 97.2% of PF05057, 229.6 bits
- Monoacylglycerol Lipases Act as Evolutionarily Conserved Regulators of Non-oxidative Ethanol Metabolism
Heier, The Journal of biological chemistry 2016 - “..., YBR204c / LDH1 , YOR059c / LPL1 , YBR177c / EHT1 , YPR147c , YGL144c / ROG1 , and YKL094w / YJU3 were amplified by PCR using genomic DNA obtained from BY4742 as template and the following primers: TGL1_fw, 5-GAT CGG ATC CAT GTA CTT...”
- High-throughput biochemical fingerprinting of Saccharomyces cerevisiae by Fourier transform infrared spectroscopy
Kohler, PloS one 2015 - “...YNL280C ERG24 38 1 , 2 YGL126W SCS3 79 1 , 2 YNL123W NMA111 39 YGL144C ROG1 80 1 sample, showed a dominant FTIR phenotype that is different from the wild type after 24 hours of cultivation; 2 sample, showed a dominant FTIR phenotype that is...”
- A highly redundant gene network controls assembly of the outer spore wall in S. cerevisiae
Lin, PLoS genetics 2013 - “...YFR023w PES4 RNA binding motif YFR039c OSW7 Fly signal peptide YGL096w TOS8 putative transcription factor YGL144c ROG1 putative lipase YHR153c SPO16 synaptonemal complex assembly YIR013c GAT4 putative transcription factor YJL037w YJL037w IRC18 / OSW6 Fly paralog of OSW4 YJL038c LOH1 / OSW4 Permeable paralog of OSW6...”
- “...FET5 YMR058w FET3 N 50% w/ GMC1 YFL041w FET5 Y 65% w/ FET3 Rog set: YGL144c ROG1 Y 63% w/ ROG1 YDL109c N Pes set: YFR023w PES4 Y 59% w/ MIP6 YHR015w MIP6 Y a Indicates whether the transcript is induced during sporulation [55] . b...”
- Chemogenetic fingerprinting by analysis of cellular growth dynamics
Warringer, BMC chemical biology 2008 - “...YDR101c, YDR132c, SWM1, GLO2, SUM1, YDR384c, HAT2, PRB1, CAN1, VTC1, DOT6, FTR1, YGL010w, ATE1, YGL131c, YGL144c, AMS1, APG1, GTS1, YGL196w, MIG2, KIP3, EDC1, YGL242c, HFM1, HXK2, BNS1, YHL002w, YHL029C, SOD2, PCL7, SPO22, UBP7, MPH1, HYR1, YJL131c, TIF2, YJR044c, SOD1, MNN4, EAP1, YKR090w, YKR104w, YBT1, AYT1, DAN2,...”
- Comparative analysis indicates regulatory neofunctionalization of yeast duplicates
Tirosh, Genome biology 2007 - “...9 YLL010C YLR019W orf19.5406 0.82661 0.11215 13 8 AAP1' APE2 orf19.5197 0.59717 0.14552 7 11 YGL144C YDL109C orf19.3991 0.82365 0.17816 41 21 PMT2 PMT3 orf19.6812 0.75012 0.26011 57 10 NHP6A YBR089CA orf19.4623.3 0.78273 0.3078 1 0 MKK2 MKK1 orf19.6889 0.77227 0.31153 7 10 YBR238C YGL107C orf19.7459...”
- Transcriptional response of yeast to aflatoxin B1: recombinational repair involving RAD51 and RAD1
Keller-Seitz, Molecular biology of the cell 2004 - “...60 Functione Protein of unknown function Similarity to YGL144c Similarity to hypothetical C. elegans protein C56A3.8 Similarity to Yjl083p Similarity to human...”
- Disruption of six novel ORFs from Saccharomyces cerevisiae chromosome VII and phenotypic analysis of the deletants
Victoria, Yeast (Chichester, England) 2000 (PubMed)- “...VII, namely YGL133w, YGL134w, YGL136c, YGL138c, YGL142c and YGL144c. Disruptions were made using the short anking homology PCR replacement strategy in the...”
- “...deleted in any of the genes YGL134w, YGL138c and YGL144c under the conditions tested. YGL142c was shown to be an essential gene. Segregants bearing a deletion...”
- Yeast glycogen synthase kinase 3 is involved in protein degradation in cooperation with Bul1, Bul2, and Rsp5
Andoh, Molecular and cellular biology 2000 - “...fragments were inserted just before nucleotide 75 of the YGL144c ORF in strain YTA004K and at nucleotide 244 of the YOR253w ORF in strain YTA011K. Immunoblot...”
- “...analysis, ROG1 and ROG2 were revealed to be YGL144c and YOR253w, respectively, using a Saccharomyces genome database. Rog1 contains a lipase-like motif, and the...”
- More
- ROG1 encodes a monoacylglycerol lipase in Saccharomyces cerevisiae.
Vishnu, FEBS letters 2015 (PubMed)- GeneRIF: These results suggest that Rog1p is a MAG lipase that regulates lipid homeostasis.
LOC109342050 putative lipase ROG1 from Lupinus angustifolius
Aligns to 24:254 / 352 (65.6%), covers 96.8% of PF05057, 224.5 bits
LPL1_YEAST / Q08448 Lipid droplet phospholipase 1; EC 3.1.-.-; EC 3.1.1.4 from Saccharomyces cerevisiae (strain ATCC 204508 / S288c) (Baker's yeast) (see 4 papers)
NP_014702 putative hydrolase from Saccharomyces cerevisiae S288C
YOR059C Yor059cp from Saccharomyces cerevisiae
Aligns to 1:214 / 450 (47.6%), covers 97.2% of PF05057, 223.6 bits
- function: Phospholipase involved in maintaining the lipid droplet morphology (PubMed:25014274). Has phospholipase activity with broad substrate specificity, acting on glycerophospholipids phosphatidylethanolamine (PE), phosphatidic acid (PA), phosphatidycholine (PC) and phosphatidylserine (PS), primarily at sn-2 position (PubMed:25014274). It can later remove fatty acids from the sn-1 position of the produced lysophospholipids such as lysophosphatidylethanolamine (LPE) (PubMed:25014274). Shows also activity toward phosphatidylglycerol, but, in contrast to what was observed with the other phospholipids tested, prefers the sn-1 position (PubMed:25014274).
catalytic activity: a 1,2-diacyl-sn-glycero-3-phosphoethanolamine + H2O = a 1- acyl-sn-glycero-3-phosphoethanolamine + a fatty acid + H(+) (RHEA:44604)
catalytic activity: a 1-acyl-sn-glycero-3-phosphoethanolamine + H2O = a fatty acid + H(+) + sn-glycero-3-phosphoethanolamine (RHEA:32967)
catalytic activity: a 1,2-diacyl-sn-glycero-3-phosphate + H2O = a 1-acyl-sn- glycero-3-phosphate + a fatty acid + H(+) (RHEA:44420)
catalytic activity: a 1,2-diacyl-sn-glycero-3-phosphocholine + H2O = a 1-acyl-sn- glycero-3-phosphocholine + a fatty acid + H(+) (RHEA:15801)
catalytic activity: a 1,2-diacyl-sn-glycero-3-phospho-L-serine + H2O = a 1-acyl- sn-glycero-3-phospho-L-serine + a fatty acid + H(+) (RHEA:44672)
catalytic activity: a 1,2-diacyl-sn-glycero-3-phosphoglycerol + H2O = a 2-acyl-sn- glycero-3-phosphoglycerol + a fatty acid + H(+) (RHEA:62032)
catalytic activity: a 1-(9Z-octadecenoyl)-2-acyl-sn-glycero-3-phosphocholine + H2O = 1-(9Z-octadecenoyl)-sn-glycero-3-phosphocholine + a fatty acid + H(+) (RHEA:62036)
catalytic activity: a 1-(9Z-octadecenoyl)-2-acyl-sn-glycero-3-phosphoglycerol + H2O = (9Z)-octadecenoate + a 2-acyl-sn-glycero-3-phosphoglycerol + H(+) (RHEA:62044)
catalytic activity: an N-aryl-1,2-dihexadecanoyl-sn-glycero-3-phosphoethanolamine + H2O = an N-aryl-1-hexadecanoyl-sn-glycero-3-phosphoethanolamine + H(+) + hexadecanoate (RHEA:62048)
catalytic activity: a 1-(9Z-octadecenoyl)-2-acyl-sn-glycero-3-phosphate + H2O = 1- (9Z-octadecenoyl)-sn-glycero-3-phosphate + a fatty acid + H(+) (RHEA:62052)
catalytic activity: 1,2-dihexadecanoyl-sn-glycero-3-phosphoethanolamine + H2O = 1- hexadecanoyl-sn-glycero-3-phosphoethanolamine + H(+) + hexadecanoate (RHEA:62100)
disruption phenotype: Leads to an altered morphology of lipid droplets with a smaller size. - Spore Germination of the Obligate Biotroph Spongospora subterranea: Transcriptome Analysis Reveals Germination Associated Genes
Balotf, Frontiers in microbiology 2021 - “...TCONS_00008644 Q9ZRF1 Probable mannitol dehydrogenase (EC 1.1.1.255) TCONS_00010484 A0A0H5RB43 Zn (2)-C6 fungal-type domain-containing protein TCONS_00011177 Q08448 Lipid droplet phospholipase 1 (EC 3.1.1.4) TCONS_00009401 O93662 Catalase (EC 1.11.1.6) TCONS_00008033 P43098 Fatty acid synthase subunit alpha (EC 2.3.1.86) TCONS_00003907 P25867 Ubiquitin-conjugating enzyme E2-17 kDa (EC 2.3.2.23) TCONS_00000069 A0A0H5R2B3...”
- The phosphorylation of a kinetochore protein Dam1 by Aurora B/Ipl1 kinase promotes chromosome bipolar attachment in yeast.
Jin, Scientific reports 2017 - GeneRIF: regulation of Dam1 phosphorylation imposed by Ipl1 kinase is critical for faithful chromosome segregation.
- Identification and Potential Participation of Lipases in Autophagic Body Degradation in Embryonic Axes of Lupin (Lupinus spp.) Germinating Seeds
Wleklik, International journal of molecular sciences 2023 - “...0.2846 0.0734 0.1256 0.4167 0.7070 0.4139 0.0128 white and Andean 5. XM_019604187.1 XP_019459732.1 putative lipase YOR059C (LOC109359495) 0.5098 0.3743 0.1712 0.3106 0.2847 0.2233 0.6089 0.6995 0.6764 0.0244 Andean 6. XM_019580024.1 XP_019435569.1 putative lipase ROG1 (LOC109342050) 0.4751 0.3420 0.1784 0.3196 0.3168 0.2231 0.5423 0.6956 0.6792 0.0250 white...”
- A Comparative Transcriptome Between Anti-drug Sensitive and Resistant Candida auris in China
Zhou, Frontiers in microbiology 2021 - “...B9J08_003361 RHO1 GTP-binding protein RHO1 Phospholipase 0.60 B9J08_003959 SLC1 Probable 1-acyl-sn-glycerol-3-phosphate acyltransferase Phospholipase 0.69 B9J08_004606 YOR059C Putative lipase YOR059C Phospholipase 0.69 B9J08_001064 PGC1 Phosphatidylglycerol phospholipase C Phospholipase 0.63 B9J08_003873 PLC1 1-Phosphatidylinositol 4,5-bisphosphate phosphodiesterase 1 Phospholipase 0.85 B9J08_000871 LAP3 Cysteine proteinase 1, mitochondrial Proteinase 1.25 B9J08_005051 YIL108W...”
- Monoacylglycerol Lipases Act as Evolutionarily Conserved Regulators of Non-oxidative Ethanol Metabolism
Heier, The Journal of biological chemistry 2016 - “...YMR313c / TGL3 , YKR089c / TGL4, YOR081c / TGL5 , YBR204c / LDH1 , YOR059c / LPL1 , YBR177c / EHT1 , YPR147c , YGL144c / ROG1 , and YKL094w / YJU3 were amplified by PCR using genomic DNA obtained from BY4742 as template and...”
- Identification of a phospholipase B encoded by the LPL1 gene in Saccharomyces cerevisiae
Selvaraju, Biochimica et biophysica acta 2014 (PubMed)- “...on the localization and enzyme activity we renamed YOR059c as LPL1 (LD phospholipase 1). 0 false false Phospholipids Phospholipase Lipid droplet GFP...”
- “...NCBI was performed. Multiple sequence alignment of YOR059c (NP_014702.1) is homologous to Arabidopsis thaliana (NP_001031014.1) and Oryza sativa indica group...”
- High confidence proteomic analysis of yeast LDs identifies additional droplet proteins and reveals connections to dolichol synthesis and sterol acetylation
Currie, Journal of lipid research 2014 - “...glycerol A, G ( 69 ) ( 67 ) YKL047W Unknown, putative lipase Current work YOR059C Unknown, putative lipase. A ( 69 ) YPR147C Unknown Current work Identified proteins were found as described in the Results and are annotated for ORF, gene name, presence in other...”
- “...were previously localized to the LD by microscopy (Dga1, Ldh1, Pgc1, Tgl4, Tgl5, Ubx2, and YOR059C). Of the 10 remaining proteins, three (Ecm29, Nte1, and Taz1) did not show LD localization when we examined C-terminal GFP fusions of them by microscopy, suggesting that they purify with...”
- Lipid droplets and peroxisomes: key players in cellular lipid homeostasis or a matter of fat--store 'em up or burn 'em down
Kohlwein, Genetics 2013 - “...YPT7 (AST4 , VAM4) Rab family GTPase 23.0 4.62 5,530 Lipid droplets, cytoplasm None None YOR059c Putative lipase 51.1 9.81 1,210 Lipid droplets 1 None Much of the information in this table may be found in the Saccharomyces Genome Database. ND, not determined. a Ghaemmaghami et...”
- YPR139c/LOA1 encodes a novel lysophosphatidic acid acyltransferase associated with lipid droplets and involved in TAG homeostasis
Ayciriex, Molecular biology of the cell 2012 - “...+ 0.12 YP091 YPR091C Uncharacterized PH domaincontaining protein + 0.12 YBR056W Uncharacterized glycosyl hydrolase 0.09 YOR059C + 0.09 NTE1 YML059c Lysophospholipase PL metabolism 0.09 GPT2 YKR067w G-3-P acyltransferase 2 (GAT1) PL biosynthesis + 0.09 UBX2 YML013w Protein involved in ER-associated protein degradation ER-associated protein catabolic process...”
- Lipid particles/droplets of the yeast Saccharomyces cerevisiae revisited: lipidome meets proteome
Grillitsch, Biochimica et biophysica acta 2011 - “...3 2 LP/C/M/PM Serine hydrolase YNL134C YNL134C 2 C/N Unknown YNL208W YNL208W 3 M/R Unknown YOR059C YOR059C LP Unknown YOR246C YOR246C LP Similarity to oxidoreductase YPT7 YML001W 4 2 V/M GTPase ZEO1 YOL109W 9 M/PM/ext Peripheral membrane protein...”
- More
GRMZM2G130432 uncharacterized protein LOC100191604 from Zea mays
Aligns to 23:250 / 345 (66.1%), covers 96.3% of PF05057, 223.1 bits
- Aberrant splicing in maize rough endosperm3 reveals a conserved role for U12 splicing in eukaryotic multicellular development
Gault, Proceedings of the National Academy of Sciences of the United States of America 2017 - “...GRMZM2G110277 Shoots 0.801 1.10E-11 1.86E-03 GRMZM2G111954 Shoots 0.833 2.03E-11 1.86E-03 GRMZM2G119640 Shoots 0.683 2.22E-16 1.86E-03 GRMZM2G130432 U12 intron Shoots 0.733 8.71E-12 1.86E-03 Misspliced Roots 0.656 2.99E-10 2.65E-02 GRMZM2G137847 Shoots 0.833 3.75E-12 1.86E-03 GRMZM2G175398 Shoots 0.828 3.40E-08 1.86E-03 GRMZM2G350312 Shoots 0.830 4.38E-06 1.86E-03 GRMZM2G476538 Shoots 0.833 1.78E-08...”
- “...region amplified. Full gene models are shown for ( C ) GRMZM2G306935, ( E ) GRMZM2G130432, and ( F ) GRMZM5G820727. Fig. S3. RT-PCR validation of rgh3 splicing defects predicted by Cufflinks in diverse tissue types. Gene-specific primers amplified cDNA from roots, shoots, whole kernels, embryos,...”
SPAC4A8.10 lipase (predicted) from Schizosaccharomyces pombe
Aligns to 239:451 / 723 (29.5%), covers 97.2% of PF05057, 222.6 bits
AT1G10040 hypothetical protein from Arabidopsis thaliana
Aligns to 76:307 / 412 (56.3%), covers 96.8% of PF05057, 221.9 bits
LOC109327267 putative lipase YDL109C from Lupinus angustifolius
Aligns to 69:306 / 411 (57.9%), covers 97.2% of PF05057, 220.1 bits
LOC107799608 uncharacterized protein LOC107799608 from Nicotiana tabacum
Aligns to 79:314 / 446 (52.9%), covers 97.2% of PF05057, 217.4 bits
NP_001099001 protein FAM135A isoform a from Homo sapiens
Aligns to 1048:1244 / 1319 (14.9%), covers 99.1% of PF05057, 211.0 bits
F135A_HUMAN / Q9P2D6 Protein FAM135A from Homo sapiens (Human) (see paper)
Aligns to 1244:1440 / 1515 (13.0%), covers 99.1% of PF05057, 211.0 bits
YD444_YEAST / Q04093 Putative lipase YDR444W; EC 3.1.-.- from Saccharomyces cerevisiae (strain ATCC 204508 / S288c) (Baker's yeast) (see 2 papers)
YDR444W Putative protein of unknown function from Saccharomyces cerevisiae
Aligns to 192:417 / 687 (32.9%), covers 97.2% of PF05057, 199.0 bits
- Correction to: A Genome-Wide Screen for Genes Affecting Spontaneous Direct-Repeat Recombination in Saccharomyces cerevisiae
, G3 (Bethesda, Md.) 2022 - “...25.9 NGG1 30.3 ACE2 15.6 YCL023C 26.0 POP2 30.4 MOT2 15.8 FEN2 26.7 ATP11 30.8 YDR444W 15.8 BUB1 26.8 RPL37B 31.0 SLX5 16.7 CCW12 27.1 HFI1 31.0 SLX8 16.7 HST4 27.1 YML013C-A 31.1 Figure 2. A high-throughput replica-pinning screen for genes controlling direct-repeat recombination. (A) Schematic...”
- Conservation of nucleosome positions in duplicated and orthologous gene pairs
Nishida, TheScientificWorldJournal 2012 - “...0.989813233 1319833 chr04 YDR432W 0.955728738 0.982171718 1328775 + chr04 YDR438W 0.971626925 0.98904082 1338266 + chr04 YDR444W 0.973566433 0.976502447 1350282 + chr04 YDR453C 0.952661492 0.954481014 1365654 chr04 YDR476C 0.969940159 0.964679279 1411119 chr04 YDR477W 0.954743343 0.979243738 1412365 + chr04 YDR479C 0.977460825 0.994501786 1416866 chr04 YDR480W 0.967727074 0.986953403 1417391...”
- “...YLR299W AFUA_7G04760 0.36169498 YCL038C AFUA_2G06170 0.359699115 YKL113C AFUA_3G06060 0.351986208 YHL020C AFUA_5G09420 0.350312962 YMR224C AFUA_6G11410 0.348946198 YDR444W AFUA_3G04240 0.345942811 YER107C AFUA_1G09020 0.34238252 YDR162C AFUA_2G03680 0.342381673 YNL212W AFUA_3G08750 0.341561675 YNL097C AFUA_3G11940 0.339603963 YKL191W AFUA_6G07100 0.337319743 YPL030W AFUA_6G02570 0.336821966 YNL224C AFUA_3G05330 0.336636223 YKR024C AFUA_5G11050 0.328747023 YPR020W AFUA_1G16280 0.323479927 YPL171C...”
- Design of improved membrane protein production experiments: quantitation of the host response
Bonander, Protein science : a publication of the Protein Society 2005 - “...YPL216W, YLR162W, YLR202C, YOR389W, YFL066C, YLR149C, YMR290W-A, YDR444W, YOL098C, and YBL112C. time course, which had a different profile under different...”
- The yeast protein kinase C cell integrity pathway mediates tolerance to the antifungal drug caspofungin through activation of Slt2p mitogen-activated protein kinase signaling
Reinoso-Martín, Eukaryotic cell 2003 - “...LEU1 LYS20 HSM3 RIB7 a b c YLR017w YDR444w YDR461w YHR096c YAL042w YAR071w YDR058c YBR145w YCL009c YGL009c YDL182w YBR272c YBR014c YBR153w YJR024c Function...”
- Random exploration of the Kluyveromyces lactis genome and comparison with that of Saccharomyces cerevisiae
Ozier-Kalogeropoulos, Nucleic acids research 1998 - “...retained as more likely candidates for actual genes (YDR444w and YAR045w, respectively). The present finding of K.lactis homologs suggests the opposite. Note...”
NP_001349894 protein FAM135B from Homo sapiens
Q49AJ0 Protein FAM135B from Homo sapiens
Aligns to 1135:1331 / 1406 (14.0%), covers 98.6% of PF05057, 194.7 bits
- A GRN Autocrine-Dependent FAM135B/AKT/mTOR Feedforward Loop Promotes Esophageal Squamous Cell Carcinoma Progression.
Dong, Cancer research 2021 (PubMed)- GeneRIF: A GRN Autocrine-Dependent FAM135B/AKT/mTOR Feedforward Loop Promotes Esophageal Squamous Cell Carcinoma Progression.
- Silencing FAM135B enhances radiosensitivity of esophageal carcinoma cell.
Bi, Gene 2021 (PubMed)- GeneRIF: Silencing FAM135B enhances radiosensitivity of esophageal carcinoma cell.
- Phenotypic and molecular features underlying neurodegeneration of motor neurons derived from spinal and bulbar muscular atrophy patients.
Sheila, Neurobiology of disease 2019 (PubMed)- GeneRIF: Using microarray analysis reveals novel genes such as FAM135B, dysregulated in Spinal and bulbar muscular atrophy (SBMA). Knockdown of FAM135B results in neurodegeneration, indicating its role in SBMA.
- Brain and testis: more alike than previously thought?
Matos, Open biology 2021 - “...of nerve impulse Q12926 ELAV2 ELAV-like protein 2 mRNA splicing, via spliceosome; regulation of transcription Q49AJ0 FAM135B protein FAM135B cellular lipid metabolic process P43080 GUCA1A guanylyl cyclase-activating protein 1 cellular response to calcium ion; signal transduction; visual perception Q8NE63 HIPK4 homeodomain-interacting protein kinase 4 histone phosphorylation;...”
- Quantitative proteomic analysis for high-throughput screening of differential glycoproteins in hepatocellular carcinoma serum
Gao, Cancer biology & medicine 2015 - “...EMILIN-2 OS=Homo sapiens GN=EMILIN2 PE=1 SV=3 - [EMIL2_HUMAN] 0.66 1 1 1 1,053 115.6 6.46 Q49AJ0 Protein FAM135B OS=Homo sapiens GN=FAM135B PE=2 SV=2 - [F135B_HUMAN] 0.50 1 1 1 1,406 155.7 5.86 Q9NVF7 F-box only protein 28 OS=Homo sapiens GN=FBXO28 PE=1 SV=1 - [FBX28_HUMAN] 1.63 3...”
AT1G09980 hypothetical protein from Arabidopsis thaliana
Aligns to 516:718 / 802 (25.3%), covers 98.2% of PF05057, 180.3 bits
- Transcriptome-wide high-throughput deep m(6)A-seq reveals unique differential m(6)A methylation patterns between three organs in Arabidopsis thaliana
Wan, Genome biology 2015 - “...AT5G49030, AT5G27700, AT3G47060, AT2G07715, AT2G24640, AT2G25740 [ 18 ] Protein located in mitochondria or chloroplast AT1G09980, AT1G58350, AT1G68160, AT2G01008, AT2G07671, AT2G07708, AT2G07687, AT2G07727, AT2G11910, AT2G31141, AT2G33980, AT2G35750, AT2G07698, AT3G12590, AT3G41762, AT3G50380, AT4G00585, AT4G02770, AT4G31350, AT4G38120, AT4G39690, AT5G08060, AT5G15320, AT5G15750, AT5G26850, AT5G59613, AT1G07705, AT3G58010, AT3G63052, AT1G30910, AT3G08950,...”
AT1G58350 ZW18 from Arabidopsis thaliana
Aligns to 508:710 / 794 (25.6%), covers 98.2% of PF05057, 177.1 bits
- Transcriptome-wide high-throughput deep m(6)A-seq reveals unique differential m(6)A methylation patterns between three organs in Arabidopsis thaliana
Wan, Genome biology 2015 - “...AT5G27700, AT3G47060, AT2G07715, AT2G24640, AT2G25740 [ 18 ] Protein located in mitochondria or chloroplast AT1G09980, AT1G58350, AT1G68160, AT2G01008, AT2G07671, AT2G07708, AT2G07687, AT2G07727, AT2G11910, AT2G31141, AT2G33980, AT2G35750, AT2G07698, AT3G12590, AT3G41762, AT3G50380, AT4G00585, AT4G02770, AT4G31350, AT4G38120, AT4G39690, AT5G08060, AT5G15320, AT5G15750, AT5G26850, AT5G59613, AT1G07705, AT3G58010, AT3G63052, AT1G30910, AT3G08950, AT3G47060,...”
AFUA_3G12320 lipase/serine esterase, putative from Aspergillus fumigatus Af293
Aligns to 2:209 / 449 (46.3%), covers 97.7% of PF05057, 173.7 bits
- Lipid Biosynthesis as an Antifungal Target
Pan, Journal of fungi (Basel, Switzerland) 2018 - “..., A. fumigatus , and other Aspergillus species [ 51 ]. The homologous gene of AFUA_3G12320 in yeast is Lpl1 , which encodes a phospholipase B; Lpl1 is essential for the morphology of lipid droplets in yeast cells but is dispensable for cell survival because of...”
- “...41 , 56 ] AFUA_5G01960 Phosphate transporter Pho88 A. nidulans A. fumigatus [ 51 ] AFUA_3G12320 Lipase/Serine esterase S. cerevisiae [ 57 ] AFUA_2G09040 Vacuolar transporter chaperone (Vtc4) Ustilago maydis Candida [ 53 , 54 ] * Fungi tested means that fungi listed here are already...”
- Systematic Identification of Anti-Fungal Drug Targets by a Metabolic Network Approach
Kaltdorf, Frontiers in molecular biosciences 2016 - “...large ribosomal subunit protein L16 AFUA_6G12400 261 142 403 10 1,3-beta-glucan synthase catalytic subunit FksP AFUA_3G12320 307 117 424 11 Lipase/serine esterase AFUA_1G06700 220 235 455 12 Metacaspase CasA AFUA_3G14140 220 235 455 12 Metacaspase CasB AFUA_4G13340 261 213 474 13 DUF907 domain protein AFUA_2G17650 261...”
- “...subunit protein L16 * AFUA_6G12400 0.000 0.031 1.568 SUC 6 1,3-beta-glucan synthase catalytic subunit FksP AFUA_3G12320 0.000 0.506 0.837 Lipase/serine esterase AFUA_1G06700 0.000 1.705 0.000 10 Metacaspase CasA AFUA_3G14140 0.367 1.273 1.262 10 Metacaspase CasB AFUA_4G13340 0.000 0.008 1.412 DUF907 domain protein (FlcA) AFUA_2G17650 0.523 2.921...”
C0PF36 DUF676 domain-containing protein from Zea mays
Aligns to 106:256 / 261 (57.9%), covers 59.9% of PF05057, 159.4 bits
TRIREDRAFT_120125 uncharacterized protein from Trichoderma reesei QM6a
3 alignments in 263:586 / 1111 (27.0%), covering up to 62.7% of PF05057, 152.6 bits
AFUA_3G04240 lipase/serine esterase, putative from Aspergillus fumigatus Af293
2 alignments in 239:550 / 917 (30.5%), covering up to 62.7% of PF05057, 151.6 bits
- Conservation of nucleosome positions in duplicated and orthologous gene pairs
Nishida, TheScientificWorldJournal 2012 - “...AFUA_7G04760 0.36169498 YCL038C AFUA_2G06170 0.359699115 YKL113C AFUA_3G06060 0.351986208 YHL020C AFUA_5G09420 0.350312962 YMR224C AFUA_6G11410 0.348946198 YDR444W AFUA_3G04240 0.345942811 YER107C AFUA_1G09020 0.34238252 YDR162C AFUA_2G03680 0.342381673 YNL212W AFUA_3G08750 0.341561675 YNL097C AFUA_3G11940 0.339603963 YKL191W AFUA_6G07100 0.337319743 YPL030W AFUA_6G02570 0.336821966 YNL224C AFUA_3G05330 0.336636223 YKR024C AFUA_5G11050 0.328747023 YPR020W AFUA_1G16280 0.323479927 YPL171C AFUA_2G04060...”
PVX_091435 hypothetical protein, conserved from Plasmodium vivax
Aligns to 584:768 / 2176 (8.5%), covers 96.8% of PF05057, 99.4 bits
- Annotation and characterization of the Plasmodium vivax rhoptry neck protein 4 (PvRON4)
Arévalo-Pinzón, Malaria journal 2013 - “...RT-PCR SuperScript III kit (Invitrogen). Primer design and pvron4 amplification Based on bioinformatics analysis, the PVX_091435 gene ID gene was re-annotated (Figure 1 ) and such information was used to design primers for amplifying pvron4 from gDNA and cDNA. pvron4 G1 5- ATG TCT CGT AAA...”
- “...36 ]. Figure 1 Re-annotation of pvron4 within the PviS_CM000450 contig (above) schematic representation of PVX_091435 from the pvron4 gene in PlasmoDB and annotation suggested after bioinformatics and experimental analysis. The start positions for the ORFs within the contig are shown and the transcription direction. PVX_091435...”
PF3D7_1116100 serine esterase, putative from Plasmodium falciparum 3D7
Aligns to 738:922 / 1830 (10.1%), covers 96.8% of PF05057, 96.7 bits
IQB77_09235 alpha/beta hydrolase from Leptospira interrogans serovar Pomona
Aligns to 82:287 / 369 (55.8%), covers 94.0% of PF05057, 41.6 bits
PF3D7_1116000 rhoptry neck protein 4 from Plasmodium falciparum 3D7
Aligns to 782:869 / 1201 (7.3%), covers 35.9% of PF05057, 41.5 bits
- Human plasma plasminogen internalization route in Plasmodium falciparum-infected erythrocytes
El, Malaria journal 2020 - “...PF3D7_1434300 Hsp70/Hsp90 organizing protein 1 3 3.2 PF3D7_0817700 Rhoptry neck protein 5 0 6 1.0 PF3D7_1116000 Rhoptry neck protein 4 0 4 1.0 PF3D7_1320600 Ras-related protein Rab-11A 0 3 1.0 PF3D7_0807500 Proteasome subunit alpha type-6, putative 0 3 1.0 PF3D7_0302200 Cytoadherence linked asexual protein 3.2 0...”
- “...binding partners identified that are involved in erythrocyte invasion, as Rhoptry neck proteins (PF3D7_0905400, PF3D7_0817700, PF3D7_1116000, PF3D7_1452000) and Glideosome-associated connector (PF3D7_1361800). Regarding protein degradation, some sub-units of the parasites Proteasome complex (PF3D7_0727400, PF3D7_0807500) were also identified. Although further combined studies are necessary to validate these plasminogen...”
- Refining the transcriptome of the human malaria parasite Plasmodium falciparum using amplification-free RNA-seq
Chappell, BMC genomics 2020 - “...through the 3D7 time course for a tail-to-tail gene pair ( Pf3D7_1115900 , DHHC9 and Pf3D7_1116000 , RON4). Despite an overlap of 327nt in the 3 UTRs the steady state level of these genes is strongly correlated, with a spearman correlation of value 0.81. g Correlation...”
- “...of correlation, including the example shown in Fig. 3 f ( Pf3D7_1115900 , DHHC9 and Pf3D7_1116000 , RON4). To rigorously determine if the different classes of adjacent gene pairs are coregulated, we further determined the patterns of correlations between 1000 pairs of head-to-head, tail-to-tail and randomly...”
- Discovery of four new B-cell protective epitopes for malaria using Q beta virus-like particle as platform
Atcheson, NPJ vaccines 2020 - “...PCHAS_1023300 PCHAS_1007200 PCHAS_1467100 Pcy PCYB_031630 PCYB_095300 PCYB_092210 PCYB_133650 Pf 3D7 Q8I2A0 PF3D7_0818600 PF3D7_0812300 PF3D7_0408600 PF3D7_1147800.2 PF3D7_1116000 PF3D7_0911900 PF3D7_1420700 PF3D7_0408700 PF3D7_1252100 Pf IT PFIT_0821500 PFIT_0815200 PFIT_0407200 PFIT_1148400.1 PFIT_1116800 PFIT_0912100 PFIT_1421700 PFIT_0407300 PFIT_1252300 Pg A0A151LWY9 PGSY75_0818600 Pk PKH_051320 PKNH_1428300 PKNH_0306600 PKNH_0945700 PKNH_0913700 PKNH_0709900 PKNH_1337300 PKNH_0306700 PKNH_1472100 Pr A0A060RRJ1...”
- Phosphorylation-Dependent Assembly of a 14-3-3 Mediated Signaling Complex during Red Blood Cell Invasion by Plasmodium falciparum Merozoites
More, mBio 2020 - “...EBA140, PF3D7_1301600), apical merozoite antigen 1 (AMA1), rhoptry neck proteins (RON2, PF3D7_1452000; RON3, PF3D7_1252100; RON4, PF3D7_1116000), and parasite proteins responsible for motility, such as inner membrane complex proteins PfIMC1c (PF3D7_1003600) and PfIMC1g (PF3D7_0525800), GAP45 (PF3D7_1222700), GAP40 (PF3D7_0515700), MyoA (PF3D7_1342600), MyoB (PF3D7_0503600), and MTIP (PF3D7_1246400) ( Fig.1d...”
- Expression and Localization Profiles of Rhoptry Proteins in Plasmodium berghei Sporozoites
Tokunaga, Frontiers in cellular and infection microbiology 2019 - “...PF3D7_1452000 Neck TGME49_300100 Cao et al., 2009 ; Ishino et al., 2019 RON4 PBANKA_0932000 Rhoptry PF3D7_1116000 Neck TGME49_229010 Richard et al., 2010 RON5 PBANKA_0713100 Rhoptry PF3D7_0817700 Neck TGME49_311470 Richard et al., 2010 RON6 PBANKA_0311700 Apical end PF3D7_0214900 Neck TGME49_297960 Proellocks et al., 2009 RALP1 PBANKA_0619700 Rhoptry...”
- Proteomic analysis of exported chaperone/co-chaperone complexes of P. falciparum reveals an array of complex protein-protein interactions
Zhang, Scientific reports 2017 - “...MAL3P1.5, PFC0120w Apical/rhoptry PF3D7_1015200.1/2 cysteinetRNA ligase, putative (CysRS) 2 3,40 0 0,00 2/0 PF10_0149 Apicoplast PF3D7_1116000 rhoptry neck protein 4 (RON4) 2 1,67 0 0,00 2/0 PF11_0168 Rhoptry neck PF3D7_0930300 merozoite surface protein 1 (MSP1) 11 8,37 1 2,85 11,00 PFI1475w Merozoite/ring surface PF3D7_0207600 serine repeat...”
- Widespread occurrence of lysine methylation in Plasmodium falciparum proteins at asexual blood stages
Kaur, Scientific reports 2016 - “...channel protein K6(Dimethyl) HILIC IcnkPNLINYLK PF3D7_1113800 conserved Plasmodium membrane protein, unknown function K4(Methyl) HILIC NPIPSNESQPIISFPNEDDNHAQnEGSInAPSEGEHNNTDNk PF3D7_1116000 rhoptry neck protein 4 (RON4) C-Term(Methyl) IP NTTQTGnkDTnEMDLENYEDTLNSPK PF3D7_1116700 dipeptidyl aminopeptidase 1 (DPAP1) K8(Methyl) HILIC SNYnFEkPFLWLAR PF3D7_1117700 GTP-binding nuclear protein RAN/TC4 (RAN) K7(Trimethyl) HILIC EVFIrELISNSSDAIEk PF3D7_1118200 heat shock protein 90,...”
- Signaling transcript profile of the asexual intraerythrocytic development cycle of Plasmodium falciparum induced by melatonin and cAMP
Lima, Genes & cancer 2016 - “...subunit RPN3, putative (RPN3) UPS 3.3 PF3D7_0313100 MAL3P4.5, PFC0550w ubiquitin-protein ligase, putative (HRD3) UPS 0.4 PF3D7_1116000 PF11_0168, RON4 rhoptry neck protein 4 (RON4) Host cell invasion 0.1 Schizont (cAMP) PF3D7_1458500 PF14_0558 DN spindle assembly abnormal protein 4, putative (SAS4) A replication DNA duplication 5.3 PF3D7_1021800 PF10_0212,...”
- More
FTN_0701 hypothetical protein from Francisella tularensis subsp. novicida U112
Aligns to 1:191 / 215 (88.8%), covers 59.0% of PF05057, 37.2 bits
- Molecular complexity orchestrates modulation of phagosome biogenesis and escape to the cytosol of macrophages by Francisella tularensis
Asare, Environmental microbiology 2010 - “...2 # tnfn1_pw060418p04q176 FTN_0548 conserved hypothetical protein 2 # tnfn1_pw060328p06q164 FTN_0630 hypothetical protein 5 tnfn1_pw060328p05q141 FTN_0701 conserved hypothetical protein 5 tnfn1_pw060418p02q152 FTN_0706 hypothetical membrane protein 3 tnfn1_pw060418p02q175 FTN_0717 conserved hypothetical membrane protein 5 tnfn1_pw060328p06q126 FTN_0732 hypothetical protein 5 tnfn1_pw060323p07q129 FTN_0759 conserved hypothetical protein 2 tnfn1_pw060323p04q134 FTN_0938...”
- Molecular bases of proliferation of Francisella tularensis in arthropod vectors
Asare, Environmental microbiology 2010 - “...2 # tnfn1_pw060418p04q176 FTN_0548 conserved hypothetical protein 2 # tnfn1_pw060328p06q164 FTN_0630 hypothetical protein 5 tnfn1_pw060328p05q141 FTN_0701 conserved hypothetical protein 5 tnfn1_pw060418p02q152 FTN_0706 hypothetical membrane protein 3 tnfn1_pw060418p02q175 FTN_0717 conserved hypothetical membrane protein 5 tnfn1_pw060328p06q126 FTN_0732 hypothetical protein 5 tnfn1_pw060323p07q129 FTN_0759 conserved hypothetical protein 2 tnfn1_pw060323p04q134 FTN_0938...”
ACIAD3547 hypothetical protein; putative enzyme from Acinetobacter sp. ADP1
Aligns to 161:296 / 454 (30.0%), covers 58.1% of PF05057, 35.6 bits
lpg1157 lipase B from Legionella pneumophila subsp. pneumophila str. Philadelphia 1
Aligns to 50:182 / 254 (52.4%), covers 54.8% of PF05057, 34.8 bits
- Assessing the impact, genomics and evolution of type II secretion across a large, medically important genus: the Legionella type II secretion paradigm
White, Microbial genomics 2019 - “...(40 % I, E=210 66 ) [ 25, 113, 124, 131, 147 ] LipB lpw12111 lpg1157 triacylglycerol lipase Supt not required for growth in A549, Ac, Nl, U937, Vv, Wm and murine lung 54 % [ Lentisphaerae ] Victivallis vadensis (36 % I, E=210 40 )...”
- Xanthomonas campestris pv. vesicatoria Secretes Proteases and Xylanases via the Xps Type II Secretion System and Outer Membrane Vesicles
Solé, Journal of bacteriology 2015 - “...X. oryzae pv. oryzae KACC 10331 (94%) T2S substrate Lpg1157 from L. pneumophila T2S substrate Lpg0406 from L. pneumophila (21%) T2S substrate Lpg1962 from L....”
- Comparative and functional genomics of legionella identified eukaryotic like proteins as key players in host-pathogen interactions
Gomez-Valero, Frontiers in microbiology 2011 - “...Phospholipase C lpg0745 lpp0810 lpl0781 lpc2548 lpa01148 lpw08251 llo2076 llb3335 lipA Mono- and triacylglycerol lipase lpg1157 lpp1159 lpl1164 lpc0620 lpa01801 lpw12111 llo2433 llb2928 lipB Triacylglycerol lipase lpg2848 lpp2906 lpl2760 lpc3133 lpa04141 lpw31111 llo0201 llb1671 srnA Type 2 ribonuclease, promotes amebal infection lpg1116 lpp1117 lpl1121 lpc0574 lpa01738...”
- Virulence factors encoded by Legionella longbeachae identified on the basis of the genome sequence analysis of clinical isolate D-4968
Kozak, Journal of bacteriology 2010 - “...lpg2814 lpg2837 lpg2848 lpg1918 lpg0264 lpg2343 lpg0467 lpg0468 lpg1157 lpg0032 Comments Prepilin peptidase required for both the T2SS and type IV pilus...”
lpl1164 hypothetical protein from Legionella pneumophila str. Lens
Aligns to 50:181 / 254 (52.0%), covers 54.8% of PF05057, 34.8 bits
lpp1159 hypothetical protein from Legionella pneumophila str. Paris
Aligns to 50:182 / 254 (52.4%), covers 54.8% of PF05057, 34.0 bits
BTH_II0639 lipase from Burkholderia thailandensis E264
Aligns to 51:181 / 364 (36.0%), covers 56.7% of PF05057, 33.0 bits
GB|BAA00960.1 triacylglycerol lipase; EC 3.1.1.3 from Pseudomonas sp. KWI-56 (see paper)
Aligns to 53:174 / 364 (33.5%), covers 55.8% of PF05057, 32.4 bits
LIP3 / AAA95966.1 lipase-esterase from Mycoplasma mycoides (see paper)
Aligns to 15:216 / 269 (75.1%), covers 79.3% of PF05057, 32.2 bits
LIP_PSEPS / P0DUB9 Triacylglycerol lipase; Extracellular lipase; Triacylglycerol ester hydrolase; EC 3.1.1.3 from Pseudarthrobacter phenanthrenivorans (Arthrobacter phenanthrenivorans) (see 2 papers)
Aligns to 9:130 / 319 (38.2%), covers 56.2% of PF05057, 32.1 bits
- function: Catalyzes the hydrolysis of triacylglycerol.
catalytic activity: a triacylglycerol + H2O = a diacylglycerol + a fatty acid + H(+) (RHEA:12044)
cofactor: Ca(2+) (Binds 1 Ca(2+) ion per subunit. {ECO:0000269|PubMed:8683577, ECO:0000305|Ref.)3}
subunit: Monomer (Probable). Interacts with lipase-specific foldase Lif (By similarity).
IV454_31865 hypothetical protein from Massilia antarctica
Aligns to 30:143 / 215 (53.0%), covers 56.2% of PF05057, 32.1 bits
1tahB / P0DUB8 The crystal structure of triacylglycerol lipase from pseudomonas glumae reveals a partially redundant catalytic aspartate (see paper)
Aligns to 8:129 / 318 (38.4%), covers 56.2% of PF05057, 32.1 bits
- Ligand: calcium ion (1tahB)
LIP_BURPL / P0DUB8 Triacylglycerol lipase; Extracellular lipase; Triacylglycerol ester hydrolase; EC 3.1.1.3 from Burkholderia plantarii (see 6 papers)
lipA / GB|CAA49812.1 Triacylglycerol lipase; EC 3.1.1.3 from Burkholderia glumae (see 4 papers)
Aligns to 48:168 / 358 (33.8%), covers 56.2% of PF05057, 31.8 bits
- function: Catalyzes the hydrolysis of triacylglycerol.
catalytic activity: a triacylglycerol + H2O = a diacylglycerol + a fatty acid + H(+) (RHEA:12044)
cofactor: Ca(2+) (Binds 1 Ca(2+) ion per subunit.)
subunit: Monomer (Probable). Interacts with lipase-specific foldase Lif (PubMed:16518399).
disruption phenotype: Loss of extracellular active lipase. Not required for growth on oleic acid as a carbon source.
BPSS1741 Lipase precursor from Burkholderia pseudomallei K96243
Aligns to 52:215 / 364 (45.1%), covers 56.7% of PF05057, 31.5 bits
- Global transcriptional analysis of Burkholderia pseudomallei high and low biofilm producers reveals insights into biofilm production and virulence
Chin, BMC genomics 2015 - “...BPSS0486, BPSS0712, BPSS1285 and BPSS2328 ), seven phospholipases and lipase-related genes ( BPSL1064, BPSS0016, BPSS1740, BPSS1741, BPSS1937, BPSS2279 and BPSS2319 ) as well as seven cell envelope biogenesis-related genes ( BPSL0607, BPSL1872, BPSL3094, BPSL3312, BPSS1840, BPSS1932 and BPSS2016 ) were up-regulated in the high biofilm producer...”
ABTJ_00119, ABZJ_03752 alpha/beta fold hydrolase from Acinetobacter baumannii MDR-TJ
Aligns to 153:284 / 447 (29.5%), covers 58.1% of PF05057, 31.5 bits
- Colistin Resistance in Acinetobacter baumannii MDR-ZJ06 Revealed by a Multiomics Approach
Hua, Frontiers in cellular and infection microbiology 2017 - “...heat shock protein 2.180889 13.35847 1.03E-25 5.06E-24 ABZJ_01180 putative phage-like protein 2.066152 3.22126 4.47E-06 3.56E-05 ABZJ_03752 PGAP1-like protein 2.014551 10.16569 2.49E-27 1.49E-25 ABZJ_00060 Thiol-disulfide isomerase and thioredoxin 1.894318 12.3252 7.68E-20 2.75E-18 ABZJ_00894 lactoylglutathione lyase-like protein 1.797874 6.779815 5.27E-15 1.62E-13 ABZJ_00054 N-alpha-acetylglutamate synthase (amino-acid acetyltransferase) 1.77044 10.25589...”
- Complete sequence of pABTJ2, a plasmid from Acinetobacter baumannii MDR-TJ, carrying many phage-like elements
Huang, Genomics, proteomics & bioinformatics 2014 - “...tail 108 31.25 ABTJ_00117 Phage minor tail 231 46.81 ABTJ_00118 Cell wall-associated hydrolases 249 36.80 ABTJ_00119 Phage tail component 192 34.83 ABTJ_00120 Phage tail component 3727 18.27 ABTJ_00126 Phage-related lysozyme 212 42.40 Note: Length of protein is indicated by number of amino acid residues comprised; amino...”
A1S_3361 hypothetical protein from Acinetobacter baumannii ATCC 17978
Aligns to 153:284 / 447 (29.5%), covers 58.1% of PF05057, 31.5 bits
7cofA / A0A1Y1BQV9 Cholesterol esterase from burkholderia stabilis (orthorhombic crystal form)
Aligns to 9:138 / 320 (40.6%), covers 56.2% of PF05057, 31.3 bits
- Ligand: calcium ion (7cofA)
Ngar_c32780 alpha/beta hydrolase from Candidatus Nitrososphaera gargensis Ga9.2
Aligns to 26:132 / 287 (37.3%), covers 43.3% of PF05057, 30.7 bits
- The Thaumarchaeon N. gargensis carries functional bioABD genes and has a promiscuous E. coli ΔbioH-complementing esterase EstN1
Chow, Scientific reports 2018 - “...( i . e . estN1 ), Ngar_c30910 ( i . e . estN2 ), Ngar_c32780 and Ngar_c35080, which could possibly encode a BioH analogue, were amplified with specific primers, cloned into pDrive (PCR Cloning Kit, Qiagen, Hilden, Germany) and transformed into competent E . coli...”
- “...[Ngar_c14400 ( i . e . EstN1), Ngar_c30910 ( i . e . EstN2) and Ngar_c32780; e-values between 4.2e 41 and 2.0e 20 ]. Hydrolytic activity of carboxylesterases from N . gargensis after expression in E . coli The six different putative /-hydrolase genes Ngar_c21820, Ngar_c24650,...”
RBAM_037130 hypothetical protein from Bacillus amyloliquefaciens FZB42
Aligns to 10:164 / 416 (37.3%), covers 59.0% of PF05057, 30.6 bits
PPT2_DROME / Q9VKH6 Lysosomal thioesterase PPT2 homolog; PPT-2; EC 3.1.2.- from Drosophila melanogaster (Fruit fly) (see paper)
NP_609500 Palmitoyl-protein thioesterase 2 from Drosophila melanogaster
Aligns to 22:199 / 288 (61.8%), covers 57.6% of PF05057, 30.0 bits
CBG20335 Protein CBG20335 from Caenorhabditis briggsae
Aligns to 44:174 / 299 (43.8%), covers 41.9% of PF05057, 30.0 bits
Q75NT4 sterol esterase (EC 3.1.1.13) from Burkholderia cepacia (see paper)
Aligns to 53:174 / 364 (33.5%), covers 56.2% of PF05057, 29.5 bits
- Efficient Preparation of High-Purity Fucoxanthinol by SpyTag-Tailored Active Cholesterol Esterase Aggregates.
Jin, Marine drugs 2022 - “...90.79%. 2.3. Preparation of Active Cholesterol Esterase Aggregates by SpyTag Tailoring We designed cholesterol esterase (Q75NT4) containing SpyTag. The fusion gene Pet-Q75NT4-SpyTag was transformed and induced, and SpyTag was terminally fused to Q75NT4. Figure 3 shows the diagrammatic sketch of the Pet-Q75NT4-SpyTag chimera design. Pet-Q75NT4-SpyTag was...”
- “...hydrolysis of cholesterol oleate ester and had cholesterol esterase activity, indicating that the target enzyme Q75NT4 was expressed in the form of active cholesterol esterase aggregates in Escherichia coli . Induction conditions were optimized on the basis of the yield of active cholesterol esterase aggregates. As...”
BCAM0949 exported lipase LipA from Burkholderia cenocepacia J2315
I35_RS20825 triacylglycerol lipase from Burkholderia cenocepacia H111
Aligns to 53:173 / 364 (33.2%), covers 55.8% of PF05057, 29.1 bits
- Identification by Reverse Vaccinology of Three Virulence Factors in Burkholderia cenocepacia That May Represent Ideal Vaccine Antigens
Irudal, Vaccines 2023 - “...24 proteins. The localization and different aspects of virulence were investigated for three of themBCAL1524, BCAM0949, and BCAS0335. The three antigens were localized in the outer membrane vesicles confirming that they are surface exposed. We showed that BCAL1524, a collagen-like protein, promotes bacteria auto-aggregation and plays...”
- “...was obtained by growth in LB medium. To complement each deleted strain, BCAL1524 (1674 bp), BCAM0949 (1099 bp) and BCAS0335 (3595 bp) genes were amplified using B. cenocepacia K56-2 DNA as template and the primers pairs are listed in Table S3 . Fragments were cloned into...”
- Various Evolutionary Trajectories Lead to Loss of the Tobramycin-Potentiating Activity of the Quorum-Sensing Inhibitor Baicalin Hydrate in Burkholderia cenocepacia Biofilms
Sass, Antimicrobial agents and chemotherapy 2019 - “...same location (e.g., changes in BCAL1315, BCAL1664, and BCAM0949); we speculate that these mutations were already present in the starting population at low...”
- “...chemotaxis protein SNP in CDS (907087 G to T, A369C) 52 BCAM0949 Exported lipase LipA SNP in CDS (1051105 C to G, S180W) 47 100 100 100 100 100 100 100 100...”
- Phenotypic and genotypic characterisation of Burkholderia cenocepacia J2315 mutants affected in homoserine lactone and diffusible signal factor-based quorum sensing systems suggests interplay between both types of systems
Udine, PloS one 2013 - “...measured the expression of cepI (BCAM1870), cepR (BCAM1868), cciI (BCAM0239a), cciR (BCAM0240), zmpA (BCAS0409), lipA (BCAM0949), lipB (BCAM0950) and orbI (BCAL1696) by qPCR. Gene expression was measured in planktonic cells in the presence or absence of added signalling molecules. Although no difference in cepR gene expression...”
- Differential modulation of Burkholderia cenocepacia virulence and energy metabolism by the quorum-sensing signal BDSF and its synthase
Deng, Journal of bacteriology 2009 - “...zmpA (Bcas0409) encoding a metalloprotease (8, 20), lipA (Bcam0949) and lipB (Bcam0950) encoding a lipase and a lipase chaperone (14), respectively, and the...”
- “...increased the transcript levels of zmpA (Bcas0409), lipA (Bcam0949), lipB (Bcam0950), and orbI (Bcal1696) (Fig. 4A). We then tested whether BDSF can further...”
- Reciprocal regulation by the CepIR and CciIR quorum sensing systems in Burkholderia cenocepacia
O'Grady, BMC genomics 2009 - “...CciI NC 52.1 NC BCAM0240 N -acylhomoserine lactone dependent regulatory protein CciR NC 4.0 -23.5 BCAM0949 Exported lipase LipA -3.1 NC NC BCAM0950 Lipase chaperone LipB -2.5 NC NC BCAM1869 Conserved hypothetical protein -5.9 NC NC BCAM1871 Conserved hypothetical protein -37.6 NC -20.2 BCAM2307 Zinc metalloprotease...”
- “...medium and phase of growth influence regulation by CciR. Genes encoding the exported lipase LipA (BCAM0949) and the lipase chaperone LipB (BCAM0950, previously called limA ) are required for lipase production [ 32 ]. Expression of both lipA and lipB was decreased in the cepR mutant...”
- Transcriptional Response of Burkholderia cenocepacia H111 to Severe Zinc Starvation
Barnett, British journal of biomedical science 2023 - “...I35_RS10860 Imidazolonepropionase 2.326828435 0.022280782 I35_RS06165 Phenol degradation protein 2.320499563 2.27E28 I35_RS22340 Hypothetical protein 2.300982216 0.00000167 I35_RS20825 Alpha/beta hydrolase 2.246852811 0.035832439 I35_RS13380 ABC transporter permease 2.238628283 5.97E30 I35_RS10865 Hypothetical protein 2.099694274 0.022469745 I35_RS16595 DNA-binding protein 2.091617711 0.000362322 I35_RS29435 Hypothetical protein 2.072176035 0.022280782 I35_RS27035 2,2-Dialkylglycine decarboxylase 2.047152459 0.00024177...”
Q6GNY7 Lysosomal thioesterase PPT2-B from Xenopus laevis
Aligns to 19:157 / 288 (48.3%), covers 61.8% of PF05057, 28.4 bits
- Transcriptome analysis of genes and pathways associated with metabolism in Scylla paramamosain under different light intensities during indoor overwintering.
Li, BMC genomics 2020 - “...(ko00071). Lysosomal thioesterase PPT2 (ID: O70489; LL: 3.47-fold, HL: 3.12-fold) and lysosomal thioesterase PPT2-B (ID: Q6GNY7; LL: 1.97-fold, HL: 3.00-fold) were up-regulated in both the LL and HL groups. In the LL group, fatty aldehyde dehydrogenase (ID: P47740) was the most down-regulated gene (0.31-fold), followed by...”
- “...Fatty acid elongation (ko00062) Lysosomal thioesterase PPT2 O70489 3.4756 0.0236 3.1206 0.0462 Lysosomal thioesterase PPT2-B Q6GNY7 1.9706 0.0252 3.0013 1.27E-05 3-ketoacyl-CoA thiolase Q3T0R7 0.4633 0.0070 0.4285 0.0006 Hydroxyacyl-coenzyme A dehydrogenase Q16836 0.4400 0.0349 0.3574 0.0132 Fatty acid degradation (ko00071) Short/branched chain specific acyl-CoA dehydrogenase, mitochondrial P45954...”
- Isolation of a thioesterase gene from the metagenome of a mountain peak, Apharwat, in the northwestern Himalayas.
Sudan, 3 Biotech 2013 - “...Thermomyces lanuginosus (gi. CAB58509.1), yersiniabactin thioesterase PHOAA (B6VKU7), palmitoyl protein thioesterase 1(P454782) and lysosomal thioesterase (Q6GNY7). Multiple alignments with ClustalW software, of known lipases and thioesterases (taken from uniprot) with Aph4 indicated that the nucleophilic serine in the active site was conserved in thioesterase under study...”
- “...P-SSM-2 (gi.Yp_214431.1), lipase Thermomyces lanuginosus (gi.CAB58509.1), thioesterase component of yersiniabactin synthetase gene (B6VKU7), lysosomal thioesterase (Q6GNY7) and palmitoyl protein thioesterase (P45478). b Phylogenetic tree of Aph4, known lipases and known thioesterase that have same GXSXG motif generated by using Mega5 software Liaw et al. (2010) analysed...”
LIP_BURCE / P22088 Triacylglycerol lipase; Extracellular lipase; Triacylglycerol ester hydrolase; EC 3.1.1.3 from Burkholderia cepacia (Pseudomonas cepacia) (see 8 papers)
lipA / GI|557867 triacylglycerol lipase; EC 3.1.1.3 from Burkholderia cepacia (see 5 papers)
Aligns to 53:173 / 364 (33.2%), covers 55.8% of PF05057, 28.1 bits
- function: Catalyzes the hydrolysis of triacylglycerol. It shows a preference for triacylglycerols with a chain length between 6 and 12 carbons.
catalytic activity: a triacylglycerol + H2O = a diacylglycerol + a fatty acid + H(+) (RHEA:12044)
cofactor: Ca(2+) (Binds 1 Ca(2+) ion per subunit.)
subunit: Monomer. - A Novel Lipase from Streptomyces exfoliatus DSMZ 41693 for Biotechnological Applications
Rodríguez-Alonso, International journal of molecular sciences 2023 - “...tool of the BioEdit program and the amino acid sequence of Burkholderia cepacia lipase (UniProt P22088) as reference. Hypothetical genes encoding lipases from S. exfoliatus DSMZ 41693, including their signal peptide coding sequence ( lipA , lipB , lipC , and lipD ), were amplified by...”
- Comparative Structural Analysis of Different Mycobacteriophage-Derived Mycolylarabinogalactan Esterases (Lysin B).
Korany, Biomolecules 2019 - “...pancreatic lipase HuPL 1LPB P16233 8.6 2.8 147 465 15 Pseudomonas cepacia lipase PCL 1YS1 P22088 9.1 3.1 143 364 16 Candida rugosa lipase CRL 1Lpo P20261 7.3 3.4 100 549 12 1 Length according to UniprotKB. Note: Crystal structures were retrieved from Dali server. biomolecules-10-00045-t002_Table...”
WP_011162057 alpha/beta hydrolase from Lactobacillus johnsonii NCC 533
LJ1228 hypothetical protein from Lactobacillus johnsonii NCC 533
Aligns to 21:140 / 248 (48.4%), covers 45.6% of PF05057, 27.9 bits
- Conversion of (poly)phenolic compounds in food fermentations by lactic acid bacteria: Novel insights into metabolic pathways and functional metabolites
Gaur, Current research in food science 2023 - “...acid, ethyl ferulate, rosmarinic acid L. johnsonii N6.2 ( Lai et al., 2009 ) Lj1228; WP_011162057 Chlorogenic acid, ethyl ferulate, rosmarinic acid HceP; WP_011101978 Chlorogenic acid, methyl ferulate Lp. plantarum TMW1.460 ( Gaur, 2022 , Gaur et al., in press ) Lp_0796; YP_004888771 Methyl ferulate, methyl...”
- Characterization of isogenic mutants with single or double deletions of four phenolic acid esterases in Lactiplantibacillus plantarum TMW1.460
Gaur, International journal of food microbiology 2023 (PubMed)- “...TanA, Lp_0796, Est_1092 and a homolog of Lj0536 and Lj1228 that was termed HceP. To determine which of the phenolic acid esterases present in Lp plantarum...”
- “...2009 ; Iwamoto et al., 2008 ) Lj0536, Lj1228 WP_004898050.1, WP_011162057.1 Chlorogenic acid, ethyl ferulate, rosmarinic acid GB998_RS11900 53 249 (Lai et al.,...”
- Conversion of (poly)phenolic compounds in food fermentations by lactic acid bacteria: Novel insights into metabolic pathways and functional metabolites
Gaur, Current research in food science 2023 - “...Chlorogenic acid, ethyl ferulate, rosmarinic acid L. johnsonii N6.2 ( Lai et al., 2009 ) Lj1228; WP_011162057 Chlorogenic acid, ethyl ferulate, rosmarinic acid HceP; WP_011101978 Chlorogenic acid, methyl ferulate Lp. plantarum TMW1.460 ( Gaur, 2022 , Gaur et al., in press ) Lp_0796; YP_004888771 Methyl ferulate,...”
- New Insights Into Cinnamoyl Esterase Activity of Oenococcus oeni
Collombel, Frontiers in microbiology 2019 - “...p -coumarate faeC https://www.ncbi.nlm.nih.gov/nuccore/AJ505939 Crepin et al., 2003 Lactobacillus johnsonii NCC 533 Ferulic acid esterases Lj1228 and Lj0536 31 Ethyl ferulate, chlorogenic acid ND https://www.ncbi.nlm.nih. gov/nuccore/GU454587.1 https://www.ncbi.nlm.nih. gov/nuccore/GU454586.1 Lai et al., 2009 Lactobacillus jonhsonii DPC6026 Cinnamoyl esterase LJP-0936 ND ND ND https://www.ncbi.nlm. nih.gov/protein/329667314 Guinane et al.,...”
- Characterization of Feruloyl Esterases Produced by the Four Lactobacillus Species: L. amylovorus, L. acidophilus, L. farciminis and L. fermentum, Isolated from Ensiled Corn Stover
Xu, Frontiers in microbiology 2017 - “...et al., 2013 ), Est-1092 from L. plantarum DSM1055 ( Esteban-Torres et al., 2015 ), Lj1228 and Lj0536 from L. johnsonii N6.2 ( Lai et al., 2009 ). FaeC, a FAE from Aspergillus niger N402, was used as an outgroup ( Dilokpimol et al., 2017 )....”
- “...FaeLfa and Lj0536 grouped into the same cluster. Others contained the proteins of FaeLfe and Lj1228. These proteins have distant phylogenetic relationships with Est-1092 and Lp-0796, the FAEs derived from the two L. plantarum strains. FIGURE 3 Phylogenetic tree based on amino acid sequences of FaeLam,...”
- Novel Feruloyl Esterase from Lactobacillus fermentum NRRL B-1932 and Analysis of the Recombinant Enzyme Produced in Escherichia coli
Liu, Applied and environmental microbiology 2016 - “...NRRL B-1932 (Table 3). Two FE genes, Lj0536 and Lj1228 from L. johnsoni encoding two cinnamoyl esterases (both around 31 kDa), shared 42% sequence identity...”
- “...substrate, the specific activities of Lj0536 (17.2 mU/mg) and Lj1228 (1.11 mU/mg) appeared much lower than those of the crude LfFE (45.89 0.48 mU/mg) (Table 3...”
- Three feruloyl esterases in Cellulosilyticum ruminicola H1 act synergistically to hydrolyze esterified polysaccharides
Li, Applied and environmental microbiology 2011 - “...Butyrivibrio fibrisolvens (9, 10); Lj0536 and Lj1228, cinnamoyl esterases from Lactobacillus johnsonii (31); TtFAE, feruloyl esterase from Thermoanaerobacter...”
- Biochemical properties of two cinnamoyl esterases purified from a Lactobacillus johnsonii strain isolated from stool samples of diabetes-resistant rats
Lai, Applied and environmental microbiology 2009 - “...biochemical parameters of the purified enzymes Lj0536 and Lj1228. The assays were conducted at the optimal conditions (pH and temperature) determined for each...”
- “...HEPES buffer (pH 7.8) at 25C, and the assays with Lj1228 were performed using 20 mM MES (morpholineethanesulfonic acid) buffer (pH 6.7) at 30C. The effect of pH...”
MRET_3765 triacylglycerol lipase from Malassezia restricta
Aligns to 118:239 / 558 (21.9%), covers 30.4% of PF05057, 27.8 bits
- Skin Commensal Fungus Malassezia and Its Lipases
Park, Journal of microbiology and biotechnology 2021 - “...12 , 71 ] MRET_4144 [ 12 , 71 ] Putative serine esterase, Lipase-like (PF05057) MRET_3765 [ 12 , 71 ] GDSL-like Lipase/Acylhydrolase (PF00657) MRET_3994 O [ 12 , 71 ] M. globosa CBS 7966 Class 3 (PF01764) MGL_0279 [ 11 ] MGL_0797 ( MgLIP1 )...”
LIC_12988 alpha/beta fold hydrolase from Leptospira interrogans
LIC12988 lipase from Leptospira interrogans serovar Copenhageni str. Fiocruz L1-130
Aligns to 85:197 / 306 (36.9%), covers 35.5% of PF05057, 27.4 bits
EHI_020250 lecithin:cholesterol acyltransferase domain-containing protein from Entamoeba histolytica HM-1:IMSS
Aligns to 160:300 / 399 (35.3%), covers 36.9% of PF05057, 27.3 bits
- Lipids in Entamoeba histolytica: Host-Dependence and Virulence Factors
Castellanos-Castro, Frontiers in cellular and infection microbiology 2020 - “...metabolism. Name Entry EC Lecithin-cholesterol acyltransferase EHI_031360 EHI_136400 2.3.1.43 Lysophospholipid acyltransferase EHI_086180 2.3.1.51 Lysophospholipase III EHI_020250 3.1.1.5 Glycerophosphoryl diester phosphodiesterase EHI_059880 EHI_113970 EHI_068320 EHI_199860 3.1.4.46 Phosphatidylethanolamine/phosphatidyl-N-methylethanolamine N-methyltransferase EHI_153710 2.1.1.71 Diacylglycerol diphosphate phosphatase/phosphatidate phosphatase EHI_165320 3.1.3.4 Diacylglycerol acyltransferase EHI_099180 2.3.1.158 Phospholipase D1/2 EHI_082560 EHI_146550 EHI_146400 3.1.4.4 Diacylglycerol...”
- “...enzymes related to AT, TA, and other phospholipases such as: lysophospholipid acyltransferase (EHI_086180), lysophospholipase III (EHI_020250), glycerophosphoryl diester phosphodiesterase (EHI_059880), phospholipase D1/2 (EHI_082560), phospholipid: diacylglycerol acyltransferase (EHI_099180) ( Table 3 ). Recycling of Glycerophospholipids in Host-Parasite Interactions Giardia is not able to de novo synthesize phospholipids,...”
- Overexpression of Differentially Expressed Genes Identified in Non-pathogenic and Pathogenic Entamoeba histolytica Clones Allow Identification of New Pathogenicity Factors Involved in Amoebic Liver Abscess Formation
Meyer, PLoS pathogens 2016 (no snippet) - Phenotypic and transcriptional profiling in Entamoeba histolytica reveal costs to fitness and adaptive responses associated with metronidazole resistance
Penuliar, Frontiers in microbiology 2015 - “...enzyme, therefore, may contribute to the decreased growth rate. The repression of lecithin: cholesterol acyltransferase (EHI_020250) may also be associated with decreased growth rate, because the enzyme is crucial in the maturation, remodeling, and metabolism of high density lipoprotein, HDL (Calabresi et al., 2011 ). BspA1...”
- Identification of the virulence landscape essential for Entamoeba histolytica invasion of the human colon
Thibeaux, PLoS pathogens 2013 - “...EHI_045710 AP-2 complex protein 2,14 1,90E-06 Oxidoreduction activities EHI_026480 (2r)-phospho-3-sulfolactate synthase 2,41 3,10E-13 Lipid metabolism EHI_020250 lecithin:cholesterol acyltransferase 2,5 1,90E-17 EHI_111000 fatty acid elongase 2,1 5,10E-11 EHI_127830 long-chain-fatty-acidCoA ligase 2,1 4,90E-19 EHI_080220 Niemann-Pick C1 protein 2,16 1,30E-12 EHI_152280 serine palmitoyltransferase 2,02 9,60E-10 Other metabolism EHI_159710 alanine...”
MGG_00773 triacylglycerol lipase from Pyricularia oryzae 70-15
Aligns to 142:311 / 367 (46.3%), covers 35.5% of PF05057, 27.1 bits
- Dysfunctional Pro1 leads to female sterility in rice blast fungi
Uchida, iScience 2023 - “...examine whether the DNA sequences were consistent with the phenotype. SNPs within MGG_00779, MGG_00693, and MGG_00773 genes were selected as targets for genotyping because these genes were close to the FS1L, FS1C, and FS1R loci, respectively ( Figures2 A and 2B). Among 37 F 4 progenies,...”
HMPREF0675_4479 alpha/beta fold hydrolase from Cutibacterium acnes SK137
Aligns to 71:179 / 180 (60.6%), covers 41.5% of PF05057, 27.0 bits
MGL_4063 uncharacterized protein from Malassezia globosa CBS 7966
Aligns to 53:167 / 544 (21.1%), covers 27.2% of PF05057, 27.0 bits
- Skin Commensal Fungus Malassezia and Its Lipases
Park, Journal of microbiology and biotechnology 2021 - “...region (PF04083) MGL_1975 [ 11 ] MGL_2531 [ 11 ] Putative serine esterase, Lipase-like (PF05057) MGL_4063 [ 11 ] GDSL-like Lipase/Acylhydrolase (PF00657) MGL_1366 O [ 11 ] M. sympodialis ATCC 42132 Class 3 (PF01764) MSYG_1326 O [ 81 ] MSYG_2002 [ 81 ] MSYG_2462 O [...”
AT4G19860 lecithin:cholesterol acyltransferase family protein / LACT family protein from Arabidopsis thaliana
Aligns to 133:254 / 535 (22.8%), covers 38.2% of PF05057, 26.7 bits
- Interspecific Variation in the Unsaturation Level of Seed Oils Were Associated With the Expression Pattern Shifts of Duplicated Desaturase Genes and the Potential Role of Other Regulatory Genes
Wang, Frontiers in plant science 2020 - “...PDAT transcripts homologous to Arabidopsis PDAT1 (At5g13640), PDAT2 (At3g44830), and the PDAT - related gene (At4g19860) respectively, were identified in both P. ostii and P. ludlowii . The expression level of PoPDAT2 in mature seeds was much higher than that of PlPDAT2 . PDAT1 was clearly...”
- The dynamic response of the Arabidopsis root metabolome to auxin and ethylene is not predicted by changes in the transcriptome
Hildreth, Scientific reports 2020 - “...0.15 NPC4, NPC5* AT3G03540 AT3G03530 259221_s_at 0.27 0.13 0.28 0.16 0.07 0.25 0.83 0.10 LCAT4 AT4G19860 254547_at 0.04 0.30 0.11 0.28 0.69 0.17 0.12 0.10 PLA2-ALPHA AT2G06925 266500_at 0.12 0.16 0.00 0.15 0.15 0.63 1.02 0.66 PLA-IBETA2 AT4G16820 245447_at 0.03 0.64 0.06 0.43 1.01 0.88 0.59...”
- Association mapping of seed oil and protein content in Sesamum indicum L. using SSR markers
Li, PloS one 2014 - “...sf00044.12 At3G20320 Acid-Binding Protein [46] family member 15 sf00044.41 At2G25170 Chromatin remodeling factor [47] sf00044.61 At4G19860 Acyl acceptor Acyltransferase sf00044.90 At1G13210 Translocase sf00044.113 At1G74320 Choline Kinase [48] Note: a Related genes are the genes containing or close to the screened markers. b Nearby lipid genes refer...”
- Identification and characterization of an LCAT-like Arabidopsis thaliana gene encoding a novel phospholipase A
Chen, FEBS letters 2012 (PubMed)- “...Arabidopsis lecithin:cholesterol acyltransferase (LCAT) family gene (At4g19860) was functionally expressed in yeast, where it was demonstrated to encode...”
- “...2.6 Fatty acid analysis 3 Results 3.1 At4g19860 encodes a cytosolic, acidic pH optimal and calcium-independent PLA preferentially hydrolyzing sn -2-oleoyl-PC...”
- Comparative deep transcriptional profiling of four developing oilseeds
Troncoso-Ponce, The Plant journal : for cell and molecular biology 2011 - “...in the same biochemical pathway. Expressed sequence tags for orthologs of another uncharacterized PDAT-related gene (At4g19860) were present at similar or higher levels than LPCAT in the other oilseeds, suggesting that further study of a possible role in TAG biosynthesis may be useful ( Table S1a...”
WP_015677081 lactonizing lipase from Leptospira yanagawae serovar Saopaulo str. Sao Paulo = ATCC 700523
Aligns to 31:189 / 370 (43.0%), covers 38.2% of PF05057, 26.7 bits
- AMWEst, a new thermostable and detergent-tolerant esterase retrieved from the Albian aquifer
Adjeroud, Applied microbiology and biotechnology 2024 - “...that AMWEst showed moderate similarity (50%) to several lipolytic enzymes including the lactonizing lipase (GenBank: WP_015677081) from Leptospira yanagawae (identity 49%), the triacylglycerol lipase (GenBank: WP_020775775) from Leptospira meyeri (identity 49%), the lactonizing lipase (GenBank: EYF06121) from Chondromyces apiculatus DSM 436 (identity 49%), and the triacylglycerol...”
TGL2_YEAST / P54857 Triacylglycerol lipase 2; Lipase 2; Neutral lipid hydrolase; EC 3.1.1.3 from Saccharomyces cerevisiae (strain ATCC 204508 / S288c) (Baker's yeast) (see 4 papers)
NP_010343 triglyceride lipase from Saccharomyces cerevisiae S288C
NP_010343, YDR058C Protein with lipolytic activity towards triacylglycerols and diacylglycerols when expressed in E. coli; role in yeast lipid degradation is unclear from Saccharomyces cerevisiae
Aligns to 106:219 / 326 (35.0%), covers 38.7% of PF05057, 26.6 bits
- function: Mitochondrial triacylglycerol (TAG) lipase with activity toward long-chain diacylglycerols (DAGs) and triacylglycerols (TAGs) (PubMed:9544243, PubMed:19959834). Involved in mitochondrial lipid metabolism (PubMed:31483742).
catalytic activity: a triacylglycerol + H2O = a diacylglycerol + a fatty acid + H(+) (RHEA:12044)
catalytic activity: 1,2,3-tri-(9Z-octadecenoyl)-glycerol + H2O = (9Z)- octadecenoate + di-(9Z)-octadecenoylglycerol + H(+) (RHEA:38575)
catalytic activity: 1,2,3-tributanoylglycerol + H2O = butanoate + dibutanoylglycerol + H(+) (RHEA:40475)
catalytic activity: 1,2,3-trioctanoylglycerol + H2O = dioctanoylglycerol + H(+) + octanoate (RHEA:47864)
catalytic activity: di-(9Z)-octadecenoylglycerol + H2O = (9Z)-octadecenoate + (9Z- octadecenoyl)-glycerol + H(+) (RHEA:47868)
catalytic activity: dioctanoylglycerol + H2O = H(+) + octanoate + octanoylglycerol (RHEA:47880)
subunit: Interacts with MIA40; forms mixed disulfide intermediates with MIA40. - The mitochondrial intermembrane space-facing proteins Mcp2 and Tgl2 are involved in yeast lipid metabolism.
Odendall, Molecular biology of the cell 2019 - GeneRIF: Data show that mitochondrial protein MCP2 (MCP2) has a negative genetic interaction with the gene triglyceride lipase TGL2 (TGL2) encoding a neutral lipid hydrolase.
- The TGL2 gene of Saccharomyces cerevisiae encodes an active acylglycerol lipase located in the mitochondria.
Ham, The Journal of biological chemistry 2010 - GeneRIF: mitochondrial Tgl2p-dependent lipolysis is crucial for the survival of cells under antimitotic drug treatment
- High-throughput biochemical fingerprinting of Saccharomyces cerevisiae by Fourier transform infrared spectroscopy
Kohler, PloS one 2015 - “...RSB1 44 WT WT BY4743 5 YOR100C CRC1 45 YJR019C TES1 6 YOR171C LCB4 46 YDR058C TGL2 7 YOR196C LIP5 47 1 YJL196C ELO1 8 YOR245C DGA1 48 1 , 2 YKR053C YSR3 9 YOR377W ATF1 49 1 YCR048W ARE1 10 1 , 2 YOL002C IZH2...”
- “...GC. ORF Gene sample # YHR067W HTD2 1 a , b WT WT BY4743 4 YDR058C TGL2 7 YKR067W GPT2 12 YLR450W HMG2 13 YJR073C OPI3 19 a , b YJR103W URA8 20 YKL140W TGL1 22 YLL012W YEH1 24 YML008C ERG6 31 a , b YMR205C...”
- Identification of genes affecting vacuole membrane fragmentation in Saccharomyces cerevisiae
Michaillat, PloS one 2013 - “...1.8 YOL011W PLB3 Phospholipase B 1.5 YOR081C TGL5 Triacylglycerol lipase preferring VLCFAs; acyltransferase activity 1.8 YDR058C TGL2 Acylglycerol lipase 1.5 YIL040W APQ12 Unknown; mutant accumulates triglycerides 2.0 YOR084W LPX1 Putative lipase 1.5 YDR503C LPP1 Lipid phosphate phosphatase 1.0 YDL052C SLC1 Lyso-PA acyl transferase 1.3 YNR008W LRO1...”
- Gene cloning and characterization of a novel esterase from activated sludge metagenome
Zhang, Microbial cell factories 2009 - “...the putative lipase/esterase from Magnaporthe grisea 70-15 and Saccharomyces cerevisiase Tg12p (XP_368471, 31% identity; and NP_010343, 29% identity, respectively), members of the family of fungal hydrolases. And also, the EstAS contained a catalytic triad (Ser92, His125, and Asp249) and a LHYFRG conserved motif (starting from His36),...”
- “...Server http://www.ch.embnet.org/software/BOX_form.html . XP_504639, esterase/lipase from Yarrowia lipolytica CLIB122; XP_368471, LipA from Magnaporthe grisea 70-15; NP_010343, esterase/lipase from Saccharomyces cerevisiae Tg12p; ZP_02733109, lipase from Gemmata obscuriglobus UQM 2246. Figure 2 Phylogenetic analysis of EstAS and closely related proteins . Phylogenetic analysis was performed using the program...”
- The yeast protein kinase C cell integrity pathway mediates tolerance to the antifungal drug caspofungin through activation of Slt2p mitogen-activated protein kinase signaling
Reinoso-Martín, Eukaryotic cell 2003 - “...c YLR017w YDR444w YDR461w YHR096c YAL042w YAR071w YDR058c YBR145w YCL009c YGL009c YDL182w YBR272c YBR014c YBR153w YJR024c Function ER-associated protein...”
BPSS2319 lipase precursor from Burkholderia pseudomallei K96243
Aligns to 45:166 / 356 (34.3%), covers 56.7% of PF05057, 26.5 bits
- Global transcriptional analysis of Burkholderia pseudomallei high and low biofilm producers reveals insights into biofilm production and virulence
Chin, BMC genomics 2015 - “...BPSS2328 ), seven phospholipases and lipase-related genes ( BPSL1064, BPSS0016, BPSS1740, BPSS1741, BPSS1937, BPSS2279 and BPSS2319 ) as well as seven cell envelope biogenesis-related genes ( BPSL0607, BPSL1872, BPSL3094, BPSL3312, BPSS1840, BPSS1932 and BPSS2016 ) were up-regulated in the high biofilm producer (Figs. 2 and 3...”
XP_006468458 lecithin-cholesterol acyltransferase-like 4 from Citrus sinensis
Aligns to 157:315 / 537 (29.6%), covers 43.3% of PF05057, 26.4 bits
VDAG_08973 uncharacterized protein from Verticillium dahliae VdLs.17
Aligns to 26:153 / 186 (68.8%), covers 51.2% of PF05057, 25.8 bits
- RNA-seq analyses of gene expression in the microsclerotia of Verticillium dahliae
Duressa, BMC genomics 2013 - “...VDAG_03732 97.43 Unknown VDAG_02042 67.51 Unknown VDAG_03078 60.72 Unknown VDAG_07349 58.42 Unknown VDAG_02389 42.48 Unknown VDAG_08973 37.13 Unknown VDAG_05569 30.02 Unknown VDAG_05179 29.71 Unknown VDAG_10456 28.13 Unknown VDAG_00592 27.17 Unknown VDAG_04171 24.46 Unknown VDAG_06885 22.53 Unknown VDAG_09869 20.88 Unknown VDAG_00490 20.38 Unknown Cell death VDAG_00261 72.35...”
SEQ_1233 hydrolase from Streptococcus equi subsp. equi 4047
Aligns to 76:201 / 301 (41.9%), covers 43.3% of PF05057, 25.5 bits
Q9KQM4 Putative 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase from Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
VC1974 conserved hypothetical protein from Vibrio cholerae O1 biovar eltor str. N16961
Aligns to 12:117 / 263 (40.3%), covers 41.5% of PF05057, 25.2 bits
ACICU_RS04620 alpha/beta fold hydrolase from Acinetobacter baumannii ACICU
Aligns to 356:474 / 637 (18.7%), covers 45.2% of PF05057, 25.1 bits
NPW32_RS07465 alpha/beta hydrolase from Staphylococcus epidermidis
Aligns to 28:138 / 291 (38.1%), covers 44.7% of PF05057, 24.8 bits
XP_504639 YALI0E31515p from Yarrowia lipolytica CLIB122
Aligns to 98:206 / 327 (33.3%), covers 25.8% of PF05057, 24.8 bits
- Novel lipolytic enzymes identified from metagenomic library of deep-sea sediment
Jeon, Evidence-based complementary and alternative medicine : eCAM 2011 - “...ACJ13070, a lipase from uncultured bacterium; (ACJ13070); XP_390196, a hypothetical protein from Gibberella zeae PH-1; XP_504639, a YALI0E31515p from Yarrowia lipolytica . Triangles and squares represent the residues involved in the formation of the catalytic triad and the oxyanion hole, respectively, and the conserved pentapeptide motifs...”
- Gene cloning and characterization of a novel esterase from activated sludge metagenome
Zhang, Microbial cell factories 2009 - “...amino acid identity to esterase/lipase from Gemmata obscuriglobus UQM 2246 (ZP_02733109) and Yarrowia lipolytica CLIB122 (XP_504639), respectively; and several conserved regions were identified, including the putative active site, HSMGG, a catalytic triad (Ser92, His125 and Asp216) and a LHYFRG conserved motif. The EstAS was overexpressed, purified...”
- “...Gemmata obscuriglobus UQM 2246 (ZP_02733109, 33% identity), followed by the lipase from Yarrowia lipolytica CLIB122 (XP_504639, 31% identity), the putative lipase/esterase from Magnaporthe grisea 70-15 and Saccharomyces cerevisiase Tg12p (XP_368471, 31% identity; and NP_010343, 29% identity, respectively), members of the family of fungal hydrolases. And also,...”
PF3D7_0629300 phospholipase, putative from Plasmodium falciparum 3D7
Aligns to 579:686 / 863 (12.5%), covers 35.5% of PF05057, 24.8 bits
- A malaria parasite phospholipase facilitates efficient asexual blood stage egress
Ramaprasad, 2023 - A malaria parasite phospholipase facilitates efficient asexual blood stage egress
Ramaprasad, PLoS pathogens 2023 - “...just prior to egress detected the presence in the PV of a lecithin:cholesterol acyltransferase (LCAT; PF3D7_0629300). Conditional ablation of LCAT resulted in abnormal egress and a reduced replication rate. Lipidomic profiles of LCAT-null parasites showed drastic changes in several phosphatidylserine and acylphosphatidylglycerol species during egress. We...”
- “...of LCAT reduces blood stage proliferation Previous transcriptomic analyses indicate that peak expression of LCAT (PF3D7_0629300) during ABS occurs during schizont development [ 35 ]. To investigate the localisation of LCAT in ABS P . falciparum parasites, we appended a C-terminal GFP-tag to the endogenous gene...”
- Phospholipases A and Lysophospholipases in protozoan parasites
Hervé, Microbial cell (Graz, Austria) 2023 - “...migration through the epithelial layers, merozoite release from hepatocytes [ 36 , 37 ] PfLCAT PF3D7_0629300 Merozoite release from hepatocytes, egress in asexual blood stage [ 38 ] PbPLA1 PBANKA_1423100 Merozoite release from hepatocytes [ 39 ] PfPAPTL1/PN PLA1 PF3D7_0209100 Gametocyte induction and maturation, translocation of...”
- The patatin-like phospholipase PfPNPLA2 is involved in the mitochondrial degradation of phosphatidylglycerol during Plasmodium falciparum blood stage development
Shunmugam, Frontiers in cellular and infection microbiology 2023 - “...). In addition, another recent study has assigned a role of the ecithin:cholesterol acyltransferase LCAT (PF3D7_0629300) to the erythrocytic phase of P. falciparum . Conditional ablation of LCAT resulted in abnormal egress and a reduced replication rate by altering the levels of several phosphatidylserine and acylphosphatidylglycerol...”
- Global analysis of putative phospholipases in Plasmodium falciparum reveals an essential role of the phosphoinositide-specific phospholipase C in parasite maturation
Burda, mBio 2023 - “...the non-essential putative phospholipases identified in our work have been previously studied. The homolog of PF3D7_0629300 in the rodent malaria model P. berghei (PBANKA_1128100) exhibits phospholipase and membranolytic activity in vitro and has been implicated in cell traversal by sporozoites and disruption of the liver-stage PVM...”
- The role of cholesterol in invasion and growth of malaria parasites
Maier, Frontiers in cellular and infection microbiology 2022 - “...stage (trophozoite, schizont), gametocytes (male, female), ookinete All Plasmodium No (asexual) ND Phosphatidylcholine-sterol acyltransferase, putative PF3D7_0629300 (PFF1420w) liver stage, asexual stage (trophzoite, schizont), oocyst, sprozoite (injected) All Plasmodium No (asexual) Delayed egress from PV in liver stage ( Burda etal., 2015 ) PFA66 PF3D7_0113700 (PFA0660w) asexual...”
- Activity-based protein profiling of human and plasmodium serine hydrolases and interrogation of potential antimalarial targets
Davison, iScience 2022 - “...temporal activation of Pf SHs suggests they may play stage-specific roles in metabolism. PF3D7_1129300, PF3D7_1476800, PF3D7_0629300 ( Pf LCAT) and PF3D7_1134500 seem to be most active at schizont stages, and PF3D7_1458300, PF3D7_1358000 and PF3D7_1120400 (abH112) in early schizonts. The activities of Psta1, PF3D7_1328500 (MLPL), and RhoSH...”
- Genome-Wide Analysis of the Malaria Parasite Plasmodium falciparum Isolates From Togo Reveals Selective Signals in Immune Selection-Related Antigen Genes
Kassegne, Frontiers in immunology 2020 - “...1216005 (-) 1.16843 PF3D7_1335100 merozoite surface protein 7, MSP7 Chr13: 1419086 - 1420141 (-) 1.07565 PF3D7_0629300 phospholipase, putative, PL Chr13: 1205190 - 1207781 (+) 1.00902 *Plasmodium helical interspersed subtelomericb. Antigenic variation within Pf surface-exposed putative proteins is a target of host immune selection. Therefore, we applied...”
- More
A0A1C9U7K7 feruloyl esterase (EC 3.1.1.73) from Lactobacillus amylovorus (see paper)
Aligns to 24:130 / 247 (43.3%), covers 41.9% of PF05057, 24.5 bits
SGHV006 hypothetical protein from Glossina pallidipes salivary gland hypertrophy virus
Aligns to 103:237 / 361 (37.4%), covers 35.0% of PF05057, 24.4 bits
7r1kA / W8FKE7 Phosphorylated bacillus pumilus lipase a
Aligns to 2:100 / 181 (54.7%), covers 41.9% of PF05057, 24.2 bits
- Ligand: oxaloacetate ion (7r1kA)
LCAT3 / Q93V61 phospholipase A1 LCAT3 (EC 3.1.1.32) from Arabidopsis thaliana (see paper)
LCAT3_ARATH / Q93V61 Phospholipase A(1) LCAT3; Lecithin-cholesterol acyltransferase-like 3; EC 3.1.1.32 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
AT3G03310 lecithin:cholesterol acyltransferase family protein / LACT family protein from Arabidopsis thaliana
Aligns to 152:258 / 447 (23.9%), covers 36.9% of PF05057, 24.2 bits
- function: Hydrolyzes the sn-1 acylester bond of phospholipids. Phosphatidylcholine, phosphatidylethanolamine and phosphatidic acid can be used as substrates. Weak activity with lysophosphatidylcholine and no activity with tripalmitoylglycerol and cholesteryl oleate. Seems to have a preference for unsaturated fatty acids at the sn-1 position.
catalytic activity: a 1,2-diacyl-sn-glycero-3-phosphocholine + H2O = a 2-acyl-sn- glycero-3-phosphocholine + a fatty acid + H(+) (RHEA:18689) - Differentially expressed genes during the imbibition of dormant and after-ripened seeds - a reverse genetics approach
Yazdanpanah, BMC plant biology 2017 - “...superfamily protein SALK_094895 AT3G02990 KO 15 Member of Heat Stress Transcription Factor family (HSFA1E) SALK_025488.38.10 AT3G03310 KO 16 Lecithin:cholesterol acyltransferase 3 (LCAT3) SALK_038352 AT3G22490 KO 17 Seed maturation protein SALK_082777C AT3G53410 KO 18 Paralog of ubiquitin E3 ligase (LUL2) SALK_090239C AT3G62090 KO 19 Phytochrome-Interacting Factors (PIF6)...”
- “...is known to respond to karrikin (KO5, At3G14880), LECITHIN:CHOLESTEROL ACYLTRANSFERASE 3 ( LCAT3 ; KO16, At3G03310) which is involved in lipid metabolism, a seed maturation protein (KO17; AT3G22490), SSADH1 , PIF6 , the antioxidant gene PEROXIREDOXIN Q ( PRXQ ; KO36, AT3G26060), and a SEED STORAGE...”
- Identification of Arabidopsis candidate genes in response to biotic and abiotic stresses using comparative microarrays
Sham, PloS one 2015 - “...2.735 At2g33380 RD20 255795 5.153 2.360 5.936 26.651 At3g14067 subtilase 256997 2.271 2.166 2.684 6.830 At3g03310 LCAT3 259057 2.88 2.38 5.18 17.57 At3g05030 NHX2 259081 2.627 3.144 3.396 4.889 At1g70900 Unknown 262313 2.10 2.01 2.83 4.92 At2g42540 COR15A 263497 7.40 2.88 88.16 102.16 At2g06890 transposable element...”
- A gene co-expression network predicts functional genes controlling the re-establishment of desiccation tolerance in germinated Arabidopsis thaliana seeds
Costa, Planta 2015 - “...(GLX2-5) AT1G14530 TOM THREE HOMOLOG 1 (THH1) AT2G33830 Dormancy/auxin-associated family protein AT1G15330 Cystathionine beta-synthase protein AT3G03310 LECITHIN:CHOLESTEROL ACYLTRANSFERASE 3 (LCAT3) AT1G15740 Leucine-rich repeat family protein AT3G20250 PUMILIO 5 (PUM5) AT1G21680 DPP6 N-terminal domain-like protein AT3G26580 Tetratricopeptide repeat (TPR)-like superfamily protein AT1G55530 RING/U-box superfamily protein AT4G05390 ROOT...”
- Exon-primed intron-crossing (EPIC) markers for evolutionary studies of Ficus and other taxa in the fig family (Moraceae)
Yao, Applications in plant sciences 2013 - “...0.04593 JQ341917 AT4G02580 T10P11_14 R: GCATGGTGTAGTGCCACAAA JQ341918 FA03310 F: GCGGGTATAAGAAGGGAACC 740/581 (+2) 43 0.05866 JQ341919 AT3G03310 LCAT3 R: GGTGCATTGACCACCTTGAT JQ341920 FA07360a F: GCTGATAAAATGGTTGCTGCTG 540/287 29 0.05410 JQ341921 AT2G07360 T13E11.13 R: CCCCTTGATCTTCCCCATTACT JQ341922 FA08510 F: TGCTGGACTTCTTGGTGATG 893/741 51 0.05724 JQ341923 AT1G08510 FATB R: CAATCACGACGCATACCATTC JQ341924 FA11980 F:...”
- Bidirectional promoters in seed development and related hormone/stress responses
Kourmpetli, BMC plant biology 2013 - “...subunit peroxisome cytosol AT3G03160 AT3G03150 264 y y unknown protein unknown protein endomembrane mitochondrion AT3G03320 AT3G03310 135 RNA-binding protein lecithin:cholesterol acyltransferase 3 cytosol plasma membrane AT3G12320 AT3G12300 580 y unknown protein unknown protein nucleus cytosol AT3G13190 AT3G13180 559 unknown function (DUF827) rRNA small subunit methyltransferase B...”
- Expression in yeast of a novel phospholipase A1 cDNA from Arabidopsis thaliana
Noiriel, European journal of biochemistry 2004 (PubMed)- “...The expression of one of these cDNAs, AtLCAT3 (At3g03310), in various yeast strains resulted in the doubling of the triacylglycerol content. Furthermore, a...”
- “...and comparison with the sequence of the gene At3g03310 to encode a truncated AtLCAT3 polypeptide lacking 43 amino acids. A complete ORF was reconstituted...”
NE0456 Esterase/lipase/thioesterase family active site from Nitrosomonas europaea ATCC 19718
Aligns to 37:156 / 310 (38.7%), covers 41.9% of PF05057, 24.1 bits
W8FKE7 Lipase from Bacillus pumilus
Aligns to 34:136 / 215 (47.9%), covers 41.9% of PF05057, 23.9 bits
- Structure and Mechanism of a Cold-Adapted Bacterial Lipase
van, Biochemistry 2022 - “...Methods Protein Production A synthetic Bacillus pumilus lipase gene construct corresponding to UniProt accession ID W8FKE7 was codon-optimized for expression in Escherichia coli and synthesized by GenScript. The mature peptide sequence, excluding the signal peptide, was subcloned into pET22b with cytosolic expression. The expression vector containing...”
- ThermoSlope: A Software for Determining Thermodynamic Parameters from Single Steady-State Experiments
Lund, Molecules (Basel, Switzerland) 2021 - “...Production The DNA sequence encoding residues 35215 of the mature Bacillus pumilus Lipase L5 (UniProtKB W8FKE7) was optimised for E. coli expression, synthesised and subcloned into pET-22b(+) within the NdeI/XhoI sites by GenScript Biotech (Leiden, The Netherlands). The plasmid was transformed into NiCo21(DE3) chemically competent E.coli...”
SAPIO_CDS6465 Alpha/beta hydrolase fold family protein from Scedosporium apiospermum
Aligns to 23:142 / 272 (44.1%), covers 41.0% of PF05057, 23.7 bits
- Lower Funneling Pathways in Scedosporium Species
Poirier, Frontiers in microbiology 2021 - “...of catechol ( Martins et al., 2019 ). Interestingly, orthologs of these genes, SAPIO_CDS6464 and SAPIO_CDS6465, respectively, were identified in another scaffold (scaffold 103) of the S. apiospermum genome ( Figure 4B ), clustered with a MFS gene (SAPIO_CDS6466) and genes encoding for proteins involved in...”
CJE1115 hypothetical protein from Campylobacter jejuni RM1221
Aligns to 105:208 / 500 (20.8%), covers 21.2% of PF05057, 23.7 bits
- Bioinformatic Analysis of the Campylobacter jejuni Type VI Secretion System and Effector Prediction
Robinson, Frontiers in microbiology 2021 - “...CJ488_0953 169 CJ488_0954 192 CJ488_0955 506 CJ488_0956 90 CJ488_0957 507 Lipase (class 3) domain-containing protein CJE1115 64 A0W69_09355 62 CJ488_0958 130 CJ488_0959 178 CJ488_0960 41 CJ488_0961 225 Lipase (class 3) domain-containing protein CJ488_0962 195 Phage lysozyme-like containing protein CJ488_0963 119 CJ488_0964 1310 CJE1137 98 A0W69_09370 94...”
- “...the T6SS operon ( Figure 3 ), with the former sharing homology to the proteins CJE1115 (64% aa identity) and A0W69_09355 (62% aa identity) from RM1221 and pCJDM202, respectively. Within our local C. jejuni database, 108 out of the 512 (21.09%) genomes were found to possess...”
ESTB_BACSU / Q79F14 Extracellular esterase EstB; Extracellular esterase LipB; Lipase B; Triacylglycerol lipase; EC 3.1.1.3 from Bacillus subtilis (strain 168) (see 2 papers)
Q79F14 acylglycerol lipase (EC 3.1.1.23) from Bacillus subtilis (see paper)
BSU08350 secreted esterase / lipase from Bacillus subtilis subsp. subtilis str. 168
Aligns to 29:131 / 210 (49.0%), covers 42.4% of PF05057, 23.7 bits
- function: An esterase which preferentially hydrolyzes triacylglyceride substrates with short chain fatty acids (C3-C10) with the maximum activity towards tricaprylin (C8:0); essentially inactive on C18:1 or C18:4 substrates. Active against p-nitrophenylesters with fatty acid chain lengths from C6 to C18.
catalytic activity: a triacylglycerol + H2O = a diacylglycerol + a fatty acid + H(+) (RHEA:12044) - Secondary structural entropy in RNA switch (Riboswitch) identification
Manzourolajdad, BMC bioinformatics 2015 - “...0.3376 79 ylaA BSU14710 0.816 77 909862 910018 forward BSU08330 yfiN -658 0.3503 79 estB BSU08350 0.816 78 4109617 4109773 reverse BSU40030 yxaB -1253 0.3885 79 yxaD BSU40010 0.813 79 3252983 3253139 forward BSU31660 mrpG -538 0.3949 4632 yuzC BSU31730 0.811 80 4066294 4066450 reverse BSU39600...”
Q8RJP5 triacylglycerol lipase (EC 3.1.1.3) from Priestia megaterium (see paper)
Aligns to 29:131 / 210 (49.0%), covers 42.4% of PF05057, 23.7 bits
lip / CAB95850.2 lipase precursor from Bacillus licheniformis (see 2 papers)
Aligns to 32:134 / 213 (48.4%), covers 42.4% of PF05057, 23.6 bits
JD965_RS01465 triacylglycerol lipase from Bacillus siamensis
Aligns to 32:134 / 214 (48.1%), covers 41.9% of PF05057, 23.6 bits
GYO_3335 2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase from Bacillus spizizenii TU-B-10
Aligns to 20:133 / 274 (41.6%), covers 45.2% of PF05057, 23.5 bits
- Disparate Effects of Two Clerodane Diterpenes of Giant Goldenrod (Solidago gigantea Ait.) on Bacillus spizizenii
Bozsó, International journal of molecular sciences 2024 - “...[ 47 ]. Moreover, up-regulation of other common genes of menaquinone synthesis (GYO_1191, yhcB ; GYO_3335, ytxM ; GYO_3490, dhbC ) supports the importance of menaquinone dependent respiratory electron transport during diterpene-induced stress response. Finally, a putative glycosyltransferase (GYO_2344, yojK ) was activated in all samples....”
- “...GYO_2953 1.1 1.0 2.1 1.7 B. subtilis (BSU_27160) yrhJ , cytochrome P450, fatty acid metabolism GYO_3335 1.1 2.1 1.0 1.7 B. subtilis (BSU_30810) ytxM , ubiquinone and menaquinone biosynthesis GYO_3455 1.2 1.4 2.3 1.1 B. subtilis (BSU_31650) mrpF , Na+/H+ antiporter subunit, sodium export GYO_3490 2.3...”
BA2607 lipase, putative from Bacillus anthracis str. Ames
Aligns to 104:214 / 400 (27.8%), covers 26.7% of PF05057, 23.3 bits
A9QXC9 triacylglycerol lipase (EC 3.1.1.3) from Burkholderia cepacia (see paper)
Aligns to 54:173 / 364 (33.0%), covers 55.8% of PF05057, 22.9 bits
A0W69_09355 Mbeg1-like protein from Campylobacter jejuni
Aligns to 168:238 / 531 (13.4%), covers 20.3% of PF05057, 22.9 bits
- Bioinformatic Analysis of the Campylobacter jejuni Type VI Secretion System and Effector Prediction
Robinson, Frontiers in microbiology 2021 - “...CJ488_0954 192 CJ488_0955 506 CJ488_0956 90 CJ488_0957 507 Lipase (class 3) domain-containing protein CJE1115 64 A0W69_09355 62 CJ488_0958 130 CJ488_0959 178 CJ488_0960 41 CJ488_0961 225 Lipase (class 3) domain-containing protein CJ488_0962 195 Phage lysozyme-like containing protein CJ488_0963 119 CJ488_0964 1310 CJE1137 98 A0W69_09370 94 CJ488_0965 422...”
- “...3 ), with the former sharing homology to the proteins CJE1115 (64% aa identity) and A0W69_09355 (62% aa identity) from RM1221 and pCJDM202, respectively. Within our local C. jejuni database, 108 out of the 512 (21.09%) genomes were found to possess the protein CJ488_0957 (average per...”
F9UM18 feruloyl esterase (EC 3.1.1.73) from Lactiplantibacillus plantarum (see paper)
lp_0796 alpha/beta fold hydrolase from Lactiplantibacillus plantarum WCFS1
lp_0796 carboxylesterase from Lactobacillus plantarum WCFS1
Aligns to 12:137 / 249 (50.6%), covers 43.8% of PF05057, 22.8 bits
- Characterization of isogenic mutants with single or double deletions of four phenolic acid esterases in Lactiplantibacillus plantarum TMW1.460
Gaur, International journal of food microbiology 2023 (PubMed)- “...Lp. plantarum TMW1.460, which encodes for four esterases: TanA, Lp_0796, Est_1092 and a homolog of Lj0536 and Lj1228 that was termed HceP. To determine which of...”
- “...responsible for esterase activity, mutants with deletions in lp_0796, est_1092, tanB, hceP, or hceP and est_1092 were constructed. The phenotype of wild type...”
- Conversion of (poly)phenolic compounds in food fermentations by lactic acid bacteria: Novel insights into metabolic pathways and functional metabolites
Gaur, Current research in food science 2023 - “...methyl ferulate Lp. plantarum TMW1.460 ( Gaur, 2022 , Gaur et al., in press ) Lp_0796; YP_004888771 Methyl ferulate, methyl caffeate, methyl p-coumarate, methyl sinapate Lp. plantarum WCFS1 ( Esteban-Torres et al., 2013 ) Est_1092; WP_015825406 Methyl ferulate, methyl caffeate, methyl p-coumarate, methyl sinapate Lp. plantarum...”
- Impact of Lactic Acid Bacteria Fermentation on Phenolic Compounds and Antioxidant Activity of Avocado Leaf Extracts
De, Antioxidants (Basel, Switzerland) 2023 - “...strains was related to the presence of two esterases with differences in their substrate range: Lp_0796 that hydrolyses esters of caffeic, p -coumaric, ferulic and sinapic acids, while Est_1092 was able to hydrolyse both hydroxycinnamoyl and hydroxybenzoyl esters [ 54 ]. This cinnamoyl esterase activity is...”
- Isolation, characterization and comparative genomics of potentially probiotic Lactiplantibacillus plantarum strains from Indian foods
Surve, Scientific reports 2022 - “...Esterases characterized from L. plantarum , Lp_2945 (Gallate decarboxylase from WCFS1), Lp_2956 (Tannase from WCFS1, Lp_0796 (Esterase from WCFS1), EFK29314 (Tannase from ATCC14917) and JDM1_1092 (Esterase from JDM1). ( d ) Riboflavin and ( e ) folate biosynthesis proteins, adapted from 36 . Bile and acid...”
- Feruloyl Esterase (LaFae) from Lactobacillus acidophilus: Structural Insights and Functional Characterization for Application in Ferulic Acid Production
Jeon, International journal of molecular sciences 2023 - “...has been observed in other FAEs, including FaeI from Cellulosilyticum ruminicola [ 21 ] and Lp_0796 from L. plantarum [ 14 ]. We discovered that the activity of La Fae is optimal within a temperature range of 25 and 37 C and shows approximately 75% of...”
- Enhancing the Hydrolysis and Acyl Transfer Activity of Carboxylesterase DLFae4 by a Combinational Mutagenesis and In-Silico Method
Li, Foods (Basel, Switzerland) 2023 - “...Haowen Zhang et al. rationally increased 4- and 5-fold catalytic efficiency of a feruloyl esterase LP_0796 from Lactobacillus plantarum by mutation Asp with Ala23 and Ile198, respectively [ 35 ]. Eight mutants were generated based on the simulated structure to enhance the catalytic efficiency of a...”
- A reverse catalytic triad Asp containing loop shaping a wide substrate binding pocket of a feruloyl esterase from Lactobacillus plantarum
Zhang, International journal of biological macromolecules 2021 (PubMed)- “...hemicellulose and ferulic acid in plant cell walls. LP_0796 from Lactobacillus plantarum was identified as a feruloyl esterase that may have potential...”
- “...and catalytic mechanisms limits its application. Here, LP_0796 showed the highest activity towards methyl caffeate at pH 6.6 and 40 C. The crystal...”
- New Insights Into Cinnamoyl Esterase Activity of Oenococcus oeni
Collombel, Frontiers in microbiology 2019 - “...ND ND ND https://www.ncbi.nlm. nih.gov/protein/329667314 Guinane et al., 2011 Lactobacillus plantarum WCFS1 Feruloyl esterase/carboxyl esterase Lp_0796 28 Methyl ferulate, methyl caffeate, methyl p -coumarate, and methyl sinapinate lp_0796 https://www.ncbi.nlm. nih.gov/protein/YP_004888771.1 Esteban-Torres et al., 2013 7 Lactobacillus plantarum Feruloyl esterase Est-1092 33.5 Methyl ferulate, methyl caffeate est-1092...”
- Ethylphenol Formation by Lactobacillus plantarum: Identification of the Enzyme Involved in the Reduction of Vinylphenols
Santamaría, Applied and environmental microbiology 2018 - “...acids from plant cell walls. A feruloyl esterase (Lp_0796) has been identified as the esterase responsible for the esterase activity observed on L. plantarum...”
- The Lp_3561 and Lp_3562 Enzymes Support a Functional Divergence Process in the Lipase/Esterase Toolkit from Lactobacillus plantarum
Esteban-Torres, Frontiers in microbiology 2016 - “...produced and biochemically characterized. These esterase proteins exhibited diverse specific activities, such as feruloyl esterase (Lp_0796; Esteban-Torres et al., 2013 ), arylesterase (Lp_1002 and Lp_2631; Esteban-Torres et al., 2014a , c ), carboxylesterase (Lp_0973 and Lp_2923; Benavente et al., 2013 ; lvarez et al., 2011 ,...”
- “...were performed by using ClustalW2 at the EBI site ( http://www.ebi.ac.uk/Tools/msa/clustalw2/ ). Protein sequences are Lp_0796 (accession YP_004888771), Lp_0973 (YP_004888920), Lp_1002 (YP_004888940), Lp_1760 (YP_004889565), Lp_2631 (YP_004890283), Lp_2923 (YP_004890513), Lp_3505 (YP_004890987), Lp_3561 (YP_004891038), Lp_3562 (YP_004891039), and Est_1092 (ACT61979). FIGURE 2 Amino acid sequence alignment of Lp_3561 (YP_004891038)...”
- Lactobacillus plantarum WCFS1 and its host interaction: a dozen years after the genome
van, Microbial biotechnology 2016 - “...on the host (e.g. antiinflammatory and antioxidants; EstebanTorres etal ., 2013 ). Feruloyl esterase (FE; lp_0796 ), an enzyme involved in the release of these compounds would be able to release these beneficial compounds. Unfortunately, an efficient transport system for feruloyl esters appeared to be lacking...”
- A Lactobacillus plantarum esterase active on a broad range of phenolic esters
Esteban-Torres, Applied and environmental microbiology 2015 - “...our group (15-23). From the esterases assayed, only Lp_0796 was able to hydrolyze hydroxycinnamic acids and was therefore considered a feruloyl esterase. Given...”
- “...program to amplify internal regions of the lp_0796 and est_1092 esterase genes. Oligonucleotides 977 (5=-GCCAACATGCCGTC ATTTTA) and 978 (5=-CCGCACATCATTGGCACTT)...”
- More
CNE02710 lipase 2 from Cryptococcus neoformans var. neoformans JEC21
Aligns to 136:288 / 587 (26.1%), covers 42.4% of PF05057, 22.4 bits
- Brain inositol is a novel stimulator for promoting Cryptococcus penetration of the blood-brain barrier
Liu, PLoS pathogens 2013 - “...2.59 CNL04840 CNAG_05138 Exo-beta-1,3-glucanase 2.54 CNC02410 CNAG_01737 Methyl sterol oxidase 2.54 CNB00990 CNAG_03596 2-Oxoglutarate_dehydrogenase_complex 2.53 CNE02710 CNAG_07639 Triacylglycerol lipase 2.50 Signal transduction CNA01180 CNAG_00130 Serine/threonine protein kinase 5.11 CNB05690 CNAG_04090 bZip transcription factor 3.13 CNB01230 CNAG_03621 Cyclophilin A 2.96 CNH00140 CNAG_05348 Small_GTPase_CDC42 2.88 CNH00970 CNAG_05431 Transcription...”
CNAG_07639 triacylglycerol lipase from Cryptococcus neoformans var. grubii H99
Aligns to 136:289 / 586 (26.3%), covers 42.4% of PF05057, 22.4 bits
- Brain inositol is a novel stimulator for promoting Cryptococcus penetration of the blood-brain barrier
Liu, PLoS pathogens 2013 - “...CNL04840 CNAG_05138 Exo-beta-1,3-glucanase 2.54 CNC02410 CNAG_01737 Methyl sterol oxidase 2.54 CNB00990 CNAG_03596 2-Oxoglutarate_dehydrogenase_complex 2.53 CNE02710 CNAG_07639 Triacylglycerol lipase 2.50 Signal transduction CNA01180 CNAG_00130 Serine/threonine protein kinase 5.11 CNB05690 CNAG_04090 bZip transcription factor 3.13 CNB01230 CNAG_03621 Cyclophilin A 2.96 CNH00140 CNAG_05348 Small_GTPase_CDC42 2.88 CNH00970 CNAG_05431 Transcription factor...”
PPA0735 putative hydrolase from Propionibacterium acnes KPA171202
Aligns to 5:114 / 155 (71.0%), covers 42.4% of PF05057, 22.3 bits
AT2G44810, NP_182008 DAD1 (DEFECTIVE ANTHER DEHISCENCE 1); phospholipase A1/ triacylglycerol lipase from Arabidopsis thaliana
Aligns to 161:281 / 357 (33.9%), covers 41.9% of PF05057, 22.2 bits
- Genome-wide analysis of the JAZ subfamily of transcription factors and functional verification of BnC08.JAZ1-1 in Brassica napus
Wang, Biotechnology for biofuels and bioproducts 2022 - “...lines might be through ubiquitinproteasome pathways. In addition, four DEGs ( AT3G03530 , AT3G03540 , AT2G44810 , AT4G01950 ) were enriched in the phospholipid metabolism pathway, which was understandable as seed development is also a process of continuous accumulation and storage of lipids. Moreover, of all...”
- Transcriptome analysis at mid-stage seed development in litchi with contrasting seed size
Pathak, 3 Biotech 2022 - “...WRKY70 (AT3G56400), JMT (AT1G19640), DAD1 (AT2G44810), MYB23 (AT5G38830), cysteine-rich RLK6 (AT4G38830) and DREB1 (AT4G25480)}, suggests compromised...”
- Crystal Structures of the Plant Phospholipase A1 Proteins Reveal a Unique Dimerization Domain
Heo, Molecules (Basel, Switzerland) 2022 - “...in food and biotechnology industries [ 17 , 18 ]. In Arabidopsis thaliana , DAD1 (At2g44810) was identified as an sn -1 specific acylhydrolase, and several studies have suggested that AtDSEL ( Arabidopsis thaliana DAD1-like seedling establishment-related lipase), one of the homologues of DAD1, plays significant...”
- Jasmonates and Histone deacetylase 6 activate Arabidopsis genome-wide histone acetylation and methylation during the early acute stress response
Vincent, BMC biology 2022 - “...1/peroxisomal 3-ketoacyl-CoA thiolase (PKT4; AT1G04710) (WT +MeJA). The H4ac enrichment of the phospholipase A1 (DAD1, AT2G44810); lipoxygenases LOX2 (AT3G45140) LOX3 (AT1G17420), LOX4 (AT1G72520), LOX6 (AT1G67560), allene oxide cyclases AOC1/2/3 (AT3G25760, AT3G25770, AT3G25780), and 12-oxophytodienoic acid reductase OPR2 (AT1G76690) was instead HDA6 independent. For PP, the activating...”
- Molecular Targets and Biological Functions of cAMP Signaling in Arabidopsis
Xu, Biomolecules 2021 - “...metabolites [ 151 , 152 ], and it was associated with the CRGs including DND1 (AT2G44810) that catalyze the initial step of JA biosynthesis [ 153 ], AOC1 and AOC2 both being the allene oxide cyclase [ 154 ]. Obviously, these results were in line with...”
- “...processes. Biological Processes CRGs Phytohormone biosynthesis and homeostasis PIN6 (AT1G77110), PID (AT2G34650), JAR1 (AT2G46370), DND1 (AT2G44810), AOC1 (AT3G25760), AOC2 (AT3G25770), GA1 (AT4G02780), CPS (AT4G02780), ACS8 (AT4G37770), LOG7 (AT5G06300), SMT3 (AT1G76090), CYP702A3 (AT4G15310), HXXXD-type acyl-transferase family protein (AT2G40230) mRNA degradation SOV (AT1G77680), CAF1-5 (AT1G61470), TSN2 (AT5G61780), BRN2...”
- Screening and Interaction Analysis Identify Genes Related to Anther Dehiscence in Solanum melongena L
Wang, Frontiers in plant science 2021 - “...were upregulated in S12 vs. F142. SmDAD1 is crucial for JA biosynthesis. Arabidopsis DAD1 ( At2g44810 ) encodes the first chloroplastic lipase identified. This enzyme is involved in supplying -linolenic acid for the JA-biosynthetic pathway (Ishiguro et al., 2001 ). Mutations in DAD1 reduced JA levels...”
- The grapevine (Vitis vinifera L.) floral transcriptome in Pinot noir variety: identification of tissue-related gene networks and whorl-specific markers in pre- and post-anthesis phases
Vannozzi, Horticulture research 2021 - “...tissues). Although no information on this gene is available in grapevine, its Arabidopsis orthologous, namely AT2G44810 , encodes DEFECTIVE ANTHER DEHISCENCE 1 (DAD1), a protein located in the chloroplast 50 whose phospholipase A1 activity catalyzes the late phase of the jasmonate biosynthetic pathway 51 . DAD1...”
- The Role of Chloroplast Membrane Lipid Metabolism in Plant Environmental Responses
Cook, Cells 2021 - “...At4g22305 A. thaliana PC / PA GLIP1 At5g50990 Synthetic esters GLIP2 At1g53940 Oxylipin Responses DAD1 At2g44810 A. thaliana MGDG, PC, TAG DGL At1g06800 A. thaliana MGDG, DGDG, PC, TAG GLA1 FJ821553 N. attenuata PC, MGDG, TAG * References for each of the respective genes are given...”
- More
ABUW_2914 alpha/beta hydrolase from Acinetobacter baumannii
Aligns to 77:179 / 341 (30.2%), covers 38.7% of PF05057, 22.2 bits
LSA0439 Hypothetical extracellular lipase/esterase precursor from Lactobacillus sakei subsp. sakei 23K
Aligns to 114:225 / 282 (39.7%), covers 47.0% of PF05057, 22.1 bits
CIMG_09463 uncharacterized protein from Coccidioides immitis RS
Aligns to 35:155 / 1107 (10.9%), covers 49.8% of PF05057, 22.0 bits
- Gene exchange between two divergent species of the fungal human pathogen, Coccidioides
Maxwell, Evolution; international journal of organic evolution 2019 - “...3.5 with an allele frequency of 52%. One of these genes encodes a hypothetical protein (CIMG_09463), whereas the other (CIMG_09462) encodes an NADPH2 quinone reductase. CIMG_09462 is homologous the Saccharomyces cerevisiae protein Zta1p, and mutants in this gene are sensitive to oxidative stress ( Fernndez et...”
MAG0040 Esterase/lipase from Mycoplasma agalactiae PG2
Aligns to 14:121 / 272 (39.7%), covers 41.5% of PF05057, 21.8 bits
PM0355 unknown from Pasteurella multocida subsp. multocida str. Pm70
Aligns to 19:123 / 262 (40.1%), covers 41.5% of PF05057, 21.7 bits
DAD1 / Q948R1 DAD1 (EC 3.1.1.32) from Arabidopsis thaliana (see paper)
PLA11_ARATH / Q948R1 Phospholipase A(1) DAD1, chloroplastic; Phospholipase A1-Ibeta1; Protein DEFECTIVE IN ANTHER DEHISCENCE 1; AtDAD1; EC 3.1.1.32 from Arabidopsis thaliana (Mouse-ear cress) (see 6 papers)
Q948R1 phospholipase A1 (EC 3.1.1.32) from Arabidopsis thaliana (see paper)
NP_001324613 alpha/beta-Hydrolases superfamily protein from Arabidopsis thaliana
Aligns to 218:376 / 447 (35.6%), covers 41.9% of PF05057, 21.5 bits
Balat_0669 hypothetical protein from Bifidobacterium animalis subsp. lactis DSM 10140
BIF_00780 alpha/beta fold hydrolase from Bifidobacterium animalis subsp. lactis BB-12
Aligns to 30:146 / 262 (44.7%), covers 42.4% of PF05057, 21.3 bits
- The Gut Microbiota Links Dietary Polyphenols With Management of Psychiatric Mood Disorders
Westfall, Frontiers in neuroscience 2019 - “...was determined to be carried out by B. animalis by a specific enzyme identified as Balat_0669 ( Raimondi et al., 2015 ). The urolithins are an important class of bioactive microbial metabolites derived from ellagitannin and ellagic acid precursors. Several bacterial species have been identified that...”
- Characterisation of a Hydroxycinnamic Acid Esterase From the Bifidobacterium longum subsp. longum Taxon
Kelly, Frontiers in microbiology 2018 - “...Figure S1 Multiple sequence alignment of CaeA (B8809_1755) from B. longum subsp. longum NCIMB 8809, Balat_0669 from B. lactis subsp. animalis , Lp_1002 from Lactobacillus plantarum WCFS1, Lp_2923 from L. plantarum WCFS1 and lj0536 from Lactobacillus johnsonii N6.2. The (Gly X Ser X Gly) esterase motif...”
- Role of bifidobacteria in the hydrolysis of chlorogenic acid
Raimondi, MicrobiologyOpen 2015 - “...acid was detected only in B. animalis . In silico research among bifidobacteria esterases identified Balat_0669 as the cytosolic enzyme likely responsible of CA release in B. animalis . Comparative modeling of Balat_0669 and molecular docking studies support its role in chlorogenic acid hydrolysis. Expression, purification,...”
- “...the web interface (Altschul etal. 1990 ; Berman etal. 2000 ). The query sequence of Balat_0669 was obtained from the NCBI protein database (NCBI reference sequence: YP_002969671.1). Alignments were repeated for confirmation with ClustalW2 (Larkin etal. 2007 ; Goujon etal. 2010 ). The homology modeling of...”
- Updated Genome Sequence for the Probiotic Bacterium Bifidobacterium animalis subsp. lactis BB-12
Jensen, Microbiology resource announcements 2021 - “...Intergenic(+323/+44) BIF_00332 / BIF_02065 1419504 +C Intergenic(+328/+40) BIF_00332 / BIF_02065 1424409 4bp36bp Intergenic(+52/47) BIF_00028 / BIF_00780 1429003 1bp16bp Intergenic(+54/44) BIF_00776 / BIF_01792 1429006 TG Intergenic(+57/41) BIF_00776 / BIF_01792 1429008 CT Intergenic(+59/39) BIF_00776 / BIF_01792 1435740 10bp24bp Intergenic(+33/+22) BIF_00308 / BIF_00385 1435753 CA Intergenic(+46/+18) BIF_00308 / BIF_00385...”
7c4dA / A0A2S1GUX0 Marine microorganism esterase (see paper)
Aligns to 12:121 / 261 (42.1%), covers 41.9% of PF05057, 21.1 bits
- Ligand: acetate ion (7c4dA)
YbfF / b0686 esterase from Escherichia coli K-12 substr. MG1655 (see 4 papers)
YBFF_ECOLI / P75736 Esterase YbfF; EC 3.1.-.- from Escherichia coli (strain K12) (see paper)
P75736 palmitoyl-CoA hydrolase (EC 3.1.2.2) from Escherichia coli (see paper)
ybfF / GB|ABB60819.1 esterase ybfF; EC 3.1.-.- from Escherichia coli K12 (see 5 papers)
NP_415212 esterase from Escherichia coli str. K-12 substr. MG1655
NP_415212 hypothetical protein from Escherichia coli str. K-12 substr. MG1655
Aligns to 12:121 / 254 (43.3%), covers 42.9% of PF05057, 21.0 bits
- function: Displays esterase activity toward palmitoyl-CoA, malonyl-CoA and pNP-butyrate.
- The Escherichia coli proteome: past, present, and future prospects
Han, Microbiology and molecular biology reviews : MMBR 2006 - “...P77279 YbbN YbdQ P77395 YbeZ YbfF P0A9K3 P75736 PhoH-like protein Esterase 6.24/40,654.52 5.86/28,437.26 YbgF YbgI YbhC P45955 P0AFP6 P46130 Hypothetical...”
- Discovery of an Escherichia coli esterase with high activity and enantioselectivity toward 1,2-O-isopropylideneglycerol esters.
Godinho, Applied and environmental microbiology 2011 - GeneRIF: This approach led to the identification of esterase YbfF as the major Escherichia coli enzyme responsible for the hydrolytic activity toward 1,2-O-isopropylideneglycerol esters.
- High-resolution structure of ybfF from Escherichia coli K12: a unique substrate-binding crevice generated by domain arrangement.
Park, Journal of molecular biology 2008 (PubMed)- GeneRIF: The high-resolution structure of ybfF shows that the inserted helical bundle structure is critical for creating a large inner space, thereby providing the broad substrate spectrum toward large biomolecules.
- Crystallization and preliminary X-ray diffraction analysis of ybfF, a new esterase from Escherichia coli K12.
Park, Acta crystallographica. Section F, Structural biology and crystallization communications 2007 - GeneRIF: With two Ec_ybfF molecules in the asymmetric unit, the crystal volume per unit protein weight is 2.17 A(3) Da(-1), corresponding to a solvent content of 42%
- Response and adaptation of Escherichia coli to suppression of the amber stop codon
Wang, Chembiochem : a European journal of chemical biology 2014 - “...NP_415348 MoeA 0.43 NP_417354 YgfK 3.93 NP_416930 AmiA 0.43 NP_415510 CspG 4.23 NP_417999 DppC 0.44 NP_415212 YbfF 5.15 NP_418141 IbpB 0.44 NP_418012 CspA 6.78 NP_416678 YeiR 0.46 NP_416075 CspB 8.34 NP_418193 AtpE[ c ] 0.46 NP_416201 YdiI 16.19 [a] NCBI Accession number. [b] Ratios of proteins...”
NCgl0090 alpha/beta hydrolase from Corynebacterium glutamicum ATCC 13032
Aligns to 7:111 / 250 (42.0%), covers 42.4% of PF05057, 20.8 bits
- A strategy to enhance and modify fatty acid synthesis in Corynebacterium glutamicum and Escherichia coli: overexpression of acyl-CoA thioesterases
Liu, Microbial cell factories 2023 - “...The C. glutamicum genome contains three putative ACOT genes: tesA (NCgl2365), tesB (NCgl1600), and te9 (NCgl0090) [ 9 ]. TesA (GenBank accession number [GAN] WP004567531) encoded by tesA belongs to the TE1 family [ 10 ], and TesB (GAN WP011014521) encoded by tesB is a member...”
- Transcriptome and Multivariable Data Analysis of Corynebacterium glutamicum under Different Dissolved Oxygen Conditions in Bioreactors
Sun, PloS one 2016 - “...0% DO, the restricted genes were polyphosphate glucokinase (NCgl1835), pyruvate dehydrogenase E2 component (dihydrolipoamide acetyltransferase) (NCgl0090), and pyruvate dehydrogenase E1 component (NCgl2167), whereas triosephosphate isomerase (NCgl1524) was up-regulated, indicating that the metabolism from the glycolytic pathway toward the TCA cycle was weakened under 0% DO. Previous...”
- “...with the consumption of NADH. The pyruvate dehydrogenase complex (pyruvate dehydrogenase subunit E1 (NCgl2167), acyltransferase (NCgl0090)) was down-regulated, so the metabolic flux to TCA was decreased. The concentrations of some amino acids, such as valine, cysteine, and arginine, were higher than at 30% DO and 50%...”
Or search for genetic data about PF05057 in the Fitness Browser
by Morgan Price,
Arkin group
Lawrence Berkeley National Laboratory