Family Search for PF05553 (DUF761)

PF05553.11 hits 24 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.

AT2G26110 hypothetical protein (RefSeq) from Arabidopsis thaliana
Aligns to 270:305 / 309 (11.7%), covers 97.2% of PF05553, 63.7 bits

• Quantitative Interactor Screening with next-generation Sequencing (QIS-Seq) identifies Arabidopsis thaliana MLO2 as a target of the Pseudomonas syringae type III effector HopZ2
  Lewis, BMC genomics 2012
  • “...At1g04170 0.32 0 0.03 90 6 Z3 Short At5g67380 0.32 0 0.03 90 6 Short At2g26110 0.32 0 0.03 90 4 Short At5g54890 0.32 0 0.03 90 4 Z3 Short At5g25110 0.32 0 0.03 90 3 Z1c Short At2g22840 0.32 0 0.03 90 5 Z1c Short...”

AT5G47920 hypothetical protein (RefSeq) from Arabidopsis thaliana
Aligns to 150:185 / 187 (19.3%), covers 100.0% of PF05553, 61.2 bits

• Role of callose synthases in transfer cell wall development in tocopherol deficient Arabidopsis mutants
  Maeda, Frontiers in plant science 2014
  • “...Ca-transporting ATPase, plasma membrane-type, putative (ACA13) At5g13080 1.88 0.00 5.51 WRKY family transcription factor (WRKY75) At5g47920 1.06 0.00 5.13 Expressed protein At1g68620 2.08 0.00 4.95 Expressed protein At1g65500 2.13 0.00 4.84 Expressed protein At1g76640 2.52 0.00 4.54 Calmodulin-related protein, putative At2g26020 2.01 0.00 4.40 Plant defensin-fusion...”

A70_ARATH / F4K956 Pathogen-associated molecular patterns-induced protein A70; PIG A70 from Arabidopsis thaliana (Mouse-ear cress) (see paper)
AT5G56980 hypothetical protein (RefSeq) from Arabidopsis thaliana
Aligns to 343:377 / 379 (9.2%), covers 97.2% of PF05553, 61.0 bits

• Candidate Domestication-Related Genes Revealed by Expression Quantitative Trait Loci Mapping of Narrow-Leafed Lupin (Lupinus angustifolius L.)
  Plewiński, International journal of molecular sciences 2019
  • “...Lup011836 (OIW03199.1), and Lup002110 (OIW20134.1) sequences. Lup011781 has been identified as a homolog of MHM17-10 (AT5G56980) gene. It is pathogen-associated molecular pattern-induced gene with unknown function, putatively participating in jasmonic acid pathway [ 78 ]. Lup011739 encodes a homolog of GALACTURONOSYLTRANSFERASE-LIKE 10 , which is involved...”
  • “...NLL-10 51.4 18.4 53.5 0.71 galacturonosyltransferase 10-like, GAUT10 OIW03144.1 NLL-10 51.3 16.7 45.2 0.62 MHM17-10, AT5G56980 OIW03199.1 NLL-10 48.4 16.4 50.5 0.69 general transcription factor IIH subunit 2, GTF2H2 OIW03193.1 NLL-10 50.3 10.6 31.5 0.53 pentatricopeptide repeat-containing protein OIW20134.1 NLL-10 49.7 9.7 28.9 0.52 UDP-Glycosyltransferase 85A2,...”
• Constructing Networks of Organelle Functional Modules in Arabidopsis
  Penga, Current genomics 2016
  • “...AT1G50740 AT1G77450 AT5G67210 AT5G54300 AT5G06320 AT1G73805 AT2G23810 AT5G63790 AT5G10695 AT5G63790 AT5G06320 AT3G48090 AT3G06500 AT2G17040 AT4G19120 AT5G56980 AT4G01950 AT2G22080 AT5G47910 AT4G23810 AT1G02390 AT1G76650 AT1G43910 AT1G27770 AT4G36500 AT2G46510 AT3G25600 AT1G61890 AT3G55840 AT5G59550 AT5G37770 AT5G66210 AT1G74430 AT2G20370 AT3G08720 AT4G30280 AT3G15210 AT1G05170 AT4G18880 AT3G16720 AT4G23810 AT5G52750 AT4G14365 AT5G62020 AT4G35110...”
• RARGE II: an integrated phenotype database of Arabidopsis mutant traits using a controlled vocabulary
  Akiyama, Plant & cell physiology 2014
  • “...provide examples of AT1G21600, which is a subunit in the plastid-encoded RNA polymerase complex, and AT5G56980, which is related to the jasmonic acid signaling pathway. Arabidopsis Database Gene function Mutant line Ontology Phenotype Introduction Arabidopsis thaliana is one of the most commonly used experimental plants, and...”
  • “...genes and does not have known protein functions, including interaction, localization and enzyme activity. The AT5G56980 gene was found to encode an unknown protein that is disrupted and induced in the lines GT4800 and F21325, which were obtained as a loss-of-function line and a gain-of-function line,...”
• Generalist insects behave in a jasmonate-dependent manner on their host plants, leaving induced areas quickly and staying longer on distant parts
  Perkins, Proceedings. Biological sciences 2013
  • “...control of an early jasmonate-responsive promoter gene A70 (At5g56980) [35]. A bioluminescent LUC signal appeared around the feeding site in the elicited leaf...”
  • “...control of an early JA-responsive promoter gene A70 (At5g56980) [35] were constructed as follows: Promega pGL4-11 was digested with Fse1, ends were polished...”
• Arabidopsis systemic immunity uses conserved defense signaling pathways and is mediated by jasmonates
  Truman, Proceedings of the National Academy of Sciences of the United States of America 2007
  • “...A70 depends on RPM1 recognition. RNA blots of A70 (At5g56980) accumulation 4 hpi in local or systemic tissues after virulent (D) or avirulent (avrRpm1) (R) P....”
  • “...DC3000(avrRpm1) isolate. We identified one PIG, A70 (At5g56980), rapidly induced in systemic tissue after challenge with DC3000(avrRpm1) but not the compatible...”

LOC106389377 uncharacterized protein LOC106389377 from Brassica napus
Aligns to 339:373 / 375 (9.3%), covers 97.2% of PF05553, 60.7 bits

• CRb and PbBa8.1 Synergically Increases Resistant Genes Expression upon Infection of Plasmodiophora brassicae in Brassica napus
  Shah, Genes 2020
  • “...down-regulated in 618R and 305R as compared to 409R. In addition, two MAPK-signaling genes (BNAC02G11940D, LOC106389377) related to JA biosynthesis were strongly down-regulated in 618R as compared to 305R and 409R. Two genes related to ethylene receptor 2 (LOC106364668, LOC106446234) were up-regulated in 618R as compared...”

AT5G54300 hypothetical protein (RefSeq) from Arabidopsis thaliana
Aligns to 287:322 / 326 (11.0%), covers 97.2% of PF05553, 59.7 bits

• Constructing Networks of Organelle Functional Modules in Arabidopsis
  Penga, Current genomics 2016
  • “...AT5G43150 AT3G50260 AT3G28340 AT2G26530 AT2G35710 AT5G26920 AT3G50760 AT1G66090 AT1G21790 AT3G46110 AT1G29330 AT1G72520 AT1G50740 AT1G77450 AT5G67210 AT5G54300 AT5G06320 AT1G73805 AT2G23810 AT5G63790 AT5G10695 AT5G63790 AT5G06320 AT3G48090 AT3G06500 AT2G17040 AT4G19120 AT5G56980 AT4G01950 AT2G22080 AT5G47910 AT4G23810 AT1G02390 AT1G76650 AT1G43910 AT1G27770 AT4G36500 AT2G46510 AT3G25600 AT1G61890 AT3G55840 AT5G59550 AT5G37770 AT5G66210 AT1G74430 AT2G20370...”
• GhCFE1A, a dynamic linker between the ER network and actin cytoskeleton, plays an important role in cotton fibre cell initiation and elongation
  Lv, Journal of experimental botany 2015
  • “...XP_002316932.1 (POPTRDRA FT_771875), NP_176321.2 (At1g61260); NP_200241.1 (At5g54300), KF018237 (CFE1A A1), KF018238 (CFE1D D5), KF018239 (CFE1A TM-1), KF018240...”
  • “...and POPTRDRAFT_771875), and Arabidopsis thaliana (At1g61260 and At5g54300). Accession numbers are listed in the Materials and methods. (B) Phylogenetic analysis...”
• Arabidopsis extra large G-protein 2 (XLG2) interacts with the Gbeta subunit of heterotrimeric G protein and functions in disease resistance
  Zhu, Molecular plant 2009
  • “...1.35 247492_at At5g61890 unknown 0.48 1.50 * 248205_at At5g54300 unknown 0.50 1.10 246573_at At1g31680 copper amine oxidase-like 2.39 0.59 * 266590_at At2g46240...”

AT5G38700 hypothetical protein (RefSeq) from Arabidopsis thaliana
Aligns to 146:179 / 182 (18.7%), covers 86.1% of PF05553, 57.6 bits

• Global nucleosome positioning regulates salicylic acid mediated transcription in Arabidopsis thaliana
  Singh, BMC plant biology 2015
  • “...genes for each class (total six classes; i.e. SI-ND genes AT1G28480, AT1G80590, AT3G56400; SR-ND genes AT5G38700, AT4G37800, AT5G13220; SI-NI genes AT1G05700, AT1G09380, AT1G68450; SR-NI genes AT4G21850, AT1G66100, AT4G34410; CON genes AT5G02380, AT5G02500, AT5G60390 and SIL genes AT1G27380, AT4G23780, AT3G26130). For the internal control set, five exonic...”
• Accession-specific modifiers act with ZWILLE/ARGONAUTE10 to maintain shoot meristem stem cells during embryogenesis in Arabidopsis
  Tucker, BMC genomics 2013
  • “...0.017 FHE5 AT5G36910 249645_at THIONIN 2.2 16.5 0.002 AT5G38580 249517_at F-box family protein -3.2 0.014 AT5G38700 249522_at unknown protein 3.2 0.011 AT5G38960 249479_at germin-like protein, putative 6.2 0.003 AT5G39060 258246_s_at transposable element gene 17.0 0.000 AT5G39100 249495_at GERMIN-LIKE PROTEIN 6 -3.8 0.042 AT5G39210 249472_at CRR7 4.8...”

AT4G26130 hypothetical protein (RefSeq) from Arabidopsis thaliana
Aligns to 250:284 / 286 (12.2%), covers 94.4% of PF05553, 56.5 bits

• Identifying Early Warning Signals for the Sudden Transition from Mild to Severe Tobacco Etch Disease by Dynamical Network Biomarkers
  Tarazona, Viruses 2019
  • “..., LAP1 ), At3g02630 ( ACYL ACYL CARRIER PROTEIN (ACP) DESATURASE 5 , AAD5 ), At4g26130 (hypothetical protein described as a cotton fiber protein), At5g2107 (hypothetical protein described as a Fe 3+ di-citrate transport system permease), and At5g43940 ( ALCOHOL DEHYDROGENASE 2 ( ADH2 ), PARAQUAT...”

AT4G16790 hydroxyproline-rich glycoprotein family protein (RefSeq) from Arabidopsis thaliana
Aligns to 434:468 / 473 (7.4%), covers 88.9% of PF05553, 54.2 bits

• Transcriptomic profiling of linolenic acid-responsive genes in ROS signaling from RNA-seq data in Arabidopsis
  Mata-Pérez, Frontiers in plant science 2015
  • “...of NADH dehydrogenase complex I and cytochrome oxidase complex III ( AT2G07785, AT2G07689, ATMG00650, ATMG00285, AT4G16790, ATMG01360, ATMG00513, ATCG00890, ATCG01250, ATMG00580, ATMG00990, ATCG01090, ATMG00510, ATCG01080, ATCG01070, ATCG01100, ATCG01050, AT2G07751 , and ATCG01010 ). It has been reported that most photosynthesis-related genes are down-regulated after herbivore attack...”
• Conservation of microstructure between a sequenced region of the genome of rice and multiple segments of the genome of Arabidopsis thaliana
  Mayer, Genome research 2001
  • “...W AT4g17486 (2.7e-44) C; AT5g47310 (1.1e-50) W AT4g16790 (5.5e-7) C; AT3g60380 (4.4e-9) C AT3g44940 (1.7e-36) C; AT4g16750 (1.3e-31) C AT4g17340 (6.7e-97)...”

AT1G61260 hypothetical protein (RefSeq) from Arabidopsis thaliana
Aligns to 307:342 / 344 (10.5%), covers 100.0% of PF05553, 53.1 bits

• GhCFE1A, a dynamic linker between the ER network and actin cytoskeleton, plays an important role in cotton fibre cell initiation and elongation
  Lv, Journal of experimental botany 2015
  • “...(POPTRDRAFT_811252), XP_002316932.1 (POPTRDRA FT_771875), NP_176321.2 (At1g61260); NP_200241.1 (At5g54300), KF018237 (CFE1A A1), KF018238 (CFE1D D5), KF018239...”
  • “...POPTRDRAFT_811252, and POPTRDRAFT_771875), and Arabidopsis thaliana (At1g61260 and At5g54300). Accession numbers are listed in the Materials and methods....”

AT4G02170 hypothetical protein (RefSeq) from Arabidopsis thaliana
Aligns to 133:166 / 171 (19.9%), covers 83.3% of PF05553, 52.3 bits

• Gain-of-function mutation of AtDICE1, encoding a putative endoplasmic reticulum-localized membrane protein, causes defects in anisotropic cell elongation by disturbing cell wall integrity in Arabidopsis
  Le, Annals of botany 2018
  • “...3.6 3.3 9.3 YES AT2G38250 AT5G49520 AT3G57260 AT1G68290 AT2G17040 AT4G02170 AT4G02330 AT3G50770 121.0 284.6 74.7 172.0 1983.1 45.9 4488.5 504.3 P P P P P P P...”

AT5G06790 hypothetical protein (RefSeq) from Arabidopsis thaliana
Aligns to 172:207 / 209 (17.2%), covers 97.2% of PF05553, 48.2 bits

• Exposure to Sound Vibrations Lead to Transcriptomic, Proteomic and Hormonal Changes in Arabidopsis
  Ghosh, Scientific reports 2016
  • “...even a single gene that was commonly down-regulated at P <0.05. Two genes (At4g19430 and At5g06790) were commonly down-regulated by 500, 1000 and 3000Hz treatments. Three genes (At4g16447, At1g48330 and At2g21210) were down-regulated by 500, 2000, 3000Hz. Treatment with 500Hz shared maximum number of differentially expressed...”
  • “...in this group. Among them At2g20670 was highly induced by all SV treatments whereas At4g19430, At5g06790, At1g48330 and At4g16447 were down-regulated. Seven mechanostimulus responsive genes are also categorized in this group ( Fig. 2 ). Notably, many of the aforementioned genes discussed under different groups are...”

AT4G14380 hypothetical protein (RefSeq) from Arabidopsis thaliana
Aligns to 163:198 / 200 (18.0%), covers 94.4% of PF05553, 47.1 bits

• misMM: An Integrated Pipeline for Misassembly Detection Using Genotyping-by-Sequencing and Its Validation with BAC End Library Sequences and Gene Synteny
  Ko, Genomics & informatics 2017
  • “...Bra033489 A01 11,455,026 11,470,735 AT4G14350 Chr4 8,256,086 8,260,787 Included in MCB Bra033487 A04 4,917,814 4,918,407 AT4G14380 Chr4 8,285,766 8,286,772 Included in ADB Bra033486 A04 4,915,949 4,917,119 AT4G14385 Chr4 8,286,986 8,288,800 Included in ADB Bra033483 A04 4,882,642 4,883,358 AT4G14440 Chr4 8,306,745 8,307,753 Included in ADB Bra033482 A04...”
• Genome-wide SNP identification and QTL mapping for black rot resistance in cabbage
  Lee, BMC plant biology 2015
  • “...A01: 25,091,903 - 25,095,843 C01: 14,884,502 - 16,579,946 BRQTL-C1_2 Bo1g057060/070 Bra039560 A01: 11,678,267 - 11,687,802 AT4G14380 C01: 18,227,386 37,119,290 Bo1g086130 Bra013691 A01: 7,172,559 - 7,175,366 AT4G23440 Bo1g087610 Bra038144 Scaffold000140 AT1G57850 Bo1g091560 Bo1g094680/710 a Bra031456/455 a A01: 17,128,737 17,140,522 AT1G61100/105 a Bo1g103860 BRQTL-C3 Bo3g060060/070/080/100/110/130/140 a Bra001160/161/162 a...”

AT5G57510 hypothetical protein (RefSeq) from Arabidopsis thaliana
Aligns to 87:122 / 130 (27.7%), covers 88.9% of PF05553, 46.8 bits

• Functional characterization of drought-responsive modules and genes in Oryza sativa: a network-based approach
  Sircar, Frontiers in genetics 2015
  • “...WRKY71, CACTFTPPCA1 LOC_Os02g37180 Maize: GRMZM2G083855 (metal binding protein) ABRE, MYB, WRKY71, CACTFTPPCA1 LOC_Os08g34800 Arabidopsis : AT5G57510 Response to chitin ABRE, MYB, WRKY71, CACTFTPPCA1 LOC_Os12g05690 Arabidopsis : AT3G10120 Protein modification process, biosynthetic process ABRE, MYB, WRKY71, CACTFTPPCA1 LOC_Os02g53410 Maize: GRMZM2G139293 (conserved gene, unknown function) ABRE, MYB, WRKY71,...”
• Transcriptome analysis of Gossypium hirsutum flower buds infested by cotton boll weevil (Anthonomus grandis) larvae
  Artico, BMC genomics 2014
  • “...0.01 contig17371 CCR4 Serine/threonine-protein kinase-like domain AT5g47850 3.51 0 contig2100 MAPK3 Encodes a mitogen-activated kinase AT5g57510 4.27 8.61E-07 contig2102 MAPK3 Encodes a mitogen-activated kinase AT3g45640 2.17 2.57E-10 contig14909 MKK9 Member of MAP Kinase Kinase family AT1g73500 2.22 1.58E-10 contig7892 MAPKKK14 Member of MEKK subfamily AT2g30040 2.96...”

AT4G04990 hypothetical protein (RefSeq) from Arabidopsis thaliana
Aligns to 264:295 / 303 (10.6%), covers 83.3% of PF05553, 45.8 bits

• Arabidopsis thaliana transcription factors bZIP19 and bZIP23 regulate the adaptation to zinc deficiency
  Assunção, Proceedings of the National Academy of Sciences of the United States of America 2010
  • “...similar to unknown protein [Arabidopsis thaliana] (TAIR:AT1G61260.1) AT4G04990 Up-regulated LAC2 (laccase 2) AT2G29130 ANR1; DNA binding / transcription factor...”

LOC101293711 uncharacterized protein LOC101293711 from Fragaria vesca subsp. vesca
Aligns to 182:212 / 219 (14.2%), covers 77.8% of PF05553, 41.1 bits

• Disease Resistance Genetics and Genomics in Octoploid Strawberry
  Barbey, G3 (Bethesda, Md.) 2019
  • “...dawn Description augustus_masked-fvb1-2-processed-gene-27.2 cis 89817565 0.43 0.0418 30.4% 36.6 113.3 32.2 21.3 34.3 uncharacterized protein LOC101293711 augustus_masked-fvb1-4-processed-gene-7.11 cis 166502627 0.16 0.0150 43.4% 2.3 0.6 4.0 3.8 1.6 PLT5_ARATH Sugar-proton symporter PLT5 augustus_masked-fvb2-4-processed-gene-105.5 cis 166503861 0.29 0.0114 80.9% 0.0 0.0 2.8 1.8 1.3 TMVRN_NICGU TMV resistance N...”

AT3G60380 hypothetical protein (RefSeq) from Arabidopsis thaliana
Aligns to 700:729 / 743 (4.0%), covers 69.4% of PF05553, 40.4 bits

• Comparative transcriptome analysis of galls from four different host plants suggests the molecular mechanism of gall development
  Takeda, PloS one 2019
  • “...- - RNA polymerase AT5G56120 2.03 2.28 2.14 5.01 - - - cotton fiber protein AT3G60380 1.89 3.14 3.58 4.75 - - - phosphatidylinositol 4-phosphate 5-kinase MSS4-like protein AT1G29195 1.73 2.76 2.40 4.22 - - - TIP41-like protein AT3G54000 1.43 1.89 2.47 8.71 - - -...”
• Stable isotope metabolic labeling-based quantitative phosphoproteomic analysis of Arabidopsis mutants reveals ethylene-regulated time-dependent phosphoproteins and putative substrates of constitutive triple response 1 kinase
  Yang, Molecular & cellular proteomics : MCP 2013
  • “...347 AT2G30105 AT2G46180 AT3G08780 AT3G58440 AT3G60380 AT4G21930 AT4G37210 AT5G04550 32 AT5G63190 SHTLFADLNIKpSPTGGK KVQLSDSVQGYKpSPLR oxMGQpTPERPSISSVKK...”
• Characterization of the plasma membrane proteins and receptor-like kinases associated with secondary vascular differentiation in poplar
  Song, Plant molecular biology 2011
  • “...FU340 fgenesh4_pm.C_LG_VI000737 2 4 5 109593 At5g11560 Unknown protein FU9 eugene3.00400141 2 1 0 83569 At3g60380 Unknown protein FU13 eugene3.00081921 1 3 0 75211 At3g06150 Unknown protein FU30 estExt_Genewise1_v1.C_LG_IV3066 1 2 0 66269 At1g28240 Unknown protein FU66 fgenesh4_pm.C_LG_I000553 1 1 0 50584 At3g16200 Unknown protein FU76...”
• Conservation of microstructure between a sequenced region of the genome of rice and multiple segments of the genome of Arabidopsis thaliana
  Mayer, Genome research 2001
  • “...C; AT5g47310 (1.1e-50) W AT4g16790 (5.5e-7) C; AT3g60380 (4.4e-9) C AT3g44940 (1.7e-36) C; AT4g16750 (1.3e-31) C AT4g17340 (6.7e-97) W; AT5g47450 (4.1e-97)...”

AT5G13880 hypothetical protein (RefSeq) from Arabidopsis thaliana
Aligns to 151:179 / 188 (15.4%), covers 77.8% of PF05553, 37.6 bits

• Role of callose synthases in transfer cell wall development in tocopherol deficient Arabidopsis mutants
  Maeda, Frontiers in plant science 2014
  • “...At1g74055 1.00 0.00 4.18 Expressed protein At1g30370 1.60 0.01 3.80 Lipase class 3 family protein At5g13880 1.45 0.01 3.60 Expressed protein At3g49130 0.94 0.01 3.16 Hypothetical protein At5g46590 1.31 0.01 3.09 No apical meristem (NAM) family protein At3g21780 0.91 0.01 3.09 UDP-glucosyl transferase family protein At1g17180...”

AT5G61710 hypothetical protein (RefSeq) from Arabidopsis thaliana
Aligns to 117:149 / 155 (21.3%), covers 86.1% of PF05553, 36.7 bits

• The Arabidopsis ABA-activated kinase OST1 phosphorylates the bZIP transcription factor ABF3 and creates a 14-3-3 binding site involved in its turnover
  Sirichandra, PloS one 2010
  • “...1,8 At4g40020 Unknown protein LVRRKSLSFS 9,20E-08 13 6,4 At2g31560 Unknown protein LTRAKSLTDD 1,00E-06 14 8,1 At5g61710 Unknown protein LRRRRTSNTR 1,70E-06 21 12 At4g26950 Unknown protein LRRSRSSSSS 2,70E-06 24 13 At3g12870 Unknown protein LRRAKSLRVE 2,00E-06 24 13 At2g43340 Unknown protein LKRTKSLTDD 2,20E-06 29 17 At4g19970 Unknown protein...”
• Pollen development and fertilization in Arabidopsis is dependent on the MALE GAMETOGENESIS IMPAIRED ANTHERS gene encoding a type V P-type ATPase
  Jakobsen, Genes & development 2005
  • “...At1g68610 At1g01460 At2g35210 At1g44160 At3g09530 At5g61710 At4g15980 At3g03800 At4g00350 At3g04630 At1g52240 At1g61290 At2g47340 At1g79860 At1g75870 At4g04980...”

AT1G72790 hydroxyproline-rich glycoprotein family protein (RefSeq) from Arabidopsis thaliana
Aligns to 507:538 / 561 (5.7%), covers 77.8% of PF05553, 36.7 bits

• Suppression of ASKβ (AtSK32), a Clade III Arabidopsis GSK3, Leads to the Pollen Defect during Late Pollen Development
  Dong, Molecules and cells 2015
  • “...phosphorylated at the potential priming sites: PEP carboxykinase PCK1, RanBP domain-containing protein, thioredoxin-regulated beta-amylase TR-BAMY, At1g72790, remorin family protein, At4g11270, nodulin family protein, RabGAP/TBC domain-containing protein AtGYPC1b, glycine-rich protein and At3g01160 ( de la Fuente van Bentem et al., 2008 ). All ASKs in clade II,...”

AT4G29110 hypothetical protein (RefSeq) from Arabidopsis thaliana
Aligns to 162:187 / 200 (13.0%), covers 61.1% of PF05553, 34.8 bits

• The Histone Deacetylase Inhibitor Suberoylanilide Hydroxamic Acid Alleviates Salinity Stress in Cassava
  Patanun, Frontiers in plant science 2016
  • “...receptor-like cytoplasmic kinase 2 4.438 1.88E-06 RknMes02_051803 AT3G09270 Glutathione S-transferase TAU 8 4.369 1.29E-05 RknMes02_037654 AT4G29110 Unknown protein 4.337 7.18E-06 RknMes02_051464 AT3G06240 F-box family protein 4.284 2.95E-06 RknMes02_053782 AT4G17380 MUTS-like protein 4 4.231 1.34E-05 RknMes02_049288 AT5G52060 BCL-2-associated athanogene 1 4.218 2.22E-05 RknMes02_000416 AT2G26870 Non-specific phospholipase C2...”
  • “...3.199 1.34E-06 RknMes02_044414 3.137 2.80E-05 RknMes02_054888 AT1G01690 Putative recombination initiation defects 3 3.128 5.59E-06 RknMes02_037654 AT4G29110 Unknown protein 2.989 7.18E-06 RknMes02_055397 AT2G26140 FTSH protease 4 2.940 7.16E-06 RknMes02_052664 AT5G64310 Arabinogalactan protein 1 2.918 4.99E-05 RknMes02_001499 AT5G54160 O-methyltransferase 1 2.918 8.90E-05 RknMes02_012269 AT1G06460 Alpha-crystallin domain 32.1 2.841...”

LOC101762337 uncharacterized protein LOC101762337 from Setaria italica
Aligns to 174:195 / 204 (10.8%), covers 55.6% of PF05553, 28.4 bits

• Functional Identification and Characterization of Genes Cloned from Halophyte Seashore Paspalum Conferring Salinity and Cadmium Tolerance
  Chen, Frontiers in plant science 2016
  • “...isoform X2 [ Setaria italica ] ACGCGGCAAACGCCACTGCTCCTCTCCTCATC CTCTTCCTCTTCCCCGCCTCCCTCGCC TCGCC ATG GCC 19 KT203476 Uncharacterized protein LOC101762337 [ Setaria italica ] ACATCACATACATGCATGTAGGCTCACAAAAA CCCTAGTCGCAGCACCTTGCTGGC ATG GCT 20 KT203477 Phosphoenolpyruvate carboxylase 1 [ Aegilops tauschii ] GCCTCGCTCAGCAGCAAAAACACGCGGCCCTT GCTCTTGCTTCGTTCTCGCTTCCCGCCCCGCC ATG GCG 21 KT203478 Chlorophyll a-b binding protein M9, chloroplastic-like [...”

AT4G32860 hypothetical protein (RefSeq) from Arabidopsis thaliana
Aligns to 172:197 / 199 (13.1%), covers 55.6% of PF05553, 28.2 bits

• Optimized probe masking for comparative transcriptomics of closely related species
  Poeschl, PloS one 2013
  • “...2.05 1.94 C,D 251910_at AT3G53810 485775 -1-0-0- x1xxx-xx0- 1.31 1.10 NA 0.28 0.24 C,D 253400_at AT4G32860 491410 -11-010-1 x-11x0-0xx1 1.42 0.91 NA 0.09 0.12 C,D 253959_at AT4G26410 945436 1011-01- -11-xxx0- 0.27 0.07 NA 0.08 0.00 C,D 261766_at AT1G15580 471758 -1-0-111- x-1xx0x-x 4.46 1.54 NA 0.38 0.61...”

LOC101510669 uncharacterized protein LOC101510669 from Cicer arietinum
Aligns to 217:253 / 253 (14.6%), covers 91.7% of PF05553, 28.0 bits

• Overexpression of Chickpea Defensin Gene Confers Tolerance to Water-Deficit Stress in Arabidopsis thaliana
  Kumar, Frontiers in plant science 2019
  • “...2.60722 101501038 Ca3 uncharacterized LOC101501038 protein-coding 95 LOC101508795 1.99777 101508795 Ca6 uncharacterized LOC101508795 protein-coding 96 LOC101510669 2.23982 101510669 Ca8 uncharacterized LOC101510669 protein-coding 97 LOC101511932 2.82384 101511932 Ca2 uncharacterized LOC101511932 protein-coding 98 LOC101512423 3.25588 101512423 Ca5 uncharacterized LOC101512423 protein-coding 99 LOC101515113 1.63132 101515113 Ca4 uncharacterized LOC101515113 protein-coding...”

AT1G52140 hypothetical protein (RefSeq) from Arabidopsis thaliana
Aligns to 180:206 / 208 (13.0%), covers 63.9% of PF05553, 27.1 bits

• RNA sequencing of Populus x canadensis roots identifies key molecular mechanisms underlying physiological adaption to excess zinc
  Ariani, PloS one 2015
  • “...4,68 0 POPTR_0018s03780 NA flowering promoting factor 1 ATFPF1 1,91 1,22 0,01 POPTR_0018s08240 NA protein AT1G52140 2,1 1,74 0 POPTR_0018s13070 NA ein3-binding f-box protein 1-like EBF1 1,72 0,98 0,01 POPTR_0018s14270 NA trans-cinnamate 4-monooxygenase NA 2,02 2,74 0 POPTR_0018s14280 NA superkiller viralicidic activity 2-like 2-like HEN2 1,89...”
• Hyperosmotic priming of Arabidopsis seedlings establishes a long-term somatic memory accompanied by specific changes of the epigenome
  Sani, Genome biology 2013
  • “...36); hydrolase Down 200 400 Down AT1G52070 Jacalin lectin family protein Down 200 200 Down AT1G52140 Unknown protein Down 1,800 200 Down AT1G52410 TSA1; calcium ion binding/protein binding Down 800 200 Down AT1G56650 PAP1; transcription factor Down 600 200 Down AT1G57830 Toll-Interleukin-Resistance (TIR) domain Down 400...”

Or search for genetic data about PF05553 in the Fitness Browser