Family Search for PF05603 (Hikeshi-like_N)

PF05603 hits 8 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.

HIKES_HUMAN / Q53FT3 Protein Hikeshi from Homo sapiens (Human) (see 3 papers)
NP_057485 protein Hikeshi isoform 1 from Homo sapiens
Aligns to 5:132 / 197 (65.0%), covers 96.2% of PF05603, 132.2 bits

• function: Acts as a specific nuclear import carrier for HSP70 proteins following heat-shock stress: acts by mediating the nucleoporin- dependent translocation of ATP-bound HSP70 proteins into the nucleus. HSP70 proteins import is required to protect cells from heat shock damages. Does not translocate ADP-bound HSP70 proteins into the nucleus.
  subunit: Forms an asymmetric homodimer; required for binding and nuclear import of HSP70 proteins (PubMed:25760597). Interacts with ATP- bound HSP70 proteins (PubMed:22541429). Interacts with NUP62 and NUP153 (via F-X-F-G repeats) (PubMed:22541429). Interacts with HSPA8 (PubMed:25760597).
• Integrating Genetics, Transcriptomics, and Proteomics in Lung Tissue to Investigate Chronic Obstructive Pulmonary Disease.
  Zhang, American journal of respiratory cell and molecular biology 2023
• Gene network downstream plant stress response modulated by peroxisomal H2O2.
  Terrón-Camero, Frontiers in plant science 2022
  • “...LRR family protein A6NIV6 LRRIQ4-LRR and IQ domain-containing protein 4 AT1G66080 A0A178W730 nuclear import carrier Q53FT3 HIKESHI-Protein Hikeshi AT2G37770 A0A178W1B1 oxidoreductase activity Q04828 AKR1C1-Aldo-keto reductase family 1 member C1 AT2G45570 F4HRA1 CYP76C5-Cytochrome P450 A0N0X8 CYP1A1-Cytochrome P450 AT3G26680 O64649 Sterile alpha motif (SAM) domain-containing protein Q6PJP8 DCLRE1A-DNAcross-link...”
• Functional classification of cellular proteome profiles support the identification of drug resistance signatures in melanoma cells.
  Paulitschke, Journal of proteome research 2013
  • “...P35659, P36957, P49406, P61619, P62312, P82664, Q02978, Q04446, Q14004, Q14197, Q14694, Q15293, Q16643, Q16698, Q2VIR3, Q53FT3, Q70UQ0, Q8IYD1, Q8N5M4, Q8WWI1, Q92466, Q9BTW9, Q9HAN9, Q9NYV4, Q9NZB2, Q9UID3, Q9UIJ7, Q9Y4P3, Q9Y5J7 (CF). Classification of these proteins by cellular processes (C), enzymatic activity (D), binding activity (E), and pathology,...”
• Comparison of extensive protein fractionation and repetitive LC-MS/MS analyses on depth of analysis for complex proteomes.
  Wang, Journal of proteome research 2010
  • “...c ID a Name Sequence X corr C n z X corr C n z Q53FT3 Uncharacterized protein C11orf73 R.LVQTAAQQVAEDK.F 4.74 0.35 2 4.62 0.35 2 R.LAQNPLFWK.T 2.69 0.185 2 2.11 0.046 2 Q8IW35 Leucine-rich repeat and IQ domain-containing protein 2 K.AGLLPCPEPTIISAILK.D 3.39 0.129 3 2.94...”
• The interaction between the import carrier Hikeshi and HSP70 is modulated by heat, facilitating the nuclear import of HSP70 under heat stress conditions.
  Kose, Genes to cells : devoted to molecular & cellular mechanisms 2024 (PubMed)
  • GeneRIF: The interaction between the import carrier Hikeshi and HSP70 is modulated by heat, facilitating the nuclear import of HSP70 under heat stress conditions.
• Further Delineation of the Clinical and Pathologic Features of HIKESHI-Related Hypomyelinating Leukodystrophy.
  Helman, Pediatric neurology 2021
  • GeneRIF: Further Delineation of the Clinical and Pathologic Features of HIKESHI-Related Hypomyelinating Leukodystrophy.
• HIKESHI silencing can enhance mild hyperthermia sensitivity in human oral squamous cell carcinoma HSC‑3 cells.
  Tabuchi, International journal of molecular medicine 2020
  • GeneRIF: HIKESHI silencing can enhance mild hyperthermia sensitivity in human oral squamous cell carcinoma HSC3 cells.
• Absence of Hikeshi, a nuclear transporter for heat-shock protein HSP70, causes infantile hypomyelinating leukoencephalopathy.
  Vasilescu, European journal of human genetics : EJHG 2017
  • GeneRIF: A novel homozygous variant in HIKESHI was identified in a patient with hypomyelinating leukoencephalopathy with periventricular cysts and vermian atrophy. Modified interactions inside Hikeshi's hydrophobic pockets induce mutant protein instability.
• Heat shock-induced HIKESHI protects cell viability via nuclear translocation of heat shock protein 70.
  Yanoma, Oncology reports 2017 (PubMed)
  • GeneRIF: Our results suggest that HIKESHI is a marker of cancer progression and that the combination of HIKESHI inhibition and hyperthermia is a therapeutic tool for refractory gastric cancer
• Hikeshi modulates the proteotoxic stress response in human cells: Implication for the importance of the nuclear function of HSP70s.
  Rahman, Genes to cells : devoted to molecular & cellular mechanisms 2017 (PubMed)
  • GeneRIF: Depletion of Hikeshi renders HeLa cells proteotoxic stress-sensitive through the abrogation of the nuclear function of HSP70s required for HSF1 regulation.
• Leukoencephalopathy and early death associated with an Ashkenazi-Jewish founder mutation in the Hikeshi gene.
  Edvardson, Journal of medical genetics 2016 (PubMed)
  • GeneRIF: Leukoencephalopathy and early death associated with an Ashkenazi-Jewish founder mutation in the Hikeshi gene.P.V54L mutation in Hikeshi is associated with absence of nuclear HSP70 during heat shock stress.
• Structural and functional analysis of Hikeshi, a new nuclear transport receptor of Hsp70s.
  Song, Acta crystallographica. Section D, Biological crystallography 2015 (PubMed)
  • GeneRIF: The crystal structure of Hikeshi explains how Hikeshi participates in the regulation of nuclear import through the recognition of FG-Nups and which part of Hikeshi affects its binding to Hsp70.
• More

HIKES_MOUSE / Q9DD02 Protein Hikeshi; Lethal gene on chromosome 7 Rinchik 6 protein from Mus musculus (Mouse) (see 2 papers)
Q5M808 Protein Hikeshi from Rattus norvegicus
Aligns to 5:132 / 197 (65.0%), covers 95.5% of PF05603, 131.7 bits

• function: Acts as a specific nuclear import carrier for HSP70 proteins following heat-shock stress: acts by mediating the nucleoporin- dependent translocation of ATP-bound HSP70 proteins into the nucleus. HSP70 proteins import is required to protect cells from heat shock damages. Does not translocate ADP-bound HSP70 proteins into the nucleus (By similarity). May also be indirectly required for organization and/or function of the secretory apparatus in Club cells in lung.
  subunit: Forms an asymmetric homodimer; required for binding and nuclear import of HSP70 proteins. Interacts with ATP-bound HSP70 proteins. Interacts with NUP62 and NUP153 (via F-X-F-G repeats). Interacts with HSPA8.
  disruption phenotype: Mice display severe emphysematous enlargement of the distal respiratory sacs at birth. Club cells display enlargement and disorganization of the Golgi complex and formation of aberrant vesicular structures.
• Proteomic investigation of acute and chronic hypoxia/reoxygenation responsive proteins and pathways in H9C2 cardiomyoblasts
  Öztuğ, Turkish journal of biology = Turk biyoloji dergisi 2024
  • “...Q4QQV3 Protein FAM162A 1.56564E-16 Q5U1Y4 1,5-anhydro-D-fructose reductase 1.56564E-16 Q63135 Complement component receptor 1-like protein 1.03506E-06 Q5M808 Protein Hikeshi 0.029882805 Q5PQX0 UDP-glucuronic acid decarboxylase 1 2.96014E-06 Q9ES66 Calpain-10 0.009777426 Q641Y1 Transmembrane reductase CYB561D2 0.001315411 Q4V888 Type 2 phosphatidylinositol 4,5-bisphosphate 4-phosphatase 0.001359204 P36201 Cysteine-rich protein 2 2.78761E-05 P09759...”

OPI10_SCHPO / O60175 Protein OPI10 homolog from Schizosaccharomyces pombe (strain 972 / ATCC 24843) (Fission yeast) (see paper)
NP_595931 hikeshi family nuclear import carrier Opi10 from Schizosaccharomyces pombe
SPBC21H7.06c inositol metabolism protein Opi10 (predicted) from Schizosaccharomyces pombe
Aligns to 5:121 / 200 (58.5%), covers 94.0% of PF05603, 126.0 bits

• The Schizosaccharomyces pombe Hikeshi/Opi10 protein has similar biochemical functions to its human homolog but acts in different physiological contexts.
  Oda, FEBS letters 2014 (PubMed)
  • GeneRIF: Data indicate taht Opi10 is required for the normal expression of stress response genes under optimal conditions and for cell growth during glucose deprivation.
• A genome-wide screen for sporulation-defective mutants in Schizosaccharomyces pombe
  Ucisik-Akkaya, G3 (Bethesda, Md.) 2014
  • “...SPBC29A10.02 No match spo6 SPBC1778.04 No match SPBC15C4.06c No match apq12 SPBC428.04 Matches with cyp9 SPBC21H7.06c Matches with cyp9 SPAC139.01c Matches with nrd1 SPBC23G7.06c Matches with nrd1 SPBC1711.08 Matches with nrd1 To test the effectiveness of our screen, we culled from the literature a list of...”
• Transcription factors Pcr1 and Atf1 have distinct roles in stress- and Sty1-dependent gene regulation
  Sansó, Eukaryotic cell 2008
  • “...SPACUNK4.15 ght2 SPAC26F1.04c SPAC4H3.04c SPAC3G9.11c SPAC186.02c SPAC16A10.01 SPBC21H7.06c psi1 a WT, Unt atf1, Untb pcr1, Untb WT, KClb atf1, KClc pcr1,...”

CG13926 uncharacterized protein from Drosophila melanogaster
Aligns to 7:136 / 197 (66.0%), covers 98.5% of PF05603, 124.0 bits

• Detecting New Allies: Modifier Screen Identifies a Genetic Interaction Between Imaginal disc growth factor 3 and combover, a Rho-kinase Substrate, During Dorsal Appendage Tube Formation in Drosophila
  Espinoza, G3 (Bethesda, Md.) 2020
  • “...Df(3L)Exel9004 No effect a Df(3L)BSC414 Suppressor a Df(3L)BSC289 Enhancer Df(3L)BSC426 Enhancer ABCBC7 GC CG13928 CG33230 CG13926 Df(3L)ED4256 No effect Df(3L)Exel6087 No effect a Df(3L)ED230 Suppressor a Df(3L)BSC451 Enhancer Df(3L)TO2 Suppressor Df(3L)BSC554 Suppressor maelstrom CG14450 CG11367 CG32454 CG11241 l(3)04053 CG7369 a Df(3L)BSC23 Suppressor a Df(3L)BSC671 No effect...”
• Complementary transcriptomic, lipidomic, and targeted functional genetic analyses in cultured Drosophila cells highlight the role of glycerophospholipid metabolism in Flock House virus RNA replication
  Castorena, BMC genomics 2010
  • “...- CG7967 - CG8620 - CG9796 - CG12022 - CG12084 - CG13117 - CG13917 - CG13926 - CG14642 - CG33191 - CG34349 - CG42324 Cyp6a17 Cyp6a17 meso18E meso18E Msr-110 Msr-110 unc-119 unc-119 Biological process designation was determined from either direct GO biological process terms or inferred...”

OPI10_YEAST / Q08202 Protein OPI10; Overproducer of inositol protein 10 from Saccharomyces cerevisiae (strain ATCC 204508 / S288c) (Baker's yeast) (see 3 papers)
YOL032W Opi10p from Saccharomyces cerevisiae
Aligns to 5:155 / 246 (61.4%), covers 99.2% of PF05603, 122.5 bits

• function: Involved in phospholipid biosynthesis.
• The Role of Ancestral Duplicated Genes in Adaptation to Growth on Lactate, a Non-Fermentable Carbon Source for the Yeast Saccharomyces cerevisiae
  Mattenberger, International journal of molecular sciences 2021
  • “...were Ctr1 (YPR124W), Gph3 (YPR160W), Gsy2 (YLR258W; WGD), Tma10 (YLR327C; WGD), Pgm2 (YMR105C; WGD), Opi10 (YOL032W), Gad1 (YMR250W; SSD), Fes1 (YBR101C), Rgi (YER067W; WGD), Btn2 (YGR142W; WGD), Rie1 (YGR250C), Tdh1 (YJL052W), Roq1 (YJL144W) and Mrs4 (YKR052C; WGD). 2.7. Metabolic Evolution of YPL Adapted S. cerevisiae Populations...”
• Transcriptional profiling reveals molecular basis and novel genetic targets for improved resistance to multiple fermentation inhibitors in Saccharomyces cerevisiae
  Chen, Biotechnology for biofuels 2016
  • “...YDL174C, YDL193W, YER062C, YFL053W, YGL134W, YGR254W, YHR046C, YHR174W, YJR096W, YKL201C, YLL026W, YML100W, YMR135C, YMR145C, YNR001C, YOL032W, YOL059W, YOL086C, YOL136C, YOR299W Response to chemical (GO:0042221) YBR006W, YBR101C, YCR021C, YDL124W, YDR135C, YFL053W, YFR022W, YGR008C, YJL034W, YJL128C, YJR096W, YKL062W, YKL073W, YKL109W, YKR066C, YKR071C, YLL026W, YLR350W, YMR250W, YNL007C, YOL081W, YPL026C,...”
• New insight into the role of the Cdc34 ubiquitin-conjugating enzyme in cell cycle regulation via Ace2 and Sic1
  Cocklin, Genetics 2011
  • “...YNL077W YJL082W YBR214W YPL247C YNL007C YOR267C YFL040W YOL032W YBR101C YER035W YHL021C YGR088W YER028C YNR014W YMR316W YER053C YOL016C YGL179C YLR121C...”
• Genomic analysis of the Opi- phenotype
  Hancock, Genetics 2006
  • “...ldb16, ycl006c, ydl096c, ydr360w, ykr035c, ylr338w, yol032w, ypr044c Enzyme assays: b-Galactosidase and chloramphenicol acetyltransferase (Cat) assays were...”
  • “...vps24, vps74, ypt6, ysp3, ydl096c, ydr360w, ykr035c, yol032w, ypr044c clathrin-independent transport of proteins (such as alkaline phosphatase, Vam3p, and...”
• l7Rn6 encodes a novel protein required for clara cell function in mouse lung development
  Fernández-Valdivia, Genetics 2006
  • “...yeast two-hybrid screening identified physical interaction of YOL032W and Sec17, the Saccharomyces homolog of l7Rn6 and a-SNAP, respectively (Uetz et al....”
• Global phenotypic analysis and transcriptional profiling defines the weak acid stress response regulon in Saccharomyces cerevisiae
  Schüller, Molecular biology of the cell 2004
  • “...following input ORFs: YNR002C, YPL058C, YPL122C, YNR030W, YOL032W, and YGR046W. A logo generator (http://weblogo.berkeley.edu/ logo.cgi) was used for graphical...”
  • “...YMR172W YOR052C YKL095W YNL194C YNL200C YOL048C YIL136W YOL032W YER103W YBR116C YPR156C YGR046W YPL247C YOR134W YPR157W Biological process unknown Protein...”

XP_006508196 protein Hikeshi isoform X2 from Mus musculus
Aligns to 5:100 / 130 (73.8%), covers 63.2% of PF05603, 115.2 bits

• Nuclear import carrier Hikeshi cooperates with HSP70 to promote murine oligodendrocyte differentiation and CNS myelination.
  Li, Developmental cell 2023 (PubMed)
  • GeneRIF: Nuclear import carrier Hikeshi cooperates with HSP70 to promote murine oligodendrocyte differentiation and CNS myelination.
• Upstream and downstream mechanisms for the promoting effects of IGF-1 on differentiation of spermatogonia to primary spermatocytes.
  Shen, Life sciences 2014 (PubMed)
  • GeneRIF: study identified downregulation of let-7 as an upstream mechanism for IGF1/IGF1R upregulation and activation of ERK1/2 and PI3K as a downstream mechanism mediating the IGF1 signaling cascade promoting spermatogenesis.

AT1G66080 hypothetical protein from Arabidopsis thaliana
A0A178W730 Uncharacterized protein from Arabidopsis thaliana
Aligns to 10:131 / 190 (64.2%), covers 84.2% of PF05603, 46.2 bits

• Gene network downstream plant stress response modulated by peroxisomal H₂O₂
  Terrón-Camero, Frontiers in plant science 2022
  • “...HSPBP1 (Fes1A)-Hsp70-binding 1 AT1G33600 Q9FW48 LRR family protein A6NIV6 LRRIQ4-LRR and IQ domain-containing protein 4 AT1G66080 A0A178W730 nuclear import carrier Q53FT3 HIKESHI-Protein Hikeshi AT2G37770 A0A178W1B1 oxidoreductase activity Q04828 AKR1C1-Aldo-keto reductase family 1 member C1 AT2G45570 F4HRA1 CYP76C5-Cytochrome P450 A0N0X8 CYP1A1-Cytochrome P450 AT3G26680 O64649 Sterile alpha motif...”
• Pre-harvest climate and post-harvest acclimation to cold prevent from superficial scald development in Granny Smith apples
  Marc, Scientific reports 2020
  • “...2.36 MD04G1022400 0 AT5G48570 ROF2 FKBP-type peptidyl-prolyl cis-trans isomerase H MDP0000275263 2.00 MD09G1263000 510 112 AT1G66080 Protein of unknown function DUF775 H MDP0000273764 1.06 MD17G1258000 910 116 AT1G66080 Protein of unknown function DUF775 H MDP0000917573 1.68 MD02G1050200 510 70 AT3G24500 ATMBF1C Multiprotein bridging factor 1C H...”
• An expanded nuclear phylogenomic PCR toolkit for Sapindales
  Collins, Applications in plant sciences 2016
  • “...KX767939 610750 X X X X X X X X X X X R: ACGACTTGGCTGATCTCTGAATAA AT1G66080 F: CCTCTTCTCTTCCATAGTGTTGCT 900 X R: CCCACAAAACGACTGCATAAAGTT AT2G05170B c F: GCACAGTACATTAACACCATTGGT 430480 X X X X X X X X X R: TGGCTTGTGGTCTATGAGAATCTT AT1G65070 F: CCTAATACTGGAGGGAAAACTGCT KX767914 KX767915 510600 X X...”
• TOPOISOMERASE 6B is involved in chromatin remodelling associated with control of carbon partitioning into secondary metabolites and cell walls, and epidermal morphogenesis in Arabidopsis
  Mittal, Journal of experimental botany 2014
  • “...responsive ; At1g24140/matrixin metallopeptidase and At1g24150/formin homologue4 ; At1g28370/ERF-AP2 domain11 and At1g28380/necrotic spotted lesions1 ; At1g66080 /unknown and At1g66090/LRR-NBS receptor kinase ; At1g74930/DREB subfamily A-5 and At1g74940/DUF581 ; At2g18690 /unknown and At2g18700/TSP11 ; AT3G25600/ EF-hand family protein and AT3G25610/haloacid dehalogenase ; AT4G27652 and AT4G27654 (unrelated unknowns);...”
• The role of the Arabidopsis FUSCA3 transcription factor during inhibition of seed germination at high temperature
  Chiu, BMC plant biology 2012
  • “...trans acting-siR480/255 At4g23570 SGT1A_phosphatase-related At4g02980 endoplasmic reticulum auxin binding protein 1 (ABP1) At4g10250 ATHSP22.0_HSP20-like chaperones At1g66080 unknown protein At3g14880 unknown protein At3g24500 multiprotein bridging factor 1 C (ATMBF1C) At3g16050 pyridoxine biosynthesis 1.2 (A37_ATPDX1.2) At3g07150 unknown protein At1g07350 RNA-binding protein (RRM/RBD/RNP motifs) At1g26800 RING/U-box superfamily protein At1g35660...”
• Evidence for a DNA-Based Mechanism of Intron-Mediated Enhancement
  Rose, Frontiers in plant science 2011
  • “...=11 CO>AT>CO 10.61.7, n =14 5.00.9, n =15 CO<AT<CO 4.70.8, n =4 3.30.6, n =6 At1g66080 11.94.1, n =8 5.71.8, n =11 The steady state levels of GUS enzyme activity and GUS mRNA accumulation in lines containing a single-copy TRP1:GUS fusion with the indicated intron are...”
  • “...the reverse strand had a positive IMEter score. We chose the first intron from the At1g66080 gene for further study because it has the highest IMEter score on its reverse strand of all 20,411 introns with negative scores on the transcribed strand. This intron would not...”
• Gene network downstream plant stress response modulated by peroxisomal H₂O₂
  Terrón-Camero, Frontiers in plant science 2022
  • “...(Fes1A)-Hsp70-binding 1 AT1G33600 Q9FW48 LRR family protein A6NIV6 LRRIQ4-LRR and IQ domain-containing protein 4 AT1G66080 A0A178W730 nuclear import carrier Q53FT3 HIKESHI-Protein Hikeshi AT2G37770 A0A178W1B1 oxidoreductase activity Q04828 AKR1C1-Aldo-keto reductase family 1 member C1 AT2G45570 F4HRA1 CYP76C5-Cytochrome P450 A0N0X8 CYP1A1-Cytochrome P450 AT3G26680 O64649 Sterile alpha motif (SAM)...”

B6TQX0 Hikeshi-like domain-containing protein from Zea mays
Aligns to 12:125 / 180 (63.3%), covers 54.9% of PF05603, 40.1 bits

• The Difference of Physiological and Proteomic Changes in Maize Leaves Adaptation to Drought, Heat, and Combined Both Stresses
  Zhao, Frontiers in plant science 2016
  • “...II reaction center protein L/ P60138 + Protein phosphatase 2C/ B6T9X8 + Putative uncharacterized protein/ B6TQX0 + + Cytochrome b559 subunit beta/ P69523 + Thiamine thiazole synthase, chloroplastic/ B4FSE1 + 16.9 kDa class I heat shock protein 1/ B6TTC8 + + Iron-sulfur assembly protein IscA, mRNA/...”

Or search for genetic data about PF05603 in the Fitness Browser