Family Search for PF05768 (DUF836)

PF05768.14 hits 72 sequences in PaperBLAST's database above the trusted cutoff. Showing all hits. Or show only hits to curated sequences or try another family.

AT4G08280 hypothetical protein (RefSeq) from Arabidopsis thaliana
Aligns to 34:122 / 126 (70.6%), covers 98.8% of PF05768, 78.6 bits

• Transcriptome-wide high-throughput deep m(6)A-seq reveals unique differential m(6)A methylation patterns between three organs in Arabidopsis thaliana
  Wan, Genome biology 2015
  • “...22 33 ] Redox process AT1G50430, AT1G67140, AT1G76150, AT2G27110, AT1G80560, AT2G07687, AT2G07727, AT2G38020, AT3G20560, AT2G48060, AT4G08280, AT4G23420, AT4G39850, AT5G42790, AT5G65750, AT4G01860, AT3G08950, AT3G01380, AT4G36080, AT2G43420, AT4G16310, AT5G21060, AT1G56000, AT4G17150, AT5G08470, AT4G16070, AT4G30993, AT3G20560 [ 18 , 34 36 ] Signal transduction AT1G03060, AT1G43130, AT1G48090, AT1G51690, AT1G58250,...”

asl1664 hypothetical protein (NCBI ptt file) from Nostoc sp. PCC 7120
Aligns to 2:83 / 95 (86.3%), covers 98.8% of PF05768, 78.0 bits

• The nitrogen-regulated response regulator NrrA controls cyanophycin synthesis and glycogen catabolism in the cyanobacterium Synechocystis sp. PCC 6803
  Liu, The Journal of biological chemistry 2014
  • “...4.76 alr4249 sigE AATTCTCAGTAGTTAACA -32 4.37 asl1664 asl1664-murE TATCATGTATTCTTTACA -52 4.67 asr0064 asr0064 TGTCAGGAAATTTTGACA -182 4.64 hetR...”

Tery_4152 glutaredoxin 2 (NCBI) from Trichodesmium erythraeum IMS101
Aligns to 2:88 / 91 (95.6%), covers 98.8% of PF05768, 74.4 bits

• The nitrogen-regulated response regulator NrrA controls cyanophycin synthesis and glycogen catabolism in the cyanobacterium Synechocystis sp. PCC 6803
  Liu, The Journal of biological chemistry 2014
  • “...73102 Trichodesmium erythraeum IMS101 Tery_1921 19 Tery_4152 Tery_4152-murE AATGCTCAAAAGTTTACT -144 4.38 Tery_4481 glyS-murD TGTCCTCGTAAATTAATA -392 4.46 a...”

NGO_0331 glutaredoxin family protein from Neisseria gonorrhoeae FA 1090
Aligns to 2:76 / 77 (97.4%), covers 100.0% of PF05768, 70.2 bits

• Iron-regulated small RNA expression as Neisseria gonorrhoeae FA 1090 transitions into stationary phase growth
  Jackson, BMC genomics 2017
  • “...Fe dependent small RNAs FA 1090 5 ORF sRNA Orientation 3 ORF Fe Regulation NrsA NGO_0331 trans a NGO_0332 Induced NrsB NGO_0686 trans NGO_0687 Induced NrsC NGO_1221 trans NGO_1222 Induced NrsD NGO_1651 trans a NGO_1652 Induced NrsE NGO_1713 trans NGO_1714 Induced a RIT present Relative concentration...”

NE2328 putative thioredoxin (NCBI ptt file) from Nitrosomonas europaea ATCC 19718
Aligns to 9:85 / 85 (90.6%), covers 98.8% of PF05768, 68.6 bits

• Transcriptomic Response of Nitrosomonas europaea Transitioned from Ammonia- to Oxygen-Limited Steady-State Growth
  Sedlacek, mSystems 2020
  • “...TableS2 ; Data Set S1 ). Surprisingly, rubredoxin (NE1426) and a glutaredoxin family protein-encoding gene (NE2328) did not follow this trend and were transcribed at significantly higher levels (2.8- and 1.8-fold, respectively) during O 2 -limited growth ( TableS2 ). Although their role in N. europaea...”

BA5371 glutaredoxin family protein (NCBI ptt file) from Bacillus anthracis str. Ames
Aligns to 2:79 / 81 (96.3%), covers 80.5% of PF05768, 65.7 bits

• Bacillus anthracis thioredoxin systems, characterization and role as electron donors for ribonucleotide reductase
  Gustafsson, The Journal of biological chemistry 2012
  • “...potential NrdH redoxins denoted NrdH (BA4201) and NrdH2 (BA5371), and one hypothetical protein similar to the arsenate reductase family denoted ArsC (BA5229)...”
  • “...protein BA5387 BA2768 BA4758 BA4945 BA5225 BA4201 BA5371 BA5229 Potential active site Potential gene product Predicted extinction coefficient CAVC CPYC CGPC...”

G372_RS0101425 glutaredoxin family protein from Thioalkalivibrio thiocyanoxidans ARh2
Aligns to 3:77 / 79 (94.9%), covers 97.6% of PF05768, 65.2 bits

• Analysis of the Genes Involved in Thiocyanate Oxidation during Growth in Continuous Culture of the Haloalkaliphilic Sulfur-Oxidizing Bacterium Thioalkalivibrio thiocyanoxidans ARh 2T Using Transcriptomics
  Berben, mSystems 2017
  • “...protein L3 G372_RS0100975 1.52 2.39E-11 30S ribosomal protein S10 G372_RS0101385 1.64 1.11E-5 Nucleoside triphosphate pyrophosphohydrolase G372_RS0101425 1.76 7.96E-7 Glutaredoxin G372_RS0101510 1.75 2.01E-12 30S ribosomal protein S6 G372_RS0101520 1.59 3.63E-12 Hypothetical protein G372_RS0102735 1.73 2.80E-10 Sulfite oxidase G372_RS0102740 1.52 6.26E-12 6,7-Dimethyl-8-ribityllumazine synthase G372_RS0102750 1.70 7.83E-17 30S ribosomal...”

YDR286C Putative protein of unknown function; predicted to have thiol-disulfide oxidoreductase active site (RefSeq) from Saccharomyces cerevisiae
Aligns to 22:109 / 114 (77.2%), covers 98.8% of PF05768, 65.1 bits

• Multi-omics Reveal Specific Targets of the RNA-Binding Protein Puf3p and Its Orchestration of Mitochondrial Biogenesis
  Lapointe, Cell systems 2018
  • “...). For example, they include previously uncharacterized genes (e.g., AIM11 , AIM18 , YBR292C , YDR286C , YDR381C-A , YGR021W , and YGR161W-C ), which we can now potentially link to roles in mitochondrial biogenesis given their identity as Puf3p target mRNAs. Thus, the pathways mapped...”
• The roles of thiol oxidoreductases in yeast replicative aging
  Hacioglu, Mechanisms of ageing and development 2010
  • “...disulfide isomerase YCL035C GRX1 CxxC 26 -CPYC- Glutaredoxin YCR083W TRX3 CxxC 54 -CGPC- Mitochondrial thioredoxin YDR286C YDR286C CxxC 30 -CGLC- Thioredoxin YDR513W GRX2 CxxC 60 -CPYC- Glutaredoxin YGR029W ERV1 CxxC, CxxC 29, 129 -CRSC, -CNWC- Mitochondrial biogenesis YGR209C TRX2 CxxC 30 -CGPC- Thioredoxin YIL005W EPS1 CxxC,...”
• Most, but not all, yeast strains in the deletion library contain the [PIN(+)] prion
  Manogaran, Yeast (Chichester, England) 2010
  • “...YLR304C (ACO1) YOR274W (MOD5) YDR283C ( GCN2 ) YGL127C ( SOH1 ) YLR331C (JIP3) YOR379C YDR286C YGL226W YML061C (PIF1) YPL148C (PPT2) YDR287W ( INM2) YGL252C ( RTG2 ) YML121W (GTR1) YPR054W (SMK1) YDR294C ( DPL1 ) YGR007W ( MUQ1 ) YML129C (COX14) YPR060C (ARO7) YDR333C YGR268C...”
• Computationally driven, quantitative experiments discover genes required for mitochondrial biogenesis
  Hess, PLoS genetics 2009
  • “...mitochondrial biogenesis. For example, the four genes ( AIP1 , MPM1 , YDL027C , and YDR286C ) that specifically interact with rvs167 are potentially involved in the actin-based transmission of mitochondria to the daughter cell as Rvs167 is a regulator of actin polymerization [49] . In...”
• Genomic-scale comparison of sequence- and structure-based methods of function prediction: does structure provide additional insight?
  Fetrow, Protein science : a publication of the Protein Society 2001
  • “...YER174C YDR098C YPL059W YOR085W (OST3) YML019W (OST6) YDR286C YNL155W YDR133C YDR199W YOL024W YKL102C YLR245C (cdd1) YLR246W (erf2) YHR002W Active site Thd/FFFc...”
  • “...consensus positives discussed in the text. (Black bar) Sequence (YDR286C) identified by BL00195A and the FFF. We are unable to validate this prediction by using...”

Francci3_0483 glutaredoxin 2 (NCBI) from Frankia sp. CcI3
Aligns to 16:90 / 103 (72.8%), covers 98.8% of PF05768, 63.6 bits

• Transcriptomes of Frankia sp. strain CcI3 in growth transitions
  Bickhart, BMC microbiology 2011
  • “...DNA-binding protein Francci3_1949 1203 acyl transferase region Francci3_0991 691 hypothetical protein Francci3_1985 724 glutaredoxin 2 Francci3_0483 1202 regulatory protein GntR Francci3_3218 690 Rhodanese-like Francci3_2753 721 translation elongation factor Tu Francci3_0580 1179 CRISPR-associated protein Francci3_3346 680 Thiolase Francci3_2502 718 thioredoxin Francci3_4537 1165 hypothetical protein Francci3_1874 678 response...”

Rv0508 hypothetical protein (NCBI) from Mycobacterium tuberculosis H37Rv
Aligns to 5:84 / 97 (82.5%), covers 97.6% of PF05768, 61.0 bits

• Identification and characterization of a novel phosphodiesterase from the metagenome of an Indian coalbed
  Singh, PloS one 2015
  • “...outline). (B) Superimposition of the homology model structure of PdeM (colored as blue) and template Rv0508 structure (colored as pink), and stereoview of the superimposition of active site residues in the homology model of PdeM (colored as blue) and the template structure of Rv0805 (PDB ID:...”
• Reengineering redox sensitive GFP to measure mycothiol redox potential of Mycobacterium tuberculosis during infection
  Bhaskar, PLoS pathogens 2014
  • “...identified three putative Mrx1 like proteins in Mtb H37Rv. Out of the three proteins (Rv3053c, Rv0508, and Rv3198A), Rv3198A demonstrate highest similarity with Mrx1 of Msm (72% identity). Based on this, we selected Rv3198A ORF as a putative mycoredoxin-encoding gene and named its product as Mtb...”
• Mycobacterium tuberculosis modulates its cell surface via an oligopeptide permease (Opp) transport system
  Flores-Valdez, FASEB journal : official publication of the Federation of American Societies for Experimental Biology 2009
  • “...1.0 1.1 0.6 1.3 0.6 2.4 1.1 Rv0341 Rv0404 Rv0440 Rv0467 Rv0475 Rv0508 1.1 1.9 0.7 0.3 0.6 1.0 0.8 0.4 1.6 0.9 1.1 0.6 0.6 0.9 1.0 1.1 1.0 0.9 Rv0509 Rv0583c...”

CPXV091 CPXV091 protein (NCBI) from Cowpox virus
Aligns to 4:112 / 124 (87.9%), covers 98.8% of PF05768, 59.8 bits

• Generation of a complete single-gene knockout bacterial artificial chromosome library of cowpox virus and identification of its essential genes
  Xu, Journal of virology 2014
  • “...CPXV084 CPXV085 CPXV086 CPXV087 CPXV088 CPXV089 CPXV090 CPXV091 CPXV092 CPXV093 CPXV094 CPXV095 CPXV096 CPXV097 CPXV098 CPXV099 CPXV100 CPXV101 CPXV102 CPXV103...”

GLRX2_VACCW / P68460 Glutaredoxin-2 from Vaccinia virus (strain Western Reserve) (VACV) (Vaccinia virus (strain WR)) (see 4 papers)
VACWR081 thioredoxin-like protein (NCBI) from Vaccinia virus
Aligns to 4:112 / 124 (87.9%), covers 98.8% of PF05768, 59.3 bits

• function: Glutaredoxin necessary for virion morphogenesis and virus replication. Functions as a thiol-disulfide transfer protein between membrane-associated A2.5 and substrates L1 or F9. The complete pathway for formation of disulfide bonds in intracellular virion membrane proteins sequentially involves oxidation of E10, A2.5 and G4. Exhibit thioltransferase and dehydroascorbate reductase activities in vitro.
  subunit: Homodimer (Probable). Interacts with A2.5; this interaction involves formation of a transient disulfide-bonded intermediate, allowing disulfide bond transfer. Interacts with L1; this interaction involves formation of a transient disulfide-bonded intermediate, allowing disulfide bond transfer.
• The genome of Yoka poxvirus
  Zhao, Journal of virology 2011
  • “...56003-56662 57012-56638 72 74 71 67 VACWR078 VACWR079 VACWR080 VACWR081 (G1L) (G3L) (G2R) (G4L) 591 111 220 124 YKV061 440 57015-58334 58 VACWR082 (G5R) 434...”

MSMEG_0951 glutaredoxin 2 (NCBI) from Mycobacterium smegmatis str. MC2 155
Aligns to 1:79 / 80 (98.8%), covers 96.3% of PF05768, 58.3 bits

• Discovery of a novel dehydratase of the fatty acid synthase type II critical for ketomycolic acid biosynthesis and virulence of Mycobacterium tuberculosis
  Lefebvre, Scientific reports 2020
  • “...membrane protein MmpS2, respectively. The distinct genes in M. smegmatis , MSMEG_0946 , MSMEG_0950 and MSMEG_0951 , are annotated as encoding a NAD-dependent epimerase/dehydratase family protein, a hypothetical protein and the glutaredoxin 2, respectively. ( C ) Verification of hadD Mtb gene deletion by PCR analysis....”

REQ_37660 glutaredoxin family protein from Rhodococcus hoagii 103S
Aligns to 7:85 / 87 (90.8%), covers 98.8% of PF05768, 58.0 bits

• Mycoredoxins Are Required for Redox Homeostasis and Intracellular Survival in the Actinobacterial Pathogen Rhodococcus equi
  Mourenza, Antioxidants (Basel, Switzerland) 2019
  • “...to the upstream and downstream sequences of each putative mycoredoxin-encoding genes, i.e., REQ_32710, REQ_30100, and REQ_37660. These fragments were fused by PCR using the KAPA HiFi polymerase (KAPA Biosystems, Wilmington, MA, USA). The resulting 3 kbp amplicons were cloned on pSelAct plasmid [ 33 ] (...”
  • “...( Figure S2 ) and were identified accordingly as Mrx1 (REQ_32710), Mrx2 (REQ_30100), and Mrx3 (REQ_37660). We also compared the genome regions carrying mrx genes in different actinobacteria with the Artemis comparison tool [ 40 ] ( Figure S3 ). Overall, the synteny of the genome...”

CNPV104 glutaredoxin-like protein from Canarypox virus
Aligns to 4:114 / 125 (88.8%), covers 100.0% of PF05768, 56.1 bits

• Genomic characterization of two novel pathogenic avipoxviruses isolated from pacific shearwaters (Ardenna spp.)
  Sarker, BMC genomics 2017
  • “...105 105 SWPV1-092 SWPV2-098 CNPV103 CNPV103 N1R/p28-like protein 62.304 98.947 188 190 190 SWPV1-093 SWPV2-099 CNPV104 CNPV104 putative glutaredoxin 2, virion morphogenesis 86.4 99.2 125 125 125 SWPV1-094 SWPV2-100 CNPV105 CNPV105 conserved hypothetical protein 77.35 98.718 234 234 234 SWPV1-095 SWPV2-101 CNPV106 CNPV106 putative elongation factor...”
• The genome of canarypox virus
  Tulman, Journal of virology 2004
  • “...CNPV098 CNPV099 CNPV100 CNPV101 CNPV102 CNPV103 CNPV104 93244-92246 (333) 95922-93541 (794) 96741-96079 (221) 97484-96831 (218) 98751-97543 (403) 99035-99385...”
  • “...in several large CNPV genomic regions (CNPV069 to CNPV084, CNPV104 to CNPV140, CNPV171 to CNPV194, and CNPV238 to CNPV273) which correspond to the large genomic...”

Deide_13741 putative Glutaredoxin (RefSeq) from Deinococcus deserti VCD115
Aligns to 8:79 / 92 (78.3%), covers 68.3% of PF05768, 53.8 bits

• Proteomics-based refinement of Deinococcus deserti genome annotation reveals an unwonted use of non-canonical translation initiation codons
  Baudet, Molecular & cellular proteomics : MCP 2010
  • “...start site. Only one peptide is found upstream from hitherto annotated sequences of Deide_05590, Deide_07640, Deide_13741, Deide_16590, Deide_19650, Deide_22950, Deide_2p01230, and Deide_2p01630. Visual inspection of multialignments of these polypeptides and close homologous sequences confirmed that some residues were missing in all of these cases. We thus...”

Cp1002_0272 glutaredoxin family protein from Corynebacterium pseudotuberculosis 1002
Aligns to 9:83 / 84 (89.3%), covers 97.6% of PF05768, 51.5 bits

• Label-free proteomic analysis to confirm the predicted proteome of Corynebacterium pseudotuberculosis under nitrosative stress mediated by nitric oxide
  Silva, BMC genomics 2014
  • “...12 1.25 1 CYT noxC Shared D9Q680_CORP1 Glutaredoxin-like domain protein 292.69 2 -1.91 0 CYT Cp1002_0272 Core Glycolysis pathways D9Q5B6_CORP1 N-Acetylglucosamine kinase 228.69 6 1.74 0.98 CYT nanK Core D9Q4U9_CORP1 Alcohol dehydrogenase 236.02 17 1.22 1 CYT adhA Shared Iron-sulfur clusters D9Q7L6_CORP1 Ferredoxin 36927.57 7 2.10...”

D6WAN7 Acetyl-CoA acetyltransferase, mitochondrial-like Protein from Tribolium castaneum
Aligns to 423:497 / 502 (14.9%), covers 98.8% of PF05768, 49.0 bits

• The Differential Expression of Mevalonate Pathway Genes in the Gut of the Bark Beetle Dendroctonus rhizophagus (Curculionidae: Scolytinae) Is Unrelated to the de Novo Synthesis of Terpenoid Pheromones
  Sarabia, International journal of molecular sciences 2019
  • “...jeffreyi AY966010.1 92 Q56CY6 91.5 Leptinotarsa decemlineata KP689334.1 72 A0A0H4IRH6 81.1 Tribolium castaneum XM_969915.4 72 D6WAN7 79.9 HMGS Dendroctonus ponderosae JQ855690.1 95 I1VJ69 96.7 Dendroctonus jeffreyi AF166002.1 94 Q9NDA8 93.7 Dendroctonus armandi KP317812.1 92 A0A0F7LEZ1 94.5 Ips pini AY902193.1 72 Q5EE42 75.9 Leptinotarsa decemlineata KP689335.1 71...”

Q8P6W3 Uncharacterized protein from Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Aligns to 2:73 / 78 (92.3%), covers 97.6% of PF05768, 46.9 bits

• Protein structure refinement using a quantum mechanics-based chemical shielding predictor.
  Bratholm, Chemical science 2017
  • “...0.4 1.3 (0.5) 0.9 9.1 Lamin-B1 (P20700) 0.5 1.6 (0.4) 1.6 1.9 Target protein XcR50 (Q8P6W3) 0.3 0.6 (0.4) 0.8 2.9 OB-fold domain of replication protein A (Q6LYF9) 0.5 1.5 (0.5) 1.7 2.1 TM1442 protein (Q9X1F5) 0.3 1.5 (0.4) 1.8 1.8 Liver fatty acid-binding protein (LFAB)...”
• A community resource of experimental data for NMR / X-ray crystal structure pairs.
  Everett, Protein science : a publication of the Protein Society 2016 (no snippet)

LHK_01462 thioredoxin (RefSeq) from Laribacter hongkongensis HLHK9
Aligns to 4:79 / 82 (92.7%), covers 96.3% of PF05768, 46.9 bits

• Environmental adaptability and stress tolerance of Laribacter hongkongensis: a genome-wide analysis
  Lau, Cell & bioscience 2011
  • “...bonds trxA Thioredoxin 1 ppGpp LHK_01690 CV1584 NMB1366 NGO0652 - Thioredoxin LHK_00591 CV1325 NMB0006 NGO0057 LHK_01462 CV4257 NMB1845 NGO1923 LHK_01491 CV4279 NMB1958 NGO2124 LHK_02476 LHK_02092 trxC Thioredoxin 2 OxyR - CV1106 - - trxB Thioredoxin reductase LHK_1482 CV1895 CV2813 NMB1324 NGO0580 - Peroxiredoxin LHK_02841 CV3708 NMB0946...”

DR_0057 conserved hypothetical protein (NCBI ptt file) from Deinococcus radiodurans R1
Aligns to 6:78 / 84 (86.9%), covers 69.5% of PF05768, 46.7 bits

• Conservation and diversity of radiation and oxidative stress resistance mechanisms in Deinococcus species
  Lim, FEMS microbiology reviews 2019
  • “...three small (80 to 100 residues) CXXC motif-containing Grx-like proteins (i.e . DR_2085, DR_A0072 and DR_0057) (de Groot etal. 2009 ; Yuan etal. 2012 ), while GSH, GSH reductase and GSH peroxidase are absent (Slade and Radman 2011 ). Of these three Grx-like proteins, the DR_2085-...”

Dhaf_0850 Thioredoxin domain protein (RefSeq) from Desulfitobacterium hafniense DCB-2
Aligns to 22:103 / 110 (74.5%), covers 97.6% of PF05768, 30.0 bits

• Genome sequence of Desulfitobacterium hafniense DCB-2, a Gram-positive anaerobe capable of dehalogenation and metal reduction
  Kim, BMC microbiology 2012
  • “...expressed constitutively. Other oxygen responsive genes include those for thioredoxin (Dhaf_1227 and Dhaf_3584), thioredoxin reductase (Dhaf_0850), and rubrerythrin (Dhaf_4567). These results suggest that D. hafniense DCB-2 is equipped with and can operate defensive machinery against oxygen, which includes ROS scavenging, oxygen metabolism, and other oxygen-responsive reductive...”

O57917 thioredoxin-disulfide reductase (EC 1.8.1.9) from Pyrococcus furiosus (see paper)
PH0178 glutaredoxin-like protein (NCBI ptt file) from Pyrococcus horikoshii OT3
Aligns to 26:81 / 226 (24.8%), covers 56.1% of PF05768, 29.5 bits

• A hyperthermostable novel protein-disulfide oxidoreductase is reduced by thioredoxin reductase from hyperthermophilic archaeon Pyrococcus horikoshii
  Kashima, Archives of biochemistry and biophysics 2003 (PubMed)
  • “...Yasuhiro Ishikawa, Kazuhiko Abstract A redox protein gene (PH0178) with high sequence homology to a glutaredoxin from Pyrococcus furiosus and a thioredoxin...”
  • “...proteins were characterized. The redox protein from PH0178 had strong thioredoxin-like activity, but no glutaredoxin activity. The protein from PH1426 had...”
• DNA microarray analysis of the hyperthermophilic archaeon Pyrococcus furiosus: evidence for anNew type of sulfur-reducing enzyme complex
  Schut, Journal of bacteriology 2001
  • “...abyssi (PAB0936 and PAB2245) and P. horikoshii (PH0572 and PH0178). Two of the other S-induced proteins that might be related to S metabolism are ORF 1805557,...”

WD0758 glutaredoxin family protein (NCBI) from Wolbachia endosymbiont of Drosophila melanogaster
Aligns to 3:83 / 112 (72.3%), covers 69.5% of PF05768, 29.4 bits

• Genomic evolution of the pathogenic Wolbachia strain, wMelPop
  Woolfit, Genome biology and evolution 2013
  • “...at amino acid 36 ( fig. 5 C ). Frameshift Mutation in the Ortholog of WD0758 WD0758 encodes a 112 amino acid glutaredoxin domain (GRX) protein in w Mel. GRX proteins catalyze the reduction of disulfide bonds formed in other proteins and are involved in a...”
  • “...outside of the GRX domain the effect this mutation would have on the function of WD0758 is unclear; no other GRX domain proteins are thought be encoded by w MelPop-CLA. Ten Base Pair Deletion in Ortholog of WD0413 Gene WD0413 encodes a 600 amino acid aspartyl-tRNA...”
• Wolbachia variants induce differential protection to viruses in Drosophila melanogaster: a phenotypic and phylogenomic analysis
  Chrostek, PLoS genetics 2013
  • “...C T 23 S N WD0754 ankyrin repeat-containing protein 728880 T C 48 E G WD0758 glutaredoxin family protein 732864 C G 18 G A WD0766 ankyrin repeat-containing protein 739409 T G 139 L W WD0766 ankyrin repeat-containing protein 739559 T C 189 I T WD0813...”

lmo2344 similar to B. subtilis YtnI protein (NCBI ptt file) from Listeria monocytogenes EGD-e
Aligns to 3:83 / 88 (92.0%), covers 70.7% of PF05768, 27.8 bits

• Deletion of glutaredoxin promotes oxidative tolerance and intracellular infection in Listeria monocytogenes
  Sun, Virulence 2019
  • “...oxidative stress. Listeria monocytogenes has been shown to encode a putative glutaredoxin, Grx (encoded by lmo2344 ), while the underlying roles remain unknown. Here we suggest an unexpected role of L. monocytogenes Grx in oxidative tolerance and intracellular infection. The recombinant Grx was able to efficiently...”
  • “...to elucidate the roles of glutaredoxin in the foodborne pathogen L. monocytogenes . L. monocytogenes lmo2344 is annotated as a putative glutaredoxin in the GenBank database. Homologs of the oxidoreductase system related genes have been identied in the sequenced genome of L. monocytogenes EGD-e via in...”
• Pyruvate carboxylase plays a crucial role in carbon metabolism of extra- and intracellularly replicating Listeria monocytogenes
  Schär, Journal of bacteriology 2010
  • “...lmo2322 lmo2335 (fruA) lmo2336 (fruB) lmo2337 lmo2343 lmo2344 lmo2345 lmo2437d lmo2522 lmo2539 (glyA) lmo2590b lmo2684c lmo2685c lmo2708 lmo2714 lmo2742d...”

TK1085 protein disulfide oxidoreductase (NCBI) from Thermococcus kodakaraensis KOD1
Aligns to 26:81 / 226 (24.8%), covers 56.1% of PF05768, 27.7 bits

• Distinct Physiological Roles of the Three Ferredoxins Encoded in the Hyperthermophilic Archaeon Thermococcus kodakarensis
  Burkhart, mBio 2019
  • “...MbhL S 0 5 10 27 TK1983 Pyruvate:ferredoxin oxidoreductase, subunit S 0 2 7 23 TK1085 Protein disulfide oxidoreductase S 0 4 19 21 TK1596 V-type ATP synthase, subunit H S 0 6 59 18 TK2090 Membrane-bound hydrogenase subunit, MbhK S 0 6 47 15 TK1982...”
  • “...to combat oxidative stress, via partnerships with peroxiredoxin (TK0537), superoxide reductase (TK0525), and thioredoxin/protein-disulfide oxidoreductase (TK1085). Fd partnerships with MBS and GAPOR were not recovered. The membrane-bound sulfane reductase (MBS; previously known as the membrane-bound oxidoreductase, MBX [TK12141226]) ( 15 ) and the glyceraldehyde-3-phosphate:Fd oxidoreductase (GAPOR...”
• Proteome profiling of heat, oxidative, and salt stress responses in Thermococcus kodakarensis KOD1
  Jia, Frontiers in microbiology 2015
  • “...kodakarensis KOD1 genomic DNA as a template was performed to isolate TK0108, TK0217, TK0537, and TK1085 using the following oligonucleotide primers listed in supplementary Table 1 . The PCR products and the pET28a vector were digested by the restriction enzymes. The ligation products were transformed into...”
  • “...24.49 26.0 28 Metallophosphoesterase TK0547 19 2.6 5.22 5.3 24.12 23.0 29 Protein disulphide oxidoreductase TK1085 39 3.8 4.72 4.8 25.28 25.6 30 Deblocking aminopeptidase TK0781 31 1.9 5.46 5.5 38.27 38.5 31 Hypothetical protein TK0163 46 1.8 5.60 5.6 28.74 29.7 32 Oxidoreductase TK0845 22...”
• Complete genome sequence of the hyperthermophilic archaeon Thermococcus kodakaraensis KOD1 and comparison with Pyrococcus genomes
  Fukui, Genome research 2005
  • “...act on the oxygen detoxification. Protein disulfide oxidoreductase (TK1085) can repair the oxidized disulfide bond in a polypeptide in cooperation with thiore-...”

PAB2245 GLUTAREDOXIN-LIKE PROTEIN (NCBI ptt file) from Pyrococcus abyssi GE5
Aligns to 26:80 / 226 (24.3%), covers 56.1% of PF05768, 27.6 bits

• DNA microarray analysis of the hyperthermophilic archaeon Pyrococcus furiosus: evidence for anNew type of sulfur-reducing enzyme complex
  Schut, Journal of bacteriology 2001
  • “...ORFs are also present in P. abyssi (PAB0936 and PAB2245) and P. horikoshii (PH0572 and PH0178). Two of the other S-induced proteins that might be related to...”

VAS14_00891 GrxA family glutaredoxin from Photobacterium angustum S14
VAS14_00891 putative glutaredoxin 1 (NCBI) from Vibrio angustum S14
Aligns to 2:82 / 87 (93.1%), covers 68.3% of PF05768, 27.2 bits

• Proteome analysis of the UVB-resistant marine bacterium Photobacterium angustum S14
  Matallana-Surget, PloS one 2012
  • “...RNA-binding protein Hfq 1.46 1.69 2 3.08 0.00 1 1.54 0.00 1 3.45 0.00 1 VAS14_00891 putative glutaredoxin 1 1.47 1.04 2 1.32 1.08 2 0.94 0.00 1 1.41 1.31 2 VAS14_06208 ATP-dependent protease ATP-binding subunit 1.49 1.14 2 1.26 1.31 5 1.35 1.17 7 1.80...”
  • “...smaller abundance under UVB treatment compared with the dark control. In this study, one glutaredoxin (VAS14_00891, Table 1 ) was more abundant under UVB treatment. Disulfide bonds are required for proper protein folding and enhance protein stability and/or activity. The formation and reduction of disulfide bonds...”

MTH807 thioredoxin (NCBI ptt file) from Methanothermobacter thermautotrophicus str. Delta H
Aligns to 4:84 / 85 (95.3%), covers 82.9% of PF05768, 27.2 bits

• Thioredoxin targets fundamental processes in a methane-producing archaeon, Methanocaldococcus jannaschii
  Susanti, Proceedings of the National Academy of Sciences of the United States of America 2014
  • “...(7, 8), where Trx1 is closely related to MTH807 (identity, 51%; similarity, 67%) and Trx2 corresponds to MTH895 (identity, 37%; similarity, 54%). Purified...”

OEOE_RS00645 glutaredoxin-like protein NrdH from Oenococcus oeni PSU-1
Aligns to 3:80 / 81 (96.3%), covers 80.5% of PF05768, 27.1 bits

• Genetic and transcriptional study of glutathione metabolism in Oenococcus oeni
  Margalef-Català, International journal of food microbiology 2017 (PubMed)
  • “...Among the studied genes, the one for a NrdH-redoxin (OEOE_RS00645) showed a common response to ethanol in the strains, being over-expressed when grown with GSH....”
  • “...Glutaredoxin ( rdx1 ) glut95_R GGTATCCCGACCAAGAATCA 0.25 OEOE_RS00645 glut139_F TCGCTCAATTGAAAGCTGAA 0.25 92 This work Glutaredoxin ( rdx 2) glut139_R...”
• Transcriptomic and Proteomic Analysis of Oenococcus oeni Adaptation to Wine Stress Conditions
  Margalef-Català, Frontiers in microbiology 2016
  • “...1.25 1.40 1.10 0.76 General stress protein OEOE_RS00325 2.18 2.10 2.46 2.54 2.60 2.58 Glutaredoxin OEOE_RS00645 1.04 0.44 0.27 0.64 0.82 0.86 Heat-shock protein Hsp20 OEOE_RS01385 0.92 0.43 0.55 0.89 0.88 1.13 Glutathione reductase OEOE_RS05740 0.63 0.78 0.83 0.96 1.00 0.98 Cold-shock protein OEOE_RS06620 1.75 1.14...”

THIO_METJA / Q57755 Thioredoxin from Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440) (Methanococcus jannaschii) (see paper)
Aligns to 5:84 / 85 (94.1%), covers 69.5% of PF05768, 26.3 bits

• function: Acts to maintain redox homeostasis; functions as a protein disulfide reductase.

ECs0929 glutaredoxin1 redox coenzyme for glutathione-dependent ribonucleotide reductase (NCBI ptt file) from Escherichia coli O157:H7 str. Sakai
c0982 glutaredoxin 1 (RefSeq) from Escherichia coli CFT073
Z1076 glutaredoxin1 redox coenzyme for glutathione-dependent ribonucleotide reductase (NCBI ptt file) from Escherichia coli O157:H7 EDL933
Aligns to 2:82 / 85 (95.3%), covers 67.1% of PF05768, 26.0 bits

• Transcriptomic analysis of Escherichia coli O157:H7 and K-12 cultures exposed to inorganic and organic acids in stationary phase reveals acidulant- and strain-specific acid tolerance responses
  King, Applied and environmental microbiology 2010
  • “...b1439 ECs4871 ECs3271 ECs2412 ECs4196 ECs4523 ECs3537 ECs0645 ECs0929 ECs3331 b3942 b2392 b1705 b3345 b3648 b2674 b0606 b0849 b2469 ECs4441 ECs4043 ECs2037...”
• Rab5, Rab7, and Rab11 Are Required for Caveola-Dependent Endocytosis of Classical Swine Fever Virus in Porcine Alveolar Macrophages
  Zhang, Journal of virology 2018 (secret)
• Transcriptomic analysis reveals specific metabolic pathways of enterohemorrhagic Escherichia coli O157:H7 in bovine digestive contents
  Segura, BMC genomics 2018
  • “...NDE NDE Z4804 gntU Gnt-I system low-affinity gluconate transporter NDE 2.35 1.99E-03 NDE NDE NDE Z1076 grxA Glutaredoxin 1 2.97 1.14E-06 5.31 2.61E-19 3.99 2.46E-11 4.51 3.83E-14 4.00 2.26E-11 Z4879 hpR Phosphocarrier protein NDE NDE 2.56 5.73E-04 2.14 7.02E-03 2.32 1.63E-03 Z1389 hyaA Hydrogenase I (small...”

P0A1P8 Glutaredoxin 1 from Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Aligns to 3:82 / 87 (92.0%), covers 67.1% of PF05768, 25.9 bits

• N-dodecanoyl-homoserine lactone influences the levels of thiol and proteins related to oxidation-reduction process in Salmonella
  de, PloS one 2018
  • “...Q8ZQX1 fldA Oxidation-reduction ND ND ND ND ND ND 9.103 1.504 9.307 1.054 Glutaredoxin 1 P0A1P8 grxA Oxidation-reduction ND ND 10.883 0.737 ND ND ND ND -0.839 0.547 Glutaredoxin 3 Q7CPH7 grxC Oxidation-reduction ND ND ND ND ND ND ND ND 8.107 1.078 Hydrogenase-3, iron-sulfur subunit...”

LSA0942 Ribonucleotide reductase, NrdH-redoxin (NCBI) from Lactobacillus sakei subsp. sakei 23K
Aligns to 3:75 / 76 (96.1%), covers 78.0% of PF05768, 25.2 bits

• Global transcriptome response in Lactobacillus sakei during growth on ribose
  McLeod, BMC microbiology 2011
  • “...nrdF Ribonucleoside-diphosphate reductase, beta chain 1.0 0.6 LSA0941 nrdE Ribonucleoside-diphosphate reductase, alpha chain 1.0 0.6 LSA0942 nrdH Ribonucleotide reductase, NrdH-redoxin 1.1 LSA0950 pyrR Bifunctional protein: uracil phosphoribosyltransferase and pyrimidine operon transcriptional regulator -0.6 LSA0993 rnhB Ribonuclease HII (RNase HII) 0.6 LSA1018 cmk Cytidylate kinase 0.6 LSA1097...”

Plano_1669 thioredoxin from Planococcus sp. PAMC 21323
Aligns to 24:99 / 104 (73.1%), covers 61.0% of PF05768, 25.1 bits

• Complete genome sequence of Planococcus sp. PAMC21323 isolated from Antarctica and its metabolic potential to detoxify pollutants
  Jung, Standards in genomic sciences 2018
  • “...Alkyl hydroperoxide reductase F Plano_2965 TrxA Thioredoxin Plano_0462; Plano_0753; Plano_0826; Plano_0924; Plano_0931; Plano_1054; Plano_1156; Plano_1389; Plano_1669 TrxB Thioredoxin reductase Plano_0301; Plano_0900; Plano_1802 Gpx Glutathione peroxidase Plano_2887 GR Glutathione reductase Plano_2022 Grx Glutaredoxin Plano_1634 To reduce thiol-modification in proteins caused by ROS, most microorganisms use low-molecule thiol...”

VF_0890 glutaredoxin 1 (RefSeq) from Vibrio fischeri ES114
VF_0890 GrxA family glutaredoxin from Aliivibrio fischeri ES114
Aligns to 2:81 / 87 (92.0%), covers 68.3% of PF05768, 25.1 bits

• Characterizing the host and symbiont proteomes in the association between the Bobtail squid, Euprymna scolopes, and the bacterium, Vibrio fischeri
  Schleicher, PloS one 2011
  • “...- putative lipoprotein 5.22 72 16 59711049 VF_0442 Pgk phosphoglycerate kinase 5.08 1747 17 59711497 VF_0890 grxA glutaredoxin 1 4.88 216 18 59710869 VF_0262 rpoA DNA-directed RNA polymerase alpha 4.84 647 19 59713778 VF_A0595 - cold shock protein 4.78 273 20 59712703 VF_2096 - hypothetical protein...”

Q2YLN2 Glutaredoxin from Brucella abortus (strain 2308)
BAB1_1879 Glutaredoxin:Thioredoxin type domain (NCBI) from Brucella melitensis biovar Abortus 2308
Aligns to 3:62 / 88 (68.2%), covers 59.8% of PF05768, 24.8 bits

• Comparative analysis of glutaredoxin domains from bacterial opportunistic pathogens
  Leeper, Acta crystallographica. Section F, Structural biology and crystallization communications 2011
  • “...expression and purification GLXRs from Br. melitensis and Ba. henselae (NCBI YP_415222 and YP_033241.1; UniProt Q2YLN2 and Q6G5J5; Pfam ID PF00462; EC 1.20.4.1) were cloned into a pAVA vector (Choi et al. , 2011 ) and expressed from RIL cells grown in 2l of M9 medium...”
• Proteomics-based confirmation of protein expression and correction of annotation errors in the Brucella abortus genome
  Lamontagne, BMC genomics 2010
  • “...PrfA BAB2_0459 Pgl BAB1_0544 DegT/DnrJ/EryC1/StrS BAB1_1187 Endoribonuclease BAB1_1874 LysC BAB2_0460 Zwf BAB1_0561 Man-6-P isomerase L-PSP BAB1_1879 GrxC BAB2_0483 ShuT type II BAB1_1188 GDPD BAB1_1887 HemC BAB2_0513 GcvT BAB1_0570 XylA BAB1_1205 ElaB-domain BAB1_1895 FtsK-gamma BAB2_0518 PutA BAB1_0587 Unknown BAB1_1212 BhbA BAB1_1918 LpdA-2 BAB2_0566 AldA BAB1_0588 ATP/GTP-binding BAB1_1213...”

SO2745, SO_2745 glutaredoxin (NCBI ptt file) from Shewanella oneidensis MR-1
Aligns to 2:80 / 86 (91.9%), covers 68.3% of PF05768, 24.7 bits

• Distinct Roles of Shewanella oneidensis Thioredoxin in Regulation of Cellular Responses to Hydrogen and Organic Peroxides
  Feng, Applied and environmental microbiology 2019 (secret)
• Global molecular and morphological effects of 24-hour chromium(VI) exposure on Shewanella oneidensis MR-1
  Chourey, Applied and environmental microbiology 2006
  • “....gov/shewanella_metal_stress/chronic/supplemental). S. oneidensis glutaredoxin (SO2745) also was transcriptionally induced by 6.9-fold under Cr(VI)...”

VC1146 glutaredoxin 1 (RefSeq) from Vibrio cholerae O1 biovar eltor str. N16961
Aligns to 2:81 / 87 (92.0%), covers 68.3% of PF05768, 24.4 bits

• The transcriptional regulator VqmA increases expression of the quorum-sensing activator HapR in Vibrio cholerae
  Liu, Journal of bacteriology 2006
  • “...synthase III Proline dehydrogenase VC0432 VC0604 VC0687 VC1146 VC1589 VC1590 VC2000 VC2087 VC2744 VC2746 VCA0136 VCA0197 VCA0657 VCA0744 VCA0745 VCA0751 VCA1073...”

Ent638_1364 glutaredoxin 1 (RefSeq) from Enterobacter sp. 638
Aligns to 3:81 / 89 (88.8%), covers 67.1% of PF05768, 24.3 bits

• Genome sequence of the plant growth promoting endophytic bacterium Enterobacter sp. 638
  Taghavi, PLoS genetics 2010
  • “...fur (a DNA-binding transcriptional dual regulator of siderophore biosynthesis and transport, Ent638_1198) and grxA (glutaredoxin, Ent638_1364), all of which are present in Enterobacter sp. 638. Three glutathione S-transferase (GST) genes (Ent638_0139, Ent638_0268 and Ent638_1329), a glutathione ABC transporter (GsiABCD, Ent638_1323-1326), two glutathione peroxidase (Ent638_1732 and Ent638_2699),...”

KP1_1843 glutaredoxin 1 redox coenzyme (RefSeq) from Klebsiella pneumoniae NTUH-K2044
Aligns to 3:80 / 87 (89.7%), covers 67.1% of PF05768, 24.2 bits

• YjcC, a c-di-GMP phosphodiesterase protein, regulates the oxidative stress response and virulence of Klebsiella pneumoniae CG43
  Huang, PloS one 2013
  • “...Gene name Fold a expression ORF b ID Oxidative response/repair/sos responsive Glutaredoxin I grxA 2.6 KP1_1843 Thioredoxin ybbN 2.4 KP1_1349 DNA damage inducible protein I dinI 2.1 KP1_2061 Heat shock response/chaperones/protein modification Heat shock protein ibpB 5.9 KP1_5467 Heat shock protein ibpA 5.6 KP1_2622 Heat shock...”

LSEI_1467 Glutaredoxin related protein (NCBI) from Lactobacillus casei ATCC 334
Aligns to 3:75 / 76 (96.1%), covers 78.0% of PF05768, 24.1 bits

• Physiological and transcriptional response of Lactobacillus casei ATCC 334 to acid stress
  Broadbent, Journal of bacteriology 2010
  • “...stress response LSEI_1617 LSEI_1281 LSEI_1848 LSEI_0963 LSEI_1467 LSEI_1762 LSEI_1338 LSEI_2239 LSEI_2238 LSEI_1567 LSEI_1566 LSEI_1565 LSEI_1564 LSEI_1563 AA5...”

AV944_10100 thioredoxin from Sphingomonas sp. LK11
Aligns to 25:104 / 108 (74.1%), covers 61.0% of PF05768, 24.0 bits

• Complete genome sequencing and analysis of endophytic Sphingomonas sp. LK11 and its potential in plant growth
  Asaf, 3 Biotech 2018
  • “...65% (Table S3). These unique genes include glutaredoxin-related (locus AV944_14990 and AV944_14990) and thioredoxin-related (locus AV944_10100) genes, which may be responsible for maintaining a cellular redox environment and may control oxidative stress responses in LK11 as previously reported (Zeller and Klug 2006 ). In addition, the...”

GLRX / P35754 glutaredoxin-1 (EC 1.8.5.1) from Homo sapiens (see 3 papers)
NP_001112362 glutaredoxin-1 from Homo sapiens
P35754 Glutaredoxin-1 from Homo sapiens
Aligns to 14:80 / 106 (63.2%), covers 50.0% of PF05768, 24.0 bits

• Critical Roles of Glutaredoxin in Brain Cells-Implications for Parkinson's Disease.
  Gorelenkova, Antioxidants & redox signaling 2019
  • GeneRIF: Research on Grx and its potential roles in Parkinson's disease (PD) presents a complex situation where Grx1 likely plays a primary neuroprotective role in dopaminergic neurons but a proinflammatory role in microglia. Midbrain PD samples showed decreased Grx1 specifically within dopaminergic neurons. Increased GLRX copy number in PD patients was associated with earlier onset.[review]
• Structural and mechanistic aspects of S-S bonds in the thioredoxin-like family of proteins.
  Sousa, Biological chemistry 2019 (PubMed)
  • GeneRIF: The glutaredoxin (Grx) is involved in the formation, transfer or isomerization of disulfide bonds through a characteristic thiol-disulfide exchange reaction.
• Thioredoxin and glutaredoxin regulate metabolism through different multiplex thiol switches.
  López-Grueso, Redox biology 2019
  • GeneRIF: Trx and Grx have both, common and specific protein Cys redox targets and that down regulation of either redoxin has markedly different metabolic outcomes. They reflect the delicate sensitivity of redox equilibrium to changes in any of the elements involved and the difficulty of forecasting metabolic responses to redox environmental changes.
• GLRX inhibition enhances the effects of geftinib in EGFR-TKI-resistant NSCLC cells through FoxM1 signaling pathway.
  Wang, Journal of cancer research and clinical oncology 2019 (PubMed)
  • GeneRIF: GLRX inhibition enhanced the effects of geftinib in gefitinib-resistant cell proliferation in vitro and in vivo and promoted apoptosis and cell cycle arrest via the EGFR/Forkhead Box M1 (FoxM1) signaling pathway, indicating that combined inhibition of GLRX could enhance growth-inhibitory effects of gefitinib in gefitinib-resistant NSCLC cells.
• Glutaredoxin-1 Silencing Induces Cell Senescence via p53/p21/p16 Signaling Axis.
  Yang, Journal of proteome research 2018 (PubMed)
  • GeneRIF: Glutaredoxin-1 silencing induces cell senescence via p53/p21/p16 signaling axis.
• Serum Glutaredoxin Activity as a Marker of Oxidative Stress in Chronic Kidney Disease: A Pilot Study.
  Levin, Nephron 2018 (PubMed)
  • GeneRIF: Patients who experienced a stroke or myocardial infarction at any time had a significantly higher increase in Grx during the 2 years of dialysis
• Determination of glutathione redox potential and pH value in subcellular compartments of malaria parasites.
  Mohring, Free radical biology & medicine 2017 (PubMed)
  • GeneRIF: Based on the roGFP2-hGrx1 signals, glutathione-dependent redox potentials of -267mV and -328mV, respectively, were obtained. Employing these novel tools, initial studies on the effects of redox-active agents and clinically employed antimalarial drugs were carried out on both organelles.
• Glutaredoxin 1 (GRX1) inhibits oxidative stress and apoptosis of chondrocytes by regulating CREB/HO-1 in osteoarthritis.
  Sun, Molecular immunology 2017 (PubMed)
  • GeneRIF: GRX1 overexpression constrains oxidative stress and apoptosis in osteoarthritis chondrocytes by regulating CREB/HO-1, providing a novel insight into the molecular mechanism and potential treatment of osteoarthritis.
• More
• Role of GSH and Iron-Sulfur Glutaredoxins in Iron Metabolism-Review
  Daniel, Molecules (Basel, Switzerland) 2020
  • “...available, n: nucleus. Protein Name Accession Gene Active Site Functions and Reactions FeS Locali-Zation Grx1 P35754 Glrx CPYC Oxidoreductase, (de-)glutathionylation [ 75 , 76 ] no c/n Grx2a Q9NS18 Glrx2 CSYC Oxidoreductase, FeS as redox sensor [ 16 , 77 , 78 ] Fe 2 S...”
• Human glutaredoxin-1 can transfer copper to isolated metal binding domains of the P1B-type ATPase, ATP7B.
  Maghool, Scientific reports 2020
  • “...thioredoxin fold 42 , with an exposed C-XX-C motif (C23-XX-C26; residues numbered according to UniProtKB P35754) 43 . This motif was shown by site-directed mutagenesis and related analyses to be the active site of the enzyme and also the high affinity Cu(I) binding site 10 ,...”
• Proteomic Profiling and Monitoring of Training Distress and Illness in University Swimmers During a 25-Week Competitive Season.
  Knab, Frontiers in physiology 2020
  • “...binding; complement activation; innate; phagocytosis P08185 Corticosteroid-binding globulin Major transport protein for glucocorticoids and progestins P35754 Glutaredoxin-1 Glutathione activity; cell redox homeostasis The data of the current study supports the use of this targeted protein panel in combination with ratings of training distress when monitoring athletes...”
• Proteomic Profiling of Retinoblastoma-Derived Exosomes Reveals Potential Biomarkers of Vitreous Seeding.
  Galardi, Cancers 2020
  • “...kDa regulatory subunit A beta isoform PPP2R1B Extracellular Region Or Secreted protein phosphatase regulator activity P35754 Glutaredoxin-1 GLRX Cytoplasm binding P41236 Protein phosphatase inhibitor 2; Protein phosphatase inhibitor 2-like protein 3 PPP1R2; PPP1R2P3 protein phosphatase activity P47985 Cytochrome b-c1 complex subunit 11; Cytochrome b-c1 complex subunit...”
• Chronic Occupational Exposure to Ionizing Radiation Induces Alterations in the Structure and Metabolism of the Heart: A Proteomic Analysis of Human Formalin-Fixed Paraffin-Embedded (FFPE) Cardiac Tissue.
  Azimzadeh, International journal of molecular sciences 2020
  • “...E1 component 1.9 4.54 10 2 P39059 COL15A1 Collagen alpha-1(XV) chain 1.8 3.28 10 2 P35754 GLRX Glutaredoxin-1 1.8 4.58 10 2 P40121 CAPG Macrophage-capping protein 1.8 2.32 10 2 P36269 GGT5 Glutathione hydrolase 5 proenzyme 1.8 3.04 10 2 O75340 PDCD6 Programmed cell death protein...”
• iTRAQ and PRM-based quantitative proteomics in early recurrent spontaneous abortion: biomarkers discovery
  Cui, Clinical proteomics 2019
  • “...Q7Z2Y8 Interferon-induced very large GTPase 1 OS=Homo sapiens GN=GVINP1 PE=2 SV=2-[GVIN1_HUMAN] 0.66 1 2.29 0.0133 P35754 Glutaredoxin-1 OS=Homo sapiens GN=GLRX PE=1 SV=2-[GLRX1_HUMAN] 10.38 1 1.47 0.0214 H7C070 Uncharacterized protein KIAA1109 (Fragment) OS=Homo sapiens GN=KIAA1109 PE=1 SV=1-[H7C070_HUMAN] 0.37 1 1.32 0.0150 Q53FL1 Tumor endothelial marker 8 isoform...”
• Substrate specificity of thioredoxins and glutaredoxins - towards a functional classification
  Gellert, Heliyon 2019
  • “...Table1 Protein name ID Active site pdb Functions loc. Interactome (number) Homo sapiens glutaredoxins Grx1 P35754 CPYC 1b4q, ... (de)-glutathionylation c/n 24 Grx2a/c Q9NS18 CSYC 2fls, ... Fe/S, redox sensor [ 52 ] c/m/n 64 [ 53 ] Grx3.d2 O76003 CGFS 3zyw Fe/S, iron metabolism [...”
• Proteomic Markers of Non-functional Overreaching During the Race Across America (RAAM): A Case Study.
  Merritt, Frontiers in physiology 2019
  • “...phagocytosis recognition and engulfment P08185 Corticosteroid-binding globulin (CBG) Major transport protein for glucocorticoids and progestins P35754 Glutaredoxin-1 (GLRX1) Glutathione activity; cell redox homeostasis P00568 Adenylate kinase isoenzyme 1 (KAD1) Role in cellular energy homeostasis; nucl. diphoph. kinase activity. P01009 Alpha-1-antitrypsin (A1AT) Inhibitor of serine proteases; primary...”
• More

grxA / P68688 reduced glutaredoxin 1 from Escherichia coli (strain K12) (see 3 papers)
grxA / MB|P68688 glutaredoxin-1 from Escherichia coli K12 (see 10 papers)
P68688 Glutaredoxin 1 from Escherichia coli (strain K12)
NP_415370 reduced glutaredoxin 1 from Escherichia coli str. K-12 substr. MG1655
b0849 glutaredoxin 1, redox coenzyme for ribonucleotide reductase (RNR1a) (NCBI) from Escherichia coli str. K-12 substr. MG1655
Aligns to 2:82 / 85 (95.3%), covers 67.1% of PF05768, 24.0 bits

• Conservation and diversity of radiation and oxidative stress resistance mechanisms in Deinococcus species
  Lim, FEMS microbiology reviews 2019
  • “...M. tuberculosis (P95106), S. aureus (Q936D1) and B. cereus (Q819J1), and Grx from E. coli (P68688 and P0AC262) and P. aeruginosa (Q9HU55). Weblogo plots show sequences around the CxxC motif extracted from deinococcal proteins of each group. See further the legend to Figure 4 . Ribonucleotide...”
• Insights into deglutathionylation reactions. Different intermediates in the glutaredoxin and protein disulfide isomerase catalyzed reactions are defined by the gamma-linkage present in glutathione.
  Peltoniemi, The Journal of biological chemistry 2006 (PubMed)
  • GeneRIF: in contrast to the glutaredoxin-glutathione mixed disulfide intermediate, the only intermediate in the protein disulfide isomerases (PDI)-catalyzed reaction was PDI peptide mixed disulfide
• The primary structure of Escherichia coli glutaredoxin. Distant homology with thioredoxins in a superfamily of small proteins with a redox-active cystine disulfide/cysteine dithiol.
  Höög, European journal of biochemistry 1983 (PubMed)
  • GeneRIF: N-terminus verified by Edman degradation on complete protein
• [The role of thiol redox systems in response of Escherichia coli to distant UV irradiation].
  Oktiabr'skiĭ, Mikrobiologiia (PubMed)
  • GeneRIF: grxA plays a role in E. coli resistance to distant UV irradiation and in regulation of SOS response.
• Transcriptional responses of Escherichia coli during recovery from inorganic or organic mercury exposure
  LaVoie, BMC genomics 2018
  • “...n.s. b4248 yjgH Putative reactive intermediate deaminase, UPF0076 family 296 24 3 6 2 n.s. b0849 grxA Glutaredoxin 1 246 33 n.s. 14 4 n.s. b1144 ymfJ Function unknown, e14 prophage 185 39 n.s. 3 3 n.s. b2582 trxC Thioredoxin 2, zinc-binding; Trx2 134 50 7...”
• Antitumor and antimicrobial activities of endophytic fungi from medicinal parts of Aquilaria sinensis
  Cui, Journal of Zhejiang University. Science. B 2011 (secret)
• Transcriptomic analysis of Escherichia coli O157:H7 and K-12 cultures exposed to inorganic and organic acids in stationary phase reveals acidulant- and strain-specific acid tolerance responses
  King, Applied and environmental microbiology 2010
  • “...ECs3331 b3942 b2392 b1705 b3345 b3648 b2674 b0606 b0849 b2469 ECs4441 ECs4043 ECs2037 ECs0629 b0590 b3556 b3162 b1434 ECs3307 ECs3782 ECs3448 ECs3889 b2436...”
• Global gene expression profiling of asymptomatic bacteriuria Escherichia coli during biofilm growth in human urine
  Hancock, Infection and immunity 2007
  • “...3,916 1,096 1,859 ygiD c3685 aaeX grxA b3039 c3685 b3242 b0849 23.4 22.5 21.2 21.1 3,863 791 3,905 4,675 c2436 c2424 yfiP yqjF mdtL yhcN yqgA rydB sgaB c2436...”
  • “...4,731 1.9 5.9 2.1 5.3 1.2 nlpI infC grxA b3163 Z2747 b0849 4,698 4,677 4,675 3.7 1.1 21.1 cspG rpmH bfr yhhW pdhR rplK iscR rseA yceD ryhB Z5401 b0990 b3703...”
• Global gene expression profiling of the asymptomatic bacteriuria Escherichia coli strain 83972 in the human urinary tract
  Roos, Infection and immunity 2006
  • “...c1382 b1445 b0620 c2901 b3241 b1335 Z1954 b1430 b3238 b0849 b0151 fepE ydhC evgA nlpI Z4919 c0674 b1660 b2369 b3163 Z4919 a Function or product Respiratory...”
• Elucidation of the antibacterial mechanism of the Curvularia haloperoxidase system by DNA microarray profiling
  Hansen, Applied and environmental microbiology 2004
  • “...ynhD ynhC b1680 ynhA yaaA yaiA ybjM yljA b0812 b3942 b0849 b0606 b2582 b0605 b0683 b3500 b0604 b2000 b4367 b0475 b1684 b1683 b1682 b1681 b1680 b1679 b0006 b0389...”
• Stationary-phase quorum-sensing signals affect autoinducer-2 and gene expression in Escherichia coli
  Ren, Applied and environmental microbiology 2004
  • “...carB ldcC rfbX sdiA grxA phoH b3213 b0033 b0186 b2037 b1916 b0849 b1020 2.6 2.5 2.4 2.3 2.3 2.1 2.1 aroP b0112 2 flgJ pyrE b1081 b3642 2 2 Phosphate regulon...”
• DNA microarray-mediated transcriptional profiling of the Escherichia coli response to hydrogen peroxide
  Zheng, Journal of bacteriology 2001
  • “...Induction ratioa dps yaiA katG grxA yfiA ibpA b0812 b0389 b3942 b0849 b2597 b3687 180 56 44 37 36 29 yjiD ycfR ahpF b4326 b1112 b0606 29 26 22 trxC sufA ymgB...”
  • “...katG grxA ahpF trxC ahpC fur gor dsbG flu fhuF b0812 b3942 b0849 b0606 b2582 b0605 b0683 b3500 b0604 b2000 b4367 330 270 54 350 73 2,000 390 160 93 110 200 180...”

Q25N99 Macaca fascicularis brain cDNA clone: QorA-11477, similar to human glutaredoxin (thioltransferase) (GLRX), mRNA, RefSeq: NM_002064.1 from Macaca fascicularis
Aligns to 14:92 / 106 (74.5%), covers 50.0% of PF05768, 24.0 bits

• Gingival Exudatome Dynamics Implicate Inhibition of the Alternative Complement Pathway in the Protective Action of the C3 Inhibitor Cp40 in Nonhuman Primate Periodontitis
  Bostanci, Journal of proteome research 2018
  • “...down 0.22 0.53 0.00 2.97 up Q18ND3 0.01 2.05 down 0.97 0.47 0.04 2.52 up Q25N99 * 0.03 2.76 down 0.81 0.11 0.05 2.65 Q2PFQ8 * 0.08 4.19 0.39 0.40 0.01 3.79 up Q2PFT0 * 0.00 1.88 down 0.54 1.26 0.02 3.14 up Q4R3L3 * 0.01...”

YPK_2733 GrxA family glutaredoxin (RefSeq) from Yersinia pseudotuberculosis YPIII
YPTB1358 glutaredoxin 1 (NCBI) from Yersinia pseudotuberculosis IP 32953
Aligns to 3:83 / 87 (93.1%), covers 67.1% of PF05768, 23.7 bits

• Fis Is Essential for Yersinia pseudotuberculosis Virulence and Protects against Reactive Oxygen Species Produced by Phagocytic Cells during Infection
  Green, PLoS pathogens 2016
  • “...YPK_0452; flgD , YPK_2423; psaEFABC , YPK_2761-YPK_2757; katG , YPK_3388; ahpC , YPK_3267; grxA , YPK_2733; recA , YPK_3375; rpoC , YPK_0341. Supporting Information S1 Fig Mini-TnSeq assay schematic. (A) Mutants containing identical in-frame scar sequences were prepared for Illumina sequencing. Briefly, genomic DNA was isolated...”
• IscR is essential for yersinia pseudotuberculosis type III secretion and virulence
  Miller, PLoS pathogens 2014
  • “...2.1 YPTB1149 succinyl-CoA synthetase beta chain sucC 3.0 YPTB1150 succinyl-CoA synthetase alpha chain sucD 3.1 YPTB1358 glutaredoxin 1 grxA 2.3 YPTB1418 integration host factor beta-subunit ihfB 2.7 YPTB2047 pyruvate kinase II pykA 2.3 YPTB2143 aconitate hydratase 1 acnA 2.2 YPTB2216 putative acetolactate synthase large subunit ilvB...”

NP_490812 Glutaredoxin domain-containing protein from Caenorhabditis elegans
Aligns to 14:99 / 105 (81.9%), covers 52.4% of PF05768, 23.7 bits

• Glutaredoxin deficiency exacerbates neurodegeneration in C. elegans models of Parkinson's disease.
  Johnson, Human molecular genetics 2015
  • GeneRIF: Re-expression of GLRX-10 selectively in dopaminergic neurons attenuates mutant LRRK2-mediated phenotype.
• The Alveolate Perkinsus marinus: biological insights from EST gene discovery
  Joseph, BMC genomics 2010
  • “...gallus Peroxiredoxin V Pm01453 ABV22156 3e-75 Perkinsus chesapeaki Glutaredoxin Pm06883 ABV22433 9e-16 Oxyrrhis marina Pm07604 NP_490812 2e-27 Caenorhabditis elegans Pm04444 XP_002125050 4e-28 Ciona intestinalis Pm07679 XP_002181580 2e-20 Phaeodactylum tricornutum Glutathione reductase Pm04212 XP_002296324 1e-112 Thalassiosira pseudonana Thioredoxin reductase Pm07484 GI:15826813 7e-54 Rattus norvegicus Pm02868 EEB11260 1e-78...”

LGG_RS07055 glutaredoxin-like protein NrdH from Lactobacillus rhamnosus GG
Aligns to 3:75 / 76 (96.1%), covers 78.0% of PF05768, 23.6 bits

• Intra-species Genomic and Physiological Variability Impact Stress Resistance in Strains of Probiotic Potential
  Arnold, Frontiers in microbiology 2018
  • “...of protein export (Jakob et al., 2015 ; Jousselin et al., 2015 ), the NrdH-redoxin (LGG_RS07055), uracil transport (LGG_RS06995, LGG_RS07000, and LGG_RS07005) and peptide ABC transport system operon (LGG_RS07940, LGG_RS07945, LGG_RS07950, LGG_RS07955, and LGG_RS07960 were down regulated in AMC010 exposed to bile. In vitro growth and...”

Mbov_0832 thioredoxin family protein from Mycoplasma bovis HB0801
Aligns to 23:100 / 104 (75.0%), covers 50.0% of PF05768, 23.3 bits

• Comparative Genomics of Mycoplasma bovis Strains Reveals That Decreased Virulence with Increasing Passages Might Correlate with Potential Virulence-Related Factors
  Rasheed, Frontiers in cellular and infection microbiology 2017
  • “...Mbov_0714 C-A C-A S845,529 Predicted integral membrane protein 21 Mbov_0797 G-A G-A S929,799 VspHB0801-5 22 Mbov_0832 A-C A-C S964,804 Thioredoxin 23 Mbov_0049 G-A S58,153 Putative lipoprotein 24 Mbov_0111 C-T S120,789 Putative lipoprotein 25 Mbov_0212 C-T S247,443 Transketolase 26 Mbov_0248 G-T S284,709 Integrase 27 Mbov_0299 G-A S350,175...”
  • “...indels (Mbov_0018, Mbov_0049, Mbov_0111, Mbov_0134, Mbov_0338, Mbov_0347, Mbov_0350, Mbov_0393, Mbov_0518, Mbov_0525, Mbov_0581, Mbov_0682, Mbov_0742, and Mbov_0832). Hence, the genes responsible for virulence attenuation would likely include the other 10 genes in the 14.2-kb deleted region and the 32 genes with SNPs and indels, but which lacked...”

BQ00240 Thioredoxin (NCBI) from Bartonella quintana str. Toulouse
Aligns to 26:103 / 107 (72.9%), covers 68.3% of PF05768, 23.3 bits

• Bartonella quintana deploys host and vector temperature-specific transcriptomes
  Abromaitis, PloS one 2013
  • “...1.99 6 2.70 BQ02420 hemin binding protein a hbpA 1.41 0.02 5.35 1.59 7 2.68 BQ00240 thioredoxin trxA 0.68 0.71 1.28 1.79 2 2.60 BQ00830 hypothetical protein 0.82 0.53 0 2.09 2 2.56 BQ07681 hypothetical protein 0.70 0.58 0 2.11 3 2.43 BQ11010 hypothetical protein 0.92...”

WP_016708488 glutaredoxin 3 from Pseudoalteromonas haloplanktis ATCC 14393
Aligns to 3:81 / 85 (92.9%), covers 68.3% of PF05768, 23.2 bits

• Cloning, expression, purification, and characterization of glutaredoxin from Antarctic sea-ice bacterium Pseudoalteromonas sp. AN178
  Wang, BioMed research international 2014
  • “...identity with P. haloplanktis TAC 125 Grx (YP_338909), P. agarivorans Grx (WP_004588615), P. haloplanktis Grx (WP_016708488), P. undina Grx (WP_010391834), and R. nanhaiensis Grx (WP_008217797), respectively. This indicated that Ps Grx could be a novel Grx belonging to Trx-like superfamily. 3.2. Expression and Purification of the...”
  • “...The displayed sequences are Pseudoalteromonas haloplanktis Grx (YP_338909), Pseudoalteromonas agarivorans Grx (WP_004588615), Pseudoalteromonas haloplanktis Grx (WP_016708488), Pseudoalteromonas undina Grx (WP_010391834), and Rheinheimera nanhaiensis Grx (WP_008217797). The shaded boxes in same color indicate identical residues. Symbols: closed triangles, cysteines (C) in the active site; pentagrams, residues involved...”

BBMN68_1397 glutaredoxin family protein from Bifidobacterium longum subsp. longum BBMN68
Aligns to 2:79 / 88 (88.6%), covers 69.5% of PF05768, 23.2 bits

• Transcriptomic analysis of Bifidobacterium longum subsp. longum BBMN68 in response to oxidative shock
  Zuo, Scientific reports 2018
  • “...(bp) Forward Reverse sufB1 (BBMN68_611) ACGACGGTGACGCACGACT AGATGCCGAGCATGTTGAGGT 243 glycerate kinase (BBMN68_585) GCCCTCGGCGTTCGTCTTCT CAATGTGGCGACATCATCTTTGGA 225 grxC2 (BBMN68_1397) GCAGTGCGATGCCACCAAG CAGGAGTTGTCCGGCGTGAT 147 tatC (BBMN68_1285) GGAGCCGGACTGGCATGGTATCT CGTTGCGAGACGCCACTGCTT 228 hcaD (BBMN68_1524) ACGCCAGAACCCTCACCTACC CCGATCACCACTGCCGACTT 217 16S rRNA (BBMN68_rRNA7) CGTAGGGTGCAAGCGTTATC GCCTTCGCCATTGGTGTT 197 nrdI (BBMN68_1398) GGATGCCGTTTGCAGGAC TCGTTGAGGAAGCGTTTGAC 164 nrdE (BBMN68_1399) CCTGCCGCTCGACAATACT CTTGAACGCACCAAGGAAAG 334 nrdF...”
  • “...reductase (GR) 27 . Two genes encoding glutaredoxin, grxC1 ( BBMN68_125 ) and grxC2 ( BBMN68_1397 ), were upregulated in BBMN68 upon exposure to oxygen. In particular, grxC2 , also known as nrdH , was upregulated more than 6-fold after both 30min and 60min oxygen exposure...”

WP_004588615 glutaredoxin 3 from Pseudoalteromonas atlantica
Aligns to 3:73 / 85 (83.5%), covers 68.3% of PF05768, 23.1 bits

• Cloning, expression, purification, and characterization of glutaredoxin from Antarctic sea-ice bacterium Pseudoalteromonas sp. AN178
  Wang, BioMed research international 2014
  • “...74.4%, 72.2%, and 50.0% identity with P. haloplanktis TAC 125 Grx (YP_338909), P. agarivorans Grx (WP_004588615), P. haloplanktis Grx (WP_016708488), P. undina Grx (WP_010391834), and R. nanhaiensis Grx (WP_008217797), respectively. This indicated that Ps Grx could be a novel Grx belonging to Trx-like superfamily. 3.2. Expression...”
  • “...sequences of other Grxs. The displayed sequences are Pseudoalteromonas haloplanktis Grx (YP_338909), Pseudoalteromonas agarivorans Grx (WP_004588615), Pseudoalteromonas haloplanktis Grx (WP_016708488), Pseudoalteromonas undina Grx (WP_010391834), and Rheinheimera nanhaiensis Grx (WP_008217797). The shaded boxes in same color indicate identical residues. Symbols: closed triangles, cysteines (C) in the active...”

Dred_2669 Thioredoxin domain protein (RefSeq) from Desulfotomaculum reducens MI-1
Aligns to 24:105 / 108 (75.9%), covers 95.1% of PF05768, 23.0 bits

• The genome of the Gram-positive metal- and sulfate-reducing bacterium Desulfotomaculum reducens strain MI-1
  Junier, Environmental microbiology 2010
  • “...There are three ORFs annotated as thioredoxins in the D. reducens genome (dred_0762, dred_0904 and dred_2669), but only one (dred_2669) is associated with a thioredoxin reductase (dred_2670). A third gene (dred_2668) that includes nine TMH and has no known function is present as part of this...”

Mbar_A1038 glutaredoxin-like protein (NCBI) from Methanosarcina barkeri str. fusaro
Aligns to 3:83 / 83 (97.6%), covers 96.3% of PF05768, 22.6 bits

• A Ferredoxin Disulfide Reductase Delivers Electrons to the Methanosarcina barkeri Class III Ribonucleotide Reductase
  Wei, Biochemistry 2015
  • “...sequences pET-MbNrdD Mbar_A1037 forward CTTTAAGAAGGAGATATACATATGCATCACCATCACGGCAGCGGAAGTGGAAGCGGCAGCGGCTCTGACAACAAGCCAGT reverse GGTGCTCGAGTGCGGCCGCAAGCTTACCTGAGTTCCCTTGGACTGTATCG pSV-PfMBP-MbNrdG Mbar_A1036 forward CCTGTATTTTCAGGGCGCCCATATGAAAGTAAACTACGCAGGGACTGTCC reverse GCCCGTTTGATCTCGAGTGCGGCCGTCATACAGAGTCTGAGAGCACTTCG pET28a-MbNrdH Mbar_A1038 forward GCCTGGTGCCGCGCGGCAGCCATATGGCAAAAATAATCATATATACAACGG reverse GGTGCTCGAGTGCGGCCGCAAGCTTACAGGACTTCCTGGATTTTTTCAGGG pSV-PfMBP-MbFDR1 Mbar_A2920 forward CCTGTATTTTCAGGGCGCCCATATGACTGATCATAATGAACTAAAACAG reverse GCCCGTTTGATCTCGAGTGCGGCCGTTAATTCGCTTTGAAGAAAAGTTCGC pET28a-MbMRX Mbar_A2431 forward CCTGGTGCCGCGCGGCAGCCATATGGATGTATCTACTCTGAATAAAG reverse GGTGCTCGAGTGCGGCCGCAAGCTTATCCTTGAAATCCAAGGGC pET28a-MbTrxA Mbar_A2899 forward CCTGGTGCCGCGCGGCAGCCATATGGTTAAAGTTACACTTATTCACG reverse GGTGCTCGAGTGCGGCCGCAAGCTTCAGCTAATACGGGATATAGCATC pET28a-MbTrxB Mbar_A2898 forward CCTGGTGCCGCGCGGCAGCCATATGTATGATCTTATAATTATAGGAGG reverse...”

XP_005655046 glutaredoxin-1 isoform X1 from Sus scrofa
P12309 Glutaredoxin-1 from Sus scrofa
Aligns to 14:92 / 106 (74.5%), covers 51.2% of PF05768, 22.6 bits

• Protective effect and mechanism of glutaredoxin 1 on coronary arteries endothelial cells damage induced by high glucose.
  Li, Bio-medical materials and engineering 2014 (PubMed)
  • GeneRIF: Results indicate that the activation of eNOS/NO system is regulated by Grx 1 and coupled with inhibition of JNK and NF-kappaB signaling pathway which could alleviate the oxidative stress/apoptosis in coronary arteries endothelial cells induced by HG.
• Stabilization of the catalytic thiolate in a mammalian glutaredoxin: structure, dynamics and electrostatics of reduced pig glutaredoxin and its mutants.
  Foloppe, Journal of molecular biology 2007 (PubMed)
  • GeneRIF: Long molecular dynamics simulations and electrostatic calculations were used to analyze the structure, dynamics and electrostatics of reduced pGrx and some of its mutants.
• iTRAQ-based proteomic analysis reveals key proteins affecting muscle growth and lipid deposition in pigs
  Wang, Scientific reports 2017
  • “...1.41 0.00 UQCRC1 F1SKM0 Uncharacterized protein 1.40 0.00 GPD2 M3TYQ8 Glycerol-3-phosphate dehydrogenase 1.39 0.03 GLRX P12309 Glutaredoxin-1 1.38 0.01 NNT K9IW80 Nicotinamide nucleotide transhydrogenase 1.37 0.00 HADH P00348 Hydroxyacyl-coenzyme A dehydrogenase, mitochondrial 1.37 0.12 ACADVL A0A0B8RTA8 Acyl-CoA dehydrogenase, very long chain 1.35 0.01 ACAT1 I3LP02 Uncharacterized...”
• Proteome changes in the small intestinal mucosa of growing pigs with dietary supplementation of non-starch polysaccharide enzymes
  Zhang, Proteome science 2016
  • “...Uncharacterized protein OS=Sus scrofa PE=3 SV=1 - [I3LDJ8_PIG] None 303.51 10 0.77 0.0202 Oxidoreductase activity P12309 Glutaredoxin-1 OS=Sus scrofa GN=GLRX PE=1 SV=2 - [GLRX1_PIG] GLRX 277.83 6 0.64 0.0208 Cell redox homeostasis F1SCF9 Uncharacterized protein (Fragment) OS=Sus scrofa GN=TECR PE=4 SV=2 - [F1SCF9_PIG] TECR 38.34 1...”

Q7CPH7 Glutaredoxin from Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Aligns to 3:69 / 83 (80.7%), covers 68.3% of PF05768, 22.5 bits

• N-dodecanoyl-homoserine lactone influences the levels of thiol and proteins related to oxidation-reduction process in Salmonella
  de, PloS one 2018
  • “...P0A1P8 grxA Oxidation-reduction ND ND 10.883 0.737 ND ND ND ND -0.839 0.547 Glutaredoxin 3 Q7CPH7 grxC Oxidation-reduction ND ND ND ND ND ND ND ND 8.107 1.078 Hydrogenase-3, iron-sulfur subunit Q7CPY1 hycB Oxidation-reduction -7.993 1.393 ND ND ND ND ND ND ND ND Protease involved...”

Mcup_0678 thioredoxin family protein from Metallosphaera cuprina Ar-4
Aligns to 101:177 / 183 (42.1%), covers 70.7% of PF05768, 22.4 bits

• Thiosulfate transfer mediated by DsrE/TusA homologs from acidothermophilic sulfur-oxidizing archaeon Metallosphaera cuprina
  Liu, The Journal of biological chemistry 2014
  • “...that encodes a putative dihydrolipoamide dehydrogenase (Mcup_0680), a hypothetical protein (Mcup_0679), and a putative thioredoxin (Mcup_0678). Notably, a lipoamide-binding protein resembling protein H of the glycine cleavage system (Mcup_0662) and several proteins responsible for the biosynthesis of lipoamide-containing proteins (Mcup_06710673) are also encoded in the vicinity...”

MM_RS02345 thioredoxin from Methanosarcina mazei Go1
Aligns to 5:86 / 88 (93.2%), covers 64.6% of PF05768, 22.4 bits

• Crystal Structure of the Apo-Form of NADPH-Dependent Thioredoxin Reductase from a Methane-Producing Archaeon
  Buey, Antioxidants (Basel, Switzerland) 2018
  • “...[ 23 ], it was found that M. mazei contains two Trxs, herein named MmTrx1 (MM_RS02345) and MmTrx2 (MM_RS05160) ( Table 1 and Figure 1 B). MmTrx1 has a shorter sequence than canonical Trxs at its N-terminus, and its functional annotation awaits further investigations. The MmTrx2...”
  • “...Motif M. Acetivorans Homolog [ 6 ] Reductant Reduction of Insulin [ 7 ] MmTrx1 MM_RS02345 WCGPC MaTrx2 unknown + MmTrx2 MM_RS05160 WCGPC MaTrx6 unknown + MmTrx3 MM_RS12205 WCTAC MaTrx7 NTR [ 6 ] + MmTrx4 MM_RS11655 GCPKC MaTrx5 unknown - MmTrx5 MM_RS10780 ACPYC MaTrx1 FDR...”

PputW619_3239 glutaredoxin 3 (RefSeq) from Pseudomonas putida W619
Aligns to 3:72 / 84 (83.3%), covers 69.5% of PF05768, 22.3 bits

• Comparative genomics and functional analysis of niche-specific adaptation in Pseudomonas putida
  Wu, FEMS microbiology reviews 2011
  • “...and two putative glutathione peroxidases (PputW619_1244, PputW619_1483), a glutathione oxidoreductase (Gor, PputW619_3188) and a glutaredoxin (PputW619_3239). Among these enzymes, the KatB and AhpD domain proteins, whose genes are located on three genomic islands (regions 9, 19 and 20), are unique to P. putida W619. We also...”

AF0769 thioredoxin (trx-2) (NCBI ptt file) from Archaeoglobus fulgidus DSM 4304
Aligns to 1:88 / 93 (94.6%), covers 64.6% of PF05768, 22.3 bits

• Unexpected similarity in regulation between an archaeal inositol monophosphatase/fructose bisphosphatase and chloroplast fructose bisphosphatase
  Stieglitz, Protein science : a publication of the Protein Society 2003
  • “...fulgidus genome yielded three putative thioredoxins: AF1284, AF2144, and AF0769, with identities and positives of 49% and 66%, 38% and 68%, and 24% 766 Protein...”

MA3212 thioredoxin (NCBI ptt file) from Methanosarcina acetivorans C2A
Aligns to 10:91 / 93 (88.2%), covers 64.6% of PF05768, 22.2 bits

• Molecular characterization of the thioredoxin system from Methanosarcina acetivorans
  McCarver, The FEBS journal 2014
  • “...Predicted location Trxhomologue clade pI/MW MA1368 MaTrxR Cytoplasm - 5.8/34.0 MA0965 MaTrx1 Cytoplasm H 4.7/15.0 MA3212 MaTrx2 Cytoplasm F 5.1/10.4 MA3702 MaTrx3 Extracellular/membrane E 4.7/19.6 MA3938 MaTrx4 Cytoplasm A 5.4/8.4 MA3942 MaTrx5 Cytoplasm A 8.5/8.7 MA4254 MaTrx6 Extracellular/membrane E 4.2/17.7 MA4683 MaTrx7 Cytoplasm D 5.6/9.2 Table...”
• Top-down proteomics reveals novel protein forms expressed in Methanosarcina acetivorans
  Ferguson, Journal of the American Society for Mass Spectrometry 2009
  • “...data-rich offline electron capture dissociation (ECD) methodology. In Figure 1d , ECD unambiguously identified thioredoxin MA3212, but with a negative mass shift localized near the N-terminus. The removal of the first four amino acids near the N-terminus resulted in the matching of 10 c-type ions. Therefore,...”
  • “...MA1108 cgacaggggctacagg atg ctgtatgcactccaatggaggaagtat atg MA1522 cttaaataatcctgataacatggg gtg ctgatt atg MA1964 aggtgaaattccgattaaactgaaaacttaaaattgagg ctt acaaag atg MA3212 gacgtttcaagt att gcaggtgatttt atg MA3896 ccagaggag atg aaaacg atg MA4024 ccgaatgaaatcaaagttttaatagtttag ttg aaaaagataatcgtttggttgaaaaggatagtgaaagtt atg MA4111 ctgttccagaactaagttacagcaagaga gtg gtaatg atg MA4116 ccagaaaaccggttttttcg gtg attgcc atg * Observed start codon is shown...”
• Quantitative proteomic and microarray analysis of the archaeon Methanosarcina acetivorans grown with acetate versus methanol
  Li, Journal of proteome research 2007
  • “...which reduces O2 to water in Methanobrevibacter arboriphilus63. MA3212 is annotated as thioredoxin, a family of proteins acting as general disulfide reductases...”
  • “...MA2013 MA2082 MA2167 MA2256 MA2351 MA2699 MA2867 MA2914 MA3212 MA3284 MA3743 MA3860 MA3861 MA3862 MA3863 MA3865 NIH-PA Author Manuscript MA3916 MA3972 MA4026...”

M892_00340 GrxA family glutaredoxin from Vibrio campbellii ATCC BAA-1116
Aligns to 2:81 / 88 (90.9%), covers 68.3% of PF05768, 22.1 bits

• Vibrio campbellii hmgA-mediated pyomelanization impairs quorum sensing, virulence, and cellular fitness
  Wang, Frontiers in microbiology 2013
  • “...1.39E-10 4.43 1.51 2.93 M M892_00180 Heat shock protein HslJ 5.20E-04 1.95 0.58 3.36 O M892_00340 Glutaredoxin 4.76E-04 1.29 0.61 2.11 O M892_07710 Antioxidant, AhpC/Tsa family 2.08E-07 2.20 0.28 7.86 O M892_07875 ClpB protein 8.45E-04 1.25 0.37 3.38 O M892_09255 Peptidase 5.78E-04 1.79 0.39 4.59 O...”

Q9QUH0 Glutaredoxin-1 from Mus musculus
Aligns to 14:91 / 107 (72.9%), covers 56.1% of PF05768, 22.0 bits

• Comparative proteomes change and possible role in different pathways of microRNA-21a-5p in a mouse model of spinal cord injury.
  Mohammed, Neural regeneration research 2020
  • “...tumor protein Tpt1 67.74 56.11 1.21 0.0946 Q91VW3 SH3BGR glutaredoxin Sh3bgrl3 56.99 0 N.A N.A Q9QUH0 Glutaredoxin-1 Glrx 53.27 39.72 1.34 0.0473 Figure 2 Up- and downregulated proteins in the KD group. (A) Several proteins, such as S100-A8, acyl-CoA-binding proteins, peroxiredoxin-1, and vimentin, were upregulated in...”
• Adrenergic receptor stimulation suppresses oxidative metabolism in isolated rat islets and Min6 cells.
  Kelly, Molecular and cellular endocrinology 2018
  • “...dismutase [Cu-Zn] Sod1 0.001 2.00E-02 down P09671 Superoxide dismutase [Mn], mitochondrial Sod2 0.040 5.00E-02 down Q9QUH0 Glutaredoxin-1 (Thioltransferase-1) (TTase-1) Glrx 0.010 2.44E-03 down Oxidative Metabolism A7MCU9 Pyruvate kinase Pklr 110.5 9.40E-04 up Complex I Q99LC3 NADH dehydrogenase 1 subcomplex 10 Ndufa10 56.9 5.00E-02 up Q9CQZ6 NADH...”
• Macrophage activation and polarization modify P2X7 receptor secretome influencing the inflammatory process
  de, Scientific reports 2016
  • “...CP, EVp Non-classical 2 Thioredoxin (P10639) Redox regulation CP, mt, nucleus, EVp Non-classical 2 Glutaredoxin-1 (Q9QUH0) Redox regulation CP, mt, nucleus, EVp Non-classical 2 Monocyte differentiation antigen CD14 (P10810) LPS binding Cell membrane, GPI-anchor + Non-classical 5 Elongation factor 1- 1 (P10126) Translational elongation factor CP,...”
• Integrated analysis of proteome and transcriptome changes in the mucopolysaccharidosis type VII mouse hippocampus
  Parente, Molecular genetics and metabolism 2016
  • “...-1.95 isoleucine-tRNA synthetase 2, mitochondrial Q8BHN3 Ganab 0.017 -1.95 alpha glucosidase 2 alpha neutral subunit Q9QUH0 Glrx 0.041 -1.97 glutaredoxin O08788 Dctn1 0.042 -1.98 dynactin 1 P97450 Atp5j 0.046 -2.00 ATP synthase, H+ transporting, mitochondrial F0 complex, subunit F pseudogene; similar to ATP synthase coupling factor...”
  • “...resistance protein 1 P56375 Acyp2 0.035 -1.89 Acylphosphatase-2 Q8BIJ6 Iars2 0.047 -1.95 Isoleucyl-tRNA synthetase, mitochondrial Q9QUH0 Glrx 0.041 -1.97 Glutaredoxin-1 P97450 Atp5j 0.046 -2.00 ATP synthase-coupling factor 6, mitochondrial Q66GT5 Ptpmt1 0.022 -2.02 Protein-tyrosine phosphatase mitochondrial 1 P58281 Opa1 0.027 -2.17 Dynamin-like 120 kDa protein, mitochondrial...”
• Delineation of Molecular Pathways Involved in Cardiomyopathies Caused by Troponin T Mutations.
  Gilda, Molecular & cellular proteomics : MCP 2016
• Postconditioning leads to an increase in protein S-nitrosylation
  Tong, American journal of physiology. Heart and circulatory physiology 2014
  • “...dehydrogenase* Q9R0P5 O08553 A2AN08 P58252 Q80X90 P05064 Q9QUH0 P16858 Heat shock protein HSP 90- L-Lactate dehydrogenase A chain Myosin-binding protein C,...”
• Role of the tumor suppressor IQGAP2 in metabolic homeostasis: Possible link between diabetes and cancer.
  Vaitheesvaran, Metabolomics : Official journal of the Metabolomic Society 2014
  • “...activator Lipid Homeostasis 2.24E-02 3.5 P53657 Pyruvate kinase isozymes R/L (L-PK) Glucose Homeostasis 1.80E-02 4.9 Q9QUH0 Glutaredoxin-1 Hepatocellular energetics 5.30E-07 4.3 P30115 Glutathione S-transferase A3 Hepatocellular energetics 1.10E-03 3.4 Q91YI0 Argininosuccinate lyase (ASAL) (Arginosuccinase) Urea/TCA cycle 2.00E-02 3.1 Q8R0Y6 Cytosolic 10-formyltetrahydrofolate dehydrogenase (FDH) Methyl Donor metabolism...”
• Proteomic studies of nitrated alpha-synuclein microglia regulation by CD4+CD25+ T cells.
  Reynolds, Journal of proteome research 2009
  • “...0.05 Isocitrate dehydrogenase [NADP] cytoplasmic O88844 IPI00135231 46660 6.48 Cytoplasm redox 4 -4.43 Glutaredoxin 1 Q9QUH0 IPI00331528 11871 8.68 Cytoplasm redox 4 -1.72 Glutathione reductase 1 precursor P47791 IPI00111359 53663 8.19 Cytoplasm/mitochondria redox 2 -1.5 0.028 Alpha enolase P17182 IPI00462072 47141 6.37 Cytoplasm/ membrane glycolysis 3...”
  • “...Superoxide dismutase 2 [Mn] P09671 IPI00109109 24603 8.8 Mitochondria redox 2 1.71 <0.0001 Glutaredoxin 1 Q9QUH0 IPI00331528 11871 8.68 Cytoplasm redox 2 1.82 <0.0001 Biliverdin reductase B (NADPH) Q923D2 IPI00113996 22197 6.49 Cytoplasm redox 13 6.56 <0.0001 Oxidation resistance 1 Q4KMM3 IPI00277552 83016 4.9 Mitochondria redox...”

CPF_2747 glutaredoxin-like protein, YruB-family (NCBI) from Clostridium perfringens ATCC 13124
CPE2437 probable glutaredoxin (NCBI ptt file) from Clostridium perfringens str. 13
Aligns to 1:73 / 75 (97.3%), covers 65.9% of PF05768, 22.0 bits

• Comparative transcription analysis and toxin production of two fluoroquinolone-resistant mutants of Clostridium perfringens
  Park, BMC microbiology 2013
  • “...1.6 11.9 1.9 CPE2058 CPF_2315 ( gadB ) glutamate decarboxylase 31.9 3.5 20.0 3.4 CPE2437 CPF_2747 ( nrdH ) glutaredoxin-like protein, YruB-family 3.8 2.5 4.8 11.0 CPE2551 CPF_2875 ( glpA ) probable glycerol-3-phosphate dehydrogenase 0.8 2.5 1.3 0.1 Purines, pyrimidines, nucleotides, and nucleosides CPE2276 CPF_2558 (...”
• Comparative transcription analysis and toxin production of two fluoroquinolone-resistant mutants of Clostridium perfringens
  Park, BMC microbiology 2013
  • “...3.5 1.6 11.9 1.9 CPE2058 CPF_2315 ( gadB ) glutamate decarboxylase 31.9 3.5 20.0 3.4 CPE2437 CPF_2747 ( nrdH ) glutaredoxin-like protein, YruB-family 3.8 2.5 4.8 11.0 CPE2551 CPF_2875 ( glpA ) probable glycerol-3-phosphate dehydrogenase 0.8 2.5 1.3 0.1 Purines, pyrimidines, nucleotides, and nucleosides CPE2276 CPF_2558...”

MCA2787 hypothetical protein (NCBI) from Methylococcus capsulatus str. Bath
Aligns to 43:111 / 405 (17.0%), covers 47.6% of PF05768, 21.7 bits

• Identification of non-dot/icm suppressors of the Legionella pneumophila DeltadotL lethality phenotype
  Vincent, Journal of bacteriology 2006
  • “...in GenBank, including SO0975, GSU1615, MCA2787, and AdehDRAFT_0196 from Shewanella, Geobacter, Methylococcus, and Anaeromyxobacter species, respectively....”

ECH_0218 thioredoxin (NCBI) from Ehrlichia chaffeensis str. Arkansas
Aligns to 24:106 / 107 (77.6%), covers 68.3% of PF05768, 21.7 bits

• Solution NMR structures of oxidized and reduced Ehrlichia chaffeensis thioredoxin: NMR-invisible structure owing to backbone dynamics
  Buchko, Acta crystallographica. Section F, Structural biology communications 2018
  • “...and oxidized thioredoxin from Ehrlichia chaffeensis (Ec-Trx, ECH_0218), the etiological agent responsible for human monocytic ehrlichiosis, are described. The...”
  • “...strategy for human monocytic ehrlichiosis. The 107-residue protein ECH_0218 (Ec-Trx) has been identified as a Trx in E. chaffeensis. To assist structure-based...”
• Molecular characterization of Ehrlichia interactions with tick cells and macrophages
  Ganta, Frontiers in bioscience (Landmark edition) 2009
  • “...protein ECH_0631 16,994 M T 60 Iron-sulfur cluster binding protein ECH_0634 12,721 T 61 Thioredoxin ECH_0218 11,933 T 62 Hypothetical protein ECH_0181 ECH_0181 11,699 M 63 Hypothetical protein ECH_1043 ECH_1043 10,885 M * Italic text, proteins identified from immuno blot analysis; #M, macrophage and T, tick...”
• Total, membrane, and immunogenic proteomes of macrophage- and tick cell-derived Ehrlichia chaffeensis evaluated by liquid chromatography-tandem mass spectrometry and MALDI-TOF methods
  Seo, Infection and immunity 2008
  • “...ECH_0937 ECH_0951 ECH_0141 ECH_0573 ECH_0526 ECH_0407 ECH_0218 ECH_0176 ECH_0617 ECH_0013 ECH_0159 ECH_0595 ECH_1136 ECH_1005 ECH_0631 ECH_1055 135,000 100,000...”
  • “...17 24 8 7 12 ECH_0526 ECH_0665 ECH_1136 ECH_0218 ECH_0116 ECH_0199 ECH_0176 ECH_0509 50,000 42,000 29,500 23,000 21,000 20,500 20,500 20,500 55,364 54,842...”

D822_02899 redoxin NrdH from Streptococcus ratti FA-1 = DSM 20564
Aligns to 3:68 / 74 (89.2%), covers 50.0% of PF05768, 21.6 bits

• Genetic variability of mutans streptococci revealed by wide whole-genome sequencing
  Song, BMC genomics 2013
  • “...- D820_00607 D821_00626 D822_06143 - NrdH Glutaredoxin SMU.669c GI|290580848 D816_02885 D817_03143 D818_03447 D819_02894 D820_03090 D821_03009 D822_02899 D823_05398 SOD, which catalyzes the dismutation of superoxide into oxygen and hydrogen peroxide, is an important antioxidant defense in nearly all cells exposed to oxygen [ 67 ]. SOD is...”

WP_010391834 glutaredoxin 3 from Pseudoalteromonas undina
Aligns to 3:80 / 85 (91.8%), covers 68.3% of PF05768, 21.5 bits

• Cloning, expression, purification, and characterization of glutaredoxin from Antarctic sea-ice bacterium Pseudoalteromonas sp. AN178
  Wang, BioMed research international 2014
  • “...TAC 125 Grx (YP_338909), P. agarivorans Grx (WP_004588615), P. haloplanktis Grx (WP_016708488), P. undina Grx (WP_010391834), and R. nanhaiensis Grx (WP_008217797), respectively. This indicated that Ps Grx could be a novel Grx belonging to Trx-like superfamily. 3.2. Expression and Purification of the Ps Grx The recombinant...”
  • “...Pseudoalteromonas haloplanktis Grx (YP_338909), Pseudoalteromonas agarivorans Grx (WP_004588615), Pseudoalteromonas haloplanktis Grx (WP_016708488), Pseudoalteromonas undina Grx (WP_010391834), and Rheinheimera nanhaiensis Grx (WP_008217797). The shaded boxes in same color indicate identical residues. Symbols: closed triangles, cysteines (C) in the active site; pentagrams, residues involved in glutathione-binding site. Figure...”

PMM0512 putative arsenate reductase (NCBI) from Prochlorococcus marinus sp. MED4
Aligns to 7:98 / 122 (75.4%), covers 79.3% of PF05768, 21.4 bits

• Adaptive Evolution of Phosphorus Metabolism in Prochlorococcus
  Casey, mSystems 2016
  • “...encoding diacylglyceride kinase (PMM0183) and diacylglycerol phosphatidyltransferase (PMM0798), and unsurprisingly, the gene for arsenate reductase (PMM0512). However, it should be noted that these 4 genes showed low but detectable expression levels in natural samples from the North Pacific Subtropical Gyre ( 30 ). We compiled essential...”
• Genomic potential for arsenic efflux and methylation varies among global Prochlorococcus populations
  Saunders, The ISME journal 2016
  • “...NATL1_11591 -- -- -- P9303_11311 PMM0512 P9515_05761 A9601_05691 P9301_05391 MIT9215_706 PMT9312_0513 PMN2A_1845 NATL1_05701 Pro0511 P9211_05131 PMT1256...”

NP_071614 glutaredoxin-1 from Rattus norvegicus
Q9ESH6 Glutaredoxin-1 from Rattus norvegicus
Aligns to 14:99 / 107 (80.4%), covers 56.1% of PF05768, 21.2 bits

• Glutaredoxin regulates apoptosis in cardiomyocytes via NFkappaB targets Bcl-2 and Bcl-xL: implications for cardiac aging.
  Gallogly, Antioxidants & redox signaling 2010
  • GeneRIF: Grx1 decreases by ~40% in 2-yr-old Fischer 344 rat hearts vs 6-mo-old controls. Grx1 knockdown in H9c2 cardiomyocytes increases apoptosis, & decreases NFkappaB transcription,& production of Bcl-2 & Bcl-xL.
• Glutaredoxin regulates autocrine and paracrine proinflammatory responses in retinal glial (muller) cells.
  Shelton, The Journal of biological chemistry 2009
  • GeneRIF: interleukin-6 increased Grx1 and ICAM-1 in the rMC-1 cells.
• Nitroxyl activates SERCA in cardiac myocytes via glutathiolation of cysteine 674.
  Lancel, Circulation research 2009
  • GeneRIF: NO increased the S-glutathiolation of SERCA, and adenoviral overexpression of glutaredoxin-1 prevented both the HNO-stimulated oxidative modification of SERCA and its activation.
• Glutaredoxin-1 mediates NADPH-dependent stimulation of calcium-dependent insulin secretion.
  Reinbothe, Molecular endocrinology (Baltimore, Md.) 2009
  • GeneRIF: The role of GRX-1 in NADPH-stimulated beta-cell exocytosis and glucose-stimulated insulin secretion, is reported.
• Expression of glutaredoxin (thioltransferase) in the rat ovary during the oestrous cycle and postnatal development.
  González-Fernández, Journal of molecular endocrinology 2005 (PubMed)
  • GeneRIF: role of Grx in the maintenance of functional oocytes and in luteal cells surviving the regression process
• Redox control of exocytosis: regulatory role of NADPH, thioredoxin, and glutaredoxin.
  Ivarsson, Diabetes 2005 (PubMed)
  • GeneRIF: NADPH/glutaredoxin/thioredoxin redox regulation mediates a novel signaling pathway of nutrient-induced insulin secretion.
• Glutaredoxin exerts an antiapoptotic effect by regulating the redox state of Akt.
  Murata, The Journal of biological chemistry 2003 (PubMed)
  • GeneRIF: Glutaredoxin exerts an antiapoptotic effect by regulating the redox state of Akt
• Functional glutaredoxin (thioltransferase) activity in rat brain and liver mitochondria.
  Ehrhart, Parkinsonism & related disorders 2002 (PubMed)
  • GeneRIF: The presence of enzyme activity in subcellular organelles in brain and liver and in mitochondria demonstrates functional glutaredoxin activity.
• More
• Deciphering glycomics and neuroproteomic alterations in experimental traumatic brain injury: Comparative analysis of aspirin and clopidogrel treatment
  Abou-Abbass, Electrophoresis 2016
  • “...Ctrl and CLOP versus Ctrl and ASACLOP versus Ctrl Glutaredoxin-1 Serine/threonine-protein phosphatase PP1-gamma catalytic subunit Q9ESH6 P63088 0.00222 1.58 10 5 Table 2 List of some of the upregulated differentially expressed proteins in the ASA, CLOP, ASACLOP, and TBI groups that were found to be neuroprotective...”
• Phenobarbital induces alterations in the proteome of hepatocytes and mesenchymal cells of rat livers.
  Klepeisz, PloS one 2013
  • “...stimulus P85972 Vinculin cell adhesion Q91Y81 Septin-2 (Vascular endothelial cell specific protein 11) cell division Q9ESH6 t Glutaredoxin-1 cell redox homeostasis P85845 Fascin cellular response to cell-matrix adhesion, liver development, cell motility Q2PQA9 t, PB Kinesin-1 heavy chain cytoplasm organization, vesicle transport along microtubule P00176 PB...”
• Preliminary quantitative profile of differential protein expression between rat L6 myoblasts and myotubes by stable isotope labeling with amino acids in cell culture.
  Cui, Proteomics 2009
  • “...1 Q63691 60350 Galectin-3 IPI00194341.4 0.44 0.01 5 P08699 83781 Glutaredoxin-1 IPI00231191.6 0.49 0.07 2 Q9ESH6 64045 Mevalonate kinase IPI00214563.1 0.20 NA 1 P17256 81727 Minichromosome maintenance protein 7 IPI00371012.2 0.490.07 4 Q1PS21 288532 Mtap6 protein (Fragment) IPI00212447.2 0.31NA 1 Q6AYX8 29457 N-myc downstream regulated gene...”

Or search for genetic data about PF05768 in the Fitness Browser